#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PTPRF	5792	broad.mit.edu	37	1	44069145	44069145	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:44069145A>C	ENST00000359947.4	+	15	2739	c.2399A>C	c.(2398-2400)tAt>tCt	p.Y800S	PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000438120.1_Missense_Mutation_p.Y791S|PTPRF_ENST00000422171.2_Missense_Mutation_p.Y148S|PTPRF_ENST00000372413.3_Missense_Mutation_p.Y791S|PTPRF_ENST00000372414.3_Missense_Mutation_p.Y800S	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	800	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.Y790S(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTTGCTGCCTATACCACCAAG	0.592																																							uc001cjr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10						c.(2398-2400)TAT>TCT		protein tyrosine phosphatase, receptor type, F							82.0	79.0	80.0					1																	44069145		2203	4300	6503	SO:0001583	missense	5792				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity	g.chr1:44069145A>C	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.2399A>C	1.37:g.44069145A>C	ENSP00000353030:p.Tyr800Ser					PTPRF_uc001cjs.2_Missense_Mutation_p.Y791S|PTPRF_uc001cju.2_Missense_Mutation_p.Y371S|PTPRF_uc009vwt.2_Missense_Mutation_p.Y362S|PTPRF_uc001cjv.2_Missense_Mutation_p.Y260S|PTPRF_uc001cjw.2_Missense_Mutation_p.Y26S	p.Y800S	NM_002840	NP_002831	P10586	PTPRF_HUMAN			15	2739	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	800			Fibronectin type-III 5.|Extracellular (Potential).		D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	c.2399A>C	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.73|15.73	2.919452|2.919452	0.52653|0.52653	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000429895|ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407	.|T;T;T;T;T;T	.|0.57436	.|0.4;0.4;0.4;0.4;0.4;0.4	4.79|4.79	4.79|4.79	0.61399|0.61399	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.000000	.|0.31381	.|N	.|0.007759	T|T	0.69824|0.69824	0.3154|0.3154	M|M	0.72576|0.72576	2.205|2.205	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|0.984;0.999;0.992;0.994;1.0	.|D;D;P;P;D	.|0.97110	.|0.944;0.971;0.871;0.867;1.0	T|T	0.69064|0.69064	-0.5244|-0.5244	5|10	.|0.32370	.|T	.|0.25	.|.	14.6458|14.6458	0.68759|0.68759	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|447;148;559;791;800	.|Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586	.|.;.;.;.;PTPRF_HUMAN	L|S	448|800;791;800;791;148;54	.|ENSP00000353030:Y800S;ENSP00000398822:Y791S;ENSP00000361491:Y800S;ENSP00000361490:Y791S;ENSP00000387885:Y148S;ENSP00000361484:Y54S	.|ENSP00000353030:Y800S	I|Y	+|+	1|2	0|0	PTPRF|PTPRF	43841732|43841732	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.945000|0.945000	0.59286|0.59286	8.855000|8.855000	0.92236|0.92236	1.934000|1.934000	0.56057|0.56057	0.533000|0.533000	0.62120|0.62120	ATA|TAT		0.592	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1			18	63	0	0	0	0.007413	0	18	63				
USP1	7398	broad.mit.edu	37	1	62910726	62910726	+	Nonsense_Mutation	SNP	C	C	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:62910726C>G	ENST00000339950.4	+	6	1690	c.875C>G	c.(874-876)tCa>tGa	p.S292*	USP1_ENST00000371146.1_Nonsense_Mutation_p.S292*	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	292	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.S292*(1)		breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		GAACACCAGTCATTGGAAGAG	0.328																																					Ovarian(122;1846 2315 3982 19504)	Ovarian(122;1846 2315 3982 19504)	uc001daj.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(874-876)TCA>TGA		ubiquitin specific protease 1							53.0	58.0	56.0					1																	62910726		2172	4282	6454	SO:0001587	stop_gained	7398				DNA repair|monoubiquitinated protein deubiquitination|regulation of DNA repair|response to UV|ubiquitin-dependent protein catabolic process	nucleoplasm	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr1:62910726C>G		CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.875C>G	1.37:g.62910726C>G	ENSP00000343526:p.Ser292*					USP1_uc001dak.1_Nonsense_Mutation_p.S292*|USP1_uc001dal.1_Nonsense_Mutation_p.S292*	p.S292*	NM_001017415	NP_001017415	O94782	UBP1_HUMAN		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)	6	1203	+		all_neural(321;0.0281)	292					A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Nonsense_Mutation	SNP	ENST00000339950.4	37	c.875C>G	CCDS621.1	.	.	.	.	.	.	.	.	.	.	C	38	7.225552	0.98146	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	.	.	.	5.64	5.64	0.86602	.	0.569272	0.18356	N	0.143733	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-3.799	16.1805	0.81895	0.0:0.8671:0.1329:0.0	.	.	.	.	X	292	.	ENSP00000343526:S292X	S	+	2	0	USP1	62683314	0.676000	0.27567	0.998000	0.56505	0.983000	0.72400	2.929000	0.48916	2.937000	0.99478	0.650000	0.86243	TCA		0.328	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024881.1	NM_001017415		23	52	0	0	0	0.014323	0	23	52				
JAK1	3716	broad.mit.edu	37	1	65300251	65300251	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:65300251T>A	ENST00000342505.4	-	25	3707	c.3459A>T	c.(3457-3459)ttA>ttT	p.L1153F		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	1153	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.L1153F(1)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CTTCTTATTTTAAAAGTGCTT	0.328			Mis		ALL																																		uc001dbu.1		NA		Dom	yes		1	1p32.3-p31.3	3716	Mis	Janus kinase 1			L			ALL		1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61						c.(3457-3459)TTA>TTT		janus kinase 1							99.0	97.0	98.0					1																	65300251		1812	4078	5890	SO:0001583	missense	3716				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity	g.chr1:65300251T>A	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.3459A>T	1.37:g.65300251T>A	ENSP00000343204:p.Leu1153Phe					JAK1_uc009wam.1_Missense_Mutation_p.L1141F|JAK1_uc009wal.1_Missense_Mutation_p.L330F	p.L1153F	NM_002227	NP_002218	P23458	JAK1_HUMAN		BRCA - Breast invasive adenocarcinoma(111;0.0485)	25	3708	-			1153			Protein kinase 2.		Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	37	c.3459A>T	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	T	14.73	2.622440	0.46840	.	.	ENSG00000162434	ENST00000342505	T	0.79033	-1.23	5.01	2.55	0.30701	Protein kinase, catalytic domain (1);	.	.	.	.	T	0.41166	0.1147	L	0.41415	1.275	0.39744	D	0.971786	P	0.34412	0.453	B	0.20577	0.03	T	0.31364	-0.9946	9	0.18710	T	0.47	-2.693	4.7108	0.12872	0.0:0.2064:0.1626:0.631	.	1153	P23458	JAK1_HUMAN	F	1153	ENSP00000343204:L1153F	ENSP00000343204:L1153F	L	-	3	2	JAK1	65072839	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	1.647000	0.37260	0.923000	0.37045	0.528000	0.53228	TTA		0.328	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227		4	48	0	0	0	0.009096	0	4	48				
ELTD1	64123	broad.mit.edu	37	1	79403965	79403965	+	Splice_Site	SNP	C	C	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:79403965C>G	ENST00000370742.3	-	5	460		c.e5-1			NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.?(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TGGATCTGATCTGAGAAAAAA	0.313																																							uc001diq.3		NA																	1	Unknown(1)		lung(1)	ovary(1)|skin(1)	2						c.e5-1		EGF, latrophilin and seven transmembrane domain							35.0	32.0	33.0					1																	79403965		1796	4058	5854	SO:0001630	splice_region_variant	64123				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr1:79403965C>G	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.397-1G>C	1.37:g.79403965C>G							p.I133_splice	NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN		COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)	5	553	-								B1AR71|Q5KU34	Splice_Site	SNP	ENST00000370742.3	37	c.397_splice	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	C	9.352	1.065696	0.20067	.	.	ENSG00000162618	ENST00000370742	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2961	0.60298	0.0:0.928:0.0:0.072	.	.	.	.	.	-1	.	.	.	-	.	.	ELTD1	79176553	1.000000	0.71417	0.995000	0.50966	0.016000	0.09150	3.869000	0.56062	2.747000	0.94245	0.650000	0.86243	.		0.313	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	Intron	8	13	0	0	0	0.00308	0	8	13				
COL11A1	1301	broad.mit.edu	37	1	103431093	103431093	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:103431093A>T	ENST00000370096.3	-	38	3178	c.2866T>A	c.(2866-2868)Ttt>Att	p.F956I	COL11A1_ENST00000353414.4_Missense_Mutation_p.F917I|COL11A1_ENST00000358392.2_Missense_Mutation_p.F968I|COL11A1_ENST00000512756.1_Missense_Mutation_p.F840I	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	956	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.F956I(1)|p.F968I(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTGCCTTGAAATCCCTAAGGA	0.383																																							uc001dul.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(2866-2868)TTT>ATT		alpha 1 type XI collagen isoform A							86.0	97.0	94.0					1																	103431093		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103431093A>T	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2866T>A	1.37:g.103431093A>T	ENSP00000359114:p.Phe956Ile					COL11A1_uc001duk.2_Missense_Mutation_p.F152I|COL11A1_uc001dum.2_Missense_Mutation_p.F968I|COL11A1_uc001dun.2_Missense_Mutation_p.F917I|COL11A1_uc009weh.2_Missense_Mutation_p.F840I	p.F956I	NM_001854	NP_001845	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	38	3184	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	956			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.2866T>A	CCDS778.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.103257	0.76983	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.45	5.45	0.79879	.	0.054615	0.85682	D	0.000000	T	0.37679	0.1012	N	0.25485	0.75	0.80722	D	1	D;D;D;D;D	0.61080	0.967;0.989;0.989;0.981;0.981	D;D;D;D;D	0.75020	0.916;0.985;0.985;0.966;0.962	T	0.39375	-0.9617	10	0.62326	D	0.03	.	15.5153	0.75818	1.0:0.0:0.0:0.0	.	840;917;968;956;176	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	I	956;968;917;176;840	ENSP00000359114:F956I;ENSP00000351163:F968I;ENSP00000302551:F917I;ENSP00000426533:F840I	ENSP00000302551:F917I	F	-	1	0	COL11A1	103203681	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.213000	0.95133	2.066000	0.61787	0.455000	0.32223	TTT		0.383	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		27	87	0	0	0	0.008361	0	27	87				
HIST2H2AC	8338	broad.mit.edu	37	1	149858886	149858886	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:149858886C>T	ENST00000331380.2	+	1	362	c.362C>T	c.(361-363)aCc>aTc	p.T121I	HIST2H2BE_ENST00000369155.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	121						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T121N(1)|p.T121I(1)		NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CCAAAGAAAACCGAAAGCCAC	0.473																																							uc001etd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(361-363)ACC>ATC		histone cluster 2, H2ac							75.0	78.0	77.0					1																	149858886		2203	4300	6503	SO:0001583	missense	8338				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr1:149858886C>T	AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.362C>T	1.37:g.149858886C>T	ENSP00000332194:p.Thr121Ile					HIST2H2BE_uc001etc.2_5'Flank	p.T121I	NM_003517	NP_003508	Q16777	H2A2C_HUMAN	STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)		1	362	+	Breast(34;0.0124)|all_hematologic(923;0.127)		121					Q6DRA7|Q8IUE5	Missense_Mutation	SNP	ENST00000331380.2	37	c.362C>T	CCDS937.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.406473	0.25378	.	.	ENSG00000184260	ENST00000331380	T	0.42513	0.97	4.97	4.06	0.47325	Histone-fold (2);Histone H2A (1);	0.000000	0.45606	D	0.000345	T	0.36386	0.0965	M	0.90369	3.11	0.41988	D	0.990837	B	0.29270	0.24	B	0.26693	0.072	T	0.48410	-0.9038	10	0.66056	D	0.02	.	12.1419	0.54002	0.0:0.9153:0.0:0.0847	.	121	Q16777	H2A2C_HUMAN	I	121	ENSP00000332194:T121I	ENSP00000332194:T121I	T	+	2	0	HIST2H2AC	148125510	1.000000	0.71417	0.666000	0.29783	0.983000	0.72400	4.761000	0.62243	1.119000	0.41883	0.505000	0.49811	ACC		0.473	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087128.1	NM_003517		19	99	0	0	0	0.010504	0	19	99				
TCHH	7062	broad.mit.edu	37	1	152079909	152079909	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:152079909G>C	ENST00000368804.1	-	2	5783	c.5784C>G	c.(5782-5784)agC>agG	p.S1928R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1928					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.S1928R(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATAGAGAGGGCTGGAGCGCA	0.542																																							uc001ezp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(5782-5784)AGC>AGG		trichohyalin							135.0	135.0	135.0					1																	152079909		1968	4148	6116	SO:0001583	missense	7062				keratinization	cytoskeleton	calcium ion binding	g.chr1:152079909G>C	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.5784C>G	1.37:g.152079909G>C	ENSP00000357794:p.Ser1928Arg					TCHH_uc009wne.1_Missense_Mutation_p.S1928R	p.S1928R	NM_007113	NP_009044	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	5784	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1928					Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	c.5784C>G	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	g	13.05	2.120391	0.37436	.	.	ENSG00000159450	ENST00000368804	T	0.18960	2.18	4.82	0.761	0.18448	.	.	.	.	.	T	0.12135	0.0295	N	0.24115	0.695	0.23636	N	0.997236	D	0.76494	0.999	D	0.71414	0.973	T	0.07083	-1.0791	9	0.54805	T	0.06	-27.4321	4.3416	0.11113	0.3712:0.1616:0.4672:0.0	.	1928	Q07283	TRHY_HUMAN	R	1928	ENSP00000357794:S1928R	ENSP00000357794:S1928R	S	-	3	2	TCHH	150346533	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.621000	0.24418	0.097000	0.17492	0.457000	0.33378	AGC		0.542	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		9	191	0	0	0	0.006214	0	9	191				
SLC25A44	9673	broad.mit.edu	37	1	156180134	156180134	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:156180134C>T	ENST00000359511.4	+	4	1029	c.857C>T	c.(856-858)aCa>aTa	p.T286I	PMF1_ENST00000565805.1_5'Flank|SLC25A44_ENST00000469537.1_3'UTR|PMF1_ENST00000368273.4_5'Flank|PMF1-BGLAP_ENST00000320139.5_5'Flank|PMF1_ENST00000368279.3_5'Flank|PMF1-BGLAP_ENST00000368276.4_5'Flank|SLC25A44_ENST00000423538.2_Missense_Mutation_p.T263I|PMF1_ENST00000567140.1_5'Flank|PMF1-BGLAP_ENST00000490491.1_5'Flank|PMF1_ENST00000368277.3_5'Flank	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44	286					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.T286I(1)		breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					ATCTCAGCCACACCTTCCACC	0.567																																							uc001fnp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(856-858)ACA>ATA		solute carrier family 25, member 44							95.0	89.0	91.0					1																	156180134		2203	4300	6503	SO:0001583	missense	9673				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding	g.chr1:156180134C>T	AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.857C>T	1.37:g.156180134C>T	ENSP00000352497:p.Thr286Ile					SLC25A44_uc010phc.1_Missense_Mutation_p.T177I|SLC25A44_uc009wrr.2_Missense_Mutation_p.T294I|SLC25A44_uc010phd.1_RNA|SLC25A44_uc010phe.1_RNA|PMF1_uc009wru.1_5'Flank|PMF1_uc001fnq.2_5'Flank|PMF1_uc001fnr.2_5'Flank|BGLAP_uc001fns.1_5'Flank	p.T286I	NM_014655	NP_055470	Q96H78	S2544_HUMAN			4	1179	+	Hepatocellular(266;0.158)		286			Solcar 3.|Helical; Name=6; (Potential).		O75034	Missense_Mutation	SNP	ENST00000359511.4	37	c.857C>T	CCDS1133.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.483885	0.44147	.	.	ENSG00000160785	ENST00000359511;ENST00000423538;ENST00000412949	T;T	0.77489	-1.1;-1.1	4.8	3.89	0.44902	Mitochondrial carrier domain (2);	0.118944	0.53938	D	0.000044	T	0.39332	0.1074	N	0.17800	0.525	0.48135	D	0.999592	B;B;B	0.17038	0.007;0.005;0.02	B;B;B	0.22152	0.008;0.038;0.038	T	0.39251	-0.9623	10	0.02654	T	1	-1.7361	10.9273	0.47197	0.0:0.9092:0.0:0.0908	.	263;263;286	E9PGQ0;B4DGC4;Q96H78	.;.;S2544_HUMAN	I	286;263;134	ENSP00000352497:T286I;ENSP00000407560:T263I	ENSP00000352497:T286I	T	+	2	0	SLC25A44	154446758	0.967000	0.33354	0.989000	0.46669	0.998000	0.95712	4.529000	0.60588	1.252000	0.44001	0.655000	0.94253	ACA		0.567	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040856.1	NM_014655		6	71	0	0	0	0.001168	0	6	71				
CD5L	922	broad.mit.edu	37	1	157805889	157805889	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:157805889C>A	ENST00000368174.4	-	3	208	c.112G>T	c.(112-114)Gag>Tag	p.E38*	CD5L_ENST00000484609.1_5'UTR	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	38	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)	p.E38*(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TGTTCCACCTCCACCCGCCCT	0.632																																							uc001frk.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(112-114)GAG>TAG		CD5 molecule-like precursor							71.0	70.0	70.0					1																	157805889		2203	4300	6503	SO:0001587	stop_gained	922				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity	g.chr1:157805889C>A	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.112G>T	1.37:g.157805889C>A	ENSP00000357156:p.Glu38*						p.E38*	NM_005894	NP_005885	O43866	CD5L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		3	255	-	all_hematologic(112;0.0378)		38			SRCR 1.		A8K7M5|Q6UX63	Nonsense_Mutation	SNP	ENST00000368174.4	37	c.112G>T	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.190629	0.58017	.	.	ENSG00000073754	ENST00000368174	.	.	.	4.85	4.85	0.62838	.	0.510487	0.16573	N	0.208558	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.9752	0.35930	0.0:0.9018:0.0:0.0982	.	.	.	.	X	38	.	ENSP00000357156:E38X	E	-	1	0	CD5L	156072513	0.999000	0.42202	0.920000	0.36463	0.189000	0.23516	4.485000	0.60279	2.503000	0.84419	0.563000	0.77884	GAG		0.632	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894		40	74	1	0	1.59361e-14	0.006999	2.20724e-14	40	74				
RXRG	6258	broad.mit.edu	37	1	165398047	165398047	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:165398047G>T	ENST00000359842.5	-	2	508	c.206C>A	c.(205-207)cCa>cAa	p.P69Q		NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	69	Modulating. {ECO:0000250}.				gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.P69Q(1)		endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	GACTCGATATGGAGAGCCCAG	0.607																																							uc001gda.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(205-207)CCA>CAA		retinoid X receptor, gamma isoform a	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)						58.0	62.0	61.0					1																	165398047		2203	4300	6503	SO:0001583	missense	6258				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr1:165398047G>T	U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.206C>A	1.37:g.165398047G>T	ENSP00000352900:p.Pro69Gln						p.P69Q	NM_006917	NP_008848	P48443	RXRG_HUMAN			2	506	-	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)		69			Modulating (By similarity).		A6NIP1|Q6IBU7	Missense_Mutation	SNP	ENST00000359842.5	37	c.206C>A	CCDS1248.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928525	0.73327	.	.	ENSG00000143171	ENST00000359842	D	0.93953	-3.32	4.71	3.8	0.43715	.	0.053107	0.85682	D	0.000000	D	0.92648	0.7664	M	0.76727	2.345	0.53688	D	0.999979	P	0.42518	0.782	P	0.50314	0.637	D	0.93066	0.6478	9	0.72032	D	0.01	.	11.6521	0.51295	0.0864:0.0:0.9136:0.0	.	69	P48443	RXRG_HUMAN	Q	69	ENSP00000352900:P69Q	ENSP00000352900:P69Q	P	-	2	0	RXRG	163664671	1.000000	0.71417	0.832000	0.32986	0.938000	0.57974	7.702000	0.84576	1.206000	0.43276	0.561000	0.74099	CCA		0.607	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083794.2	NM_006917		7	58	1	0	0.00307968	0.00308	0.00337365	7	58				
DPT	1805	broad.mit.edu	37	1	168683502	168683502	+	Missense_Mutation	SNP	A	A	T	rs149928380		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:168683502A>T	ENST00000367817.3	-	2	477	c.388T>A	c.(388-390)Ttt>Att	p.F130I		NM_001937.4	NP_001928.2	Q07507	DERM_HUMAN	dermatopontin	130	2 X 53-55 AA tandem repeats.|3 X 6 AA repeats of D-R-[EQ]-W-[NQK]- [FY].				cell adhesion (GO:0007155)|collagen fibril organization (GO:0030199)|negative regulation of cell proliferation (GO:0008285)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.F130I(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)	12	all_hematologic(923;0.208)					CAACAGTAAAACTGCCACTCC	0.572																																							uc001gfp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(388-390)TTT>ATT		dermatopontin precursor							88.0	78.0	81.0					1																	168683502		2203	4300	6503	SO:0001583	missense	1805				cell adhesion	extracellular space|proteinaceous extracellular matrix		g.chr1:168683502A>T	BC033736	CCDS1275.1	1q12-q23	2008-02-05			ENSG00000143196	ENSG00000143196			3011	protein-coding gene	gene with protein product		125597				8104875	Standard	NM_001937		Approved		uc001gfp.3	Q07507	OTTHUMG00000034554	ENST00000367817.3:c.388T>A	1.37:g.168683502A>T	ENSP00000356791:p.Phe130Ile						p.F130I	NM_001937	NP_001928	Q07507	DERM_HUMAN			2	404	-	all_hematologic(923;0.208)		130			2 X 53-55 AA tandem repeats.|2-2.|1-2.|3 X 6 AA repeats of D-R-[EQ]-W-[NQK]- [FY].		A8K981|Q8N4R2|Q9UIX8	Missense_Mutation	SNP	ENST00000367817.3	37	c.388T>A	CCDS1275.1	.	.	.	.	.	.	.	.	.	.	A	33	5.275072	0.95459	.	.	ENSG00000143196	ENST00000367817	T	0.57436	0.4	5.81	5.81	0.92471	.	0.048296	0.85682	D	0.000000	T	0.63129	0.2485	M	0.61703	1.905	0.50467	D	0.999877	D	0.61080	0.989	D	0.75020	0.985	T	0.68765	-0.5322	9	0.72032	D	0.01	-18.1011	15.1438	0.72633	1.0:0.0:0.0:0.0	.	130	Q07507	DERM_HUMAN	I	130	ENSP00000356791:F130I	ENSP00000356791:F130I	F	-	1	0	DPT	166950126	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	8.304000	0.89958	2.216000	0.71823	0.533000	0.62120	TTT		0.572	DPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083618.1	NM_001937		4	63	0	0	0	0.009096	0	4	63				
NPL	80896	broad.mit.edu	37	1	182791305	182791305	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:182791305A>G	ENST00000367553.1	+	10	753	c.709A>G	c.(709-711)Aag>Gag	p.K237E	NPL_ENST00000258317.2_Missense_Mutation_p.K237E|NPL_ENST00000367554.3_Missense_Mutation_p.K218E|NPL_ENST00000463899.1_3'UTR|NPL_ENST00000367552.2_Intron|NPL_ENST00000367555.1_Intron	NM_001200056.1|NM_030769.2	NP_001186985.1|NP_110396.1	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)	237					carbohydrate metabolic process (GO:0005975)|N-acetylneuraminate catabolic process (GO:0019262)	cytoplasm (GO:0005737)	N-acetylneuraminate lyase activity (GO:0008747)	p.K237E(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(1)|stomach(1)	15						TTTTGAACAAAAGGACTTCTC	0.393																																							uc009wyb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(709-711)AAG>GAG		N-acetylneuraminate pyruvate lyase							127.0	121.0	123.0					1																	182791305		2203	4300	6503	SO:0001583	missense	80896				carbohydrate metabolic process	cytoplasm	N-acetylneuraminate lyase activity	g.chr1:182791305A>G	AF338436	CCDS1350.1, CCDS55666.1, CCDS55667.1, CCDS72990.1	1q25	2010-11-25	2003-09-16	2003-09-17	ENSG00000135838	ENSG00000135838	4.1.3.3		16781	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 1 (E. coli)"""	611412	"""chromosome 1 open reading frame 13"""	C1orf13		11318611	Standard	NM_001200056		Approved	NPL1, DHDPS1	uc009wyb.3	Q9BXD5	OTTHUMG00000035321	ENST00000367553.1:c.709A>G	1.37:g.182791305A>G	ENSP00000356524:p.Lys237Glu					NPL_uc010pnx.1_3'UTR|NPL_uc010pny.1_Intron|NPL_uc001gpo.1_Missense_Mutation_p.K218E|NPL_uc009wyc.2_Intron|NPL_uc001gpp.3_Missense_Mutation_p.K237E|NPL_uc001gpq.1_Missense_Mutation_p.K237E	p.K237E	NM_030769	NP_110396	Q9BXD5	NPL_HUMAN			11	849	+			237					B2R839|Q4G0Q8|Q4G0Z2|Q64L88|Q6PEL0	Missense_Mutation	SNP	ENST00000367553.1	37	c.709A>G	CCDS1350.1	.	.	.	.	.	.	.	.	.	.	A	12.39	1.925115	0.34002	.	.	ENSG00000135838	ENST00000367554;ENST00000367553;ENST00000258317	D;D;D	0.94537	-3.45;-3.45;-3.45	5.42	3.16	0.36331	Aldolase-type TIM barrel (1);	0.280822	0.39687	N	0.001288	D	0.86669	0.5988	N	0.19112	0.55	0.09310	N	0.999992	B;B;B	0.32862	0.129;0.174;0.387	B;B;B	0.31495	0.084;0.048;0.131	T	0.79797	-0.1652	10	0.72032	D	0.01	-15.9976	4.6722	0.12694	0.5282:0.2717:0.2001:0.0	.	237;237;218	Q9BXD5;Q9BXD5-3;Q9BXD5-2	NPL_HUMAN;.;.	E	218;237;237	ENSP00000356525:K218E;ENSP00000356524:K237E;ENSP00000258317:K237E	ENSP00000258317:K237E	K	+	1	0	NPL	181057928	0.913000	0.31002	0.719000	0.30619	0.918000	0.54935	1.695000	0.37763	0.908000	0.36671	0.528000	0.53228	AAG		0.393	NPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085463.1	NM_030769		4	47	0	0	0	0.009096	0	4	47				
COLGALT2	23127	broad.mit.edu	37	1	183923911	183923911	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:183923911C>G	ENST00000361927.4	-	7	1385	c.1014G>C	c.(1012-1014)aaG>aaC	p.K338N	COLGALT2_ENST00000367520.3_Missense_Mutation_p.K75N|COLGALT2_ENST00000546159.1_Missense_Mutation_p.K338N	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	338					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)	p.K338N(1)									CAAATCCCATCTTGTCTGGAT	0.463																																						Esophageal Squamous(10;42 606 18489 38825)	uc001gqr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1012-1014)AAG>AAC		glycosyltransferase 25 domain containing 2							169.0	136.0	147.0					1																	183923911		2203	4300	6503	SO:0001583	missense	23127				lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity	g.chr1:183923911C>G	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.1014G>C	1.37:g.183923911C>G	ENSP00000354960:p.Lys338Asn					GLT25D2_uc010poj.1_Missense_Mutation_p.K338N|GLT25D2_uc001gqq.2_Missense_Mutation_p.K75N|GLT25D2_uc001gqs.2_Missense_Mutation_p.K218N	p.K338N	NM_015101	NP_055916	Q8IYK4	GT252_HUMAN			7	1386	-			338					O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	37	c.1014G>C	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.567020	0.65651	.	.	ENSG00000198756	ENST00000546159;ENST00000361927;ENST00000367520	T;T	0.79653	-1.29;-1.29	4.84	4.84	0.62591	.	0.051966	0.85682	D	0.000000	D	0.88855	0.6550	M	0.88570	2.965	0.80722	D	1	D;D;D	0.65815	0.995;0.972;0.985	P;P;P	0.60949	0.881;0.811;0.811	D	0.90235	0.4282	10	0.72032	D	0.01	.	10.7287	0.46083	0.0:0.91:0.0:0.09	.	338;338;75	F5H3T5;Q8IYK4;Q5SXQ3	.;GT252_HUMAN;.	N	338;338;75	ENSP00000439112:K338N;ENSP00000354960:K338N	ENSP00000354960:K338N	K	-	3	2	GLT25D2	182190534	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.453000	0.35167	2.377000	0.81083	0.462000	0.41574	AAG		0.463	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101		10	87	0	0	0	0.006214	0	10	87				
CFH	3075	broad.mit.edu	37	1	196658660	196658660	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:196658660G>A	ENST00000359637.2	+	7	945	c.883G>A	c.(883-885)Gaa>Aaa	p.E295K	CFH_ENST00000439155.2_Missense_Mutation_p.E359K|CFH_ENST00000367429.4_Missense_Mutation_p.E359K			P08603	CFAH_HUMAN	complement factor H	359	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.E359K(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TTACTGTGATGAACATTTTGA	0.408																																							uc001gtj.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(1)|breast(1)	6						c.(1075-1077)GAA>AAA		complement factor H isoform a precursor							117.0	114.0	115.0					1																	196658660		2203	4300	6503	SO:0001583	missense	3075				complement activation, alternative pathway	extracellular space		g.chr1:196658660G>A	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.883G>A	1.37:g.196658660G>A	ENSP00000352658:p.Glu295Lys					CFH_uc001gti.3_Missense_Mutation_p.E359K|CFH_uc009wyw.2_Missense_Mutation_p.E334K|CFH_uc009wyx.2_Missense_Mutation_p.E295K	p.E359K	NM_000186	NP_000177	P08603	CFAH_HUMAN			8	1315	+			359			Sushi 6.		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000359637.2	37	c.1075G>A		.	.	.	.	.	.	.	.	.	.	G	9.199	1.028034	0.19512	.	.	ENSG00000000971	ENST00000367429;ENST00000439155;ENST00000391986;ENST00000359637	T;T;T	0.66815	-0.23;-0.23;-0.23	5.61	-11.2	0.00127	Complement control module (2);Sushi/SCR/CCP (2);	.	.	.	.	T	0.35770	0.0943	N	0.12182	0.205	0.09310	N	1	B;B;B;B	0.16603	0.0;0.004;0.018;0.002	B;B;B;B	0.23716	0.018;0.012;0.048;0.02	T	0.09357	-1.0678	9	0.09590	T	0.72	.	6.4834	0.22075	0.2168:0.5373:0.1046:0.1413	.	295;359;359;359	Q5TFM2;P08603-2;P08603;F8WDX4	.;.;CFAH_HUMAN;.	K	359;359;359;295	ENSP00000356399:E359K;ENSP00000402656:E359K;ENSP00000352658:E295K	ENSP00000352658:E295K	E	+	1	0	CFH	194925283	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-6.537000	0.00062	-3.632000	0.00129	-0.825000	0.03093	GAA		0.408	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000087502.1	NM_000186		30	58	0	0	0	0.007291	0	30	58				
CRB1	23418	broad.mit.edu	37	1	197404356	197404357	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:197404356_197404357GG>TT	ENST00000367400.3	+	9	3498_3499	c.3363_3364GG>TT	c.(3361-3366)caGGaa>caTTaa	p.1121_1122QE>H*	CRB1_ENST00000367397.1_Nonsense_Mutation_p.502_503QE>H*|CRB1_ENST00000535699.1_Nonsense_Mutation_p.1097_1098QE>H*|CRB1_ENST00000544212.1_Nonsense_Mutation_p.602_603QE>H*|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367399.2_Nonsense_Mutation_p.1009_1010QE>H*|RP11-75C23.1_ENST00000422250.1_RNA	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1121	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q1121_E1122>H*(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ATAAACCTCAGGAAGAGCAATT	0.396																																							uc001gtz.2		NA																	1	Complex - compound substitution(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)	9						c.(3361-3366)CAGGAA>CATTAA		crumbs homolog 1 precursor																																				SO:0001587	stop_gained	23418				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding	g.chr1:197404356_197404357GG>TT		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	Exception_encountered	1.37:g.197404356_197404357delinsTT	ENSP00000356370:p.Q1121_E1122delinsH*					CRB1_uc010poz.1_Nonsense_Mutation_p.1097_1098QE>H*|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Nonsense_Mutation_p.1009_1010QE>H*|CRB1_uc010ppb.1_Intron|CRB1_uc010ppd.1_Nonsense_Mutation_p.602_603QE>H*|CRB1_uc001gub.1_Nonsense_Mutation_p.770_771QE>H*	p.1121_1122QE>H*	NM_201253	NP_957705	P82279	CRUM1_HUMAN			9	3498_3499	+			1121_1122			Extracellular (Potential).|Laminin G-like 3.		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Nonsense_Mutation	DNP	ENST00000367400.3	37	c.3363_3364GG>TT	CCDS1390.1																																																																																				0.396	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		23	60	0	0	0	0.004672	0	23	60				
OPTC	26254	broad.mit.edu	37	1	203467938	203467938	+	Missense_Mutation	SNP	G	G	A	rs114769450	byFrequency	TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:203467938G>A	ENST00000367222.2	+	4	616	c.500G>A	c.(499-501)cGt>cAt	p.R167H		NM_014359.3	NP_055174.1	Q9UBM4	OPT_HUMAN	opticin	167					negative regulation of angiogenesis (GO:0016525)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.R167H(1)		breast(1)|cervix(1)|kidney(5)|large_intestine(3)|lung(8)|pancreas(1)|stomach(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.109)			CGCATCAGCCGTATCAGGGCC	0.552													G|||	9	0.00179712	0.0068	0.0	5008	,	,		21279	0.0		0.0	False		,,,				2504	0.0						uc001gzu.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(499-501)CGT>CAT		opticin precursor		G	HIS/ARG	58,4348	58.1+/-94.6	1,56,2146	81.0	72.0	75.0		500	-9.7	0.0	1	dbSNP_132	75	0,8600		0,0,4300	yes	missense	OPTC	NM_014359.3	29	1,56,6446	AA,AG,GG		0.0,1.3164,0.4459	benign	167/333	203467938	58,12948	2203	4300	6503	SO:0001583	missense	26254					proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding	g.chr1:203467938G>A	AF161702	CCDS1439.1	1q31	2008-02-05			ENSG00000188770	ENSG00000188770			8158	protein-coding gene	gene with protein product	"""oculoglycan"""	605127				10636917	Standard	NM_014359		Approved		uc001gzu.1	Q9UBM4	OTTHUMG00000036100	ENST00000367222.2:c.500G>A	1.37:g.203467938G>A	ENSP00000356191:p.Arg167His						p.R167H	NM_014359	NP_055174	Q9UBM4	OPT_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		4	616	+			167			LRR 1.		Q5T2G4	Missense_Mutation	SNP	ENST00000367222.2	37	c.500G>A	CCDS1439.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	2.130	-0.399351	0.04865	0.013164	0.0	ENSG00000188770	ENST00000367222;ENST00000448911	T;T	0.57752	0.38;2.94	4.85	-9.71	0.00518	.	1.304990	0.04983	N	0.466076	T	0.19604	0.0471	N	0.03029	-0.43	0.09310	N	1	B	0.15141	0.012	B	0.15484	0.013	T	0.40175	-0.9577	10	0.25751	T	0.34	-0.9928	16.0719	0.80941	0.1579:0.1788:0.6632:0.0	.	167	Q9UBM4	OPT_HUMAN	H	167;145	ENSP00000356191:R167H;ENSP00000399491:R145H	ENSP00000356191:R167H	R	+	2	0	OPTC	201734561	0.000000	0.05858	0.000000	0.03702	0.192000	0.23643	-0.742000	0.04850	-2.840000	0.00335	-1.036000	0.02392	CGT		0.552	OPTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087964.1	NM_014359		33	46	0	0	0	0.019004	0	33	46				
NFASC	23114	broad.mit.edu	37	1	204943942	204943942	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:204943942G>A	ENST00000401399.1	+	13	1748	c.1549G>A	c.(1549-1551)Gag>Aag	p.E517K	NFASC_ENST00000338586.6_Missense_Mutation_p.E517K|NFASC_ENST00000367169.4_Missense_Mutation_p.E517K|NFASC_ENST00000367170.4_Missense_Mutation_p.E517K|NFASC_ENST00000339876.6_Missense_Mutation_p.E517K|NFASC_ENST00000367171.4_Missense_Mutation_p.E517K|NFASC_ENST00000403080.1_Missense_Mutation_p.E517K|NFASC_ENST00000367172.4_Missense_Mutation_p.E517K|NFASC_ENST00000513543.1_Missense_Mutation_p.E528K|NFASC_ENST00000338515.6_Missense_Mutation_p.E517K|NFASC_ENST00000539706.1_Missense_Mutation_p.E528K|NFASC_ENST00000360049.4_Missense_Mutation_p.E528K|NFASC_ENST00000404076.1_Missense_Mutation_p.E511K|NFASC_ENST00000404907.1_Missense_Mutation_p.E528K			O94856	NFASC_HUMAN	neurofascin	517	Ig-like C2-type 5.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.E517K(2)|p.E528K(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGTCCGCCTGGAGGTCAAAGG	0.512																																							uc001hbj.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(1549-1551)GAG>AAG		neurofascin isoform 1 precursor							90.0	84.0	86.0					1																	204943942		2203	4300	6503	SO:0001583	missense	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204943942G>A	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.1549G>A	1.37:g.204943942G>A	ENSP00000385637:p.Glu517Lys					NFASC_uc001hbh.2_Missense_Mutation_p.E517K|NFASC_uc010pqz.1_Missense_Mutation_p.E511K|NFASC_uc010pra.1_Missense_Mutation_p.E528K|NFASC_uc001hbi.2_Missense_Mutation_p.E528K|NFASC_uc010prb.1_Missense_Mutation_p.E528K|NFASC_uc010prc.1_Missense_Mutation_p.E84K|NFASC_uc001hbk.1_Missense_Mutation_p.E338K	p.E517K	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		14	1877	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		517			Extracellular (Potential).|Ig-like C2-type 5.		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	c.1549G>A	CCDS53460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.9|24.9	4.578318|4.578318	0.86645|0.86645	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393|ENST00000367173	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.65916|.	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18|.	5.8|5.8	5.8|5.8	0.92144|0.92144	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.128259|.	0.35124|.	N|.	0.003431|.	T|.	0.57888|.	0.2084|.	N|N	0.25825|0.25825	0.765|0.765	0.54753|0.54753	D|D	0.999984|0.999984	P;P;P;P;D;P;P|.	0.55385|.	0.803;0.754;0.744;0.765;0.971;0.467;0.865|.	P;P;B;P;B;B;P|.	0.53549|.	0.729;0.603;0.437;0.507;0.219;0.322;0.566|.	T|.	0.50092|.	-0.8868|.	10|.	0.25106|.	T|.	0.35|.	.|.	19.7118|19.7118	0.96099|0.96099	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	517;528;528;517;517;528;517|.	O94856;O94856-11;O94856-8;F8W791;O94856-9;O94856-3;O94856-2|.	NFASC_HUMAN;.;.;.;.;.;.|.	K|X	517;517;517;517;517;517;528;528;528;517;517;511;517;528;528;504|486	ENSP00000356140:E517K;ENSP00000356139:E517K;ENSP00000356138:E517K;ENSP00000342128:E517K;ENSP00000344786:E517K;ENSP00000343509:E517K;ENSP00000438614:E528K;ENSP00000353154:E528K;ENSP00000356137:E517K;ENSP00000384875:E517K;ENSP00000385676:E511K;ENSP00000385637:E517K;ENSP00000384061:E528K;ENSP00000425908:E528K;ENSP00000415031:E504K|.	ENSP00000295776:E528K|.	E|W	+|+	1|3	0|0	NFASC|NFASC	203210565|203210565	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.876000|7.876000	0.87215|0.87215	2.764000|2.764000	0.94973|0.94973	0.485000|0.485000	0.47835|0.47835	GAG|TGG		0.512	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388		18	54	0	0	0	0.006122	0	18	54				
EIF2D	1939	broad.mit.edu	37	1	206772426	206772426	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:206772426C>T	ENST00000271764.2	-	11	1431	c.1223G>A	c.(1222-1224)gGc>gAc	p.G408D	EIF2D_ENST00000472709.2_5'Flank|EIF2D_ENST00000367114.3_Missense_Mutation_p.G284D	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	408					formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)	p.G408D(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GACCTCACTGCCCTCCAGAAA	0.498																																							uc001heh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1222-1224)GGC>GAC		ligatin							147.0	129.0	135.0					1																	206772426		2203	4300	6503	SO:0001583	missense	1939				intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity	g.chr1:206772426C>T	BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.1223G>A	1.37:g.206772426C>T	ENSP00000271764:p.Gly408Asp					LGTN_uc009xbw.2_Missense_Mutation_p.G284D	p.G408D	NM_006893	NP_008824	P41214	EIF2D_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.166)		11	1432	-	Breast(84;0.183)		408					Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Missense_Mutation	SNP	ENST00000271764.2	37	c.1223G>A	CCDS1465.1	.	.	.	.	.	.	.	.	.	.	C	9.632	1.136792	0.21123	.	.	ENSG00000143486	ENST00000367114;ENST00000271764	T;T	0.42131	0.98;1.56	5.72	3.7	0.42460	SWIB/MDM2 domain (1);	0.377447	0.33980	N	0.004375	T	0.42517	0.1206	M	0.62723	1.935	0.31943	N	0.610631	P;B	0.41188	0.741;0.183	B;B	0.41988	0.372;0.122	T	0.54351	-0.8307	10	0.31617	T	0.26	-17.8215	13.1311	0.59382	0.0:0.693:0.307:0.0	.	284;408	P41214-2;P41214	.;EIF2D_HUMAN	D	284;408	ENSP00000356081:G284D;ENSP00000271764:G408D	ENSP00000271764:G408D	G	-	2	0	EIF2D	204839049	0.995000	0.38212	0.997000	0.53966	0.570000	0.35934	1.902000	0.39848	1.382000	0.46385	0.655000	0.94253	GGC		0.498	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088475.1	NM_006893		11	71	0	0	0	0.008291	0	11	71				
DYRK3	8444	broad.mit.edu	37	1	206821060	206821060	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:206821060C>T	ENST00000367109.2	+	3	685	c.517C>T	c.(517-519)Cca>Tca	p.P173S	DYRK3_ENST00000367108.3_Missense_Mutation_p.P153S|DYRK3_ENST00000489878.1_Intron|DYRK3_ENST00000367106.1_Missense_Mutation_p.P153S	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3	173					erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.P138S(1)|p.P173S(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CTTTGTAGGTCCAAATGCCAA	0.423																																					Melanoma(164;427 2622 26826 51707)	Melanoma(164;427 2622 26826 51707)	uc001hej.2		NA																	2	Substitution - Missense(2)		lung(2)	stomach(2)|central_nervous_system(1)	3						c.(517-519)CCA>TCA		dual-specificity tyrosine-(Y)-phosphorylation							119.0	118.0	118.0					1																	206821060		2203	4300	6503	SO:0001583	missense	8444				erythrocyte differentiation	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr1:206821060C>T	Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.517C>T	1.37:g.206821060C>T	ENSP00000356076:p.Pro173Ser					DYRK3_uc001hek.2_Intron|DYRK3_uc001hei.2_Missense_Mutation_p.P153S	p.P173S	NM_003582	NP_003573	O43781	DYRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.166)		3	685	+	Breast(84;0.183)		173					D3DT79|Q7Z752|Q9HBY6|Q9HBY7	Missense_Mutation	SNP	ENST00000367109.2	37	c.517C>T	CCDS30999.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673011	0.29693	.	.	ENSG00000143479	ENST00000367109;ENST00000367108;ENST00000441486;ENST00000367106	T;T;T;T	0.68765	-0.35;-0.34;2.86;-0.34	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.52370	0.1730	L	0.27975	0.815	0.80722	D	1	B;B	0.28208	0.066;0.203	B;B	0.25506	0.028;0.061	T	0.49542	-0.8929	10	0.08381	T	0.77	.	18.1916	0.89808	0.0:1.0:0.0:0.0	.	173;153	O43781;O43781-2	DYRK3_HUMAN;.	S	173;153;153;153	ENSP00000356076:P173S;ENSP00000356075:P153S;ENSP00000410187:P153S;ENSP00000356073:P153S	ENSP00000356073:P153S	P	+	1	0	DYRK3	204887683	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	7.623000	0.83113	2.781000	0.95711	0.579000	0.79373	CCA		0.423	DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088458.1	NM_003582		44	79	0	0	0	0.009718	0	44	79				
HLX	3142	broad.mit.edu	37	1	221055563	221055563	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:221055563C>T	ENST00000366903.6	+	3	2331	c.830C>T	c.(829-831)tCa>tTa	p.S277L	HLA-AS1_ENST00000552026.1_RNA|HLX_ENST00000549319.1_Missense_Mutation_p.S63L	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	277					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.S277L(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		AGGAAGCGTTCATGGTCGCGC	0.572																																							uc001hmv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(829-831)TCA>TTA		H2.0-like homeobox							73.0	59.0	64.0					1																	221055563		2203	4300	6503	SO:0001583	missense	3142				cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:221055563C>T	BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.830C>T	1.37:g.221055563C>T	ENSP00000355870:p.Ser277Leu						p.S277L	NM_021958	NP_068777	Q14774	HLX_HUMAN		GBM - Glioblastoma multiforme(131;0.00914)	3	1287	+			277			Homeobox.		B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	ENST00000366903.6	37	c.830C>T	CCDS1527.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.537554	0.85917	.	.	ENSG00000136630	ENST00000366903;ENST00000427693;ENST00000549319	D;D;T	0.95622	-3.76;-3.73;2.3	5.84	5.84	0.93424	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.000000	0.52532	D	0.000063	D	0.96346	0.8808	L	0.39898	1.24	0.80722	D	1	P	0.50272	0.933	P	0.62089	0.898	D	0.95659	0.8713	10	0.44086	T	0.13	-19.5089	20.1278	0.97990	0.0:1.0:0.0:0.0	.	277	Q14774	HLX_HUMAN	L	277;10;63	ENSP00000355870:S277L;ENSP00000408248:S10L;ENSP00000449882:S63L	ENSP00000355870:S277L	S	+	2	0	HLX	219122186	1.000000	0.71417	0.962000	0.40283	0.199000	0.23934	7.788000	0.85771	2.768000	0.95171	0.561000	0.74099	TCA		0.572	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090902.3	NM_021958		17	37	0	0	0	0.006122	0	17	37				
OR2M7	391196	broad.mit.edu	37	1	248487582	248487582	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:248487582A>T	ENST00000317965.2	-	1	317	c.289T>A	c.(289-291)Tgt>Agt	p.C97S		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C97S(1)		breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGTGTGGCACAGCCAGCCATA	0.483																																							uc010pzk.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(289-291)TGT>AGT		olfactory receptor, family 2, subfamily M,							198.0	205.0	203.0					1																	248487582		2203	4300	6503	SO:0001583	missense	391196				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248487582A>T	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.289T>A	1.37:g.248487582A>T	ENSP00000324557:p.Cys97Ser						p.C97S	NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	289	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		97			Extracellular (Potential).		B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	c.289T>A	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	A	13.84	2.356907	0.41801	.	.	ENSG00000177186	ENST00000317965	T	0.00540	6.7	1.54	1.54	0.23209	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35067	U	0.003462	T	0.04137	0.0115	H	0.99545	4.62	0.09310	N	1	D	0.71674	0.998	D	0.68943	0.961	T	0.20338	-1.0278	10	0.87932	D	0	.	8.6678	0.34132	1.0:0.0:0.0:0.0	.	97	Q8NG81	OR2M7_HUMAN	S	97	ENSP00000324557:C97S	ENSP00000324557:C97S	C	-	1	0	OR2M7	246554205	0.995000	0.38212	0.012000	0.15200	0.205000	0.24178	5.308000	0.65768	0.703000	0.31848	0.155000	0.16302	TGT		0.483	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		167	251	0	0	0	0.01441	0	167	251				
PTPLA	9200	broad.mit.edu	37	10	17636278	17636278	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr10:17636278C>A	ENST00000361271.3	-	6	747	c.710G>T	c.(709-711)aGa>aTa	p.R237I		NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A	237					fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)	p.R237I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						GTTAGGAAGTCTTATTGAAAA	0.313																																							uc001ipg.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(709-711)AGA>ATA		protein tyrosine phosphatase-like, member A							71.0	72.0	72.0					10																	17636278		2203	4296	6499	SO:0001583	missense	9200				fatty acid biosynthetic process|multicellular organismal development|signal transduction	endoplasmic reticulum membrane|integral to membrane	lyase activity|protein tyrosine phosphatase activity	g.chr10:17636278C>A	AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.710G>T	10.37:g.17636278C>A	ENSP00000355308:p.Arg237Ile						p.R237I	NM_014241	NP_055056	B0YJ81	HACD1_HUMAN			6	745	-			237			Lumenal (Potential).		B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Missense_Mutation	SNP	ENST00000361271.3	37	c.710G>T	CCDS7121.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.345640	0.61073	.	.	ENSG00000165996	ENST00000361271	T	0.30714	1.52	5.72	5.72	0.89469	.	0.088554	0.85682	D	0.000000	T	0.36138	0.0956	L	0.47716	1.5	0.80722	D	1	B	0.26483	0.15	B	0.34346	0.18	T	0.05599	-1.0875	10	0.34782	T	0.22	-18.2397	20.2406	0.98372	0.0:1.0:0.0:0.0	.	237	B0YJ81	HACD1_HUMAN	I	237	ENSP00000355308:R237I	ENSP00000355308:R237I	R	-	2	0	PTPLA	17676284	1.000000	0.71417	0.946000	0.38457	0.883000	0.51084	1.971000	0.40530	2.857000	0.98124	0.650000	0.86243	AGA		0.313	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047046.1	NM_014241		23	77	1	0	7.41877e-09	0.012319	9.45992e-09	23	77				
SLC39A12	221074	broad.mit.edu	37	10	18280171	18280171	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr10:18280171G>T	ENST00000377369.2	+	8	1634	c.1361G>T	c.(1360-1362)gGc>gTc	p.G454V	SLC39A12_ENST00000539911.1_Missense_Mutation_p.G320V|SLC39A12_ENST00000377371.3_Missense_Mutation_p.G454V|SLC39A12_ENST00000377374.4_Missense_Mutation_p.G454V	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	454					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)	p.G454V(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						TTAATTGGAGGCATCCATGGA	0.353																																							uc001ipo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1360-1362)GGC>GTC		solute carrier family 39 (zinc transporter),							93.0	100.0	98.0					10																	18280171		2203	4300	6503	SO:0001583	missense	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18280171G>T		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1361G>T	10.37:g.18280171G>T	ENSP00000366586:p.Gly454Val					SLC39A12_uc001ipn.2_Missense_Mutation_p.G454V|SLC39A12_uc001ipp.2_Missense_Mutation_p.G454V|SLC39A12_uc010qck.1_Missense_Mutation_p.G320V	p.G454V	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN			8	1634	+			454			Helical; (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	c.1361G>T	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243878	0.79912	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.90092	0.6905	H	0.96269	3.795	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92264	0.5819	10	0.87932	D	0	-18.8587	20.3248	0.98698	0.0:0.0:1.0:0.0	.	454;454;454	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	V	454;454;454;320;374	ENSP00000366586:G454V;ENSP00000366591:G454V;ENSP00000366588:G454V;ENSP00000440445:G320V	ENSP00000366586:G454V	G	+	2	0	SLC39A12	18320177	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.851000	0.69481	2.818000	0.97014	0.655000	0.94253	GGC		0.353	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		20	78	1	0	5.03518e-11	0.007413	6.74155e-11	20	78				
NEBL	10529	broad.mit.edu	37	10	21101768	21101768	+	Silent	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr10:21101768G>A	ENST00000377122.4	-	24	2844	c.2448C>T	c.(2446-2448)gtC>gtT	p.V816V	NEBL_ENST00000417816.2_Silent_p.V153V|NEBL_ENST00000377159.4_Silent_p.V119V	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	816					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)	p.V816V(1)|p.V153V(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CAGCATCGCTGACCACCTGGG	0.512																																							uc001iqi.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(2446-2448)GTC>GTT		nebulette sarcomeric isoform							136.0	103.0	114.0					10																	21101768		2203	4300	6503	SO:0001819	synonymous_variant	10529				regulation of actin filament length		actin binding|structural constituent of muscle	g.chr10:21101768G>A	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2448C>T	10.37:g.21101768G>A						NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Silent_p.V153V	p.V816V	NM_006393	NP_006384	O76041	NEBL_HUMAN			24	2845	-			816			Nebulin 23.		B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	ENST00000377122.4	37	c.2448C>T	CCDS7134.1																																																																																				0.512	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393		15	52	0	0	0	0.003163	0	15	52				
SYT15	83849	broad.mit.edu	37	10	46968629	46968629	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr10:46968629G>A	ENST00000374321.4	-	3	373	c.307C>T	c.(307-309)Ccc>Tcc	p.P103S	RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000374323.4_Missense_Mutation_p.P156S|SYT15_ENST00000374325.3_Missense_Mutation_p.P103S|SYT15_ENST00000503753.1_Missense_Mutation_p.P103S	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P103S(2)|p.P155S(1)		cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						GCCGGGCAGGGGTCCCATGGG	0.682																																					Ovarian(57;1152 1428 19651 37745)	Ovarian(57;1152 1428 19651 37745)	uc001jea.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(307-309)CCC>TCC		synaptotagmin XV isoform a							37.0	46.0	43.0					10																	46968629		2098	4218	6316	SO:0001583	missense	83849					integral to membrane|plasma membrane		g.chr10:46968629G>A	AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.307C>T	10.37:g.46968629G>A	ENSP00000363441:p.Pro103Ser					SYT15_uc001jdz.2_Missense_Mutation_p.P103S|SYT15_uc001jeb.2_5'UTR|SYT15_uc010qfp.1_5'Flank	p.P103S	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN			3	460	-			103			Cytoplasmic (Potential).		A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Missense_Mutation	SNP	ENST00000374321.4	37	c.307C>T	CCDS44376.1	.	.	.	.	.	.	.	.	.	.	.	3.745	-0.052851	0.07362	.	.	ENSG00000204176	ENST00000416127;ENST00000374325;ENST00000503753;ENST00000374323;ENST00000374321	T;T;T;T	0.14893	2.47;2.47;2.88;2.72	4.59	1.61	0.23674	.	0.684128	0.14274	N	0.329969	T	0.13072	0.0317	L	0.50333	1.59	0.26516	N	0.974511	B;B	0.21147	0.017;0.052	B;B	0.16289	0.004;0.015	T	0.40136	-0.9579	10	0.10111	T	0.7	.	8.0039	0.30313	0.1613:0.0:0.7071:0.1316	.	103;103	Q9BQS2;Q9BQS2-2	SYT15_HUMAN;.	S	103;103;103;156;103	ENSP00000363445:P103S;ENSP00000427607:P103S;ENSP00000363443:P156S;ENSP00000363441:P103S	ENSP00000363441:P103S	P	-	1	0	SYT15	46388635	0.977000	0.34250	0.058000	0.19502	0.009000	0.06853	0.658000	0.24979	0.017000	0.15025	-1.164000	0.01763	CCC		0.682	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367008.1	NM_031912		5	53	0	0	0	0.014758	0	5	53				
PCDH15	65217	broad.mit.edu	37	10	55566681	55566681	+	Silent	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr10:55566681G>T	ENST00000373965.2	-	36	5107	c.4713C>A	c.(4711-4713)tcC>tcA	p.S1571S	PCDH15_ENST00000414778.1_Silent_p.S1568S	NM_001142771.1|NM_001142772.1	NP_001136243.1|NP_001136244.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	422					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.S1568S(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GTCGAACAGGGGAAGCAACTT	0.458										HNSCC(58;0.16)																													uc010qhq.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(4705-4707)TCC>TCA		protocadherin 15 isoform CD3-1 precursor							140.0	131.0	134.0					10																	55566681		1568	3581	5149	SO:0001819	synonymous_variant	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55566681G>T	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000373965.2:c.4713C>A	10.37:g.55566681G>T		HNSCC(58;0.16)				PCDH15_uc010qhr.1_Silent_p.S1564S	p.S1569S	NM_001142771	NP_001136243	Q96QU1	PCD15_HUMAN			36	5102	-		Melanoma(3;0.117)|Lung SC(717;0.238)	422			Cadherin 4.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000373965.2	37	c.4707C>A																																																																																					0.458	PCDH15-008	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000291336.1	NM_033056		46	151	1	0	3.77016e-25	0.013114	5.75068e-25	46	151				
PCDH15	65217	broad.mit.edu	37	10	55943219	55943219	+	Silent	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr10:55943219C>T	ENST00000320301.6	-	13	1969	c.1575G>A	c.(1573-1575)ggG>ggA	p.G525G	PCDH15_ENST00000395445.1_Silent_p.G532G|PCDH15_ENST00000361849.3_Silent_p.G525G|PCDH15_ENST00000395446.1_Silent_p.G525G|PCDH15_ENST00000409834.1_Silent_p.G136G|PCDH15_ENST00000373965.2_Silent_p.G532G|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395430.1_Silent_p.G525G|PCDH15_ENST00000414778.1_Silent_p.G530G|PCDH15_ENST00000373955.1_Silent_p.G525G|PCDH15_ENST00000373957.3_Silent_p.G503G|PCDH15_ENST00000395433.1_Silent_p.G503G|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395438.1_Silent_p.G525G|PCDH15_ENST00000437009.1_Silent_p.G525G|PCDH15_ENST00000395432.2_Silent_p.G488G	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	525	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.G525G(2)|p.G530G(2)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGACACTGTCCCCAGGTCTCA	0.363										HNSCC(58;0.16)																													uc001jju.1		NA																	4	Substitution - coding silent(4)		lung(4)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(1573-1575)GGG>GGA		protocadherin 15 isoform CD1-4 precursor							213.0	187.0	196.0					10																	55943219		2203	4300	6503	SO:0001819	synonymous_variant	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55943219C>T	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1575G>A	10.37:g.55943219C>T		HNSCC(58;0.16)				PCDH15_uc010qhq.1_Silent_p.G530G|PCDH15_uc010qhr.1_Silent_p.G525G|PCDH15_uc010qhs.1_Silent_p.G537G|PCDH15_uc010qht.1_Silent_p.G532G|PCDH15_uc010qhu.1_Silent_p.G525G|PCDH15_uc001jjv.1_Silent_p.G503G|PCDH15_uc010qhv.1_Silent_p.G525G|PCDH15_uc010qhw.1_Silent_p.G488G|PCDH15_uc010qhx.1_Silent_p.G525G|PCDH15_uc010qhy.1_Silent_p.G530G|PCDH15_uc010qhz.1_Silent_p.G525G|PCDH15_uc010qia.1_Silent_p.G503G|PCDH15_uc010qib.1_Silent_p.G503G|PCDH15_uc001jjw.2_Silent_p.G525G	p.G525G	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN			13	1970	-		Melanoma(3;0.117)|Lung SC(717;0.238)	525			Cadherin 5.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	c.1575G>A	CCDS7248.1																																																																																				0.363	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		18	72	0	0	0	0.008871	0	18	72				
WAPAL	23063	broad.mit.edu	37	10	88227091	88227091	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr10:88227091A>G	ENST00000298767.5	-	9	2787	c.2315T>C	c.(2314-2316)aTc>aCc	p.I772T	WAPAL_ENST00000372075.1_Missense_Mutation_p.I39T|WAPAL_ENST00000263070.7_Missense_Mutation_p.I39T	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	772	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)		p.I772T(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						GAGCCTTCGGATTTTTTCTTT	0.368																																							uc001kdo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2314-2316)ATC>ACC		wings apart-like homolog							180.0	167.0	171.0					10																	88227091		2203	4300	6503	SO:0001583	missense	23063				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding	g.chr10:88227091A>G	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.2315T>C	10.37:g.88227091A>G	ENSP00000298767:p.Ile772Thr					WAPAL_uc009xsv.2_Missense_Mutation_p.I86T|WAPAL_uc001kdn.2_Missense_Mutation_p.I809T|WAPAL_uc009xsw.2_Missense_Mutation_p.I766T	p.I772T	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN			9	2757	-			772			Potential.|WAPL.		A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	c.2315T>C	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.484052	0.84854	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076;ENST00000372075;ENST00000263070	T	0.48201	0.82	5.99	5.99	0.97316	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67316	0.2880	M	0.64997	1.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.99;0.998;0.996	T	0.69537	-0.5119	10	0.72032	D	0.01	.	16.4943	0.84223	1.0:0.0:0.0:0.0	.	766;810;772;809	B2RTX8;E9PH12;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	T	857;772;857;39;39	ENSP00000298767:I772T	ENSP00000263070:I39T	I	-	2	0	WAPAL	88217071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.336000	0.96533	2.291000	0.77112	0.533000	0.62120	ATC		0.368	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045		18	82	0	0	0	0.010504	0	18	82				
BLNK	29760	broad.mit.edu	37	10	97960807	97960807	+	Silent	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr10:97960807T>A	ENST00000224337.5	-	14	1083	c.942A>T	c.(940-942)acA>acT	p.T314T	BLNK_ENST00000413476.2_Silent_p.T314T|BLNK_ENST00000371176.2_Silent_p.T291T|BLNK_ENST00000427367.2_Silent_p.T314T	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	314					B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.T314T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		TTCCCCCTTCTGTAAATCCTG	0.413																																							uc001kls.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(940-942)ACA>ACT		B-cell linker isoform 1							97.0	106.0	103.0					10																	97960807		2203	4300	6503	SO:0001819	synonymous_variant	29760				B cell differentiation|humoral immune response|inflammatory response|intracellular signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr10:97960807T>A	AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.942A>T	10.37:g.97960807T>A						BLNK_uc001kme.3_Silent_p.T209T|BLNK_uc001klt.3_Silent_p.T205T|BLNK_uc009xvc.2_RNA|BLNK_uc001klu.3_Silent_p.T232T|BLNK_uc001klv.3_Silent_p.T209T|BLNK_uc001klw.3_RNA|BLNK_uc001klx.3_Silent_p.T291T|BLNK_uc001kly.3_Silent_p.T314T|BLNK_uc001klz.3_RNA|BLNK_uc001kma.3_Silent_p.T291T|BLNK_uc001kmb.3_Silent_p.T110T|BLNK_uc001kmc.3_RNA|BLNK_uc001kmd.3_Silent_p.T232T|BLNK_uc009xvd.2_RNA	p.T314T	NM_013314	NP_037446	Q8WV28	BLNK_HUMAN		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)	14	1120	-		Colorectal(252;0.083)	314					O75498|O75499|Q2MD49	Silent	SNP	ENST00000224337.5	37	c.942A>T	CCDS7446.1																																																																																				0.413	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049593.1	NM_013314		35	90	0	0	0	0.019004	0	35	90				
STK32C	282974	broad.mit.edu	37	10	134040457	134040457	+	Silent	SNP	G	G	A	rs377335124		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr10:134040457G>A	ENST00000368622.1	-	4	516	c.135C>T	c.(133-135)gaC>gaT	p.D45D	STK32C_ENST00000368625.4_Silent_p.D175D					serine/threonine kinase 32C									p.D175D(1)|p.D162D(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(15)|ovary(2)|skin(1)	23		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		TGTCCTCCTCGTCCTGGAAGG	0.622																																							uc001lle.1		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(2)|lung(2)|breast(1)	5						c.(484-486)GAC>GAT		serine/threonine kinase 32C		G		1,4405	2.1+/-5.4	0,1,2202	164.0	102.0	123.0		486	-3.0	1.0	10		123	0,8600		0,0,4300	no	coding-synonymous	STK32C	NM_173575.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		162/487	134040457	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	282974						ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr10:134040457G>A	AK057849	CCDS7666.1	10q26.3	2004-07-22			ENSG00000165752	ENSG00000165752			21332	protein-coding gene	gene with protein product							Standard	NM_173575		Approved	PKE, MGC23665, YANK3	uc001lle.1	Q86UX6	OTTHUMG00000019285	ENST00000368622.1:c.135C>T	10.37:g.134040457G>A						STK32C_uc001lld.1_Silent_p.D45D|STK32C_uc010quu.1_Silent_p.D175D|STK32C_uc009ybc.1_Silent_p.D45D|STK32C_uc009ybd.1_Silent_p.D45D|STK32C_uc001llb.2_Translation_Start_Site|STK32C_uc001llc.1_RNA	p.D162D	NM_173575	NP_775846	Q86UX6	ST32C_HUMAN		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)	4	626	-		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)	162			Protein kinase.			Silent	SNP	ENST00000368622.1	37	c.486C>T		.	.	.	.	.	.	.	.	.	.	G	19.23	3.787872	0.70337	2.27E-4	0.0	ENSG00000165752	ENST00000368620	.	.	.	4.75	-3.0	0.05480	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8799	0.58012	0.7404:0.0:0.2596:0.0	.	.	.	.	X	233	.	ENSP00000357609:R233X	R	-	1	2	STK32C	133890447	0.035000	0.19736	0.995000	0.50966	0.984000	0.73092	-0.551000	0.06027	-0.321000	0.08627	0.460000	0.39030	CGA		0.622	STK32C-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000051068.2	NM_173575		5	34	0	0	0	0.014758	0	5	34				
IFITM3	10410	broad.mit.edu	37	11	319883	319883	+	Silent	SNP	A	A	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:319883A>T	ENST00000399808.4	-	2	593	c.357T>A	c.(355-357)atT>atA	p.I119I	IFITM3_ENST00000526811.1_Silent_p.I98I|RP11-326C3.11_ENST00000602756.1_RNA|RP11-326C3.11_ENST00000602429.1_RNA|IFITM3_ENST00000602735.1_Silent_p.I98I|RP11-326C3.11_ENST00000508004.2_RNA|RP11-326C3.14_ENST00000602809.1_lincRNA|RP11-326C3.10_ENST00000534271.1_RNA	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	119	Interaction with VAPA.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)		p.I119I(1)		central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		CGATGAGCAGAATGGTCATGA	0.582																																							uc001lpa.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(7)	7						c.(355-357)ATT>ATA		interferon-induced transmembrane protein 3							81.0	84.0	83.0					11																	319883		2040	4175	6215	SO:0001819	synonymous_variant	10410				response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane		g.chr11:319883A>T	X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.357T>A	11.37:g.319883A>T						uc001loz.2_Intron	p.I119I	NM_021034	NP_066362	Q01628	IFM3_HUMAN		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)	2	458	-		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)	119			Helical; (Potential).		Q53Y76|Q96HK8|Q96J15	Silent	SNP	ENST00000399808.4	37	c.357T>A	CCDS41585.1	.	.	.	.	.	.	.	.	.	.	A	8.463	0.855725	0.17106	.	.	ENSG00000142089	ENST00000270031	.	.	.	4.15	-7.66	0.01277	.	.	.	.	.	T	0.35537	0.0935	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	T	0.51553	-0.8691	5	0.87932	D	0	5.7822	6.8582	0.24052	0.6108:0.2231:0.1661:0.0	.	.	.	.	T	100	.	ENSP00000372047:S100T	S	-	1	0	IFITM3	309883	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.097000	0.11042	-1.550000	0.01708	0.529000	0.55759	TCT		0.582	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384765.1	NM_021034		7	58	0	0	0	0.00308	0	7	58				
CARS	833	broad.mit.edu	37	11	3059360	3059360	+	Missense_Mutation	SNP	C	C	T	rs12796489	byFrequency	TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:3059360C>T	ENST00000397111.5	-	6	717	c.472G>A	c.(472-474)Gca>Aca	p.A158T	CARS_ENST00000401769.3_Missense_Mutation_p.A171T|CARS-AS1_ENST00000499962.1_RNA|CARS_ENST00000397114.3_Missense_Mutation_p.A148T|CARS_ENST00000278224.9_Missense_Mutation_p.A158T|CARS_ENST00000380525.4_Missense_Mutation_p.A241T			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	158					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.A241T(1)|p.A158T(1)	CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	AGCTGCACTGCGTGCTGAATC	0.483			T	ALK	ALCL						OREG0020690	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Ovarian(61;932 1157 5961 20446 52152)	Ovarian(61;932 1157 5961 20446 52152)	uc001lxh.2		NA		Dom	yes		11	11p15.5	833	T	cysteinyl-tRNA synthetase			L	ALK		ALCL	CARS/ALK(5)	2	Substitution - Missense(2)		lung(2)	soft_tissue(5)|ovary(2)	7						c.(472-474)GCA>ACA		cysteinyl-tRNA synthetase isoform b	L-Cysteine(DB00151)						172.0	153.0	159.0					11																	3059360		2202	4298	6500	SO:0001583	missense	833				cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding	g.chr11:3059360C>T	AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.472G>A	11.37:g.3059360C>T	ENSP00000380300:p.Ala158Thr		OREG0020690	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	608	CARS_uc001lxe.2_Missense_Mutation_p.A148T|CARS_uc001lxf.2_Missense_Mutation_p.A241T|CARS_uc001lxg.2_Missense_Mutation_p.A158T|CARS_uc010qxo.1_Missense_Mutation_p.A241T|CARS_uc010qxp.1_Missense_Mutation_p.A171T|uc001lxi.1_Intron	p.A158T	NM_001751	NP_001742	P49589	SYCC_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	6	546	-		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)	158					Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Missense_Mutation	SNP	ENST00000397111.5	37	c.472G>A	CCDS7742.1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850260	0.32699	.	.	ENSG00000110619	ENST00000380525;ENST00000397111;ENST00000278224;ENST00000397114;ENST00000401769	T;T;T;T;T	0.44881	0.91;0.92;0.91;0.92;0.91	3.86	1.89	0.25635	.	0.256618	0.38272	N	0.001760	T	0.26991	0.0661	L	0.41710	1.295	0.09310	N	1	B;B;B;B;B;B	0.19200	0.004;0.034;0.014;0.012;0.014;0.015	B;B;B;B;B;B	0.18561	0.009;0.022;0.015;0.008;0.009;0.015	T	0.20505	-1.0273	10	0.13853	T	0.58	-9.3196	6.1909	0.20524	0.1906:0.7114:0.0:0.098	.	171;241;158;158;241;148	B4DKY1;B4DPV7;P49589;P49589-2;Q5HYE4;A8MVQ3	.;.;SYCC_HUMAN;.;.;.	T	241;158;158;148;171	ENSP00000369897:A241T;ENSP00000380300:A158T;ENSP00000278224:A158T;ENSP00000380303:A148T;ENSP00000384069:A171T	ENSP00000278224:A158T	A	-	1	0	CARS	3015936	0.002000	0.14202	0.000000	0.03702	0.046000	0.14306	0.171000	0.16685	0.264000	0.21851	0.561000	0.74099	GCA		0.483	CARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030117.4	NM_001751		23	83	0	0	0	0.014323	0	23	83				
OR51S1	119692	broad.mit.edu	37	11	4869601	4869601	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:4869601G>T	ENST00000322101.2	-	1	913	c.838C>A	c.(838-840)Cat>Aat	p.H280N	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H280N(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGAAGAGTATGGGTATGCTGA	0.443																																							uc010qyo.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(838-840)CAT>AAT		olfactory receptor, family 51, subfamily S,							135.0	121.0	126.0					11																	4869601		2201	4298	6499	SO:0001583	missense	119692				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4869601G>T	AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.838C>A	11.37:g.4869601G>T	ENSP00000322754:p.His280Asn						p.H280N	NM_001004758	NP_001004758	Q8NGJ8	O51S1_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	838	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	280			Extracellular (Potential).		B9EGZ1|Q6IFI2	Missense_Mutation	SNP	ENST00000322101.2	37	c.838C>A	CCDS31362.1	.	.	.	.	.	.	.	.	.	.	G	6.765	0.510087	0.12883	.	.	ENSG00000176922	ENST00000322101	T	0.37058	1.22	5.25	4.34	0.51931	GPCR, rhodopsin-like superfamily (1);	0.448009	0.18837	N	0.129794	T	0.43277	0.1240	M	0.73430	2.235	0.09310	N	0.999998	B	0.26577	0.153	B	0.32583	0.148	T	0.45249	-0.9274	10	0.66056	D	0.02	-0.2992	12.7212	0.57144	0.0797:0.0:0.9203:0.0	.	280	Q8NGJ8	O51S1_HUMAN	N	280	ENSP00000322754:H280N	ENSP00000322754:H280N	H	-	1	0	OR51S1	4826177	0.004000	0.15560	0.433000	0.26760	0.016000	0.09150	1.289000	0.33307	1.450000	0.47717	-0.140000	0.14226	CAT		0.443	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758		18	77	1	0	2.35188e-11	0.006122	3.1665e-11	18	77				
OR51A4	401666	broad.mit.edu	37	11	4967862	4967862	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:4967862G>C	ENST00000380373.2	-	1	494	c.469C>G	c.(469-471)Ctg>Gtg	p.L157V	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L157V(1)		large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGAAGAACCAGGAGCATGCTC	0.433																																							uc010qys.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(469-471)CTG>GTG		olfactory receptor, family 51, subfamily A,							178.0	174.0	175.0					11																	4967862		2191	4267	6458	SO:0001583	missense	401666				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4967862G>C	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.469C>G	11.37:g.4967862G>C	ENSP00000369731:p.Leu157Val						p.L157V	NM_001005329	NP_001005329	Q8NGJ6	O51A4_HUMAN		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	469	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	157			Helical; Name=4; (Potential).			Missense_Mutation	SNP	ENST00000380373.2	37	c.469C>G	CCDS31367.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.449840	0.26074	.	.	ENSG00000205497	ENST00000380373	T	0.72282	-0.64	3.44	-2.09	0.07232	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.65698	0.2716	L	0.43923	1.385	0.09310	N	1	P	0.44195	0.828	P	0.54924	0.764	T	0.56643	-0.7945	9	0.11485	T	0.65	.	5.037	0.14440	0.5717:0.1716:0.2567:0.0	.	157	Q8NGJ6	O51A4_HUMAN	V	157	ENSP00000369731:L157V	ENSP00000369731:L157V	L	-	1	2	OR51A4	4924438	0.000000	0.05858	0.000000	0.03702	0.646000	0.38490	-3.863000	0.00347	-0.294000	0.08973	0.479000	0.44913	CTG		0.433	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329		8	387	0	0	0	0.00499	0	8	387				
OR51A2	401667	broad.mit.edu	37	11	4976475	4976475	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:4976475G>C	ENST00000380371.1	-	1	468	c.469C>G	c.(469-471)Ctg>Gtg	p.L157V	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L157V(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGAAGAACCAGGAGCATGCTC	0.433																																							uc010qyt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(469-471)CTG>GTG		olfactory receptor, family 51, subfamily A,							117.0	101.0	107.0					11																	4976475		2069	3888	5957	SO:0001583	missense	401667				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4976475G>C	AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.469C>G	11.37:g.4976475G>C	ENSP00000369729:p.Leu157Val						p.L157V	NM_001004748	NP_001004748	Q8NGJ7	O51A2_HUMAN		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	469	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	157			Helical; Name=4; (Potential).			Missense_Mutation	SNP	ENST00000380371.1	37	c.469C>G	CCDS31368.1	.	.	.	.	.	.	.	.	.	.	-	5.523	0.281522	0.10458	.	.	ENSG00000205496	ENST00000380371	T	0.72282	-0.64	3.13	-6.1	0.02138	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.58133	0.2101	L	0.49350	1.555	0.09310	N	1	P	0.39551	0.678	B	0.43950	0.437	T	0.51172	-0.8739	9	0.11182	T	0.66	.	4.9586	0.14054	0.421:0.2949:0.2841:0.0	.	157	Q8NGJ7	O51A2_HUMAN	V	157	ENSP00000369729:L157V	ENSP00000369729:L157V	L	-	1	2	OR51A2	4933051	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.623000	0.00876	-1.349000	0.02202	-0.746000	0.03513	CTG		0.433	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142809.1	NM_001004748		39	51	0	0	0	0.021022	0	39	51				
CCKBR	887	broad.mit.edu	37	11	6291371	6291371	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:6291371T>A	ENST00000334619.2	+	3	650	c.457T>A	c.(457-459)Tac>Aac	p.Y153N	CCKBR_ENST00000532715.1_Missense_Mutation_p.Y69N|CCKBR_ENST00000525462.1_Missense_Mutation_p.Y153N|CCKBR_ENST00000525014.1_3'UTR	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	153					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)	p.Y153N(2)		NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	ACTGGAGCGGTACAGCGCCAT	0.597																																							uc001mcp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(5)|ovary(2)|breast(1)	8						c.(457-459)TAC>AAC		cholecystokinin B receptor	Pentagastrin(DB00183)						54.0	48.0	50.0					11																	6291371		2201	4296	6497	SO:0001583	missense	887				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cell proliferation|digestion|elevation of cytosolic calcium ion concentration|feeding behavior|positive regulation of cell proliferation|sensory perception		1-phosphatidylinositol-3-kinase regulator activity|gastrin receptor activity|phosphatidylinositol phospholipase C activity|type B gastrin/cholecystokinin receptor binding	g.chr11:6291371T>A	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.457T>A	11.37:g.6291371T>A	ENSP00000335544:p.Tyr153Asn					CCKBR_uc001mcq.2_Missense_Mutation_p.Y81N|CCKBR_uc001mcr.2_Missense_Mutation_p.Y153N|CCKBR_uc001mcs.2_Missense_Mutation_p.Y153N	p.Y153N	NM_176875	NP_795344	P32239	GASR_HUMAN		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	3	650	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	153			Cytoplasmic (Potential).		A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	c.457T>A	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.285770	0.80803	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	D;D;D	0.88354	-2.37;-2.37;-2.37	4.81	4.81	0.61882	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.96473	0.8849	H	0.98199	4.17	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.994;0.999;1.0	D	0.97625	1.0138	10	0.87932	D	0	.	13.3129	0.60390	0.0:0.0:0.0:1.0	.	153;87;153	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	N	153;69;153	ENSP00000335544:Y153N;ENSP00000432079:Y69N;ENSP00000435534:Y153N	ENSP00000335544:Y153N	Y	+	1	0	CCKBR	6247947	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.525000	0.81892	2.025000	0.59659	0.533000	0.62120	TAC		0.597	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875		9	40	0	0	0	0.006214	0	9	40				
OR2AG2	338755	broad.mit.edu	37	11	6789736	6789736	+	Silent	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:6789736C>A	ENST00000338569.2	-	1	550	c.453G>T	c.(451-453)ctG>ctT	p.L151L		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L151L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TCAGGGATGCCAGGATCCAGG	0.512																																							uc001meq.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(451-453)CTG>CTT		olfactory receptor, family 2, subfamily AG,							110.0	90.0	96.0					11																	6789736		2201	4296	6497	SO:0001819	synonymous_variant	338755				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6789736C>A	AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.453G>T	11.37:g.6789736C>A							p.L151L	NM_001004490	NP_001004490	A6NM03	O2AG2_HUMAN		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	453	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)	151			Helical; Name=4; (Potential).			Silent	SNP	ENST00000338569.2	37	c.453G>T	CCDS31413.1																																																																																				0.512	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490		14	50	1	0	1.05317e-09	0.020292	1.38696e-09	14	50				
SPON1	10418	broad.mit.edu	37	11	14287127	14287127	+	RNA	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:14287127G>A	ENST00000534587.1	-	0	38				SPON1_ENST00000310358.7_RNA														p.G772E(1)									TGCGGAGGTGGAATTCAGGAA	0.493																																							uc001mle.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2317-2319)GGA>GAA		spondin 1, extracellular matrix protein							72.0	73.0	72.0					11																	14287127		1976	4153	6129			10418				cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding	g.chr11:14287127G>A																													11.37:g.14287127G>A							p.G773E	NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN		Epithelial(150;0.00898)	17	2856	+			773			TSP type-1 6.			Missense_Mutation	SNP	ENST00000534587.1	37	c.2318G>A		.	.	.	.	.	.	.	.	.	.	G	17.96	3.515365	0.64634	.	.	ENSG00000152268	ENST00000310358	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.83041	0.5168	.	.	.	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.84862	0.0820	7	0.87932	D	0	.	17.3401	0.87293	0.0:0.0:1.0:0.0	.	773	Q9HCB6	SPON1_HUMAN	E	772	.	ENSP00000309297:G772E	G	+	2	0	SPON1	14243703	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.476000	0.97823	2.688000	0.91661	0.655000	0.94253	GGA		0.493	RP11-21L19.1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000386031.1			3	20	0	0	0	0.004672	0	3	20				
MRGPRX4	117196	broad.mit.edu	37	11	18195148	18195148	+	Silent	SNP	C	C	G	rs367562933		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:18195148C>G	ENST00000314254.3	+	1	765	c.345C>G	c.(343-345)gcC>gcG	p.A115A	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A115A(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						TGCTGAGCGCCATCAGCACCG	0.577																																							uc001mnv.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(343-345)GCC>GCG		MAS-related GPR, member X4							132.0	118.0	123.0					11																	18195148		2199	4293	6492	SO:0001819	synonymous_variant	117196					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:18195148C>G	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.345C>G	11.37:g.18195148C>G							p.A115A	NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN			1	765	+			115			Helical; Name=3; (Potential).		Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Silent	SNP	ENST00000314254.3	37	c.345C>G	CCDS7831.1																																																																																				0.577	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389788.1	NM_054032		19	121	0	0	0	0.007413	0	19	121				
SLC17A6	57084	broad.mit.edu	37	11	22380959	22380959	+	Splice_Site	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:22380959G>T	ENST00000263160.3	+	4	896	c.459G>T	c.(457-459)agG>agT	p.R153S	CTD-2140G10.4_ENST00000534543.1_RNA	NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	153					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.R153S(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TCTATTTCAGGGTTTTCGGAG	0.343																																							uc001mqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(457-459)AGG>AGT		solute carrier family 17 (sodium-dependent							106.0	97.0	100.0					11																	22380959		2203	4300	6503	SO:0001630	splice_region_variant	57084				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity	g.chr11:22380959G>T	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.459-1G>T	11.37:g.22380959G>T							p.R153S	NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN			4	872	+			153			Helical; (Potential).		A6NKS2	Missense_Mutation	SNP	ENST00000263160.3	37	c.459G>T	CCDS7856.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633327	0.67015	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.60299	0.2	5.29	2.03	0.26663	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.172658	0.64402	D	0.000008	T	0.55081	0.1898	L	0.49778	1.585	0.58432	D	0.999995	P	0.45011	0.848	P	0.48524	0.58	T	0.47761	-0.9092	9	.	.	.	.	9.2852	0.37753	0.3578:0.0:0.6422:0.0	.	153	Q9P2U8	VGLU2_HUMAN	S	153;41	ENSP00000263160:R153S	.	R	+	3	2	SLC17A6	22337535	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.057000	0.41365	0.192000	0.20272	0.585000	0.79938	AGG		0.343	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346	Missense_Mutation	9	47	1	0	5.4927e-09	0.004482	7.04118e-09	9	47				
F2	2147	broad.mit.edu	37	11	46750358	46750358	+	Silent	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:46750358G>T	ENST00000311907.5	+	11	1499	c.1443G>T	c.(1441-1443)gtG>gtT	p.V481V	F2_ENST00000530231.1_Intron	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	481	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)	p.V481V(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	TTCACCCTGTGTGTCTGCCCG	0.582																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)	Esophageal Squamous(147;1147 1808 2148 38609 51144)	uc001ndf.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(1441-1443)GTG>GTT		coagulation factor II preproprotein	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)						101.0	91.0	94.0					11																	46750358		2201	4299	6500	SO:0001819	synonymous_variant	2147				activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity	g.chr11:46750358G>T	M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.1443G>T	11.37:g.46750358G>T						F2_uc001ndg.3_RNA	p.V481V	NM_000506	NP_000497	P00734	THRB_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.146)	11	1486	+		all_lung(304;0.000414)|Lung NSC(402;0.0011)	481			Peptidase S1.		B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Silent	SNP	ENST00000311907.5	37	c.1443G>T	CCDS31476.1																																																																																				0.582	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317706.1			21	68	1	0	7.33628e-21	0.014323	1.09138e-20	21	68				
OR8H2	390151	broad.mit.edu	37	11	55873302	55873303	+	Missense_Mutation	DNP	CC	CC	AA	rs143759988	byFrequency	TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:55873302_55873303CC>AA	ENST00000313503.1	+	1	784_785	c.784_785CC>AA	c.(784-786)CCa>AAa	p.P262K		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P262Q(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					TTATTTAAAACCAAGAAAGTCT	0.361										HNSCC(53;0.14)																													uc010riy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(784-786)CCA>AAA		olfactory receptor, family 8, subfamily H,																																				SO:0001583	missense	390151				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55873302_55873303CC>AA	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	Exception_encountered	11.37:g.55873302_55873303delinsAA	ENSP00000323982:p.Pro262Lys	HNSCC(53;0.14)					p.P262K	NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN			1	784_785	+	Esophageal squamous(21;0.00693)		262			Extracellular (Potential).		Q6IFC1	Missense_Mutation	DNP	ENST00000313503.1	37	c.784_785CC>AA	CCDS31518.1																																																																																				0.361	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200		7	96	0	0	0	0.004672	0	7	96				
OR5J2	282775	broad.mit.edu	37	11	55944199	55944199	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:55944199G>T	ENST00000312298.1	+	1	106	c.106G>T	c.(106-108)Gcc>Tcc	p.A36S		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A36S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					GGTGATTTACGCCATTACCTT	0.393																																							uc010rjb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4						c.(106-108)GCC>TCC		olfactory receptor, family 5, subfamily J,							192.0	179.0	183.0					11																	55944199		2201	4296	6497	SO:0001583	missense	282775				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55944199G>T	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.106G>T	11.37:g.55944199G>T	ENSP00000310788:p.Ala36Ser						p.A36S	NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN			1	106	+	Esophageal squamous(21;0.00693)		36			Helical; Name=1; (Potential).		Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	37	c.106G>T	CCDS31522.1	.	.	.	.	.	.	.	.	.	.	G	2.849	-0.238768	0.05944	.	.	ENSG00000174957	ENST00000312298	T	0.01347	4.99	4.56	-1.08	0.09936	.	0.966612	0.08502	N	0.936359	T	0.00967	0.0032	N	0.16307	0.4	0.09310	N	1	B	0.20052	0.041	B	0.12837	0.008	T	0.49437	-0.8940	10	0.52906	T	0.07	.	0.6143	0.00767	0.2919:0.1103:0.2618:0.3359	.	36	Q8NH18	OR5J2_HUMAN	S	36	ENSP00000310788:A36S	ENSP00000310788:A36S	A	+	1	0	OR5J2	55700775	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-2.748000	0.00794	-0.111000	0.12001	-0.246000	0.11932	GCC		0.393	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492		26	131	1	0	3.01185e-09	0.021523	3.90245e-09	26	131				
OR5AR1	219493	broad.mit.edu	37	11	56431534	56431534	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:56431534G>T	ENST00000302969.2	+	1	397	c.373G>T	c.(373-375)Gcc>Tcc	p.A125S		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A125S(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						TCGTTTTGTGGCCATTTGTCG	0.512																																							uc010rjm.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(373-375)GCC>TCC		olfactory receptor, family 5, subfamily AR,							187.0	174.0	178.0					11																	56431534		2201	4296	6497	SO:0001583	missense	219493				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56431534G>T	AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.373G>T	11.37:g.56431534G>T	ENSP00000302639:p.Ala125Ser						p.A125S	NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN			1	373	+			125			Cytoplasmic (Potential).		Q6IF61	Missense_Mutation	SNP	ENST00000302969.2	37	c.373G>T	CCDS31535.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339731	0.60963	.	.	ENSG00000172459	ENST00000302969	T	0.01209	5.17	4.94	4.01	0.46588	GPCR, rhodopsin-like superfamily (1);	0.149552	0.31123	N	0.008219	T	0.10937	0.0267	H	0.97732	4.065	0.39894	D	0.973815	D	0.61697	0.99	P	0.60789	0.879	T	0.16778	-1.0391	10	0.87932	D	0	.	14.3807	0.66908	0.0:0.1488:0.8512:0.0	.	125	Q8NGP9	O5AR1_HUMAN	S	125	ENSP00000302639:A125S	ENSP00000302639:A125S	A	+	1	0	OR5AR1	56188110	1.000000	0.71417	1.000000	0.80357	0.439000	0.31926	5.084000	0.64462	1.273000	0.44346	0.573000	0.79308	GCC		0.512	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334434.1	NM_001004730		20	176	1	0	4.16121e-05	0.016522	4.8447e-05	20	176				
STX3	6809	broad.mit.edu	37	11	59559626	59559626	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:59559626A>G	ENST00000337979.4	+	6	951	c.404A>G	c.(403-405)aAt>aGt	p.N135S	STX3_ENST00000437946.2_Missense_Mutation_p.N38S|STX3_ENST00000535361.1_Missense_Mutation_p.N135S|STX3_ENST00000300150.7_Missense_Mutation_p.N104S|STX3_ENST00000529177.1_Missense_Mutation_p.N135S	NM_001178040.1|NM_004177.4	NP_001171511.1|NP_004168.1	Q13277	STX3_HUMAN	syntaxin 3	135					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|long-term synaptic potentiation (GO:0060291)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|neurotransmitter transport (GO:0006836)	apical plasma membrane (GO:0016324)|azurophil granule (GO:0042582)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|vacuole (GO:0005773)	arachidonic acid binding (GO:0050544)	p.N135S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|skin(1)	13						ACCAAATACAATGAAGCTCAA	0.493																																							uc001nog.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(403-405)AAT>AGT		syntaxin 3							128.0	108.0	115.0					11																	59559626		2201	4295	6496	SO:0001583	missense	6809				cellular response to oxidative stress|intracellular protein transport|neuron projection development|neurotransmitter transport	apical plasma membrane|azurophil granule|cell-cell junction|growth cone|integral to membrane|plasma membrane enriched fraction|SNARE complex|specific granule	arachidonic acid binding|SNAP receptor activity	g.chr11:59559626A>G	AJ002076	CCDS7975.1, CCDS53637.1	11q12.1	2008-02-05	2006-04-25	2006-04-25	ENSG00000166900	ENSG00000166900			11438	protein-coding gene	gene with protein product		600876	"""syntaxin 3A"""	STX3A		16598260, 16339081	Standard	NM_004177		Approved		uc001nog.3	Q13277	OTTHUMG00000167353	ENST00000337979.4:c.404A>G	11.37:g.59559626A>G	ENSP00000338562:p.Asn135Ser					STX3_uc010rkx.1_Missense_Mutation_p.N135S|STX3_uc010rky.1_Missense_Mutation_p.N38S|STX3_uc009ymt.1_Missense_Mutation_p.N38S	p.N135S	NM_004177	NP_004168	Q13277	STX3_HUMAN			6	594	+			135			Cytoplasmic (Potential).		B4DME0|O43750|O43751|Q15360	Missense_Mutation	SNP	ENST00000337979.4	37	c.404A>G	CCDS7975.1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.878096	0.91664	.	.	ENSG00000166900	ENST00000300150;ENST00000337979;ENST00000535361;ENST00000437946;ENST00000529177;ENST00000528805	T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91;1.91	5.3	5.3	0.74995	t-SNARE (1);Syntaxin, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.57227	0.2039	M	0.89030	3	0.80722	D	1	D;D;D;D	0.89917	0.994;1.0;1.0;1.0	P;D;D;D	0.91635	0.836;0.971;0.999;0.997	T	0.65772	-0.6087	10	0.66056	D	0.02	-29.5367	14.0769	0.64895	1.0:0.0:0.0:0.0	.	38;135;135;135	E7ET77;B4DME0;Q13277-2;Q13277	.;.;.;STX3_HUMAN	S	104;135;135;38;135;87	ENSP00000300150:N104S;ENSP00000338562:N135S;ENSP00000441649:N135S;ENSP00000393536:N38S;ENSP00000433248:N135S;ENSP00000431386:N87S	ENSP00000300150:N104S	N	+	2	0	STX3	59316202	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	8.905000	0.92613	2.004000	0.58718	0.528000	0.53228	AAT		0.493	STX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394264.1	NM_004177		8	27	0	0	0	0.006214	0	8	27				
AHNAK	79026	broad.mit.edu	37	11	62287869	62287869	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:62287869C>A	ENST00000378024.4	-	5	14294	c.14020G>T	c.(14020-14022)Gtg>Ttg	p.V4674L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4674					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.V4674L(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GGCAGGTTCACATCCACATCT	0.512																																							uc001ntl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(14020-14022)GTG>TTG		AHNAK nucleoprotein isoform 1							242.0	248.0	246.0					11																	62287869		2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62287869C>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.14020G>T	11.37:g.62287869C>A	ENSP00000367263:p.Val4674Leu					AHNAK_uc001ntk.1_Intron	p.V4674L	NM_001620	NP_001611	Q09666	AHNK_HUMAN			5	14320	-		Melanoma(852;0.155)	4674					A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.14020G>T	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	c	8.809	0.934732	0.18206	.	.	ENSG00000124942	ENST00000378024	T	0.01629	4.72	5.16	4.25	0.50352	.	0.075499	0.52532	D	0.000072	T	0.08179	0.0204	M	0.84082	2.675	0.38788	D	0.954918	D	0.53312	0.959	D	0.66196	0.942	T	0.41466	-0.9507	10	0.11485	T	0.65	-23.3441	10.8332	0.46673	0.0:0.7769:0.0:0.2231	.	4674	Q09666	AHNK_HUMAN	L	4674	ENSP00000367263:V4674L	ENSP00000367263:V4674L	V	-	1	0	AHNAK	62044445	0.031000	0.19500	0.997000	0.53966	0.005000	0.04900	-0.078000	0.11375	0.593000	0.29745	-0.945000	0.02674	GTG		0.512	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		78	380	1	0	7.14593e-30	0.01441	1.1256e-29	78	380				
KRTAP5-8	57830	broad.mit.edu	37	11	71249653	71249653	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:71249653G>T	ENST00000398534.3	+	1	583	c.552G>T	c.(550-552)caG>caT	p.Q184H		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	184						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)	p.Q184H(1)		cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						TTTGCTGCCAGTGCAAGATCT	0.562																																							uc001oqr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(550-552)CAG>CAT		keratin associated protein 5-8							129.0	136.0	133.0					11																	71249653		2200	4294	6494	SO:0001583	missense	57830					extracellular region|keratin filament	structural constituent of epidermis	g.chr11:71249653G>T	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.552G>T	11.37:g.71249653G>T	ENSP00000420723:p.Gln184His						p.Q184H	NM_021046	NP_066384	O75690	KRA58_HUMAN			1	583	+			184					Q6L8G7|Q6UTX6	Missense_Mutation	SNP	ENST00000398534.3	37	c.552G>T	CCDS41683.1	.	.	.	.	.	.	.	.	.	.	-	15.43	2.831156	0.50845	.	.	ENSG00000241233	ENST00000398534	T	0.01414	4.92	1.77	1.77	0.24775	.	.	.	.	.	T	0.08935	0.0221	M	0.88906	2.99	0.25658	N	0.986031	D	0.62365	0.991	D	0.79784	0.993	T	0.03103	-1.1072	9	0.62326	D	0.03	.	9.5067	0.39051	0.0:0.0:1.0:0.0	.	184	O75690	KRA58_HUMAN	H	184	ENSP00000420723:Q184H	ENSP00000420723:Q184H	Q	+	3	2	KRTAP5-8	70927301	0.994000	0.37717	0.998000	0.56505	0.642000	0.38348	4.560000	0.60802	1.296000	0.44742	0.655000	0.94253	CAG		0.562	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127954.1	NM_021046		37	142	1	0	1.42033e-22	0.019004	2.13938e-22	37	142				
FZD4	8322	broad.mit.edu	37	11	86662265	86662265	+	Silent	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:86662265C>T	ENST00000531380.1	-	2	1838	c.1533G>A	c.(1531-1533)ttG>ttA	p.L511L	PRSS23_ENST00000533902.2_Nonsense_Mutation_p.Q72*|PRSS23_ENST00000531521.1_3'UTR	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	511					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.L511L(1)		breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CAGAATTCACCAATCTGTTGG	0.453																																							uc001pce.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(1531-1533)TTG>TTA		frizzled 4 precursor							121.0	124.0	123.0					11																	86662265		2201	4299	6500	SO:0001819	synonymous_variant	8322				canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|negative regulation of cell-substrate adhesion|neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|progesterone secretion|regulation of vascular endothelial growth factor receptor signaling pathway|substrate adhesion-dependent cell spreading|vasculogenesis|Wnt receptor signaling pathway, calcium modulating pathway	cell projection|cell surface|cytoplasm	cytokine binding|G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding	g.chr11:86662265C>T	AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.1533G>A	11.37:g.86662265C>T						PRSS23_uc001pcc.1_RNA	p.L511L	NM_012193	NP_036325	Q9ULV1	FZD4_HUMAN			2	1839	-		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	511			Cytoplasmic (Potential).		A8K9Q3|Q14C97|Q6S9E4	Silent	SNP	ENST00000531380.1	37	c.1533G>A	CCDS8279.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580984	0.65992	.	.	ENSG00000150687	ENST00000533902	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2608	0.82541	0.0:0.8683:0.1316:0.0	.	.	.	.	X	72	.	.	Q	+	1	0	PRSS23	86339913	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.503000	0.45407	2.941000	0.99782	0.655000	0.94253	CAA		0.453	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393818.2	NM_012193		13	85	0	0	0	0.013537	0	13	85				
CASP1	834	broad.mit.edu	37	11	104901057	104901057	+	Splice_Site	SNP	C	C	A	rs199667142		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr11:104901057C>A	ENST00000533400.1	-	5	662	c.627G>T	c.(625-627)tcG>tcT	p.S209S	CASP1_ENST00000353247.5_Intron|CASP1_ENST00000525825.1_Splice_Site_p.S188S|CASP1_ENST00000531166.1_Intron|CASP1_ENST00000446369.1_Splice_Site_p.S116S|CASP1_ENST00000528974.1_Splice_Site_p.S170S|CASP1_ENST00000436863.3_Splice_Site_p.S209S|CASP1_ENST00000527979.1_Splice_Site_p.S172S|CASP1_ENST00000594519.1_Splice_Site_p.S116S|CASP1_ENST00000598974.1_Splice_Site_p.S209S|CASP1_ENST00000526568.1_Splice_Site_p.S116S|CASP1_ENST00000415981.2_Intron|CASP1_ENST00000393136.4_Splice_Site_p.S188S|CASP1_ENST00000534497.1_Splice_Site_p.S116S|CASP1_ENST00000593315.1_Splice_Site_p.S188S	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	209					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)	p.S209S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	TAGAACTTACCGAAGCAGTGA	0.378																																					NSCLC(41;1246 1743 4934)	NSCLC(41;1246 1743 4934)	uc010rve.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(625-627)TCG>TCT		caspase 1 isoform alpha precursor	Minocycline(DB01017)|Penicillamine(DB00859)						98.0	98.0	98.0					11																	104901057		2202	4299	6501	SO:0001630	splice_region_variant	834				cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding	g.chr11:104901057C>A	U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.627+1G>T	11.37:g.104901057C>A						CASP1_uc001pig.2_Silent_p.S116S|CASP1_uc001pik.2_Silent_p.S172S|CASP1_uc010rvf.1_Silent_p.S116S|CASP1_uc010rvg.1_Silent_p.S188S|CASP1_uc010rvh.1_Silent_p.S116S|CASP1_uc010rvi.1_Intron|CASP1_uc001pim.3_Silent_p.S209S|CASP1_uc009yxi.2_Silent_p.S188S|CASP1_uc010rvj.1_Silent_p.S209S|CASP1_uc009yxj.2_Silent_p.S54S|CASP1_uc010rvk.1_Silent_p.S170S	p.S209S	NM_033292	NP_150634	P29466	CASP1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	5	644	-		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)	209					B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Silent	SNP	ENST00000533400.1	37	c.627G>T	CCDS8330.1																																																																																				0.378	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388116.1	NM_033292	Silent	17	78	1	0	3.45872e-05	0.004007	4.08603e-05	17	78				
Unknown	0	broad.mit.edu	37	12	9451455	9451455	+	IGR	SNP	G	G	A	rs201631239	byFrequency	TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr12:9451455G>A								SNORA75 (12037 upstream) : RP13-735L24.1 (68604 downstream)																							ATGCAGAGAAGCAGGCACGGT	0.527																																							uc010sgq.1		NA																	0					0						c.(793-795)AGC>AAC		SubName: Full=cDNA FLJ60032, highly similar to Probable ATP-dependent RNA helicase DDX11 (EC 3.6.1.-);																																				SO:0001628	intergenic_variant	642846							g.chr12:9451455G>A																													12.37:g.9451455G>A						LOC642846_uc010sgp.1_RNA|LOC642846_uc009zgn.1_Missense_Mutation_p.S115N|LOC642846_uc001qvo.2_Missense_Mutation_p.S115N|LOC642846_uc001qvp.2_5'Flank	p.S265N							8	885	+									Missense_Mutation	SNP		37	c.794G>A																																																																																				0	0.527									11	50	0	0	0	0.004007	0	11	50				
DUSP16	80824	broad.mit.edu	37	12	12630062	12630062	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr12:12630062G>A	ENST00000228862.2	-	7	2334	c.1703C>T	c.(1702-1704)tCt>tTt	p.S568F	DUSP16_ENST00000298573.4_3'UTR|DUSP16_ENST00000545864.1_5'Flank	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	568					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.S568F(1)		endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		GGCTGAGGCAGAGTAGAAGTG	0.592																																					Ovarian(158;443 1896 15437 36069 46477)	Ovarian(158;443 1896 15437 36069 46477)	uc001rao.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1702-1704)TCT>TTT		dual specificity phosphatase 16							93.0	100.0	98.0					12																	12630062		2203	4300	6503	SO:0001583	missense	80824				inactivation of MAPK activity|MAPK export from nucleus|MAPK phosphatase export from nucleus, leptomycin B sensitive	cytoplasmic membrane-bounded vesicle|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chr12:12630062G>A	AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.1703C>T	12.37:g.12630062G>A	ENSP00000228862:p.Ser568Phe					DUSP16_uc001ram.1_5'Flank|DUSP16_uc001ran.1_Missense_Mutation_p.S420F	p.S568F	NM_030640	NP_085143	Q9BY84	DUS16_HUMAN		BRCA - Breast invasive adenocarcinoma(232;0.0203)	7	2335	-		Prostate(47;0.0687)	568					Q547C7|Q96QS2|Q9C0G3	Missense_Mutation	SNP	ENST00000228862.2	37	c.1703C>T	CCDS8650.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101740	0.37048	.	.	ENSG00000111266	ENST00000228862	T	0.02067	4.47	4.88	3.95	0.45737	.	0.089746	0.43579	D	0.000546	T	0.08758	0.0217	L	0.55481	1.735	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.65573	0.936;0.936	T	0.06162	-1.0842	10	0.59425	D	0.04	.	14.6368	0.68696	0.0:0.0:0.8533:0.1467	.	568;568	Q9BY84;Q96N49	DUS16_HUMAN;.	F	568	ENSP00000228862:S568F	ENSP00000228862:S568F	S	-	2	0	DUSP16	12521329	1.000000	0.71417	0.648000	0.29521	0.193000	0.23685	6.747000	0.74872	1.346000	0.45694	0.655000	0.94253	TCT		0.592	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400311.1	NM_030640		36	162	0	0	0	0.019004	0	36	162				
CDKN1B	1027	broad.mit.edu	37	12	12870966	12870966	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr12:12870966C>T	ENST00000228872.4	+	1	909	c.193C>T	c.(193-195)Cag>Tag	p.Q65*	CDKN1B_ENST00000396340.1_Nonsense_Mutation_p.Q65*|CDKN1B_ENST00000477087.1_Intron	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	65					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)	p.Q65*(1)		breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		TTTCGATTTTCAGAATCACAA	0.582																																							uc001rat.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|lung(1)	2						c.(193-195)CAG>TAG		cyclin-dependent kinase inhibitor 1B							82.0	94.0	90.0					12																	12870966		2203	4300	6503	SO:0001587	stop_gained	1027	Multiple_Endocrine_Neoplasia_type_1|Multiple_Endocrine_Neoplasia_type_4			autophagic cell death|cell cycle arrest|cellular response to lithium ion|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of transcription, DNA-dependent|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process|S phase of mitotic cell cycle	cytosol|endosome|nucleoplasm	cyclin-dependent protein kinase inhibitor activity|protein phosphatase binding|transforming growth factor beta receptor, cytoplasmic mediator activity	g.chr12:12870966C>T	AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.193C>T	12.37:g.12870966C>T	ENSP00000228872:p.Gln65*						p.Q65*	NM_004064	NP_004055	P46527	CDN1B_HUMAN		BRCA - Breast invasive adenocarcinoma(232;0.0336)	1	665	+		Prostate(47;0.0322)|all_epithelial(100;0.159)	65					Q16307|Q5U0H2|Q9BUS6	Nonsense_Mutation	SNP	ENST00000228872.4	37	c.193C>T	CCDS8653.1	.	.	.	.	.	.	.	.	.	.	C	43	9.970683	0.99308	.	.	ENSG00000111276	ENST00000228872;ENST00000535674;ENST00000396340;ENST00000442489	.	.	.	5.29	3.42	0.39159	.	0.531595	0.19775	N	0.106358	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-16.2236	9.8123	0.40831	0.2837:0.5794:0.1369:0.0	.	.	.	.	X	65;14;65;58	.	ENSP00000228872:Q65X	Q	+	1	0	CDKN1B	12762233	0.969000	0.33509	0.987000	0.45799	0.777000	0.43975	1.028000	0.30128	0.583000	0.29574	0.650000	0.86243	CAG		0.582	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313878.2	NM_004064		57	85	0	0	0	0.01441	0	57	85				
SOX5	6660	broad.mit.edu	37	12	23687401	23687401	+	Missense_Mutation	SNP	C	C	T	rs528695217	byFrequency	TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr12:23687401C>T	ENST00000451604.2	-	15	2145	c.2044G>A	c.(2044-2046)Gcc>Acc	p.A682T	SOX5_ENST00000309359.1_Missense_Mutation_p.A669T|SOX5_ENST00000546136.1_Missense_Mutation_p.A669T|SOX5_ENST00000545921.1_Missense_Mutation_p.A672T|SOX5_ENST00000541536.1_Missense_Mutation_p.A561T|SOX5_ENST00000381381.2_Missense_Mutation_p.A561T|SOX5_ENST00000537393.1_Missense_Mutation_p.A647T|SOX5_ENST00000396007.2_Missense_Mutation_p.A296T			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	682					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A682T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						CCAGCCATGGCGATGGCTCCA	0.552													C|||	2	0.000399361	0.0	0.0	5008	,	,		18163	0.0		0.0	False		,,,				2504	0.002						uc001rfw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|lung(1)	6						c.(2044-2046)GCC>ACC		SRY (sex determining region Y)-box 5 isoform a							67.0	59.0	61.0					12																	23687401		2203	4300	6503	SO:0001583	missense	6660				transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr12:23687401C>T	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.2044G>A	12.37:g.23687401C>T	ENSP00000398273:p.Ala682Thr					SOX5_uc001rfx.2_Missense_Mutation_p.A669T|SOX5_uc001rfy.2_Missense_Mutation_p.A561T|SOX5_uc001rfv.2_Missense_Mutation_p.A296T|SOX5_uc010siv.1_Missense_Mutation_p.A669T	p.A682T	NM_006940	NP_008871	P35711	SOX5_HUMAN			15	2146	-			682					B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	c.2044G>A	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	C	5.414	0.261525	0.10239	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000537393;ENST00000541536;ENST00000396007;ENST00000545921	T;T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57	5.66	2.7	0.31948	.	0.258863	0.46145	N	0.000304	T	0.25865	0.0630	N	0.10809	0.05	0.35845	D	0.826303	B;B;B	0.24483	0.002;0.014;0.104	B;B;B	0.15870	0.002;0.008;0.014	T	0.31779	-0.9931	10	0.02654	T	1	.	10.691	0.45870	0.0:0.7802:0.0:0.2198	.	561;682;296	P35711-4;P35711;P35711-3	.;SOX5_HUMAN;.	T	669;669;561;682;647;561;296;672	ENSP00000437487:A669T;ENSP00000308927:A669T;ENSP00000370788:A561T;ENSP00000398273:A682T;ENSP00000439832:A647T;ENSP00000441973:A561T;ENSP00000379328:A296T;ENSP00000443520:A672T	ENSP00000308927:A669T	A	-	1	0	SOX5	23578668	0.989000	0.36119	0.995000	0.50966	0.962000	0.63368	2.076000	0.41548	0.351000	0.24027	-0.150000	0.13652	GCC		0.552	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940		9	69	0	0	0	0.004482	0	9	69				
OVOS2	144203	broad.mit.edu	37	12	31301005	31301005	+	IGR	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr12:31301005G>A								RP11-551L14.1 (30600 upstream) : FAM60A (132512 downstream)														p.Q419*(1)									TCCAAGTACTGAGGCGTCAAC	0.458																																							uc010sjy.1		NA																	1	Substitution - Nonsense(1)		lung(1)		NA						c.(1255-1257)CAG>TAG		RecName: Full=Ovostatin homolog 1; Flags: Precursor;							141.0	143.0	142.0					12																	31301005		1960	4168	6128	SO:0001628	intergenic_variant	0							g.chr12:31301005G>A																													12.37:g.31301005G>A							p.Q419*							11	1255	-									Nonsense_Mutation	SNP		37	c.1255C>T																																																																																				0	0.458									10	404	0	0	0	0.006214	0	10	404				
RDH16	8608	broad.mit.edu	37	12	57346753	57346753	+	Silent	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr12:57346753C>A	ENST00000398138.3	-	3	1450	c.594G>T	c.(592-594)ggG>ggT	p.G198G	RDH16_ENST00000360752.4_5'UTR	NM_003708.3	NP_003699.3	O75452	RDH16_HUMAN	retinol dehydrogenase 16 (all-trans)	198					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	electron carrier activity (GO:0009055)|retinol dehydrogenase activity (GO:0004745)	p.G198G(2)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)	16						CCACCTTCACCCCAAAGTAGG	0.458																																					GBM(179;741 2921 43105 45298)	GBM(179;741 2921 43105 45298)	uc001smi.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(592-594)GGG>GGT		retinol dehydrogenase 16							108.0	104.0	105.0					12																	57346753		1848	4103	5951	SO:0001819	synonymous_variant	8608				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	binding|electron carrier activity|retinol dehydrogenase activity	g.chr12:57346753C>A		CCDS41797.1	12q13.3	2011-09-14	2006-05-09			ENSG00000139547		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29674	protein-coding gene	gene with protein product	"""microsomal NAD+ dependent retinol dehydrogenase 4"", ""short chain dehydrogenase/reductase family 9C, member 8"""		"""retinol dehydrogenase 16 (all-trans and 13-cis)"""			9677409, 10329026, 19027726	Standard	NM_003708		Approved	RODH-4, SDR9C8	uc001smi.4	O75452		ENST00000398138.3:c.594G>T	12.37:g.57346753C>A						RDH16_uc009zpa.2_Silent_p.G53G	p.G198G	NM_003708	NP_003699	O75452	RDH16_HUMAN			3	766	-			198			Cytoplasmic (Potential).		Q9UNV2	Silent	SNP	ENST00000398138.3	37	c.594G>T	CCDS41797.1																																																																																				0.458	RDH16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410898.1	NM_003708		73	106	1	0	3.82274e-22	0.01441	5.72224e-22	73	106				
CPSF6	11052	broad.mit.edu	37	12	69652445	69652445	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr12:69652445A>G	ENST00000435070.2	+	6	880	c.770A>G	c.(769-771)cAg>cGg	p.Q257R	CPSF6_ENST00000456847.3_Intron|CPSF6_ENST00000266679.8_Missense_Mutation_p.Q294R|CPSF6_ENST00000551516.1_Intron	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	257	Pro-rich.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q257R(2)		endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			CCTCCTGGTCAGGTTCTGCCT	0.567																																							uc001sut.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(769-771)CAG>CGG		cleavage and polyadenylation specific factor 6,							100.0	87.0	91.0					12																	69652445		2203	4300	6503	SO:0001583	missense	11052				mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding	g.chr12:69652445A>G	X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.770A>G	12.37:g.69652445A>G	ENSP00000391774:p.Gln257Arg					CPSF6_uc001suu.3_Missense_Mutation_p.Q294R|CPSF6_uc010stk.1_5'UTR	p.Q257R	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)		6	880	+	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		257			Pro-rich.		A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	ENST00000435070.2	37	c.770A>G	CCDS8988.1	.	.	.	.	.	.	.	.	.	.	A	8.841	0.942221	0.18281	.	.	ENSG00000111605	ENST00000435070;ENST00000266679	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.72431	0.3459	L	0.51422	1.61	0.80722	D	1	P;P	0.48294	0.908;0.851	P;P	0.61397	0.888;0.775	T	0.70633	-0.4818	8	.	.	.	-4.9392	15.9862	0.80155	1.0:0.0:0.0:0.0	.	294;257	Q16630-2;Q16630	.;CPSF6_HUMAN	R	257;294	.	.	Q	+	2	0	CPSF6	67938712	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.660000	0.74417	2.237000	0.73441	0.460000	0.39030	CAG		0.567	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403609.1	NM_007007		59	64	0	0	0	0.01441	0	59	64				
MYBPC1	4604	broad.mit.edu	37	12	102036302	102036302	+	Silent	SNP	C	C	G	rs374351300		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr12:102036302C>G	ENST00000550270.1	+	9	696	c.696C>G	c.(694-696)acC>acG	p.T232T	MYBPC1_ENST00000392934.3_Silent_p.T219T|MYBPC1_ENST00000547405.1_Silent_p.T206T|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000441232.1_Silent_p.T232T|MYBPC1_ENST00000536007.1_Silent_p.T213T|MYBPC1_ENST00000551300.1_Silent_p.T133T|MYBPC1_ENST00000553190.1_Silent_p.T232T|MYBPC1_ENST00000361685.2_Silent_p.T257T|MYBPC1_ENST00000547509.1_Silent_p.T218T|MYBPC1_ENST00000360610.2_Silent_p.T232T|MYBPC1_ENST00000541119.1_Silent_p.T220T|MYBPC1_ENST00000452455.2_Silent_p.T232T|MYBPC1_ENST00000545503.2_Silent_p.T232T|MYBPC1_ENST00000361466.2_Silent_p.T257T|MYBPC1_ENST00000549145.1_Silent_p.T245T			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	232				GITDLR -> ESPTCS (in Ref. 1; CAA46987). {ECO:0000305}.	cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.T232T(1)|p.T257T(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						ATGGAATCACCGACCTGCGCG	0.617																																							uc001tii.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|liver(1)|skin(1)	4						c.(694-696)ACC>ACG		myosin binding protein C, slow type isoform 3							93.0	75.0	81.0					12																	102036302		2203	4300	6503	SO:0001819	synonymous_variant	4604				cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding	g.chr12:102036302C>G		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.696C>G	12.37:g.102036302C>G						MYBPC1_uc001tif.1_Silent_p.T245T|MYBPC1_uc001tig.2_Silent_p.T257T|MYBPC1_uc010svq.1_Silent_p.T219T|MYBPC1_uc001tih.2_Silent_p.T257T|MYBPC1_uc001tij.2_Silent_p.T232T|MYBPC1_uc010svr.1_Silent_p.T232T|MYBPC1_uc010svs.1_Silent_p.T232T|MYBPC1_uc010svt.1_Silent_p.T220T|MYBPC1_uc010svu.1_Silent_p.T213T|MYBPC1_uc001tik.2_Silent_p.T206T	p.T232T	NM_206820	NP_996556	Q00872	MYPC1_HUMAN			9	798	+			232	GITDLR -> ESPTCS (in Ref. 1; CAA46987).				B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Silent	SNP	ENST00000550270.1	37	c.696C>G	CCDS9085.1																																																																																				0.617	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1			9	62	0	0	0	0.004482	0	9	62				
ATXN2	6311	broad.mit.edu	37	12	111951340	111951340	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr12:111951340G>A	ENST00000377617.3	-	11	2020	c.1859C>T	c.(1858-1860)cCt>cTt	p.P620L	ATXN2_ENST00000608853.1_Missense_Mutation_p.P460L|ATXN2_ENST00000535949.1_Missense_Mutation_p.P331L|ATXN2_ENST00000550104.1_Missense_Mutation_p.P620L|ATXN2_ENST00000389153.4_Missense_Mutation_p.P355L|ATXN2_ENST00000542287.2_Missense_Mutation_p.P355L	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	620	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.P620L(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						CATCCTTGGAGGCCCTAAGGA	0.458																																							uc001tsj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1858-1860)CCT>CTT		ataxin 2							47.0	43.0	44.0					12																	111951340		2203	4300	6503	SO:0001583	missense	6311				cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding	g.chr12:111951340G>A	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.1859C>T	12.37:g.111951340G>A	ENSP00000366843:p.Pro620Leu					ATXN2_uc001tsh.2_Missense_Mutation_p.P355L|ATXN2_uc001tsi.2_Missense_Mutation_p.P331L|ATXN2_uc001tsk.2_RNA|ATXN2_uc001tsm.1_Missense_Mutation_p.P355L	p.P620L	NM_002973	NP_002964	Q99700	ATX2_HUMAN			11	2021	-			620			Pro-rich.		A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	ENST00000377617.3	37	c.1859C>T	CCDS31902.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.9|27.9	4.877397|4.877397	0.91664|0.91664	.|.	.|.	ENSG00000204842|ENSG00000204842	ENST00000481331|ENST00000389153;ENST00000377617;ENST00000550104;ENST00000542287;ENST00000535949;ENST00000492467;ENST00000550236	.|T;T	.|0.67171	.|-0.16;-0.25	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.74550|0.74550	0.3731|0.3731	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.997;0.997;0.996;0.999	T|T	0.77178|0.77178	-0.2683|-0.2683	6|10	0.87932|0.66056	D|D	0|0.02	-10.1938|-10.1938	19.4538|19.4538	0.94878|0.94878	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|355;620;331;355	.|B3KT59;Q99700;Q24JQ7;F8VQP2	.|.;ATX2_HUMAN;.;.	F|L	4|355;620;620;355;331;10;35	.|ENSP00000366843:P620L;ENSP00000446576:P620L	ENSP00000449850:L4F|ENSP00000366843:P620L	L|P	-|-	1|2	0|0	ATXN2|ATXN2	110435723|110435723	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.959000|0.959000	0.62525|0.62525	9.476000|9.476000	0.97823|0.97823	2.604000|2.604000	0.88044|0.88044	0.650000|0.650000	0.86243|0.86243	CTC|CCT		0.458	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973		9	38	0	0	0	0.008291	0	9	38				
POTEG	404785	broad.mit.edu	37	14	19553775	19553775	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr14:19553775G>T	ENST00000409832.3	+	1	411	c.359G>T	c.(358-360)tGg>tTg	p.W120L		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	120								p.W120L(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						GTGGGCCCTTGGGGAGACTAC	0.602																																							uc001vuz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(358-360)TGG>TTG		POTE ankyrin domain family, member G							381.0	415.0	404.0					14																	19553775		2201	4298	6499	SO:0001583	missense	404785							g.chr14:19553775G>T		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.359G>T	14.37:g.19553775G>T	ENSP00000386971:p.Trp120Leu					POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	p.W120L	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN			1	411	+			120					A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	c.359G>T	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	g	10.68	1.419259	0.25552	.	.	ENSG00000222036	ENST00000409832	T	0.25579	1.79	0.823	-0.389	0.12455	.	.	.	.	.	T	0.29389	0.0732	L	0.50333	1.59	0.09310	N	1	P	0.51449	0.945	P	0.55923	0.787	T	0.18147	-1.0346	9	0.23302	T	0.38	.	3.6659	0.08255	0.0:0.0:0.5674:0.4326	.	120	Q6S5H5	POTEG_HUMAN	L	120	ENSP00000386971:W120L	ENSP00000386971:W120L	W	+	2	0	POTEG	18623775	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.153000	0.10144	-0.162000	0.10964	0.416000	0.27883	TGG		0.602	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356		8	523	1	0	0.00307968	0.00308	0.00337365	8	523				
OR4Q3	441669	broad.mit.edu	37	14	20215981	20215981	+	Missense_Mutation	SNP	G	G	T	rs374635898		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr14:20215981G>T	ENST00000331723.1	+	1	395	c.395G>T	c.(394-396)cGc>cTc	p.R132L		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R132H(1)|p.R132L(1)		NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AACCCTTTGCGCTACCTTACA	0.493																																							uc010tkt.1		NA																	2	Substitution - Missense(2)		lung(1)|pancreas(1)	breast(3)	3						c.(394-396)CGC>CTC		olfactory receptor, family 4, subfamily Q,							122.0	123.0	123.0					14																	20215981		2203	4300	6503	SO:0001583	missense	441669				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20215981G>T	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.395G>T	14.37:g.20215981G>T	ENSP00000330049:p.Arg132Leu						p.R132L	NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	395	+	all_cancers(95;0.00108)		132			Cytoplasmic (Potential).		Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	c.395G>T	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	6.579	0.475163	0.12521	.	.	ENSG00000182652	ENST00000331723	T	0.01005	5.45	4.36	3.21	0.36854	GPCR, rhodopsin-like superfamily (1);	0.346500	0.20339	U	0.094276	T	0.01061	0.0035	L	0.38953	1.18	0.24468	N	0.994406	B	0.06786	0.001	B	0.09377	0.004	T	0.45220	-0.9276	10	0.72032	D	0.01	.	7.6684	0.28445	0.8952:0.0:0.1048:0.0	.	132	Q8NH05	OR4Q3_HUMAN	L	132	ENSP00000330049:R132L	ENSP00000330049:R132L	R	+	2	0	OR4Q3	19285821	0.000000	0.05858	0.998000	0.56505	0.036000	0.12997	0.024000	0.13555	0.720000	0.32209	-0.487000	0.04747	CGC		0.493	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2			8	108	1	0	0.00621372	0.006214	0.00668529	8	108				
CHD8	57680	broad.mit.edu	37	14	21876961	21876961	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr14:21876961C>T	ENST00000557364.1	-	12	2651	c.2388G>A	c.(2386-2388)tgG>tgA	p.W796*	CHD8_ENST00000430710.3_Nonsense_Mutation_p.W517*|CHD8_ENST00000555962.1_Intron|CHD8_ENST00000399982.2_Nonsense_Mutation_p.W796*			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	796					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)	p.W796*(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CCAATTTCTTCCAGGCACTTG	0.378																																							uc001was.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10						c.(1549-1551)TGG>TGA		chromodomain helicase DNA binding protein 8							79.0	67.0	71.0					14																	21876961		1809	4082	5891	SO:0001587	stop_gained	57680				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding	g.chr14:21876961C>T	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.2388G>A	14.37:g.21876961C>T	ENSP00000451601:p.Trp796*					CHD8_uc001war.1_Nonsense_Mutation_p.W413*|CHD8_uc001wav.1_5'UTR	p.W517*	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)	12	1645	-	all_cancers(95;0.00121)		796					Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Nonsense_Mutation	SNP	ENST00000557364.1	37	c.1551G>A	CCDS53885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.5|22.5	4.295077|4.295077	0.81025|0.81025	.|.	.|.	ENSG00000100888|ENSG00000100888	ENST00000555935|ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	.|.	.|.	.|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.46386|.	0.1390|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35450|.	-0.9788|.	3|.	.|0.02654	.|T	.|1	-11.835|-11.835	18.2333|18.2333	0.89941|0.89941	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	K|X	22|517;796;516;796	.|.	.|ENSP00000262707:W516X	E|W	-|-	1|3	0|0	CHD8|CHD8	20946801|20946801	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.651000|7.651000	0.83577|0.83577	2.835000|2.835000	0.97688|0.97688	0.650000|0.650000	0.86243|0.86243	GAA|TGG		0.378	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920		3	13	0	0	0	0.004672	0	3	13				
FSCB	84075	broad.mit.edu	37	14	44975251	44975251	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr14:44975251C>A	ENST00000340446.4	-	1	1231	c.940G>T	c.(940-942)Gtt>Ttt	p.V314F	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000556228.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	314						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)	p.V314F(1)		breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		TGAACTTTAACAGAATTCTCC	0.522																																							uc001wvn.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9						c.(940-942)GTT>TTT		fibrous sheath CABYR binding protein							50.0	53.0	52.0					14																	44975251		2203	4300	6503	SO:0001583	missense	84075					cilium		g.chr14:44975251C>A	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.940G>T	14.37:g.44975251C>A	ENSP00000344579:p.Val314Phe						p.V314F	NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN		GBM - Glioblastoma multiforme(112;0.128)	1	1249	-			314					Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	37	c.940G>T	CCDS9679.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.029803	0.35797	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.27104	1.69	2.69	-2.92	0.05615	.	.	.	.	.	T	0.25158	0.0611	L	0.55990	1.75	0.09310	N	1	P	0.49090	0.919	P	0.48454	0.578	T	0.12837	-1.0532	9	0.66056	D	0.02	1.4557	2.8872	0.05664	0.1648:0.4026:0.3229:0.1096	.	314	Q5H9T9	FSCB_HUMAN	F	314	ENSP00000344579:V314F	ENSP00000344579:V314F	V	-	1	0	FSCB	44045001	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	0.163000	0.16520	-0.835000	0.04234	0.461000	0.40582	GTT		0.522	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135		13	66	1	0	5.50884e-06	0.013537	6.57242e-06	13	66				
ERO1L	30001	broad.mit.edu	37	14	53133133	53133133	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr14:53133133A>T	ENST00000395686.3	-	7	812	c.589T>A	c.(589-591)Tgg>Agg	p.W197R		NM_014584.1	NP_055399.1	Q96HE7	ERO1A_HUMAN	ERO1-like (S. cerevisiae)	197					4-hydroxyproline metabolic process (GO:0019471)|brown fat cell differentiation (GO:0050873)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum unfolded protein response (GO:0030968)|extracellular matrix organization (GO:0030198)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to temperature stimulus (GO:0009266)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)	p.W197R(1)	ERO1L/FERMT2(2)	breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12	Breast(41;0.226)					CATATTTTCCAAGCATCTGGT	0.338																																							uc001wzv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(589-591)TGG>AGG		ERO1-like precursor							79.0	79.0	79.0					14																	53133133		2203	4300	6503	SO:0001583	missense	30001				chaperone mediated protein folding requiring cofactor|electron transport chain|protein thiol-disulfide exchange|response to temperature stimulus|transport	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome	disulfide oxidoreductase activity|flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor	g.chr14:53133133A>T	AF081886	CCDS9709.1	14q22.1	2010-10-06	2001-11-28		ENSG00000197930	ENSG00000197930			13280	protein-coding gene	gene with protein product		615435	"""ERO1 (S. cerevisiae)-like"""			10671517	Standard	NM_014584		Approved	ERO1A, ERO1-alpha	uc001wzv.3	Q96HE7	OTTHUMG00000140301	ENST00000395686.3:c.589T>A	14.37:g.53133133A>T	ENSP00000379042:p.Trp197Arg					ERO1L_uc001wzw.2_RNA|ERO1L_uc010aof.2_RNA	p.W197R	NM_014584	NP_055399	Q96HE7	ERO1A_HUMAN			7	815	-	Breast(41;0.226)		197					A8K9X4|A8MYW1|Q7LD45|Q9P1Q9|Q9UKV6	Missense_Mutation	SNP	ENST00000395686.3	37	c.589T>A	CCDS9709.1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.059522	0.55325	.	.	ENSG00000197930	ENST00000395686;ENST00000554251	T;T	0.39592	1.07;1.07	5.22	5.22	0.72569	.	0.121997	0.64402	D	0.000005	T	0.31009	0.0783	L	0.35542	1.07	0.80722	D	1	B	0.27594	0.182	B	0.29440	0.102	T	0.08166	-1.0735	10	0.06494	T	0.89	-9.6976	15.044	0.71813	1.0:0.0:0.0:0.0	.	197	Q96HE7	ERO1A_HUMAN	R	197;157	ENSP00000379042:W197R;ENSP00000452269:W157R	ENSP00000379042:W197R	W	-	1	0	ERO1L	52202883	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.235000	0.95353	2.096000	0.63516	0.482000	0.46254	TGG		0.338	ERO1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276892.1	NM_014584		4	21	0	0	0	0.009096	0	4	21				
RTN1	6252	broad.mit.edu	37	14	60193922	60193922	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr14:60193922C>T	ENST00000267484.5	-	3	1815	c.1480G>A	c.(1480-1482)Gcc>Acc	p.A494T		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	494					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.A494T(1)		central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		GCATCCAGGGCGCTGGGCTTC	0.711																																							uc001xen.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(1480-1482)GCC>ACC		reticulon 1 isoform A							6.0	8.0	8.0					14																	60193922		2174	4254	6428	SO:0001583	missense	6252				neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity	g.chr14:60193922C>T	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1480G>A	14.37:g.60193922C>T	ENSP00000267484:p.Ala494Thr					RTN1_uc001xem.1_Missense_Mutation_p.A74T	p.A494T	NM_021136	NP_066959	Q16799	RTN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0968)	3	1689	-			494					Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	ENST00000267484.5	37	c.1480G>A	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	C	12.23	1.875423	0.33162	.	.	ENSG00000139970	ENST00000432103;ENST00000267484;ENST00000433623	T	0.23754	1.89	5.37	0.929	0.19449	.	0.927597	0.09153	N	0.841323	T	0.18087	0.0434	L	0.57536	1.79	0.09310	N	0.999998	P	0.36535	0.557	B	0.22753	0.041	T	0.18745	-1.0327	10	0.30854	T	0.27	.	4.7565	0.13086	0.1441:0.4836:0.0:0.3723	.	494	Q16799	RTN1_HUMAN	T	74;494;420	ENSP00000267484:A494T	ENSP00000267484:A494T	A	-	1	0	RTN1	59263675	0.001000	0.12720	0.538000	0.28064	0.632000	0.37999	0.499000	0.22546	0.636000	0.30508	0.655000	0.94253	GCC		0.711	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2			3	9	0	0	0	0.004672	0	3	9				
RAB15	376267	broad.mit.edu	37	14	65417042	65417042	+	Splice_Site	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr14:65417042C>A	ENST00000533601.2	-	5	752		c.e5+1		CHURC1-FNTB_ENST00000549987.1_Intron|FNTB_ENST00000447296.2_Intron|RAB15_ENST00000436278.2_Splice_Site|RAB15_ENST00000426039.3_Splice_Site|RAB15_ENST00000267512.5_Splice_Site|FNTB_ENST00000542227.1_Intron			P59190	RAB15_HUMAN	RAB15, member RAS oncogene family						protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	GTP binding (GO:0005525)	p.?(1)		endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	8				all cancers(60;0.00136)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.0102)		CCTCCACTTACCTGCTGCCCT	0.592																																							uc001xhz.2		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e5+1		RAB15, member RAS onocogene family							315.0	265.0	282.0					14																	65417042		2203	4300	6503	SO:0001630	splice_region_variant	376267				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding	g.chr14:65417042C>A	BC014511	CCDS9768.1	14q23.2	2012-02-28	2012-02-28		ENSG00000139998	ENSG00000139998		"""RAB, member RAS oncogene"""	20150	protein-coding gene	gene with protein product						11697911	Standard	NM_198686		Approved		uc001xhz.2	P59190	OTTHUMG00000142810	ENST00000533601.2:c.414+1G>T	14.37:g.65417042C>A						FNTB_uc010tsl.1_Intron|FNTB_uc010tsm.1_Intron|RAB15_uc010aqk.2_Splice_Site	p.S182_splice	NM_198686	NP_941959	P59190	RAB15_HUMAN		all cancers(60;0.00136)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.0102)	5	626	-								G5EMR7|Q86TX7|Q8IW89	Splice_Site	SNP	ENST00000533601.2	37	c.545_splice		.	.	.	.	.	.	.	.	.	.	C	25.6	4.651190	0.88056	.	.	ENSG00000139998	ENST00000267512;ENST00000533601;ENST00000426039;ENST00000554593	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9094	0.92477	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RAB15	64486795	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.938000	0.75904	2.779000	0.95612	0.655000	0.94253	.		0.592	RAB15-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000390443.2	NM_198686	Intron	58	215	1	0	2.44918e-20	0.01441	3.62119e-20	58	215				
FAM71D	161142	broad.mit.edu	37	14	67671600	67671600	+	3'UTR	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr14:67671600G>T	ENST00000556046.1	+	0	1247							Q8N9W8	FA71D_HUMAN	family with sequence similarity 71, member D							cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E236*(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)	13		all_hematologic(31;0.0116)		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)		AGATTTCCCAGAATTCACAGA	0.488																																							uc001xja.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(706-708)GAA>TAA		hypothetical protein LOC161142							77.0	68.0	71.0					14																	67671600		2203	4300	6503	SO:0001624	3_prime_UTR_variant	161142							g.chr14:67671600G>T		CCDS9778.1	14q23.3	2007-11-20	2007-11-20	2007-11-20		ENSG00000172717			20101	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 54"""	C14orf54			Standard	NM_173526		Approved		uc001xja.2	Q8N9W8		ENST00000556046.1:c.*762G>T	14.37:g.67671600G>T						FAM71D_uc010aqn.1_RNA	p.E236*	NM_173526	NP_775797	Q8N9W8	FA71D_HUMAN		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)	5	960	+		all_hematologic(31;0.0116)	236					Q86VN4	Nonsense_Mutation	SNP	ENST00000556046.1	37	c.706G>T																																																																																					0.488	FAM71D-009	KNOWN	not_organism_supported|basic|appris_candidate	nonsense_mediated_decay	protein_coding	OTTHUMT00000412390.1	NM_173526		23	37	1	0	1.50039e-11	0.012319	2.03143e-11	23	37				
YLPM1	56252	broad.mit.edu	37	14	75279475	75279475	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr14:75279475G>A	ENST00000552421.1	+	10	3498	c.3374G>A	c.(3373-3375)aGa>aAa	p.R1125K	YLPM1_ENST00000238571.3_Missense_Mutation_p.R1636K|YLPM1_ENST00000325680.7_Missense_Mutation_p.R1831K			P49750	YLPM1_HUMAN	YLP motif containing 1	1636	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.R1636K(1)|p.R1831K(1)		breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CGGGAGAGCAGACCTGAGAGA	0.458																																							uc001xqj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(5491-5493)AGA>AAA		YLP motif containing 1							34.0	36.0	35.0					14																	75279475		1913	4138	6051	SO:0001583	missense	56252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck		g.chr14:75279475G>A	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.3374G>A	14.37:g.75279475G>A	ENSP00000447921:p.Arg1125Lys					YLPM1_uc001xql.3_RNA|YLPM1_uc001xqm.1_Missense_Mutation_p.R314K	p.R1831K	NM_019589	NP_062535	P49750	YLPM1_HUMAN	KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)	11	5616	+			1636					P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000552421.1	37	c.5492G>A		.	.	.	.	.	.	.	.	.	.	G	35	5.532761	0.96446	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000238571;ENST00000423680;ENST00000547879	.	.	.	5.89	5.89	0.94794	.	0.000000	0.64402	D	0.000002	T	0.68732	0.3033	L	0.34521	1.04	0.58432	D	0.999999	D;D	0.61080	0.989;0.959	D;D	0.75484	0.986;0.937	T	0.70256	-0.4922	9	0.87932	D	0	-2.9387	18.447	0.90688	0.0:0.0:1.0:0.0	.	1636;1831	P49750-3;P49750-4	.;.	K	1125;1831;1636;1544;240	.	ENSP00000238571:R1636K	R	+	2	0	YLPM1	74349228	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.435000	0.90297	2.796000	0.96246	0.650000	0.86243	AGA		0.458	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589		7	21	0	0	0	0.006214	0	7	21				
NPAP1	23742	broad.mit.edu	37	15	24921231	24921232	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr15:24921231_24921232CC>AA	ENST00000329468.2	+	1	691_692	c.217_218CC>AA	c.(217-219)CCt>AAt	p.P73N		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	73					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P73N(1)									GAGGCCGTGTCCTCTCCCTCGG	0.713																																							uc001ywo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(217-219)CCT>AAT		hypothetical protein LOC23742																																				SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24921231_24921232CC>AA	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	Exception_encountered	15.37:g.24921231_24921232delinsAA	ENSP00000333735:p.Pro73Asn						p.P73N	NM_018958	NP_061831	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	691_692	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	73						Missense_Mutation	DNP	ENST00000329468.2	37	c.217_218CC>AA	CCDS10015.1																																																																																				0.713	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		12	41	0	0	0	0.004672	0	12	41				
NPAP1	23742	broad.mit.edu	37	15	24924229	24924229	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr15:24924229G>A	ENST00000329468.2	+	1	3689	c.3215G>A	c.(3214-3216)gGg>gAg	p.G1072E		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	1072					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.G1072E(1)									GCACCACAAGGGGCTAGCAAC	0.542																																							uc001ywo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(3214-3216)GGG>GAG		hypothetical protein LOC23742							86.0	83.0	84.0					15																	24924229		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24924229G>A	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.3215G>A	15.37:g.24924229G>A	ENSP00000333735:p.Gly1072Glu						p.G1072E	NM_018958	NP_061831	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	3689	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	1072						Missense_Mutation	SNP	ENST00000329468.2	37	c.3215G>A	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	9.106	1.005391	0.19199	.	.	ENSG00000185823	ENST00000329468	T	0.06687	3.27	1.65	1.65	0.23941	.	.	.	.	.	T	0.04861	0.0131	N	0.22421	0.69	0.09310	N	1	P	0.34977	0.478	B	0.25987	0.065	T	0.36335	-0.9752	9	0.44086	T	0.13	.	6.7387	0.23422	0.0:0.0:1.0:0.0	.	1072	Q9NZP6	CO002_HUMAN	E	1072	ENSP00000333735:G1072E	ENSP00000333735:G1072E	G	+	2	0	C15orf2	22475322	0.015000	0.18098	0.001000	0.08648	0.180000	0.23129	-0.601000	0.05687	1.228000	0.43614	0.313000	0.20887	GGG		0.542	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		15	74	0	0	0	0.003163	0	15	74				
OTUD7A	161725	broad.mit.edu	37	15	31819480	31819480	+	Silent	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr15:31819480C>A	ENST00000307050.4	-	5	776	c.684G>T	c.(682-684)gtG>gtT	p.V228V	OTUD7A_ENST00000382902.1_Silent_p.V228V	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	228	Catalytic. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.V228V(1)		endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		CTTTCCGTAACACCAGGTCCC	0.567																																							uc001zfq.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)|skin(1)	2						c.(682-684)GTG>GTT		OTU domain containing 7A							137.0	127.0	130.0					15																	31819480		2202	4300	6502	SO:0001819	synonymous_variant	161725					cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding	g.chr15:31819480C>A	AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.684G>T	15.37:g.31819480C>A						OTUD7A_uc001zfr.2_Silent_p.V228V	p.V228V	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)	5	777	-		all_lung(180;1.6e-09)	228			OTU.|Catalytic (By similarity).|TRAF-binding (By similarity).		Q8IWK5	Silent	SNP	ENST00000307050.4	37	c.684G>T	CCDS10026.1																																																																																				0.567	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251393.2	NM_130901		33	122	1	0	1.61788e-16	0.012213	2.33478e-16	33	122				
RYR3	6263	broad.mit.edu	37	15	33920772	33920772	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr15:33920772G>T	ENST00000389232.4	+	21	2745	c.2675G>T	c.(2674-2676)gGc>gTc	p.G892V	RYR3_ENST00000415757.3_Missense_Mutation_p.G892V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	892	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.G892V(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGGACTTTCGGCAAGGTATGT	0.473																																							uc001zhi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(2674-2676)GGC>GTC		ryanodine receptor 3							100.0	98.0	99.0					15																	33920772		1929	4131	6060	SO:0001583	missense	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33920772G>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2675G>T	15.37:g.33920772G>T	ENSP00000373884:p.Gly892Val					RYR3_uc010bar.2_Missense_Mutation_p.G892V	p.G892V	NM_001036	NP_001027	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	21	2745	+		all_lung(180;7.18e-09)	892			4 X approximate repeats.|1.|Cytoplasmic (By similarity).		O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	c.2675G>T	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136646	0.77662	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.93811	-3.29;-3.29	4.7	4.7	0.59300	Ryanodine receptor Ryr (1);	0.061993	0.64402	D	0.000004	D	0.97573	0.9205	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98718	1.0707	10	0.87932	D	0	.	17.4233	0.87520	0.0:0.0:1.0:0.0	.	892;892	Q15413-2;Q15413	.;RYR3_HUMAN	V	892	ENSP00000373884:G892V;ENSP00000399610:G892V	ENSP00000354735:G892V	G	+	2	0	RYR3	31708064	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	9.291000	0.96070	2.427000	0.82271	0.557000	0.71058	GGC		0.473	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			14	50	1	0	0.00185496	0.016723	0.00207928	14	50				
CYP19A1	1588	broad.mit.edu	37	15	51503033	51503033	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr15:51503033C>T	ENST00000396402.1	-	10	1637	c.1484G>A	c.(1483-1485)aGa>aAa	p.R495K	CYP19A1_ENST00000260433.2_Missense_Mutation_p.R495K|CYP19A1_ENST00000396404.4_Missense_Mutation_p.R495K|CYP19A1_ENST00000559878.1_Missense_Mutation_p.R495K|RP11-108K3.1_ENST00000559909.1_lincRNA	NM_000103.3	NP_000094.2	P11511	CP19A_HUMAN	cytochrome P450, family 19, subfamily A, polypeptide 1	495					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|prostate gland growth (GO:0060736)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)	aromatase activity (GO:0070330)|electron carrier activity (GO:0009055)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.R495K(1)		endometrium(1)|kidney(4)|large_intestine(9)|lung(11)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	33				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)	GTCTGAGTTTCTTGGGGTAAA	0.448																																					Melanoma(142;1016 1807 39614 48966 51721)	Melanoma(142;1016 1807 39614 48966 51721)	uc001zyz.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(1483-1485)AGA>AAA		cytochrome P450, family 19	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)						241.0	227.0	232.0					15																	51503033		2196	4293	6489	SO:0001583	missense	1588				estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity	g.chr15:51503033C>T	D14473	CCDS10139.1	15q21	2009-01-26	2003-02-14	2003-02-28	ENSG00000137869	ENSG00000137869		"""Cytochrome P450s"""	2594	protein-coding gene	gene with protein product		107910	"""cytochrome P450, subfamily XIX (aromatization of androgens)"""	CYP19		8477708	Standard	NM_031226		Approved	ARO, P-450AROM, CPV1, ARO1, CYAR, aromatase	uc001zza.4	P11511	OTTHUMG00000131747	ENST00000396402.1:c.1484G>A	15.37:g.51503033C>T	ENSP00000379683:p.Arg495Lys					CYP19A1_uc001zza.3_Missense_Mutation_p.R495K	p.R495K	NM_031226	NP_112503	P11511	CP19A_HUMAN		all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	11	1735	-			495					Q16731|Q3B764|Q58FA0|Q8IYJ7	Missense_Mutation	SNP	ENST00000396402.1	37	c.1484G>A	CCDS10139.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.456622	0.43634	.	.	ENSG00000137869	ENST00000396402;ENST00000260433;ENST00000396404	T;T;T	0.72835	-0.69;-0.69;-0.69	5.46	5.46	0.80206	.	0.130543	0.64402	D	0.000002	T	0.72423	0.3458	M	0.73962	2.25	0.45662	D	0.998585	B	0.28552	0.215	B	0.33960	0.173	T	0.73110	-0.4086	10	0.62326	D	0.03	-22.1016	12.9519	0.58405	0.0:0.9256:0.0:0.0744	.	495	P11511	CP19A_HUMAN	K	495	ENSP00000379683:R495K;ENSP00000260433:R495K;ENSP00000379685:R495K	ENSP00000260433:R495K	R	-	2	0	CYP19A1	49290325	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	5.551000	0.67274	2.726000	0.93360	0.655000	0.94253	AGA		0.448	CYP19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254669.1			41	133	0	0	0	0.010771	0	41	133				
RSL24D1	51187	broad.mit.edu	37	15	55489023	55489023	+	Silent	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr15:55489023G>A	ENST00000260443.4	-	1	242	c.66C>T	c.(64-66)gtC>gtT	p.V22V	RSL24D1_ENST00000565854.1_5'Flank	NM_016304.2	NP_057388.1	Q9UHA3	RLP24_HUMAN	ribosomal L24 domain containing 1	22					ribosome biogenesis (GO:0042254)	nucleus (GO:0005634)		p.V22V(1)		central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	7						AATCGTTGCGGACGAACATCA	0.582											OREG0023135	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002acn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(64-66)GTC>GTT		ribosomal protein L24-like							114.0	88.0	96.0					15																	55489023		2193	4292	6485	SO:0001819	synonymous_variant	51187				ribosome biogenesis|translation	nucleolus|ribosome	structural constituent of ribosome	g.chr15:55489023G>A	AF201949	CCDS10152.1	15q21	2009-02-27	2009-02-27	2009-02-27	ENSG00000137876	ENSG00000137876			18479	protein-coding gene	gene with protein product		613262	"""chromosome 15 open reading frame 15"""	C15orf15		12808088, 11707418	Standard	NM_016304		Approved	HRP-L30-iso, L30, RPL24L, RPL24	uc002acn.3	Q9UHA3	OTTHUMG00000131957	ENST00000260443.4:c.66C>T	15.37:g.55489023G>A			OREG0023135	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1008		p.V22V	NM_016304	NP_057388	Q9UHA3	RLP24_HUMAN			1	209	-			22					B2RD72|Q561V8|Q8N6S8|Q96B04|Q96C76|Q96HJ1	Silent	SNP	ENST00000260443.4	37	c.66C>T	CCDS10152.1																																																																																				0.582	RSL24D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254916.1	NM_016304		17	39	0	0	0	0.006122	0	17	39				
CCPG1	9236	broad.mit.edu	37	15	55653056	55653056	+	Silent	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr15:55653056T>A	ENST00000310958.6	-	8	1213	c.915A>T	c.(913-915)acA>acT	p.T305T	CCPG1_ENST00000425574.3_Silent_p.T305T|DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000569205.1_Silent_p.T305T|CCPG1_ENST00000442196.3_Silent_p.T305T	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	305	Interaction with MCF2L and SRC. {ECO:0000250}.				cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)		p.T305T(1)		autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		ACTGATTTTCTGTAGCAAGGT	0.343																																							uc002acv.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(913-915)ACA>ACT		cell cycle progression 1 isoform 2							72.0	67.0	69.0					15																	55653056		1820	4082	5902	SO:0001819	synonymous_variant	9236				cell cycle	integral to membrane		g.chr15:55653056T>A	AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.915A>T	15.37:g.55653056T>A						CCPG1_uc002acy.2_Silent_p.T305T|CCPG1_uc002acu.1_Silent_p.T161T|CCPG1_uc002acw.1_Silent_p.T30T|CCPG1_uc002acx.2_Silent_p.T305T|CCPG1_uc010bfk.1_Silent_p.T305T|CCPG1_uc002acz.1_Silent_p.T305T	p.T305T	NM_020739	NP_065790	Q9ULG6	CCPG1_HUMAN		all cancers(107;0.0354)	8	1080	-			305			Lumenal (Potential).|Interaction with MCF2L and SRC (By similarity).		A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Silent	SNP	ENST00000310958.6	37	c.915A>T	CCDS42039.1																																																																																				0.343	CCPG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419850.1	NM_004748		23	51	0	0	0	0.012319	0	23	51				
SLC24A1	9187	broad.mit.edu	37	15	65918051	65918051	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr15:65918051C>T	ENST00000261892.6	+	2	1920	c.1633C>T	c.(1633-1635)Ctc>Ttc	p.L545F	SLC24A1_ENST00000544319.2_Missense_Mutation_p.L545F|SLC24A1_ENST00000339868.6_Missense_Mutation_p.L545F|SLC24A1_ENST00000546330.1_Missense_Mutation_p.L545F|SLC24A1_ENST00000537259.1_Missense_Mutation_p.L545F|SLC24A1_ENST00000399033.4_Missense_Mutation_p.L545F	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	545					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.L545F(1)		breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						CACTTGTTCCCTCTTCTCCCG	0.502																																							uc010ujf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1633-1635)CTC>TTC		solute carrier family 24							302.0	312.0	308.0					15																	65918051		2158	4280	6438	SO:0001583	missense	9187				response to light intensity|visual perception	integral to plasma membrane|membrane fraction|outer membrane	calcium, potassium:sodium antiporter activity|protein binding|symporter activity	g.chr15:65918051C>T	AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.1633C>T	15.37:g.65918051C>T	ENSP00000261892:p.Leu545Phe					SLC24A1_uc010ujd.1_Missense_Mutation_p.L545F|SLC24A1_uc010uje.1_Missense_Mutation_p.L545F|SLC24A1_uc010ujg.1_Missense_Mutation_p.L545F|SLC24A1_uc010ujh.1_Missense_Mutation_p.L545F	p.L545F	NM_004727	NP_004718	O60721	NCKX1_HUMAN			2	1920	+			545			Cytoplasmic (Potential).		O43485|O75184|Q17RM9	Missense_Mutation	SNP	ENST00000261892.6	37	c.1633C>T	CCDS45284.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997495	0.74818	.	.	ENSG00000074621	ENST00000537259;ENST00000261892;ENST00000339868;ENST00000544319;ENST00000399033;ENST00000546330	T;T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36;-0.36	5.92	5.92	0.95590	Sodium/calcium exchanger membrane region (1);	0.182014	0.44285	D	0.000465	T	0.78910	0.4358	L	0.45698	1.435	0.47905	D	0.99954	D;D;D;P;P	0.89917	1.0;1.0;1.0;0.846;0.873	D;D;D;P;P	0.85130	0.995;0.997;0.997;0.71;0.809	T	0.79014	-0.1976	10	0.72032	D	0.01	.	19.301	0.94144	0.0:1.0:0.0:0.0	.	545;545;545;545;545	O60721-2;Q17RM9;O60721;F5H127;B4E1W0	.;.;NCKX1_HUMAN;.;.	F	545	ENSP00000439693:L545F;ENSP00000261892:L545F;ENSP00000341837:L545F;ENSP00000445163:L545F;ENSP00000381991:L545F;ENSP00000439190:L545F	ENSP00000261892:L545F	L	+	1	0	SLC24A1	63705105	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.905000	0.39878	2.808000	0.96608	0.561000	0.74099	CTC		0.502	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397304.1	NM_004727		48	156	0	0	0	0.01441	0	48	156				
ANPEP	290	broad.mit.edu	37	15	90347501	90347501	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr15:90347501G>A	ENST00000300060.6	-	6	1475	c.1162C>T	c.(1162-1164)Cat>Tat	p.H388Y	ANPEP_ENST00000558177.1_5'Flank	NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	388	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.H388Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	GCCAGCTCATGAGCAATCACA	0.642																																					NSCLC(30;827 977 2459 19669 26125)	NSCLC(30;827 977 2459 19669 26125)	uc002bop.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1162-1164)CAT>TAT		membrane alanine aminopeptidase precursor	Ezetimibe(DB00973)						73.0	78.0	76.0					15																	90347501		2200	4299	6499	SO:0001583	missense	290				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding	g.chr15:90347501G>A	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.1162C>T	15.37:g.90347501G>A	ENSP00000300060:p.His388Tyr						p.H388Y	NM_001150	NP_001141	P15144	AMPN_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		6	1454	-	Lung NSC(78;0.0221)|all_lung(78;0.0448)		388			Extracellular.|Metalloprotease.	Zinc; catalytic (By similarity).	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	c.1162C>T	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392422	0.83011	.	.	ENSG00000166825	ENST00000300060	T	0.20069	2.1	4.63	4.63	0.57726	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.63663	0.2530	H	0.98507	4.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79524	-0.1768	10	0.87932	D	0	.	14.9628	0.71169	0.0:0.0:1.0:0.0	.	388	P15144	AMPN_HUMAN	Y	388	ENSP00000300060:H388Y	ENSP00000300060:H388Y	H	-	1	0	ANPEP	88148505	1.000000	0.71417	0.829000	0.32907	0.833000	0.47200	9.809000	0.99208	2.126000	0.65437	0.313000	0.20887	CAT		0.642	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1			32	90	0	0	0	0.012213	0	32	90				
KNOP1	400506	broad.mit.edu	37	16	19725912	19725912	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr16:19725912T>C	ENST00000219837.7	-	2	524	c.446A>G	c.(445-447)aAa>aGa	p.K149R	IQCK_ENST00000320394.6_5'Flank|AC002550.5_ENST00000565916.1_RNA|KNOP1_ENST00000568230.1_5'Flank	NM_001012991.2	NP_001013009.2	Q1ED39	KNOP1_HUMAN	lysine-rich nucleolar protein 1	149	Lys-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.K149R(1)									CTTGTGTTTTTTGAGCTTCTT	0.557																																							uc002dgq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(445-447)AAA>AGA		hypothetical protein LOC400506							48.0	53.0	51.0					16																	19725912		2171	4290	6461	SO:0001583	missense	400506					nucleolus		g.chr16:19725912T>C	BC047010	CCDS42127.1	16p12.3	2013-03-12	2013-03-12	2013-03-12	ENSG00000103550	ENSG00000103550			34404	protein-coding gene	gene with protein product	"""family with sequence similarity 191, member A"", ""testis-specific gene 118"""		"""chromosome 16 open reading frame 88"""	C16orf88			Standard	NM_001012991		Approved	101F10.1, FAM191A, TSG118	uc002dgq.3	Q1ED39		ENST00000219837.7:c.446A>G	16.37:g.19725912T>C	ENSP00000219837:p.Lys149Arg					IQCK_uc002dgr.2_5'Flank|IQCK_uc002dgs.2_5'Flank	p.K149R	NM_001012991	NP_001013009	Q1ED39	CP088_HUMAN			2	461	-			149			Lys-rich.		O43328|Q5FWF3	Missense_Mutation	SNP	ENST00000219837.7	37	c.446A>G	CCDS42127.1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.155437	0.38021	.	.	ENSG00000103550	ENST00000219837	T	0.38887	1.11	4.61	3.52	0.40303	.	8.614360	0.00166	N	0.000001	T	0.52709	0.1751	M	0.62723	1.935	0.80722	D	1	P	0.44816	0.844	P	0.48873	0.593	T	0.35773	-0.9775	9	.	.	.	-10.8923	6.9541	0.24562	0.0:0.1038:0.0:0.8962	.	149	Q1ED39	CP088_HUMAN	R	149	ENSP00000219837:K149R	.	K	-	2	0	C16orf88	19633413	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	0.675000	0.25232	0.898000	0.36418	0.459000	0.35465	AAA		0.557	KNOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435993.2	NM_001012991		21	53	0	0	0	0.012319	0	21	53				
DNAH3	55567	broad.mit.edu	37	16	21156636	21156636	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr16:21156636C>T	ENST00000261383.3	-	3	313	c.314G>A	c.(313-315)gGa>gAa	p.G105E	DNAH3_ENST00000415178.1_Missense_Mutation_p.G105E|DNAH3_ENST00000575491.1_5'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	105	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.G105E(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		ATCACTGGGTCCACGGTGGTG	0.542																																							uc010vbe.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(313-315)GGA>GAA		dynein, axonemal, heavy chain 3							186.0	135.0	152.0					16																	21156636		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:21156636C>T	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.314G>A	16.37:g.21156636C>T	ENSP00000261383:p.Gly105Glu					DNAH3_uc002die.2_Missense_Mutation_p.G76E	p.G105E	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	3	314	-			105			Stem (By similarity).		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.314G>A	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307797	0.60305	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.20598	2.06;2.19	5.81	5.81	0.92471	.	1.061350	0.07326	N	0.878462	T	0.25680	0.0625	N	0.25647	0.755	0.33014	D	0.527974	P;P	0.48694	0.651;0.914	B;P	0.46543	0.153;0.52	T	0.22487	-1.0215	10	0.30854	T	0.27	.	17.5613	0.87908	0.0:1.0:0.0:0.0	.	105;76	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	E	105;105;76	ENSP00000261383:G105E;ENSP00000394245:G105E	ENSP00000261383:G105E	G	-	2	0	DNAH3	21064137	0.851000	0.29673	0.999000	0.59377	0.992000	0.81027	2.779000	0.47734	2.755000	0.94549	0.655000	0.94253	GGA		0.542	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		14	50	0	0	0	0.020292	0	14	50				
PRKCB	5579	broad.mit.edu	37	16	23999883	23999883	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr16:23999883C>A	ENST00000321728.7	+	3	435	c.260C>A	c.(259-261)cCt>cAt	p.P87H	PRKCB_ENST00000303531.7_Missense_Mutation_p.P87H	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	87					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.P87H(2)		central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	TTCTCCTGCCCTGGCGCTGAC	0.498																																							uc002dmd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9						c.(259-261)CCT>CAT		protein kinase C, beta isoform 1	Vitamin E(DB00163)						128.0	115.0	119.0					16																	23999883		2197	4300	6497	SO:0001583	missense	5579				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding	g.chr16:23999883C>A	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.260C>A	16.37:g.23999883C>A	ENSP00000318315:p.Pro87His					PRKCB_uc002dme.2_Missense_Mutation_p.P87H	p.P87H	NM_212535	NP_997700	P05771	KPCB_HUMAN			3	457	+			87					C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	ENST00000321728.7	37	c.260C>A	CCDS10618.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728464	0.89390	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	D;D	0.93019	-3.15;-3.15	5.58	5.58	0.84498	Protein kinase C-like, phorbol ester/diacylglycerol binding (1);	0.000000	0.85682	D	0.000000	D	0.97201	0.9085	M	0.88570	2.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.97786	1.0235	10	0.87932	D	0	.	17.0572	0.86537	0.0:1.0:0.0:0.0	.	87;87	P05771-2;P05771	.;KPCB_HUMAN	H	87	ENSP00000318315:P87H;ENSP00000305355:P87H	ENSP00000305355:P87H	P	+	2	0	PRKCB	23907384	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	7.110000	0.77069	2.625000	0.88918	0.561000	0.74099	CCT		0.498	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535		30	94	1	0	3.90053e-15	0.012213	5.49723e-15	30	94				
ARMC5	79798	broad.mit.edu	37	16	31476170	31476170	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr16:31476170G>A	ENST00000563544.1	+	5	2372	c.1826G>A	c.(1825-1827)cGt>cAt	p.R609H	ARMC5_ENST00000538189.1_Missense_Mutation_p.R641H|ARMC5_ENST00000457010.2_Missense_Mutation_p.R609H|ARMC5_ENST00000268314.4_Missense_Mutation_p.R609H|ARMC5_ENST00000408912.3_Missense_Mutation_p.R704H|ARMC5_ENST00000412665.2_Missense_Mutation_p.R253H			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	609								p.R609H(1)|p.R704H(1)		central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						CCGGCACCACGTGCCCGGCCC	0.701																																							uc002ecc.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1825-1827)CGT>CAT		armadillo repeat containing 5 isoform a							14.0	17.0	16.0					16																	31476170		2112	4244	6356	SO:0001583	missense	79798						binding	g.chr16:31476170G>A	AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1826G>A	16.37:g.31476170G>A	ENSP00000456877:p.Arg609His					ARMC5_uc010vfn.1_Missense_Mutation_p.R704H|ARMC5_uc010vfo.1_Missense_Mutation_p.R641H|ARMC5_uc002eca.3_Missense_Mutation_p.R609H|ARMC5_uc010vfp.1_Missense_Mutation_p.R417H|ARMC5_uc002ecb.2_Missense_Mutation_p.R609H	p.R609H	NM_001105247	NP_001098717	Q96C12	ARMC5_HUMAN			4	2355	+			609					Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	ENST00000563544.1	37	c.1826G>A	CCDS45472.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055335	0.36277	.	.	ENSG00000140691	ENST00000408912;ENST00000538189;ENST00000268314;ENST00000457010;ENST00000412665	T;T;T;T;T	0.24151	1.87;1.87;1.87;2.09;1.87	5.22	-0.562	0.11781	Armadillo-type fold (1);	0.724676	0.13432	N	0.388350	T	0.12008	0.0292	N	0.16478	0.41	0.09310	N	1	B;B;B;B;B	0.12013	0.001;0.001;0.003;0.001;0.005	B;B;B;B;B	0.08055	0.002;0.002;0.002;0.001;0.003	T	0.20874	-1.0262	10	0.35671	T	0.21	-17.7542	3.9181	0.09231	0.2513:0.0:0.4666:0.2821	.	641;641;704;609;609	B4DH27;F5H156;B4DIU9;Q96C12;Q96C12-4	.;.;.;ARMC5_HUMAN;.	H	704;641;609;609;253	ENSP00000386125:R704H;ENSP00000443995:R641H;ENSP00000268314:R609H;ENSP00000399561:R609H;ENSP00000400183:R253H	ENSP00000268314:R609H	R	+	2	0	ARMC5	31383671	0.050000	0.20438	0.000000	0.03702	0.076000	0.17211	2.526000	0.45607	0.059000	0.16252	0.491000	0.48974	CGT		0.701	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742		5	9	0	0	0	0.014758	0	5	9				
CNTNAP4	85445	broad.mit.edu	37	16	76350353	76350353	+	Silent	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr16:76350353C>T	ENST00000476707.1	+	1	277	c.138C>T	c.(136-138)tcC>tcT	p.S46S	CNTNAP4_ENST00000377504.4_Silent_p.S42S|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Silent_p.S18S|CNTNAP4_ENST00000307431.8_Silent_p.S42S			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	43	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.S18S(2)|p.S42S(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CTCAGGCATCCTTCAGCAGTT	0.502																																							uc002feu.1		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(1)|pancreas(1)	2						c.(127-129)TCC>TCT		cell recognition protein CASPR4 isoform 1							123.0	91.0	101.0					16																	76350353		2198	4300	6498	SO:0001819	synonymous_variant	85445				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr16:76350353C>T	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.138C>T	16.37:g.76350353C>T						CNTNAP4_uc002fev.1_5'UTR|CNTNAP4_uc010chb.1_Silent_p.S18S|CNTNAP4_uc002fex.1_Silent_p.S46S|CNTNAP4_uc002few.2_Silent_p.S18S	p.S43S	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN			4	514	+			43			Extracellular (Potential).|F5/8 type C.		E9PFZ6|Q86YZ7	Silent	SNP	ENST00000476707.1	37	c.129C>T																																																																																					0.502	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401		10	40	0	0	0	0.006214	0	10	40				
ZCCHC14	23174	broad.mit.edu	37	16	87451247	87451247	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr16:87451247T>A	ENST00000268616.4	-	8	1008	c.791A>T	c.(790-792)cAt>cTt	p.H264L		NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	264							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)	p.H264L(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		GCTGCCCGCATGGGAGCAGTG	0.692																																							uc002fjz.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|breast(1)	2						c.(790-792)CAT>CTT		zinc finger, CCHC domain containing 14							71.0	83.0	79.0					16																	87451247		2198	4300	6498	SO:0001583	missense	23174				cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding	g.chr16:87451247T>A	AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.791A>T	16.37:g.87451247T>A	ENSP00000268616:p.His264Leu					ZCCHC14_uc002fka.1_RNA|ZCCHC14_uc002fkb.2_Missense_Mutation_p.H40L	p.H264L	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0285)	8	818	-			264					D3DUN1|O60324|Q3MJD8|Q9UFP0	Missense_Mutation	SNP	ENST00000268616.4	37	c.791A>T	CCDS10961.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.981918	0.53827	.	.	ENSG00000140948	ENST00000268616	T	0.20332	2.08	5.54	4.38	0.52667	.	0.164310	0.56097	D	0.000039	T	0.23289	0.0563	L	0.29908	0.895	0.39538	D	0.968773	D;P	0.56035	0.974;0.883	P;B	0.50659	0.647;0.422	T	0.02766	-1.1113	10	0.62326	D	0.03	-25.6536	12.5442	0.56190	0.0:0.0:0.1387:0.8613	.	264;264	Q8WYQ9-2;Q8WYQ9	.;ZCH14_HUMAN	L	264	ENSP00000268616:H264L	ENSP00000268616:H264L	H	-	2	0	ZCCHC14	86008748	0.968000	0.33430	0.975000	0.42487	0.050000	0.14768	2.368000	0.44222	2.237000	0.73441	0.533000	0.62120	CAT		0.692	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269107.1	NM_015144		30	151	0	0	0	0.007291	0	30	151				
ZNF18	7566	broad.mit.edu	37	17	11895767	11895767	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr17:11895767C>A	ENST00000322748.3	-	4	984	c.380G>T	c.(379-381)tGg>tTg	p.W127L	ZNF18_ENST00000454073.3_Missense_Mutation_p.W127L|ZNF18_ENST00000580306.2_Missense_Mutation_p.W127L	NM_144680.2	NP_653281.2	P17022	ZNF18_HUMAN	zinc finger protein 18	127					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.W127L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	14				Colorectal(4;3.33e-05)|COAD - Colon adenocarcinoma(4;0.000494)|READ - Rectum adenocarcinoma(10;0.233)		TACCCATTGCCACAGTCTCTG	0.527																																							uc002gng.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(379-381)TGG>TTG		zinc finger protein 18							67.0	60.0	62.0					17																	11895767		2203	4300	6503	SO:0001583	missense	7566				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr17:11895767C>A	X52342	CCDS32568.1	17p12	2013-01-09	2006-05-10		ENSG00000154957	ENSG00000154957		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12969	protein-coding gene	gene with protein product		194524	"""zinc finger protein 18 (KOX 11)"""			15702252	Standard	XM_005256786		Approved	ZKSCAN6, KOX11, HDSG1, Zfp535, ZNF535, ZSCAN38	uc002gng.1	P17022	OTTHUMG00000178307	ENST00000322748.3:c.380G>T	17.37:g.11895767C>A	ENSP00000315664:p.Trp127Leu					ZNF18_uc002gnh.1_Missense_Mutation_p.W127L|ZNF18_uc002gni.1_Missense_Mutation_p.W127L	p.W127L	NM_144680	NP_653281	P17022	ZNF18_HUMAN		Colorectal(4;3.33e-05)|COAD - Colon adenocarcinoma(4;0.000494)|READ - Rectum adenocarcinoma(10;0.233)	4	985	-			127					Q5QHQ3|Q8IYC4|Q8NAH6	Missense_Mutation	SNP	ENST00000322748.3	37	c.380G>T	CCDS32568.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.805977	0.31961	.	.	ENSG00000154957	ENST00000454073;ENST00000322748	T;T	0.04015	3.73;3.73	5.39	4.36	0.52297	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (2);	0.000000	0.44483	D	0.000446	T	0.03827	0.0108	N	0.12746	0.255	0.35833	D	0.825489	P;B	0.35745	0.518;0.012	B;B	0.40477	0.33;0.016	T	0.54430	-0.8295	10	0.29301	T	0.29	-6.8782	10.5914	0.45312	0.1917:0.8083:0.0:0.0	.	127;127	P17022-2;P17022	.;ZNF18_HUMAN	L	127	ENSP00000391376:W127L;ENSP00000315664:W127L	ENSP00000315664:W127L	W	-	2	0	ZNF18	11836492	0.983000	0.35010	1.000000	0.80357	0.889000	0.51656	0.865000	0.27940	2.531000	0.85337	0.655000	0.94253	TGG		0.527	ZNF18-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441450.2	XM_085596		32	43	1	0	1.08312e-15	0.009535	1.53548e-15	32	43				
MAPK7	5598	broad.mit.edu	37	17	19286510	19286510	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr17:19286510T>G	ENST00000308406.5	+	7	2803	c.2417T>G	c.(2416-2418)cTg>cGg	p.L806R	MAPK7_ENST00000299612.7_Missense_Mutation_p.L667R|MAPK7_ENST00000571657.1_3'UTR|MAPK7_ENST00000395604.3_Missense_Mutation_p.L806R|MAPK7_ENST00000395602.4_Missense_Mutation_p.L806R|MFAP4_ENST00000574313.2_5'Flank	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	806	May not be required for kinase activity; required to stimulate MEF2C activity. {ECO:0000250}.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)	p.L806R(1)		autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					TCCCCAATGCTGCTGGCTGAC	0.597																																							uc002gvn.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9						c.(2416-2418)CTG>CGG		mitogen-activated protein kinase 7 isoform 1							69.0	63.0	65.0					17																	19286510		2203	4300	6503	SO:0001583	missense	5598				cell cycle|cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|protein binding	g.chr17:19286510T>G	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.2417T>G	17.37:g.19286510T>G	ENSP00000311005:p.Leu806Arg					MAPK7_uc002gvo.2_Missense_Mutation_p.L667R|MAPK7_uc002gvq.2_Missense_Mutation_p.L806R|MAPK7_uc002gvp.2_Missense_Mutation_p.L806R|uc010vyt.1_5'Flank	p.L806R	NM_139033	NP_620602	Q13164	MK07_HUMAN			7	2803	+	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)		806			May not be required for kinase activity; required to stimulate MEF2C activity (By similarity).		Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	c.2417T>G	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	T	18.89	3.718735	0.68844	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.75367	-0.67;-0.93;-0.67;-0.67	4.91	4.91	0.64330	.	0.145346	0.43919	D	0.000514	T	0.71005	0.3289	L	0.44542	1.39	0.32893	D	0.512108	D	0.54964	0.969	P	0.49276	0.605	T	0.79725	-0.1683	10	0.72032	D	0.01	-11.0134	8.8741	0.35334	0.0:0.0:0.189:0.811	.	806	Q13164	MK07_HUMAN	R	806;667;806;806	ENSP00000311005:L806R;ENSP00000299612:L667R;ENSP00000378968:L806R;ENSP00000378966:L806R	ENSP00000299612:L667R	L	+	2	0	MAPK7	19227103	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.349000	0.52217	1.841000	0.53522	0.402000	0.26972	CTG		0.597	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033		3	63	0	0	0	0.004672	0	3	63				
NF1	4763	broad.mit.edu	37	17	29554590	29554590	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr17:29554590T>A	ENST00000358273.4	+	20	2758	c.2375T>A	c.(2374-2376)cTt>cAt	p.L792H	NF1_ENST00000356175.3_Missense_Mutation_p.L792H	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	792					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.L792H(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAGCTAATCCTTAACTATCCA	0.358			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		14	Whole gene deletion(8)|Unknown(4)|Substitution - Missense(2)	p.?(2)	soft_tissue(7)|lung(3)|autonomic_ganglia(2)|central_nervous_system(2)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(2374-2376)CTT>CAT		neurofibromin isoform 1							98.0	85.0	90.0					17																	29554590		2203	4300	6503	SO:0001583	missense	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29554590T>A		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.2375T>A	17.37:g.29554590T>A	ENSP00000351015:p.Leu792His	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)				NF1_uc002hgh.2_Missense_Mutation_p.L792H|NF1_uc010csn.1_Missense_Mutation_p.L652H|NF1_uc002hgi.1_5'UTR	p.L792H	NM_001042492	NP_001035957	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	20	2708	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	792					O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	c.2375T>A	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	.	21.3	4.127612	0.77549	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.10192	3.06;3.2;2.9	4.83	4.83	0.62350	Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.18759	0.0450	L	0.27053	0.805	0.80722	D	1	D;D;D	0.76494	0.964;0.999;0.982	P;D;P	0.79784	0.74;0.993;0.842	T	0.10337	-1.0634	10	0.16420	T	0.52	.	14.6843	0.69040	0.0:0.0:0.0:1.0	.	792;792;792	E1P657;P21359-2;P21359	.;.;NF1_HUMAN	H	792;792;458	ENSP00000351015:L792H;ENSP00000348498:L792H;ENSP00000389907:L458H	ENSP00000348498:L792H	L	+	2	0	NF1	26578716	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.529000	0.81952	1.937000	0.56155	0.528000	0.53228	CTT		0.358	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		29	25	0	0	0	0.007291	0	29	25				
MTMR4	9110	broad.mit.edu	37	17	56573321	56573321	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr17:56573321T>G	ENST00000323456.5	-	16	2306	c.2182A>C	c.(2182-2184)Act>Cct	p.T728P	MTMR4_ENST00000579925.1_Missense_Mutation_p.T671P	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	728					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.T728P(1)		breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GGTCCCTTAGTCTCTTCTAGG	0.493																																							uc002iwj.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(2182-2184)ACT>CCT		myotubularin related protein 4							197.0	205.0	202.0					17																	56573321		2203	4300	6503	SO:0001583	missense	9110					cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity	g.chr17:56573321T>G	AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.2182A>C	17.37:g.56573321T>G	ENSP00000325285:p.Thr728Pro						p.T728P	NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN			16	2292	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		728					D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	ENST00000323456.5	37	c.2182A>C	CCDS11608.1	.	.	.	.	.	.	.	.	.	.	T	8.183	0.794245	0.16327	.	.	ENSG00000108389	ENST00000323456	D	0.93659	-3.26	4.81	3.71	0.42584	.	1.488890	0.03611	N	0.234849	D	0.89255	0.6663	L	0.27053	0.805	0.24000	N	0.996212	B	0.24651	0.108	B	0.31547	0.132	T	0.77568	-0.2539	10	0.30854	T	0.27	.	5.4532	0.16576	0.1547:0.0853:0.0:0.76	.	728	Q9NYA4	MTMR4_HUMAN	P	728	ENSP00000325285:T728P	ENSP00000325285:T728P	T	-	1	0	MTMR4	53928320	0.000000	0.05858	0.926000	0.36857	0.631000	0.37964	0.159000	0.16442	0.935000	0.37341	0.533000	0.62120	ACT		0.493	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687		5	356	0	0	0	0.001984	0	5	356				
MRC2	9902	broad.mit.edu	37	17	60759205	60759205	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr17:60759205G>T	ENST00000303375.5	+	19	3112	c.2710G>T	c.(2710-2712)Gat>Tat	p.D904Y	MRC2_ENST00000446119.2_5'UTR|RNU6-446P_ENST00000362827.1_RNA	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	904	C-type lectin 5. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.D904Y(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CAGATGGACAGATGGTTCCAT	0.597																																							uc002jad.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2710-2712)GAT>TAT		mannose receptor, C type 2							55.0	46.0	49.0					17																	60759205		2203	4300	6503	SO:0001583	missense	9902				endocytosis	integral to membrane	receptor activity|sugar binding	g.chr17:60759205G>T	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.2710G>T	17.37:g.60759205G>T	ENSP00000307513:p.Asp904Tyr					MRC2_uc002jae.2_5'UTR|MRC2_uc002jaf.2_5'UTR	p.D904Y	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN			19	3112	+			904			Extracellular (Potential).|C-type lectin 5.		A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	c.2710G>T	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	G	33	5.237544	0.95240	.	.	ENSG00000011028	ENST00000303375	T	0.32272	1.46	5.62	5.62	0.85841	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	T	0.71400	0.3335	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81102	-0.1085	10	0.62326	D	0.03	-21.1235	19.6758	0.95932	0.0:0.0:1.0:0.0	.	904	Q9UBG0	MRC2_HUMAN	Y	904	ENSP00000307513:D904Y	ENSP00000307513:D904Y	D	+	1	0	MRC2	58112937	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.730000	0.91510	2.644000	0.89710	0.561000	0.74099	GAT		0.597	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1			8	17	1	0	0.00307968	0.00308	0.00337365	8	17				
CCDC57	284001	broad.mit.edu	37	17	80151979	80151979	+	Missense_Mutation	SNP	C	C	T	rs541959209		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr17:80151979C>T	ENST00000389641.4	-	5	691	c.655G>A	c.(655-657)Gaa>Aaa	p.E219K	CCDC57_ENST00000392347.1_Missense_Mutation_p.E219K|CCDC57_ENST00000392343.3_Missense_Mutation_p.E219K			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	219								p.E219K(2)		endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GCCCCGGCTTCCTTCAGAGCC	0.532													c|||	1	0.000199681	0.0	0.0	5008	,	,		16460	0.0		0.0	False		,,,				2504	0.001						uc002kdz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(655-657)GAA>AAA		coiled-coil domain containing 57							64.0	68.0	67.0					17																	80151979		1938	4133	6071	SO:0001583	missense	284001							g.chr17:80151979C>T	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.655G>A	17.37:g.80151979C>T	ENSP00000374292:p.Glu219Lys					CCDC57_uc002kdx.1_Missense_Mutation_p.E219K	p.E219K	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)		6	1010	-	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		219			Potential.		A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	ENST00000389641.4	37	c.655G>A		.	.	.	.	.	.	.	.	.	.	c	10.76	1.442100	0.25987	.	.	ENSG00000176155	ENST00000389641;ENST00000392347;ENST00000392343	T;T;T	0.23950	3.06;3.06;1.88	4.69	2.54	0.30619	.	0.538057	0.16840	N	0.197393	T	0.16385	0.0394	L	0.38531	1.155	0.09310	N	1	P;B	0.36535	0.557;0.392	B;B	0.35971	0.215;0.126	T	0.17258	-1.0375	10	0.11794	T	0.64	-5.6848	7.6541	0.28365	0.1876:0.6311:0.1814:0.0	.	219;219	Q2TAC2-2;Q2TAC2	.;CCD57_HUMAN	K	219	ENSP00000374292:E219K;ENSP00000376158:E219K;ENSP00000376154:E219K	ENSP00000374292:E219K	E	-	1	0	CCDC57	77745268	0.017000	0.18338	0.001000	0.08648	0.156000	0.22039	1.173000	0.31920	0.420000	0.25954	0.558000	0.71614	GAA		0.532	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082		55	59	0	0	0	0.01441	0	55	59				
DLGAP1	9229	broad.mit.edu	37	18	3502639	3502639	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr18:3502639G>C	ENST00000315677.3	-	12	3171	c.2576C>G	c.(2575-2577)cCt>cGt	p.P859R	DLGAP1_ENST00000581527.1_Missense_Mutation_p.P859R|DLGAP1_ENST00000584874.1_Missense_Mutation_p.P859R|DLGAP1_ENST00000534970.1_Missense_Mutation_p.P543R|DLGAP1_ENST00000539435.1_Missense_Mutation_p.P567R|DLGAP1_ENST00000400150.3_Missense_Mutation_p.P575R|DLGAP1_ENST00000400147.2_Missense_Mutation_p.P557R|DLGAP1_ENST00000400155.1_Missense_Mutation_p.P565R|DLGAP1_ENST00000400149.3_Missense_Mutation_p.P549R|DLGAP1_ENST00000581699.1_Missense_Mutation_p.P565R|DLGAP1_ENST00000400145.2_Missense_Mutation_p.P557R|DLGAP1_ENST00000515196.2_Missense_Mutation_p.P859R	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	859					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)		p.P859R(1)|p.P567R(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				ATGAGCATTAGGATTCTGCAC	0.388																																							uc002kmf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(2575-2577)CCT>CGT		discs large homolog-associated protein 1 isoform							67.0	73.0	71.0					18																	3502639		2203	4300	6503	SO:0001583	missense	9229				synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane		g.chr18:3502639G>C	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.2576C>G	18.37:g.3502639G>C	ENSP00000316377:p.Pro859Arg					DLGAP1_uc010wyz.1_Missense_Mutation_p.P859R|DLGAP1_uc002kme.1_Missense_Mutation_p.P557R|DLGAP1_uc010dkn.2_Missense_Mutation_p.P567R|DLGAP1_uc010wyw.1_Missense_Mutation_p.P565R|DLGAP1_uc010wyx.1_Missense_Mutation_p.P581R|DLGAP1_uc010wyy.1_Missense_Mutation_p.P543R|DLGAP1_uc002kmg.2_Missense_Mutation_p.P557R	p.P859R	NM_004746	NP_004737	O14490	DLGP1_HUMAN			9	2643	-		Colorectal(8;0.0257)	859					A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	c.2576C>G	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.556447	0.65425	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	T;T;T;T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9;1.9;1.9;1.9	5.37	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.47266	0.1436	L	0.58925	1.835	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;0.995;0.999;0.995;0.999;0.992;0.983	T	0.49707	-0.8911	10	0.87932	D	0	-10.0374	14.4459	0.67349	0.0714:0.0:0.9286:0.0	.	859;543;555;565;567;557;859;557	B7Z9Y4;B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;O14490-3;O14490;O14490-2	.;.;.;.;.;.;DLGP1_HUMAN;.	R	859;557;575;549;565;543;567;557;859	ENSP00000316377:P859R;ENSP00000383011:P557R;ENSP00000383014:P575R;ENSP00000383013:P549R;ENSP00000383019:P565R;ENSP00000437817:P543R;ENSP00000446312:P567R;ENSP00000383010:P557R;ENSP00000445973:P859R	ENSP00000316377:P859R	P	-	2	0	DLGAP1	3492639	1.000000	0.71417	0.983000	0.44433	0.981000	0.71138	7.976000	0.88070	1.406000	0.46857	0.557000	0.71058	CCT		0.388	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4			15	56	0	0	0	0.003163	0	15	56				
MC2R	4158	broad.mit.edu	37	18	13884810	13884810	+	Silent	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr18:13884810C>T	ENST00000327606.3	-	2	888	c.708G>A	c.(706-708)gtG>gtA	p.V236V		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	236					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)	p.V236V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	GGACATGAAGCACAAAGGGGG	0.547																																					Colon(141;1584 1782 35999 48227 48692)	Colon(141;1584 1782 35999 48227 48692)	uc002ksp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(1)	5						c.(706-708)GTG>GTA		melanocortin 2 receptor	Corticotropin(DB01285)|Cosyntropin(DB01284)						77.0	70.0	73.0					18																	13884810		2203	4300	6503	SO:0001819	synonymous_variant	4158				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	corticotropin receptor activity|protein binding	g.chr18:13884810C>T		CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.708G>A	18.37:g.13884810C>T							p.V236V	NM_000529	NP_000520	Q01718	ACTHR_HUMAN			2	885	-			236			Helical; Name=6; (By similarity).		A8K016|Q3MI45|Q504X6	Silent	SNP	ENST00000327606.3	37	c.708G>A	CCDS11869.1																																																																																				0.547	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254639.2			10	41	0	0	0	0.006214	0	10	41				
NPC1	4864	broad.mit.edu	37	18	21119878	21119878	+	Missense_Mutation	SNP	C	C	A	rs528841924		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr18:21119878C>A	ENST00000269228.5	-	18	3246	c.2692G>T	c.(2692-2694)Gac>Tac	p.D898Y	NPC1_ENST00000412552.2_Missense_Mutation_p.D580Y|NPC1_ENST00000540608.1_5'UTR	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	898					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)	p.D898Y(1)		breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GAAGTGTAGTCGTGCCCTTCC	0.522																																							uc002kum.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2692-2694)GAC>TAC		Niemann-Pick disease, type C1 precursor							102.0	97.0	99.0					18																	21119878		2203	4300	6503	SO:0001583	missense	4864				autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity	g.chr18:21119878C>A	AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.2692G>T	18.37:g.21119878C>A	ENSP00000269228:p.Asp898Tyr					NPC1_uc010xaz.1_Missense_Mutation_p.D631Y|NPC1_uc010xba.1_Missense_Mutation_p.D743Y	p.D898Y	NM_000271	NP_000262	O15118	NPC1_HUMAN			18	2966	-	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)		898					B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	37	c.2692G>T	CCDS11878.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.139158	0.56936	.	.	ENSG00000141458	ENST00000269228;ENST00000412552;ENST00000540608	D;D	0.94376	-3.41;-3.33	5.67	-0.46	0.12175	.	0.256554	0.44902	D	0.000401	D	0.95153	0.8429	M	0.83223	2.63	0.25324	N	0.989096	D;P	0.55605	0.972;0.903	P;P	0.58928	0.848;0.786	D	0.90678	0.4603	10	0.54805	T	0.06	-14.3435	11.5651	0.50800	0.0:0.3615:0.0:0.6385	.	909;898	Q59GR1;O15118	.;NPC1_HUMAN	Y	898;580;743	ENSP00000269228:D898Y;ENSP00000408606:D580Y	ENSP00000269228:D898Y	D	-	1	0	NPC1	19373876	0.000000	0.05858	0.056000	0.19401	0.773000	0.43773	-0.329000	0.07935	-0.319000	0.08652	-0.140000	0.14226	GAC		0.522	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254823.2	NM_000271		16	59	1	0	3.52763e-06	0.00499	4.2508e-06	16	59				
SLC39A6	25800	broad.mit.edu	37	18	33694349	33694349	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr18:33694349C>A	ENST00000590986.1	-	7	1843	c.1554G>T	c.(1552-1554)atG>atT	p.M518I	SLC39A6_ENST00000269187.5_Missense_Mutation_p.M518I|SLC39A6_ENST00000440549.2_Missense_Mutation_p.M243I			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	518					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)	p.M518I(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						CATGAGCTATCATGACCTCTT	0.463																																							uc010dmy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1552-1554)ATG>ATT		solute carrier family 39 (zinc transporter),							153.0	146.0	148.0					18																	33694349		2001	4164	6165	SO:0001583	missense	25800					integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity	g.chr18:33694349C>A	U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.1554G>T	18.37:g.33694349C>A	ENSP00000465915:p.Met518Ile					SLC39A6_uc002kzj.2_Missense_Mutation_p.M243I	p.M518I	NM_012319	NP_036451	Q13433	S39A6_HUMAN			7	1844	-			518			Cytoplasmic (Potential).		B4DR49|B4E224|Q8IXR3|Q96HP5	Missense_Mutation	SNP	ENST00000590986.1	37	c.1554G>T	CCDS42428.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.080396	0.55753	.	.	ENSG00000141424	ENST00000269187;ENST00000543723;ENST00000440549	T;T	0.71341	0.12;-0.56	5.94	5.94	0.96194	.	0.215879	0.56097	D	0.000030	T	0.72153	0.3425	N	0.13098	0.295	0.80722	D	1	B;P	0.52577	0.21;0.954	B;D	0.66351	0.285;0.943	T	0.70364	-0.4892	10	0.29301	T	0.29	-20.1817	17.849	0.88739	0.0:1.0:0.0:0.0	.	518;243	Q13433;Q13433-2	S39A6_HUMAN;.	I	518;243;243	ENSP00000269187:M518I;ENSP00000401139:M243I	ENSP00000269187:M518I	M	-	3	0	SLC39A6	31948347	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.129000	0.77225	2.812000	0.96745	0.557000	0.71058	ATG		0.463	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000444136.1			16	90	1	0	1.33834e-09	0.007413	1.75293e-09	16	90				
NARS	4677	broad.mit.edu	37	18	55269675	55269675	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr18:55269675G>A	ENST00000256854.5	-	13	1882	c.1427C>T	c.(1426-1428)tCa>tTa	p.S476L	NARS_ENST00000423481.2_Missense_Mutation_p.S227L	NM_004539.3	NP_004530.1	O43776	SYNC_HUMAN	asparaginyl-tRNA synthetase	476					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)	p.S476L(1)		breast(1)|endometrium(5)|large_intestine(5)|lung(8)|skin(1)	20		Colorectal(73;0.227)			L-Asparagine(DB00174)	GATACGCATTGAGCCTCCCAC	0.413																																							uc002lgs.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1426-1428)TCA>TTA		asparaginyl-tRNA synthetase	L-Asparagine(DB00174)						109.0	96.0	100.0					18																	55269675		2203	4300	6503	SO:0001583	missense	4677				asparaginyl-tRNA aminoacylation	cytosol|soluble fraction	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding	g.chr18:55269675G>A	D84273	CCDS32837.1	18q21.31	2014-05-06			ENSG00000134440	ENSG00000134440	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	7643	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 1, cytoplasmic"""	108410				6836455, 9421509	Standard	NM_004539		Approved	NARS1	uc002lgs.2	O43776	OTTHUMG00000180125	ENST00000256854.5:c.1427C>T	18.37:g.55269675G>A	ENSP00000256854:p.Ser476Leu					NARS_uc002lgt.2_Missense_Mutation_p.S475L|NARS_uc010xea.1_Missense_Mutation_p.S227L	p.S476L	NM_004539	NP_004530	O43776	SYNC_HUMAN			13	1655	-		Colorectal(73;0.227)	476					B4DG16|Q53GU6	Missense_Mutation	SNP	ENST00000256854.5	37	c.1427C>T	CCDS32837.1	.	.	.	.	.	.	.	.	.	.	G	33	5.208243	0.95033	.	.	ENSG00000134440	ENST00000256854;ENST00000423481	D;D	0.82255	-1.59;-1.59	6.16	6.16	0.99307	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.95705	0.8603	H	0.99357	4.53	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96779	0.9574	10	0.87932	D	0	.	20.4549	0.99139	0.0:0.0:1.0:0.0	.	227;476	B4DN60;O43776	.;SYNC_HUMAN	L	476;227	ENSP00000256854:S476L;ENSP00000407919:S227L	ENSP00000256854:S476L	S	-	2	0	NARS	53420673	1.000000	0.71417	0.973000	0.42090	0.655000	0.38815	9.436000	0.97532	2.937000	0.99478	0.650000	0.86243	TCA		0.413	NARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449872.2	NM_004539		7	37	0	0	0	0.00308	0	7	37				
KIAA1468	57614	broad.mit.edu	37	18	59895607	59895607	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr18:59895607G>T	ENST00000398130.2	+	8	1456	c.1224G>T	c.(1222-1224)ttG>ttT	p.L408F	KIAA1468_ENST00000256858.6_Missense_Mutation_p.L408F	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	408								p.L408F(1)		autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				AGCCTCCTTTGGATCAGTTGC	0.418																																							uc002lil.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6						c.(1222-1224)TTG>TTT		hypothetical protein LOC57614							130.0	125.0	127.0					18																	59895607		2203	4300	6503	SO:0001583	missense	57614						binding	g.chr18:59895607G>T	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.1224G>T	18.37:g.59895607G>T	ENSP00000381198:p.Leu408Phe					KIAA1468_uc002lik.1_Missense_Mutation_p.L408F|KIAA1468_uc010xel.1_Missense_Mutation_p.L408F|KIAA1468_uc002lim.2_Missense_Mutation_p.L52F	p.L408F	NM_020854	NP_065905	Q9P260	K1468_HUMAN			8	1439	+		Colorectal(73;0.186)	408						Missense_Mutation	SNP	ENST00000398130.2	37	c.1224G>T	CCDS11979.2	.	.	.	.	.	.	.	.	.	.	G	9.821	1.185702	0.21870	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	.	.	.	6.17	2.47	0.30058	.	0.843109	0.10865	N	0.625676	T	0.29850	0.0746	N	0.19112	0.55	0.30139	N	0.804102	B;B;B	0.27264	0.007;0.173;0.141	B;B;B	0.34779	0.017;0.189;0.143	T	0.38650	-0.9651	8	.	.	.	0.0116	8.5144	0.33237	0.4937:0.0:0.5063:0.0	.	408;408;52	Q9P260-2;Q9P260;B2RD46	.;K1468_HUMAN;.	F	408	.	.	L	+	3	2	KIAA1468	58046587	0.997000	0.39634	0.471000	0.27229	0.332000	0.28634	1.367000	0.34204	0.185000	0.20105	0.655000	0.94253	TTG		0.418	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854		4	127	1	0	0.00116845	0.001168	0.00132204	4	127				
SERPINB13	5275	broad.mit.edu	37	18	61264451	61264451	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr18:61264451G>T	ENST00000344731.5	+	8	1132	c.1030G>T	c.(1030-1032)Gag>Tag	p.E344*	SERPINB13_ENST00000269489.5_Nonsense_Mutation_p.E292*	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	344					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.E344*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						GGAAGGCACCGAGGCTGCAGC	0.542																																							uc002ljc.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1030-1032)GAG>TAG		serine (or cysteine) proteinase inhibitor, clade							62.0	54.0	57.0					18																	61264451		2203	4300	6503	SO:0001587	stop_gained	5275				regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity	g.chr18:61264451G>T	AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.1030G>T	18.37:g.61264451G>T	ENSP00000341584:p.Glu344*					SERPINB13_uc002ljd.2_Nonsense_Mutation_p.E208*|SERPINB13_uc010xep.1_Nonsense_Mutation_p.E353*|SERPINB13_uc010xeq.1_Nonsense_Mutation_p.E165*|SERPINB13_uc010xer.1_Nonsense_Mutation_p.E165*	p.E344*	NM_012397	NP_036529	Q9UIV8	SPB13_HUMAN			8	1198	+			344					A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Nonsense_Mutation	SNP	ENST00000344731.5	37	c.1030G>T	CCDS11985.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457007	0.84317	.	.	ENSG00000197641	ENST00000269489;ENST00000539341;ENST00000344731	.	.	.	5.3	5.3	0.74995	.	0.000000	0.52532	D	0.000063	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.9629	0.89091	0.0:0.0:1.0:0.0	.	.	.	.	X	292;262;344	.	ENSP00000269489:E292X	E	+	1	0	SERPINB13	59415431	1.000000	0.71417	0.736000	0.30914	0.033000	0.12548	6.650000	0.74368	2.494000	0.84150	0.557000	0.71058	GAG		0.542	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133798.1	NM_012397		9	47	1	0	1.12685e-05	0.004482	1.33779e-05	9	47				
DSEL	92126	broad.mit.edu	37	18	65181026	65181026	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr18:65181026C>A	ENST00000310045.7	-	2	2323	c.850G>T	c.(850-852)Gat>Tat	p.D284Y	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	274					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.D284Y(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				ACACCTTCATCCAAAGAACCA	0.378																																							uc002lke.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6						c.(850-852)GAT>TAT		dermatan sulfate epimerase-like							88.0	88.0	88.0					18																	65181026		2203	4300	6503	SO:0001583	missense	92126					integral to membrane	isomerase activity|sulfotransferase activity	g.chr18:65181026C>A	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.850G>T	18.37:g.65181026C>A	ENSP00000310565:p.Asp284Tyr						p.D284Y	NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN			2	2074	-		Esophageal squamous(42;0.129)	274					Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	c.850G>T	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977753	0.53720	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.39592	1.07	4.95	4.95	0.65309	.	0.000000	0.85682	U	0.000000	T	0.57388	0.2050	L	0.42581	1.335	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.51490	-0.8699	10	0.30078	T	0.28	.	18.5703	0.91133	0.0:1.0:0.0:0.0	.	274	Q8IZU8	DSEL_HUMAN	Y	284;274	ENSP00000310565:D284Y	ENSP00000310565:D284Y	D	-	1	0	DSEL	63332006	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.884000	0.69729	2.478000	0.83669	0.555000	0.69702	GAT		0.378	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160		12	92	1	0	1.61879e-10	0.013537	2.15541e-10	12	92				
CCDC102B	79839	broad.mit.edu	37	18	66504350	66504350	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr18:66504350G>T	ENST00000360242.5	+	2	467	c.350G>T	c.(349-351)aGg>aTg	p.R117M	CCDC102B_ENST00000319445.6_Missense_Mutation_p.R117M|CCDC102B_ENST00000584156.1_Missense_Mutation_p.R117M|CCDC102B_ENST00000577772.1_3'UTR|CCDC102B_ENST00000358653.5_Missense_Mutation_p.R117M	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	117								p.R117M(1)		breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				AACAGTGCCAGGGAGGAAGGA	0.463																																							uc002lkk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(349-351)AGG>ATG		coiled-coil domain containing 102B							89.0	88.0	88.0					18																	66504350		1931	4133	6064	SO:0001583	missense	79839							g.chr18:66504350G>T	AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.350G>T	18.37:g.66504350G>T	ENSP00000353377:p.Arg117Met					CCDC102B_uc002lki.2_Missense_Mutation_p.R117M|CCDC102B_uc002lkj.1_Missense_Mutation_p.R117M	p.R117M	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN			4	573	+		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)	117			Potential.		Q7Z467|Q8NDK7|Q9H5C1	Missense_Mutation	SNP	ENST00000360242.5	37	c.350G>T	CCDS11996.2	.	.	.	.	.	.	.	.	.	.	G	13.71	2.317027	0.40996	.	.	ENSG00000150636	ENST00000319445;ENST00000358653;ENST00000360242	T;T;T	0.50001	0.76;0.76;0.76	5.24	4.36	0.52297	.	0.190173	0.34411	N	0.003986	T	0.54838	0.1883	L	0.34521	1.04	0.36220	D	0.851929	D;D	0.89917	1.0;1.0	D;D	0.70935	0.971;0.961	T	0.64803	-0.6321	10	0.72032	D	0.01	-10.3358	11.0052	0.47629	0.0866:0.0:0.9134:0.0	.	117;117	Q68D86-3;Q68D86	.;C102B_HUMAN	M	117	ENSP00000316237:R117M;ENSP00000351479:R117M;ENSP00000353377:R117M	ENSP00000316237:R117M	R	+	2	0	CCDC102B	64655330	1.000000	0.71417	0.995000	0.50966	0.967000	0.64934	3.260000	0.51523	1.207000	0.43291	0.460000	0.39030	AGG		0.463	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256225.2	NM_024781		9	57	1	0	0.000274275	0.004482	0.000313272	9	57				
STK11	6794	broad.mit.edu	37	19	1218415	1218415	+	Splice_Site	SNP	G	G	T	rs112675807		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:1218415G>T	ENST00000326873.7	+	2	1463		c.e2-1		STK11_ENST00000585748.1_Splice_Site	NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11						activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(4)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTGTCCCAGGGAAATTCAA	0.522		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		24	Whole gene deletion(20)|Unknown(4)	p.0?(19)|p.?(3)	cervix(16)|lung(4)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CS004815|CS982372	STK11	S	rs112675807	c.e2-1		serine/threonine protein kinase 11							144.0	150.0	148.0					19																	1218415		2025	4175	6200	SO:0001630	splice_region_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1218415G>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.291-1G>T	19.37:g.1218415G>T		TSP Lung(3;<1E-08)					p.K97_splice	NM_000455	NP_000446	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	2	1406	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)						B2RBX7|E7EW76	Splice_Site	SNP	ENST00000326873.7	37	c.291_splice	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.635489	0.47049	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	.	.	.	4.03	4.03	0.46877	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1716	0.72878	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STK11	1169415	1.000000	0.71417	0.922000	0.36590	0.384000	0.30261	9.594000	0.98254	1.810000	0.52873	0.436000	0.28706	.		0.522	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	Intron	45	69	1	0	9.58827e-17	0.01441	1.40047e-16	45	69				
DOT1L	84444	broad.mit.edu	37	19	2191240	2191240	+	Splice_Site	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:2191240G>T	ENST00000398665.3	+	5	529		c.e5+1			NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase						histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)	p.?(2)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGGGGAGCGGTGAGTGTCGC	0.607																																							uc002lvb.3		NA																	2	Unknown(2)		lung(2)	pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4						c.e5+1		DOT1-like, histone H3 methyltransferase							74.0	86.0	82.0					19																	2191240		2129	4238	6367	SO:0001630	splice_region_variant	84444					nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding	g.chr19:2191240G>T	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.493+1G>T	19.37:g.2191240G>T							p.G165_splice	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	5	529	+		Hepatocellular(1079;0.137)						O60379|Q96JL1	Splice_Site	SNP	ENST00000398665.3	37	c.493_splice	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351039	0.82132	.	.	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000452696	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8206	0.85745	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOT1L	2142240	1.000000	0.71417	0.992000	0.48379	0.847000	0.48162	9.169000	0.94788	2.198000	0.70561	0.561000	0.74099	.		0.607	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	Intron	14	28	1	0	1.15088e-07	0.004007	1.43711e-07	14	28				
ARRDC5	645432	broad.mit.edu	37	19	4891298	4891298	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:4891298G>T	ENST00000381781.2	-	3	788	c.789C>A	c.(787-789)aaC>aaA	p.N263K	AC027319.1_ENST00000408608.1_RNA	NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	263								p.N263K(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		CCTTGGTGGTGTTGAAGCGGG	0.622																																							uc002mbm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(787-789)AAC>AAA		arrestin domain containing 5							86.0	99.0	95.0					19																	4891298		2113	4218	6331	SO:0001583	missense	645432				signal transduction			g.chr19:4891298G>T		CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.789C>A	19.37:g.4891298G>T	ENSP00000371200:p.Asn263Lys						p.N263K	NM_001080523	NP_001073992	A6NEK1	ARRD5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)	3	789	-			263						Missense_Mutation	SNP	ENST00000381781.2	37	c.789C>A	CCDS45929.1	.	.	.	.	.	.	.	.	.	.	G	0.124	-1.122068	0.01785	.	.	ENSG00000205784	ENST00000381781	T	0.16897	2.31	4.91	1.65	0.23941	Immunoglobulin E-set (1);Arrestin-like, C-terminal (1);	1.778900	0.02913	N	0.136977	T	0.11153	0.0272	L	0.27053	0.805	0.09310	N	1	B	0.28820	0.224	B	0.31495	0.131	T	0.25187	-1.0139	10	0.05620	T	0.96	-10.4339	3.958	0.09398	0.2894:0.1784:0.5322:0.0	.	263	A6NEK1	ARRD5_HUMAN	K	263	ENSP00000371200:N263K	ENSP00000371200:N263K	N	-	3	2	ARRDC5	4842298	0.537000	0.26386	0.117000	0.21633	0.014000	0.08584	0.607000	0.24209	0.744000	0.32741	-0.145000	0.13849	AAC		0.622	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450443.1	XM_292803		27	48	1	0	8.24728e-16	0.004656	1.18309e-15	27	48				
SMARCA4	6597	broad.mit.edu	37	19	11136141	11136141	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:11136141T>C	ENST00000429416.3	+	23	3406	c.3125T>C	c.(3124-3126)cTg>cCg	p.L1042P	SMARCA4_ENST00000344626.4_Missense_Mutation_p.L1042P|SMARCA4_ENST00000541122.2_Missense_Mutation_p.L1042P|SMARCA4_ENST00000358026.2_Missense_Mutation_p.L1042P|SMARCA4_ENST00000589677.1_Missense_Mutation_p.L1042P|SMARCA4_ENST00000413806.3_Missense_Mutation_p.L1042P|SMARCA4_ENST00000444061.3_Missense_Mutation_p.L1042P|SMARCA4_ENST00000450717.3_Missense_Mutation_p.L1042P|SMARCA4_ENST00000590574.1_Missense_Mutation_p.L1042P	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1042					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.L1042P(2)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				ATCATGCAGCTGCGGAAGATC	0.632			"""F, N, Mis"""		NSCLC																																		uc002mqf.3		NA		Rec	yes		19	19p13.2	6597	F|N|Mis	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""			E			NSCLC		3	Substitution - Missense(2)|Unknown(1)	p.?(1)	lung(3)	lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67						c.(3124-3126)CTG>CCG		SWI/SNF-related matrix-associated							116.0	93.0	101.0					19																	11136141		2203	4300	6503	SO:0001583	missense	6597	Rhabdoid_Predisposition_syndrome			chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	g.chr19:11136141T>C	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3125T>C	19.37:g.11136141T>C	ENSP00000395654:p.Leu1042Pro					SMARCA4_uc010dxp.2_Missense_Mutation_p.L1042P|SMARCA4_uc010dxo.2_Missense_Mutation_p.L1042P|SMARCA4_uc002mqg.1_Missense_Mutation_p.L1042P|SMARCA4_uc010dxq.2_Missense_Mutation_p.L1042P|SMARCA4_uc010dxr.2_Missense_Mutation_p.L1042P|SMARCA4_uc002mqj.3_Missense_Mutation_p.L1042P|SMARCA4_uc010dxs.2_Missense_Mutation_p.L1042P|SMARCA4_uc010dxt.1_Missense_Mutation_p.L262P|SMARCA4_uc002mqh.3_Missense_Mutation_p.L165P|SMARCA4_uc002mqi.1_Missense_Mutation_p.L245P	p.L1042P	NM_003072	NP_003063	P51532	SMCA4_HUMAN			22	3409	+		all_lung(6;0.0512)|Lung NSC(9;0.0568)	1042					B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	c.3125T>C	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.432852	0.83776	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69;-1.69;-1.69	4.79	4.79	0.61399	SNF2-related (1);	0.000000	0.64402	D	0.000007	D	0.94420	0.8205	H	0.98664	4.295	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.997;0.999;0.999;0.999	D	0.96141	0.9100	10	0.87932	D	0	-30.629	13.4377	0.61094	0.0:0.0:0.0:1.0	.	1042;1042;1042;1042;1042;262;1042;1042	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	P	1042;1042;1106;1042;1042;1042;1042;1042	ENSP00000395654:L1042P;ENSP00000350720:L1042P;ENSP00000343896:L1042P;ENSP00000445036:L1042P;ENSP00000392837:L1042P;ENSP00000397783:L1042P;ENSP00000414727:L1042P	ENSP00000343896:L1042P	L	+	2	0	SMARCA4	10997141	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.669000	0.83911	2.012000	0.59069	0.533000	0.62120	CTG		0.632	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		19	27	0	0	0	0.008871	0	19	27				
SIN3B	23309	broad.mit.edu	37	19	16942395	16942395	+	Silent	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:16942395C>T	ENST00000248054.5	+	3	339	c.318C>T	c.(316-318)ctC>ctT	p.L106L	SIN3B_ENST00000379803.1_Silent_p.L106L|SIN3B_ENST00000596802.1_Silent_p.L106L					SIN3 transcription regulator family member B									p.L106L(2)		endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						TTCTTCCCCTCGGATATAGAA	0.488																																							uc002ney.1		NA																	2	Substitution - coding silent(2)		lung(1)|endometrium(1)	ovary(2)	2						c.(316-318)CTC>CTT		SIN3 homolog B, transcription regulator							171.0	156.0	161.0					19																	16942395		2203	4300	6503	SO:0001819	synonymous_variant	23309				cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	protein binding	g.chr19:16942395C>T	AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.318C>T	19.37:g.16942395C>T						SIN3B_uc002new.2_Silent_p.L106L|SIN3B_uc002nex.2_Silent_p.L38L|SIN3B_uc002nez.1_Silent_p.L106L	p.L106L	NM_015260	NP_056075	O75182	SIN3B_HUMAN			3	332	+			106			PAH 1.			Silent	SNP	ENST00000248054.5	37	c.318C>T																																																																																					0.488	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260		41	118	0	0	0	0.00623	0	41	118				
MAST3	23031	broad.mit.edu	37	19	18235123	18235123	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:18235123G>C	ENST00000262811.6	+	9	805	c.805G>C	c.(805-807)Gtc>Ctc	p.V269L	MAST3_ENST00000608648.1_3'UTR	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	269							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.V291L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						CGTCCAGCTTGTCCGGAAACT	0.602																																							uc002nhz.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(2)|stomach(1)	5						c.(805-807)GTC>CTC		microtubule associated serine/threonine kinase							72.0	76.0	75.0					19																	18235123		2148	4251	6399	SO:0001583	missense	23031						ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr19:18235123G>C	AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.805G>C	19.37:g.18235123G>C	ENSP00000262811:p.Val269Leu						p.V269L	NM_015016	NP_055831	O60307	MAST3_HUMAN			9	805	+			269					Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	ENST00000262811.6	37	c.805G>C	CCDS46014.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267946	0.80469	.	.	ENSG00000099308	ENST00000262811	T	0.35048	1.33	4.31	4.31	0.51392	Microtubule-associated serine/threonine-protein kinase, domain (1);Microtubule-associated serine/threonine-protein kinase, pre-PK domain (2);	0.058921	0.64402	D	0.000002	T	0.55433	0.1920	M	0.89968	3.075	0.51012	D	0.999906	P	0.41978	0.767	P	0.46339	0.513	T	0.68561	-0.5376	10	0.72032	D	0.01	-47.2356	16.1107	0.81261	0.0:0.0:1.0:0.0	.	269	O60307	MAST3_HUMAN	L	269	ENSP00000262811:V269L	ENSP00000262811:V269L	V	+	1	0	MAST3	18096123	1.000000	0.71417	0.976000	0.42696	0.960000	0.62799	9.702000	0.98712	2.118000	0.64928	0.491000	0.48974	GTC		0.602	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150		3	8	0	0	0	0.004672	0	3	8				
GPI	2821	broad.mit.edu	37	19	34868453	34868453	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:34868453A>G	ENST00000356487.5	+	5	689	c.448A>G	c.(448-450)Acg>Gcg	p.T150A	GPI_ENST00000415930.3_Intron|GPI_ENST00000586425.1_Missense_Mutation_p.T150A	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	150					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)	p.T150A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					CAAGACCATCACGGACGTCAT	0.607																																							uc002nvg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(448-450)ACG>GCG		glucose phosphate isomerase							117.0	98.0	105.0					19																	34868453		2203	4300	6503	SO:0001583	missense	2821				angiogenesis|gluconeogenesis|glycolysis|hemostasis|humoral immune response	cytosol|extracellular space|nucleus|plasma membrane	cytokine activity|glucose-6-phosphate isomerase activity|growth factor activity	g.chr19:34868453A>G	M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.448A>G	19.37:g.34868453A>G	ENSP00000348877:p.Thr150Ala					GPI_uc002nvf.2_Missense_Mutation_p.T189A|GPI_uc010xrv.1_Intron|GPI_uc010xrw.1_Intron|GPI_uc010edl.1_Missense_Mutation_p.T150A	p.T150A	NM_000175	NP_000166	P06744	G6PI_HUMAN			5	551	+	Esophageal squamous(110;0.162)		150					B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	ENST00000356487.5	37	c.448A>G	CCDS12437.1	.	.	.	.	.	.	.	.	.	.	A	18.47	3.630803	0.67015	.	.	ENSG00000105220	ENST00000356487	D	0.94537	-3.45	5.82	3.66	0.41972	.	0.086416	0.85682	D	0.000000	D	0.96935	0.8999	M	0.92784	3.345	0.53005	D	0.999964	P;B	0.41673	0.759;0.154	P;B	0.53760	0.734;0.204	D	0.96032	0.9017	10	0.87932	D	0	.	10.9768	0.47472	0.7503:0.0:0.0:0.2497	.	133;150	B4DVJ0;P06744	.;G6PI_HUMAN	A	150	ENSP00000348877:T150A	ENSP00000348877:T150A	T	+	1	0	GPI	39560293	1.000000	0.71417	0.956000	0.39512	0.910000	0.53928	5.250000	0.65432	0.414000	0.25790	0.533000	0.62120	ACG		0.607	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451693.3			20	60	0	0	0	0.016522	0	20	60				
ATP4A	495	broad.mit.edu	37	19	36053478	36053478	+	Silent	SNP	T	T	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:36053478T>C	ENST00000262623.3	-	4	307	c.279A>G	c.(277-279)ccA>ccG	p.P93P		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	93					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.P93P(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	TGCCCCGTGGTGGCCGCAGTG	0.706																																							uc002oal.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(277-279)CCA>CCG		hydrogen/potassium-exchanging ATPase 4A	Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)						19.0	19.0	19.0					19																	36053478		2197	4297	6494	SO:0001819	synonymous_variant	495				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding	g.chr19:36053478T>C		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.279A>G	19.37:g.36053478T>C							p.P93P	NM_000704	NP_000695	P20648	ATP4A_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)		4	308	-	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		93			Cytoplasmic (Potential).		O00738	Silent	SNP	ENST00000262623.3	37	c.279A>G	CCDS12467.1																																																																																				0.706	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704		5	16	0	0	0	0.014758	0	5	16				
ZNF382	84911	broad.mit.edu	37	19	37117732	37117732	+	Silent	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:37117732C>T	ENST00000292928.2	+	5	1046	c.933C>T	c.(931-933)ctC>ctT	p.L311L	CTD-3234P18.2_ENST00000585467.1_lincRNA|ZNF382_ENST00000435416.1_Silent_p.L310L|ZNF382_ENST00000439428.1_Silent_p.L310L|ZNF382_ENST00000423582.1_Silent_p.L262L	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	311	Required for transcriptional repression activity; probably mediates sequence- specific DNA-binding. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L311L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AGTCATACCTCATTGAACATC	0.423																																							uc002oek.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(931-933)CTC>CTT		zinc finger protein 382							95.0	95.0	95.0					19																	37117732		2203	4300	6503	SO:0001819	synonymous_variant	84911				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37117732C>T	AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.933C>T	19.37:g.37117732C>T						ZNF382_uc010efa.2_Silent_p.L262L|ZNF382_uc010efb.2_Silent_p.L310L|ZNF382_uc002oel.2_Silent_p.L310L	p.L311L	NM_032825	NP_116214	Q96SR6	ZN382_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)		5	1046	+	Esophageal squamous(110;0.198)		311			Required for transcriptional repression activity; probably mediates sequence- specific DNA-binding (By similarity).|C2H2-type 2.		A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Silent	SNP	ENST00000292928.2	37	c.933C>T	CCDS33004.1																																																																																				0.423	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109562.2	NM_032825		32	93	0	0	0	0.009535	0	32	93				
ZFP30	22835	broad.mit.edu	37	19	38126075	38126075	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:38126075T>C	ENST00000351218.2	-	6	1924	c.1367A>G	c.(1366-1368)cAt>cGt	p.H456R	ZFP30_ENST00000392144.1_Missense_Mutation_p.H456R|ZFP30_ENST00000589018.1_Intron|ZFP30_ENST00000514101.2_Missense_Mutation_p.H456R	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	456					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H456R(1)		autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AATACTTTGATGTTGGGTAAG	0.373																																							uc002ogv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1366-1368)CAT>CGT		zinc finger protein 30 homolog							86.0	79.0	81.0					19																	38126075		2203	4300	6503	SO:0001583	missense	22835				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38126075T>C	AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.1367A>G	19.37:g.38126075T>C	ENSP00000343581:p.His456Arg					ZFP30_uc002ogw.1_Missense_Mutation_p.H456R|ZFP30_uc002ogx.1_Missense_Mutation_p.H456R|ZFP30_uc010xtt.1_Missense_Mutation_p.H455R	p.H456R	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1883	-			456			C2H2-type 11.		Q58EY8	Missense_Mutation	SNP	ENST00000351218.2	37	c.1367A>G	CCDS33005.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.527593	0.64860	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144;ENST00000440715	D;D;D	0.86865	-2.18;-2.18;-2.18	3.9	3.9	0.45041	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36034	N	0.002825	D	0.95449	0.8522	H	0.97587	4.035	0.44485	D	0.997428	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96309	0.9227	10	0.87932	D	0	.	12.1114	0.53842	0.0:0.0:0.0:1.0	.	456;456	D3Y2A0;Q9Y2G7	.;ZFP30_HUMAN	R	456;456;456;371	ENSP00000343581:H456R;ENSP00000422930:H456R;ENSP00000375988:H456R	ENSP00000343581:H456R	H	-	2	0	ZFP30	42817915	1.000000	0.71417	0.991000	0.47740	0.985000	0.73830	3.683000	0.54663	1.764000	0.52075	0.482000	0.46254	CAT		0.373	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109601.2	NM_014898		19	51	0	0	0	0.006122	0	19	51				
FCGBP	8857	broad.mit.edu	37	19	40420130	40420130	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:40420130G>A	ENST00000221347.6	-	6	2871	c.2864C>T	c.(2863-2865)gCa>gTa	p.A955V		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	955	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)		p.A955V(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCCATCTGCTGCTTGGAAGGG	0.572																																							uc002omp.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(4)|central_nervous_system(1)	9						c.(2863-2865)GCA>GTA		Fc fragment of IgG binding protein precursor							47.0	45.0	46.0					19																	40420130		2203	4300	6503	SO:0001583	missense	8857					extracellular region	protein binding	g.chr19:40420130G>A	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.2864C>T	19.37:g.40420130G>A	ENSP00000221347:p.Ala955Val						p.A955V	NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		6	2872	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		955			VWFD 2.		O95784	Missense_Mutation	SNP	ENST00000221347.6	37	c.2864C>T	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	G	8.865	0.947941	0.18356	.	.	ENSG00000090920	ENST00000221347	T	0.59638	0.25	4.84	4.84	0.62591	von Willebrand factor, type D domain (3);	0.674149	0.12888	N	0.430840	T	0.62490	0.2432	N	0.25957	0.775	0.09310	N	1	D	0.76494	0.999	D	0.91635	0.999	T	0.52162	-0.8612	10	0.09084	T	0.74	.	15.4967	0.75658	0.0:0.0:1.0:0.0	.	955	Q9Y6R7	FCGBP_HUMAN	V	955	ENSP00000221347:A955V	ENSP00000221347:A955V	A	-	2	0	FCGBP	45111970	0.003000	0.15002	0.154000	0.22540	0.010000	0.07245	1.142000	0.31540	2.528000	0.85240	0.561000	0.74099	GCA		0.572	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		4	51	0	0	0	0.001168	0	4	51				
ZNF780A	284323	broad.mit.edu	37	19	40581425	40581425	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:40581425C>A	ENST00000595687.2	-	6	1133	c.924G>T	c.(922-924)aaG>aaT	p.K308N	ZNF780A_ENST00000340963.5_Missense_Mutation_p.K308N|ZNF780A_ENST00000450241.2_Missense_Mutation_p.K274N|ZNF780A_ENST00000414720.2_Intron|ZNF780A_ENST00000594395.1_Missense_Mutation_p.K309N|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000455521.1_Missense_Mutation_p.K309N	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	308					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K274N(1)|p.K309N(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TCCCACATTCCTTACATACAA	0.388																																							uc002omy.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(922-924)AAG>AAT		zinc finger protein 780A isoform b							174.0	169.0	171.0					19																	40581425		2203	4300	6503	SO:0001583	missense	284323				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:40581425C>A	AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.924G>T	19.37:g.40581425C>A	ENSP00000472189:p.Lys308Asn					ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Missense_Mutation_p.K308N|ZNF780A_uc010xvh.1_Missense_Mutation_p.K309N	p.K308N	NM_001010880	NP_001010880	O75290	Z780A_HUMAN			6	1149	-	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)		308			C2H2-type 6.		E9PB48|Q6ZN87	Missense_Mutation	SNP	ENST00000595687.2	37	c.924G>T	CCDS33026.2	.	.	.	.	.	.	.	.	.	.	C	12.43	1.935187	0.34189	.	.	ENSG00000197782	ENST00000450241;ENST00000455521;ENST00000340963	T;T	0.21543	2.0;2.0	1.53	-2.39	0.06602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15912	0.0383	L	0.33093	0.98	0.18873	N	0.999988	B;P	0.52577	0.322;0.954	B;P	0.54210	0.086;0.745	T	0.18935	-1.0321	9	0.09590	T	0.72	.	0.3799	0.00393	0.2501:0.3026:0.2482:0.1991	.	309;308	E9PB48;O75290	.;Z780A_HUMAN	N	308;309;308	ENSP00000400997:K309N;ENSP00000341507:K308N	ENSP00000341507:K308N	K	-	3	2	ZNF780A	45273265	.	.	0.411000	0.26484	0.944000	0.59088	.	.	-0.072000	0.12864	0.305000	0.20034	AAG		0.388	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880		58	174	1	0	3.91957e-13	0.01441	5.33682e-13	58	174				
CYP2B7P	1556	broad.mit.edu	37	19	41442419	41442419	+	RNA	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:41442419C>T	ENST00000599198.1	+	0	511					NR_001278.1													p.L153L(1)		NS(1)|endometrium(6)|kidney(1)|lung(2)|ovary(1)|skin(1)	12						GGCTCAGTGTCTGATAGAGGA	0.542																																							uc010ehg.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(457-459)CTG>TTG		SubName: Full=Cytochrome P450 2B7 short isoform; SubName: Full=CYP2B protein;																																						1556							g.chr19:41442419C>T																													19.37:g.41442419C>T						CYP2A7_uc002opo.2_Intron|CYP2B7P1_uc010ehh.1_Silent_p.L153L|CYP2B7P1_uc002opq.2_RNA	p.L153L							3	465	+									Silent	SNP	ENST00000599198.1	37	c.457C>T																																																																																					0.542	CYP2B7P1-006	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000465180.1			5	17	0	0	0	0.014758	0	5	17				
MARK4	57787	broad.mit.edu	37	19	45805827	45805827	+	Silent	SNP	C	C	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:45805827C>G	ENST00000262891.4	+	17	2449	c.2118C>G	c.(2116-2118)ccC>ccG	p.P706P	MARK4_ENST00000300843.4_3'UTR	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	706	KA1. {ECO:0000255|PROSITE- ProRule:PRU00565}.				microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CGGGCGGGCCCGAGCCCCTGT	0.741																																							uc002pbb.1		NA																	0				central_nervous_system(2)|large_intestine(1)	3						c.(2116-2118)CCC>CCG		RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;																																				SO:0001819	synonymous_variant	57787				microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding	g.chr19:45805827C>G	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.2118C>G	19.37:g.45805827C>G						MARK4_uc002pba.1_3'UTR	p.P706P			Q96L34	MARK4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0102)	17	2123	+		all_neural(266;0.224)|Ovarian(192;0.231)	706			KA1.		Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Silent	SNP	ENST00000262891.4	37	c.2118C>G	CCDS56097.1																																																																																				0.741	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417		4	3	0	0	0	0.001168	0	4	3				
ZC3H4	23211	broad.mit.edu	37	19	47585439	47585439	+	Splice_Site	SNP	A	A	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:47585439A>T	ENST00000253048.5	-	10	1368		c.e10+1		ZC3H4_ENST00000594019.1_Intron|RN7SL533P_ENST00000584468.1_RNA	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4								metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.?(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		ACTAAAGGATATCGTGCATAT	0.468																																							uc002pga.3		NA																	1	Unknown(1)		lung(1)	skin(4)|ovary(2)	6						c.e10+1		zinc finger CCCH-type containing 4							153.0	143.0	146.0					19																	47585439		1985	4169	6154	SO:0001630	splice_region_variant	23211						nucleic acid binding|zinc ion binding	g.chr19:47585439A>T	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.1330+1T>A	19.37:g.47585439A>T						ZC3H4_uc002pgb.1_Intron	p.G444_splice	NM_015168	NP_055983	Q9UPT8	ZC3H4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)	10	1368	-		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)						Q9Y420	Splice_Site	SNP	ENST00000253048.5	37	c.1330_splice	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.685776	0.88639	.	.	ENSG00000130749	ENST00000253048	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2514	0.73549	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZC3H4	52277279	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	9.034000	0.93747	2.244000	0.73946	0.533000	0.62120	.		0.468	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		Intron	34	72	0	0	0	0.019004	0	34	72				
GRIN2D	2906	broad.mit.edu	37	19	48922550	48922550	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:48922550G>T	ENST00000263269.3	+	8	1883	c.1795G>T	c.(1795-1797)Gtc>Ttc	p.V599F		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	599					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.V599F(1)		autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGTGGTCGCCGTCACTGTTTT	0.607																																							uc002pjc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(3)	6						c.(1795-1797)GTC>TTC		N-methyl-D-aspartate receptor subunit 2D	L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Orphenadrine(DB01173)						149.0	99.0	116.0					19																	48922550		2203	4300	6503	SO:0001583	missense	2906					cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|protein binding	g.chr19:48922550G>T	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.1795G>T	19.37:g.48922550G>T	ENSP00000263269:p.Val599Phe					GRIN2D_uc010elx.2_5'UTR	p.V599F	NM_000836	NP_000827	O15399	NMDE4_HUMAN		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	8	1883	+		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)	599			Helical; (Potential).			Missense_Mutation	SNP	ENST00000263269.3	37	c.1795G>T	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.897223	0.72639	.	.	ENSG00000105464	ENST00000263269	T	0.57752	0.38	4.33	4.33	0.51752	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.64402	D	0.000001	T	0.58206	0.2106	N	0.20530	0.585	0.49915	D	0.999832	D	0.76494	0.999	D	0.76575	0.988	T	0.62201	-0.6904	10	0.49607	T	0.09	.	16.1361	0.81490	0.0:0.0:1.0:0.0	.	599	O15399	NMDE4_HUMAN	F	599	ENSP00000263269:V599F	ENSP00000263269:V599F	V	+	1	0	GRIN2D	53614362	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	2.501000	0.45389	2.421000	0.82119	0.655000	0.94253	GTC		0.607	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1			21	43	1	0	1.40151e-16	0.010504	2.03472e-16	21	43				
VN1R2	317701	broad.mit.edu	37	19	53762797	53762797	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:53762797A>G	ENST00000341702.3	+	1	1253	c.1169A>G	c.(1168-1170)cAt>cGt	p.H390R	VN1R2_ENST00000598458.1_Intron	NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	390					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)	p.H390R(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		CGATTCTTTCATGATTTCAGG	0.443																																							uc002qbi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1168-1170)CAT>CGT		vomeronasal 1 receptor 2							93.0	92.0	92.0					19																	53762797		2203	4300	6503	SO:0001583	missense	317701				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity	g.chr19:53762797A>G	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.1169A>G	19.37:g.53762797A>G	ENSP00000351244:p.His390Arg						p.H390R	NM_173856	NP_776255	Q8NFZ6	VN1R2_HUMAN		GBM - Glioblastoma multiforme(134;0.00301)	1	1253	+			390			Cytoplasmic (Potential).		A1L411|Q8TDU4	Missense_Mutation	SNP	ENST00000341702.3	37	c.1169A>G	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	A	11.19	1.564593	0.27915	.	.	ENSG00000196131	ENST00000341702	T	0.08458	3.09	2.58	-1.39	0.08997	.	.	.	.	.	T	0.04318	0.0119	N	0.08118	0	0.09310	N	1	P	0.36647	0.563	B	0.40602	0.334	T	0.36939	-0.9727	9	0.51188	T	0.08	.	3.2387	0.06773	0.3625:0.2155:0.0:0.422	.	390	Q8NFZ6	VN1R2_HUMAN	R	390	ENSP00000351244:H390R	ENSP00000351244:H390R	H	+	2	0	VN1R2	58454609	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.728000	0.04925	-0.383000	0.07858	-0.448000	0.05591	CAT		0.443	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856		32	67	0	0	0	0.010818	0	32	67				
TPO	7173	broad.mit.edu	37	2	1499849	1499849	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:1499849A>G	ENST00000345913.4	+	12	2186	c.2095A>G	c.(2095-2097)Act>Gct	p.T699A	TPO_ENST00000382198.1_Missense_Mutation_p.T526A|TPO_ENST00000337415.3_Missense_Mutation_p.T699A|TPO_ENST00000346956.3_Missense_Mutation_p.T699A|TPO_ENST00000497517.2_Intron|TPO_ENST00000382201.3_Missense_Mutation_p.T642A|TPO_ENST00000349624.3_Missense_Mutation_p.T526A|TPO_ENST00000329066.4_Missense_Mutation_p.T699A	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	699					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.T699A(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CTGTGACAACACTGGCCTCAC	0.567																																							uc002qww.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20						c.(2095-2097)ACT>GCT		thyroid peroxidase isoform a	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)						77.0	66.0	70.0					2																	1499849		2203	4300	6503	SO:0001583	missense	7173				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity	g.chr2:1499849A>G		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2095A>G	2.37:g.1499849A>G	ENSP00000318820:p.Thr699Ala					TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Missense_Mutation_p.T642A|TPO_uc002qwr.2_Missense_Mutation_p.T699A|TPO_uc002qwx.2_Missense_Mutation_p.T642A|TPO_uc010yio.1_Missense_Mutation_p.T526A|TPO_uc010yip.1_Missense_Mutation_p.T699A|TPO_uc002qwy.1_Missense_Mutation_p.T39A|TPO_uc002qwz.2_Intron	p.T699A	NM_000547	NP_000538	P07202	PERT_HUMAN		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	12	2186	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	699			Extracellular (Potential).		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	c.2095A>G	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	A	17.18	3.323263	0.60634	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607	T;T;T;T;T;T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58;-0.58;-0.58;-0.58;-0.58;-0.58	4.52	3.32	0.38043	.	0.096296	0.64402	D	0.000001	T	0.74794	0.3763	L	0.60012	1.86	0.80722	D	1	D;B;D;D	0.55385	0.964;0.241;0.964;0.971	P;P;P;P	0.54965	0.654;0.464;0.654;0.765	T	0.75271	-0.3376	10	0.72032	D	0.01	-21.3044	10.4385	0.44450	0.8537:0.0:0.0:0.1463	.	699;526;642;699	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	A	699;699;699;526;699;642;526;628;173	ENSP00000337263:T699A;ENSP00000318820:T699A;ENSP00000263886:T699A;ENSP00000332044:T526A;ENSP00000329869:T699A;ENSP00000371636:T642A;ENSP00000371633:T526A;ENSP00000405788:T628A;ENSP00000419461:T173A	ENSP00000329869:T699A	T	+	1	0	TPO	1478856	1.000000	0.71417	0.963000	0.40424	0.348000	0.29142	4.495000	0.60353	0.661000	0.30985	0.459000	0.35465	ACT		0.567	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547		4	31	0	0	0	0.014758	0	4	31				
DNAJC5G	285126	broad.mit.edu	37	2	27500725	27500725	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:27500725G>A	ENST00000296097.3	+	4	635	c.217G>A	c.(217-219)Gaa>Aaa	p.E73K	DNAJC5G_ENST00000402462.1_Missense_Mutation_p.E73K|DNAJC5G_ENST00000406962.1_Intron|SLC30A3_ENST00000447008.2_5'Flank|DNAJC5G_ENST00000404433.1_Missense_Mutation_p.E57K	NM_173650.1	NP_775921.1	Q8N7S2	DNJ5G_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 gamma	73	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					membrane (GO:0016020)		p.E73K(2)		cervix(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAAGCAGCAGAAATATTCAA	0.473																																							uc002rjl.1		NA																	2	Substitution - Missense(2)		cervix(1)|lung(1)	skin(1)	1						c.(217-219)GAA>AAA		DnaJ (Hsp40) homolog, subfamily C, member 5							103.0	96.0	99.0					2																	27500725		2203	4300	6503	SO:0001583	missense	285126				protein folding	membrane	heat shock protein binding|unfolded protein binding	g.chr2:27500725G>A	AF368277	CCDS1744.1	2p23	2011-09-02			ENSG00000163793	ENSG00000163793		"""Heat shock proteins / DNAJ (HSP40)"""	24844	protein-coding gene	gene with protein product		613946					Standard	NM_173650		Approved	FLJ40417, CSP-gamma	uc002rjl.1	Q8N7S2	OTTHUMG00000097079	ENST00000296097.3:c.217G>A	2.37:g.27500725G>A	ENSP00000296097:p.Glu73Lys					SLC30A3_uc010ylh.1_5'Flank|DNAJC5G_uc010yli.1_Intron|DNAJC5G_uc002rjm.1_Missense_Mutation_p.E73K	p.E73K	NM_173650	NP_775921	Q8N7S2	DNJ5G_HUMAN			4	635	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		73			J.		B4DY29|Q53SY5|Q8IYQ4|Q96RJ8	Missense_Mutation	SNP	ENST00000296097.3	37	c.217G>A	CCDS1744.1	.	.	.	.	.	.	.	.	.	.	G	34	5.313823	0.95655	.	.	ENSG00000163793	ENST00000296097;ENST00000402462;ENST00000404433	T;T;T	0.76448	-1.02;-1.02;-1.02	5.19	5.19	0.71726	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.52532	D	0.000066	T	0.78559	0.4302	N	0.12887	0.27	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.82100	-0.0624	10	0.54805	T	0.06	.	16.2195	0.82251	0.0:0.0:1.0:0.0	.	73	Q8N7S2	DNJ5G_HUMAN	K	73;73;57	ENSP00000296097:E73K;ENSP00000384305:E73K;ENSP00000385829:E57K	ENSP00000296097:E73K	E	+	1	0	DNAJC5G	27354229	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	9.606000	0.98325	2.424000	0.82194	0.557000	0.71058	GAA		0.473	DNAJC5G-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214200.1	NM_173650		14	87	0	0	0	0.020292	0	14	87				
GALNT14	79623	broad.mit.edu	37	2	31147108	31147108	+	Silent	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:31147108G>T	ENST00000349752.5	-	13	1896	c.1257C>A	c.(1255-1257)atC>atA	p.I419I	GALNT14_ENST00000486564.1_Intron|GALNT14_ENST00000406653.1_Silent_p.I399I|GALNT14_ENST00000420311.2_Silent_p.I384I|GALNT14_ENST00000324589.5_Silent_p.I424I|GALNT14_ENST00000356174.3_Silent_p.I386I	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	419	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.I419I(1)		cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					TGCCCTTCTGGATGGAGGACT	0.537																																							uc002rnr.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(2)|skin(1)	3						c.(1255-1257)ATC>ATA		N-acetylgalactosaminyltransferase 14							192.0	179.0	183.0					2																	31147108		2203	4300	6503	SO:0001819	synonymous_variant	79623					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:31147108G>T	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1257C>A	2.37:g.31147108G>T						GALNT14_uc002rnq.2_Silent_p.I399I|GALNT14_uc002rns.2_Silent_p.I424I|GALNT14_uc010ymr.1_Silent_p.I384I|GALNT14_uc010ezo.1_Silent_p.I386I	p.I419I	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN			13	1876	-	Acute lymphoblastic leukemia(172;0.155)		419			Lumenal (Potential).|Ricin B-type lectin.		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Silent	SNP	ENST00000349752.5	37	c.1257C>A	CCDS1773.2																																																																																				0.537	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		30	138	1	0	3.17567e-06	0.008361	3.84591e-06	30	138				
SULT6B1	391365	broad.mit.edu	37	2	37406711	37406711	+	Missense_Mutation	SNP	C	C	T	rs11569744	byFrequency	TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:37406711C>T	ENST00000535679.1	-	4	418	c.419G>A	c.(418-420)cGa>cAa	p.R140Q	SULT6B1_ENST00000407963.1_Missense_Mutation_p.R102Q|SULT6B1_ENST00000379149.2_Intron|SULT6B1_ENST00000260637.3_Missense_Mutation_p.R102Q			Q6IMI4	ST6B1_HUMAN	sulfotransferase family, cytosolic, 6B, member 1	140						cytoplasm (GO:0005737)	sulfotransferase activity (GO:0008146)	p.R102>?(1)|p.R102Q(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(1)	12		all_hematologic(82;0.248)				TTTAGGGTTTCGAAATATCAC	0.358													C|||	4	0.000798722	0.003	0.0	5008	,	,		19100	0.0		0.0	False		,,,				2504	0.0						uc002rpu.2		NA																	2	Substitution - Missense(1)|Complex(1)		large_intestine(1)|lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(304-306)CGA>CAA		sulfotransferase family, cytosolic, 6B, member		C	GLN/ARG	27,4379	27.2+/-55.0	0,27,2176	101.0	101.0	101.0		305	3.4	1.0	2	dbSNP_126	101	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SULT6B1	NM_001032377.1	43	0,29,6474	TT,TC,CC		0.0233,0.6128,0.223	probably-damaging	102/266	37406711	29,12977	2203	4300	6503	SO:0001583	missense	391365					cytoplasm	sulfotransferase activity	g.chr2:37406711C>T	AY289770, AY289774	CCDS33182.1	2p22.2	2007-07-26			ENSG00000138068	ENSG00000138068		"""Sulfotransferases, cytosolic"""	33433	protein-coding gene	gene with protein product						14676822	Standard	XM_005264307		Approved		uc002rpu.3	Q6IMI4	OTTHUMG00000152160	ENST00000535679.1:c.419G>A	2.37:g.37406711C>T	ENSP00000444081:p.Arg140Gln					SULT6B1_uc010yni.1_RNA	p.R102Q	NM_001032377	NP_001027549	Q6IMI4	ST6B1_HUMAN			4	326	-		all_hematologic(82;0.248)	140			PAPS (By similarity).		B2RTS7	Missense_Mutation	SNP	ENST00000535679.1	37	c.305G>A		.	.	.	.	.	.	.	.	.	.	C	20.6	4.021097	0.75275	0.006128	2.33E-4	ENSG00000138068	ENST00000535679;ENST00000260637;ENST00000407963	T;T;T	0.69040	-0.37;-0.37;-0.37	4.27	3.39	0.38822	Sulfotransferase domain (1);	0.066755	0.64402	D	0.000016	D	0.84502	0.5486	H	0.98965	4.385	0.50039	D	0.999846	D	0.89917	1.0	D	0.97110	1.0	D	0.89281	0.3612	10	0.87932	D	0	.	11.513	0.50504	0.0:0.9092:0.0:0.0908	rs11569744;rs45566432;rs11569744	140	Q6IMI4	ST6B1_HUMAN	Q	140;102;102	ENSP00000444081:R140Q;ENSP00000260637:R102Q;ENSP00000384950:R102Q	ENSP00000260637:R102Q	R	-	2	0	SULT6B1	37260215	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.121000	0.50438	1.152000	0.42452	0.561000	0.74099	CGA		0.358	SULT6B1-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001032377		33	65	0	0	0	0.012213	0	33	65				
LRRTM1	347730	broad.mit.edu	37	2	80529683	80529683	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:80529683T>C	ENST00000295057.3	-	2	1918	c.1262A>G	c.(1261-1263)aAc>aGc	p.N421S	CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000466387.1_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.N421S|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000361291.4_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	421					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.N421S(2)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						CTGCACGGCGTTCTCGGCGTG	0.662										HNSCC(69;0.2)																													uc002sok.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(1261-1263)AAC>AGC		leucine rich repeat transmembrane neuronal 1							60.0	55.0	56.0					2																	80529683		2203	4300	6503	SO:0001583	missense	347730					axon|endoplasmic reticulum membrane|growth cone|integral to membrane		g.chr2:80529683T>C	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1262A>G	2.37:g.80529683T>C	ENSP00000295057:p.Asn421Ser	HNSCC(69;0.2)				CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	p.N421S	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN			2	1532	-			421			Lumenal (Potential).		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	c.1262A>G	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	T	9.881	1.201473	0.22121	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.39406	1.08;1.08	5.32	5.32	0.75619	.	0.132846	0.50627	U	0.000119	T	0.27278	0.0669	N	0.14661	0.345	0.41853	D	0.990181	B	0.22080	0.064	B	0.19391	0.025	T	0.08848	-1.0702	9	.	.	.	.	15.2769	0.73748	0.0:0.0:0.0:1.0	.	421	Q86UE6	LRRT1_HUMAN	S	421	ENSP00000295057:N421S;ENSP00000386646:N421S	.	N	-	2	0	LRRTM1	80383194	1.000000	0.71417	0.971000	0.41717	0.902000	0.53008	4.553000	0.60753	1.985000	0.57927	0.533000	0.62120	AAC		0.662	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839		12	28	0	0	0	0.010729	0	12	28				
MAT2A	4144	broad.mit.edu	37	2	85768989	85768989	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:85768989A>T	ENST00000306434.3	+	5	566	c.443A>T	c.(442-444)gAg>gTg	p.E148V	MAT2A_ENST00000490878.1_3'UTR|MAT2A_ENST00000409017.1_Missense_Mutation_p.E85V	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	148					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)	p.E148V(1)		breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	GAAACTGAGGAGTGTATGCCT	0.408																																							uc002spr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(442-444)GAG>GTG		methionine adenosyltransferase II, alpha	L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)						126.0	110.0	115.0					2																	85768989		2203	4300	6503	SO:0001583	missense	4144				methylation|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity	g.chr2:85768989A>T		CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.443A>T	2.37:g.85768989A>T	ENSP00000303147:p.Glu148Val					MAT2A_uc010ysr.1_Missense_Mutation_p.E148V|MAT2A_uc010fgk.2_Missense_Mutation_p.E122V|MAT2A_uc010fgl.2_Missense_Mutation_p.E85V|MAT2A_uc010fgm.1_3'UTR	p.E148V	NM_005911	NP_005902	P31153	METK2_HUMAN			5	566	+			148					A8K511|B4DN45|D6W5L1|Q53SP5	Missense_Mutation	SNP	ENST00000306434.3	37	c.443A>T	CCDS1977.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527098	0.85706	.	.	ENSG00000168906	ENST00000306434;ENST00000409017	D;D	0.84146	-1.81;-1.81	5.89	5.89	0.94794	S-adenosylmethionine synthetase, central domain (1);S-adenosylmethionine synthetase superfamily (1);	0.045089	0.85682	D	0.000000	D	0.92961	0.7760	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.99;0.996	D	0.93584	0.6915	10	0.56958	D	0.05	-14.0368	14.263	0.66097	1.0:0.0:0.0:0.0	.	148;148	B4DEX8;P31153	.;METK2_HUMAN	V	148;85	ENSP00000303147:E148V;ENSP00000386353:E85V	ENSP00000303147:E148V	E	+	2	0	MAT2A	85622500	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.154000	0.77437	2.257000	0.74773	0.460000	0.39030	GAG		0.408	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252491.2	NM_005911		20	134	0	0	0	0.014323	0	20	134				
TTN	7273	broad.mit.edu	37	2	179433977	179433977	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:179433977C>G	ENST00000591111.1	-	276	72183	c.71959G>C	c.(71959-71961)Gat>Cat	p.D23987H	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D16755H|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D25628H|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D23060H|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D16688H|TTN_ENST00000460472.2_Missense_Mutation_p.D16563H|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23987	Fibronectin type-III 74. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.D16688H(1)|p.D16563H(1)|p.D23060H(1)|p.D16755H(1)|p.D23058H(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATCCCCCATCCAACAAAGGA	0.398																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(69178-69180)GAT>CAT		titin isoform N2-A							198.0	196.0	197.0					2																	179433977		1853	4089	5942	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179433977C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.71959G>C	2.37:g.179433977C>G	ENSP00000465570:p.Asp23987His					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D16755H|TTN_uc010zfi.1_Missense_Mutation_p.D16688H|TTN_uc010zfj.1_Missense_Mutation_p.D16563H	p.D23060H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	69402	-			23987					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.69178G>C		.	.	.	.	.	.	.	.	.	.	C	13.60	2.285606	0.40394	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	5.93	5.93	0.95920	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84520	0.5490	H	0.95260	3.645	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.88134	0.2840	9	0.87932	D	0	.	20.3311	0.98718	0.0:1.0:0.0:0.0	.	16563;16688;16755;23987	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	23060;16563;16755;16688;16561	ENSP00000343764:D23060H;ENSP00000434586:D16563H;ENSP00000340554:D16755H;ENSP00000352154:D16688H	ENSP00000340554:D16755H	D	-	1	0	TTN	179142223	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.803000	0.96430	0.650000	0.86243	GAT		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		119	260	0	0	0	0.01441	0	119	260				
TTN	7273	broad.mit.edu	37	2	179577492	179577492	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:179577492C>A	ENST00000591111.1	-	92	26533	c.26309G>T	c.(26308-26310)gGa>gTa	p.G8770V	TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.G9087V|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G7843V|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12924	Ig-like 70.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G7843V(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTATATTCTCCACTTTGTGA	0.408																																							uc010zfg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(23527-23529)GGA>GTA		titin isoform N2-A							90.0	87.0	88.0					2																	179577492		1912	4121	6033	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179577492C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26309G>T	2.37:g.179577492C>A	ENSP00000465570:p.Gly8770Val					TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.G4504V	p.G7843V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		91	23752	-			8770					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.23528G>T		.	.	.	.	.	.	.	.	.	.	C	13.53	2.263948	0.39995	.	.	ENSG00000155657	ENST00000342992	T	0.77750	-1.12	5.48	5.48	0.80851	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.94198	0.8138	H	0.99668	4.69	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.96636	0.9470	9	0.87932	D	0	.	19.7139	0.96107	0.0:1.0:0.0:0.0	.	8770	Q8WZ42	TITIN_HUMAN	V	7843	ENSP00000343764:G7843V	ENSP00000343764:G7843V	G	-	2	0	TTN	179285737	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	7.664000	0.83830	2.722000	0.93159	0.655000	0.94253	GGA		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		13	85	1	0	1.5842e-08	0.016723	2.00943e-08	13	85				
DNAH7	56171	broad.mit.edu	37	2	196681573	196681573	+	Silent	SNP	A	A	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:196681573A>G	ENST00000312428.6	-	51	9640	c.9540T>C	c.(9538-9540)aaT>aaC	p.N3180N		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3180	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.N3180N(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GAGAAATCTCATTAGCCAAGG	0.403																																							uc002utj.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(10)|ovary(2)	12						c.(9538-9540)AAT>AAC		dynein, axonemal, heavy chain 7							106.0	109.0	108.0					2																	196681573		1863	4101	5964	SO:0001819	synonymous_variant	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196681573A>G	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.9540T>C	2.37:g.196681573A>G							p.N3180N	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN			51	9641	-			3180			AAA 5 (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	c.9540T>C	CCDS42794.1																																																																																				0.403	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		20	94	0	0	0	0.007413	0	20	94				
FN1	2335	broad.mit.edu	37	2	216274436	216274436	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:216274436G>T	ENST00000359671.1	-	15	2414	c.2149C>A	c.(2149-2151)Ccc>Acc	p.P717T	FN1_ENST00000421182.1_Missense_Mutation_p.P717T|FN1_ENST00000357867.4_Missense_Mutation_p.P717T|FN1_ENST00000354785.4_Missense_Mutation_p.P717T|FN1_ENST00000323926.6_Missense_Mutation_p.P717T|FN1_ENST00000336916.4_Missense_Mutation_p.P717T|FN1_ENST00000432072.2_Missense_Mutation_p.P717T|FN1_ENST00000356005.4_Missense_Mutation_p.P717T|FN1_ENST00000346544.3_Missense_Mutation_p.P717T|FN1_ENST00000345488.5_Missense_Mutation_p.P717T|FN1_ENST00000446046.1_Missense_Mutation_p.P717T|FN1_ENST00000443816.1_Missense_Mutation_p.P717T|FN1_ENST00000357009.2_Missense_Mutation_p.P717T			P02751	FINC_HUMAN	fibronectin 1	717					acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.P717T(2)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GGAGAAAAGGGAGTCGTCTCT	0.512																																							uc002vfa.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13						c.(2149-2151)CCC>ACC		fibronectin 1 isoform 1 preproprotein	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						49.0	44.0	46.0					2																	216274436		2203	4300	6503	SO:0001583	missense	2335				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding	g.chr2:216274436G>T		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.2149C>A	2.37:g.216274436G>T	ENSP00000352696:p.Pro717Thr					FN1_uc002vfb.2_Missense_Mutation_p.P717T|FN1_uc002vfc.2_Missense_Mutation_p.P717T|FN1_uc002vfd.2_Missense_Mutation_p.P717T|FN1_uc002vfe.2_Missense_Mutation_p.P717T|FN1_uc002vff.2_Missense_Mutation_p.P717T|FN1_uc002vfg.2_Missense_Mutation_p.P717T|FN1_uc002vfh.2_Missense_Mutation_p.P717T|FN1_uc002vfi.2_Missense_Mutation_p.P717T|FN1_uc002vfj.2_Missense_Mutation_p.P717T	p.P717T	NM_212482	NP_997647	P02751	FINC_HUMAN		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	15	2415	-		Renal(323;0.127)	717					B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37	c.2149C>A		.	.	.	.	.	.	.	.	.	.	G	13.18	2.159937	0.38119	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.52526	0.66;1.98;2.18;0.72;2.19;1.85;2.22;1.86;2.14;1.9;1.38;0.68;1.28	5.81	4.91	0.64330	.	0.169343	0.41194	D	0.000924	T	0.51686	0.1689	L	0.47716	1.5	0.09310	N	1	P;B;P;B;B;P;B;B;B;B	0.40681	0.727;0.056;0.724;0.016;0.009;0.513;0.304;0.016;0.016;0.049	B;B;P;B;B;B;B;B;B;B	0.46543	0.297;0.114;0.52;0.012;0.005;0.119;0.087;0.012;0.012;0.078	T	0.51849	-0.8653	10	0.72032	D	0.01	.	16.0951	0.81114	0.0:0.2528:0.7472:0.0	.	717;717;717;717;717;717;717;717;717;717	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	T	717	ENSP00000394423:P717T;ENSP00000323534:P717T;ENSP00000338200:P717T;ENSP00000350534:P717T;ENSP00000346839:P717T;ENSP00000352696:P717T;ENSP00000265312:P717T;ENSP00000273049:P717T;ENSP00000349509:P717T;ENSP00000410422:P717T;ENSP00000415018:P717T;ENSP00000399538:P717T;ENSP00000348285:P717T	ENSP00000265313:P717T	P	-	1	0	FN1	215982681	0.998000	0.40836	0.009000	0.14445	0.528000	0.34623	2.933000	0.48948	1.557000	0.49525	0.655000	0.94253	CCC		0.512	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476		7	49	1	0	0.000157383	0.00308	0.00018148	7	49				
SLC19A3	80704	broad.mit.edu	37	2	228567010	228567010	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:228567010T>G	ENST00000258403.3	-	2	96	c.25A>C	c.(25-27)Agc>Cgc	p.S9R	SLC19A3_ENST00000409287.1_Missense_Mutation_p.S9R|SLC19A3_ENST00000541617.1_5'UTR	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	9					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.S9R(1)		breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	CAGGAACTGCTTAGTGAAGTT	0.393																																							uc002vpi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(25-27)AGC>CGC		solute carrier family 19, member 3	L-Cysteine(DB00151)						97.0	103.0	101.0					2																	228567010		2203	4300	6503	SO:0001583	missense	80704				thiamine-containing compound metabolic process	integral to membrane|plasma membrane	folic acid binding|reduced folate carrier activity|thiamine uptake transmembrane transporter activity	g.chr2:228567010T>G	AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.25A>C	2.37:g.228567010T>G	ENSP00000258403:p.Ser9Arg					SLC19A3_uc002vpj.2_RNA|SLC19A3_uc010zlv.1_5'UTR	p.S9R	NM_025243	NP_079519	Q9BZV2	S19A3_HUMAN		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	2	114	-		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)	9			Helical; (Potential).			Missense_Mutation	SNP	ENST00000258403.3	37	c.25A>C	CCDS2468.1	.	.	.	.	.	.	.	.	.	.	T	14.35	2.507909	0.44558	.	.	ENSG00000135917	ENST00000409287;ENST00000258403;ENST00000456524;ENST00000419059;ENST00000409456	D;D;D;T;T	0.85773	-1.62;-2.02;-2.03;-1.36;-1.37	5.67	3.17	0.36434	Major facilitator superfamily domain, general substrate transporter (1);	0.505683	0.23797	N	0.044471	T	0.66896	0.2836	N	0.11927	0.2	0.21386	N	0.999709	B	0.13145	0.007	B	0.11329	0.006	T	0.49652	-0.8917	10	0.10377	T	0.69	-9.1235	7.1907	0.25824	0.0:0.0771:0.1457:0.7772	.	9	Q9BZV2	S19A3_HUMAN	R	9	ENSP00000386298:S9R;ENSP00000258403:S9R;ENSP00000399001:S9R;ENSP00000398349:S9R;ENSP00000387193:S9R	ENSP00000258403:S9R	S	-	1	0	SLC19A3	228275254	0.000000	0.05858	0.033000	0.17914	0.771000	0.43674	0.598000	0.24074	1.097000	0.41459	0.533000	0.62120	AGC		0.393	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1			20	48	0	0	0	0.008871	0	20	48				
TRAF3IP1	26146	broad.mit.edu	37	2	239237900	239237900	+	Missense_Mutation	SNP	G	G	T	rs368042986		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:239237900G>T	ENST00000373327.4	+	5	1054	c.832G>T	c.(832-834)Gac>Tac	p.D278Y	TRAF3IP1_ENST00000391994.2_Missense_Mutation_p.D278Y|TRAF3IP1_ENST00000391993.3_Missense_Mutation_p.D278Y	NM_015650.3	NP_056465.2	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting protein 1	278	Abolishes microtubules-binding when missing.|Arg-rich.|DISC1-interaction domain.				cilium assembly (GO:0042384)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic heart tube development (GO:0035050)|intraciliary transport (GO:0042073)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube patterning (GO:0021532)|post-anal tail morphogenesis (GO:0036342)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)		p.D278Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(2)	23		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		gaaggacagggacagacggag	0.547																																							uc002vye.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(832-834)GAC>TAC		TNF receptor-associated factor 3 interacting							85.0	98.0	94.0					2																	239237900		2201	4300	6501	SO:0001583	missense	26146					cytoplasm|cytoskeleton	protein binding	g.chr2:239237900G>T	AF230877	CCDS33415.1, CCDS46557.1	2q37.3	2014-02-21			ENSG00000204104	ENSG00000204104		"""Intraflagellar transport homologs"""	17861	protein-coding gene	gene with protein product	"""microtubule interacting protein that associates with TRAF3"""	607380				10791955, 12935900	Standard	NM_015650		Approved	MIP-T3, DKFZP434F124, MIPT3, IFT54	uc002vye.3	Q8TDR0	OTTHUMG00000152872	ENST00000373327.4:c.832G>T	2.37:g.239237900G>T	ENSP00000362424:p.Asp278Tyr					TRAF3IP1_uc002vyf.2_Missense_Mutation_p.D278Y	p.D278Y	NM_015650	NP_056465	Q8TDR0	MIPT3_HUMAN		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)	5	951	+		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)	278			Abolishes microtubules-binding when missing.|DISC1-interaction domain.|Arg-rich.		Q6PCT1|Q7L8N9|Q9NRD6|Q9Y4Q1	Missense_Mutation	SNP	ENST00000373327.4	37	c.832G>T	CCDS33415.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.300314	0.81136	.	.	ENSG00000204104	ENST00000391993;ENST00000373327;ENST00000391994;ENST00000440998	T;T;T	0.15139	2.45;2.45;2.45	4.37	4.37	0.52481	.	0.568727	0.18769	N	0.131670	T	0.35307	0.0927	L	0.55481	1.735	0.43603	D	0.995963	D;D	0.59767	0.983;0.986	P;D	0.64237	0.874;0.923	T	0.10109	-1.0644	10	0.72032	D	0.01	-7.9029	15.0931	0.72211	0.0:0.0:1.0:0.0	.	278;278	Q8TDR0-2;Q8TDR0	.;MIPT3_HUMAN	Y	278	ENSP00000375851:D278Y;ENSP00000362424:D278Y;ENSP00000375852:D278Y	ENSP00000362424:D278Y	D	+	1	0	TRAF3IP1	238902639	1.000000	0.71417	0.520000	0.27837	0.929000	0.56500	3.554000	0.53720	2.159000	0.67721	0.655000	0.94253	GAC		0.547	TRAF3IP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328312.1	NM_015650		11	26	1	0	3.86212e-05	0.008291	4.5183e-05	11	26				
LRRN4	164312	broad.mit.edu	37	20	6033166	6033166	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr20:6033166C>T	ENST00000378858.4	-	2	504	c.280G>A	c.(280-282)Gag>Aag	p.E94K		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	94					long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)		p.E94K(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						TGGCCGAGCTCGGAAGTGCTC	0.741																																							uc002wmo.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(280-282)GAG>AAG		leucine rich repeat neuronal 4 precursor							6.0	9.0	8.0					20																	6033166		2131	4212	6343	SO:0001583	missense	164312					integral to membrane		g.chr20:6033166C>T	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.280G>A	20.37:g.6033166C>T	ENSP00000368135:p.Glu94Lys					LRRN4_uc002wmp.2_Missense_Mutation_p.E94K	p.E94K	NM_152611	NP_689824	Q8WUT4	LRRN4_HUMAN			2	504	-			94			Extracellular (Potential).|LRR 2.		A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	ENST00000378858.4	37	c.280G>A	CCDS13097.1	.	.	.	.	.	.	.	.	.	.	C	17.23	3.337001	0.60963	.	.	ENSG00000125872	ENST00000378858	T	0.04603	3.59	5.37	5.37	0.77165	.	0.588289	0.16361	N	0.217769	T	0.05914	0.0154	L	0.52759	1.655	0.09310	N	0.999996	D;P	0.58970	0.984;0.848	B;B	0.41374	0.355;0.209	T	0.39418	-0.9615	10	0.07813	T	0.8	-12.4928	15.0059	0.71513	0.0:0.8579:0.1421:0.0	.	94;94	Q6ZMD1;Q8WUT4	.;LRRN4_HUMAN	K	94	ENSP00000368135:E94K	ENSP00000368135:E94K	E	-	1	0	LRRN4	5981166	0.205000	0.23458	0.065000	0.19835	0.002000	0.02628	2.709000	0.47160	2.686000	0.91538	0.561000	0.74099	GAG		0.741	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611		9	10	0	0	0	0.010729	0	9	10				
AAR2	25980	broad.mit.edu	37	20	34843634	34843635	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr20:34843634_34843635GG>TT	ENST00000373932.3	+	4	1468_1469	c.1122_1123GG>TT	c.(1120-1125)gtGGtg>gtTTtg	p.V375L	AAR2_ENST00000320849.4_Missense_Mutation_p.V375L|AAR2_ENST00000397286.3_Intron	NM_015511.3	NP_056326.2	Q9Y312	AAR2_HUMAN	AAR2 splicing factor homolog (S. cerevisiae)	375								p.V375L(1)									CCCCGGTGGTGGTGGAGCTCCC	0.604																																							uc002xfc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1120-1125)GTGGTG>GTTTTG		hypothetical protein LOC25980																																				SO:0001583	missense	25980							g.chr20:34843634_34843635GG>TT		CCDS13273.1	20q11.23	2012-07-20	2012-07-20	2012-07-20	ENSG00000131043	ENSG00000131043			15886	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 4"""	C20orf4			Standard	NM_015511		Approved	bA234K24.2	uc002xfc.3	Q9Y312	OTTHUMG00000032380	Exception_encountered	20.37:g.34843634_34843635delinsTT	ENSP00000363043:p.Val375Leu					C20orf4_uc002xfd.1_Intron|C20orf4_uc002xfe.1_Missense_Mutation_p.V375L	p.V375L	NM_015511	NP_056326	Q9Y312	CT004_HUMAN			4	1215_1216	+	Breast(12;0.0162)	Myeloproliferative disorder(115;0.0393)	375					E1P5S7|Q9H4F9|Q9P1P3|Q9UFK9	Missense_Mutation	DNP	ENST00000373932.3	37	c.1122_1123GG>TT	CCDS13273.1																																																																																				0.604	AAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079001.2	NM_015511		15	44	0	0	0	0.004672	0	15	44				
KIAA1755	85449	broad.mit.edu	37	20	36869547	36869547	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr20:36869547C>A	ENST00000279024.4	-	3	1257	c.986G>T	c.(985-987)gGa>gTa	p.G329V		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	329								p.G329V(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				CAAGGAAGGTCCTTCATTGGC	0.488																																							uc002xhy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(985-987)GGA>GTA		hypothetical protein LOC85449							149.0	164.0	159.0					20																	36869547		2203	4300	6503	SO:0001583	missense	85449							g.chr20:36869547C>A	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.986G>T	20.37:g.36869547C>A	ENSP00000279024:p.Gly329Val					KIAA1755_uc002xhz.1_Missense_Mutation_p.G329V	p.G329V	NM_001029864	NP_001025035	Q5JYT7	K1755_HUMAN			3	1258	-		Myeloproliferative disorder(115;0.00874)	329					Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	c.986G>T	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.691355	0.30052	.	.	ENSG00000149633	ENST00000279024	T	0.60171	0.21	5.23	-5.01	0.02991	.	0.837095	0.10200	N	0.703514	T	0.40067	0.1102	L	0.46157	1.445	0.09310	N	0.999997	B	0.20550	0.046	B	0.20577	0.03	T	0.35624	-0.9781	10	0.42905	T	0.14	.	2.1685	0.03844	0.1171:0.1705:0.3643:0.3481	.	329	Q5JYT7	K1755_HUMAN	V	329	ENSP00000279024:G329V	ENSP00000279024:G329V	G	-	2	0	KIAA1755	36302961	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-2.681000	0.00837	-0.477000	0.06832	0.655000	0.94253	GGA		0.488	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864		86	184	1	0	2.93416e-43	0.01441	4.74585e-43	86	184				
SALL4	57167	broad.mit.edu	37	20	50418834	50418834	+	Silent	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr20:50418834G>T	ENST00000217086.4	-	1	225	c.114C>A	c.(112-114)ccC>ccA	p.P38P	SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Silent_p.P38P|SALL4_ENST00000395997.3_Silent_p.P38P	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	38					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P38P(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						cccccgccgcgggcgccgctg	0.741																																							uc002xwh.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(112-114)CCC>CCA		sal-like 4							7.0	11.0	9.0					20																	50418834		2011	4005	6016	SO:0001819	synonymous_variant	57167				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:50418834G>T	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.114C>A	20.37:g.50418834G>T						SALL4_uc010gii.2_Silent_p.P38P|SALL4_uc002xwi.3_Silent_p.P38P	p.P38P	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN			1	215	-			38					A2A2D8|Q540H3|Q6Y8G6	Silent	SNP	ENST00000217086.4	37	c.114C>A	CCDS13438.1																																																																																				0.741	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3			3	21	1	0	0.004672	0.004672	0.00507186	3	21				
SAMSN1	64092	broad.mit.edu	37	21	15884835	15884835	+	Silent	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr21:15884835G>T	ENST00000400566.1	-	4	420	c.339C>A	c.(337-339)acC>acA	p.T113T	SAMSN1_ENST00000400564.1_Intron|SAMSN1_ENST00000285670.2_Silent_p.T181T	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	113					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)	p.T113T(1)|p.T181T(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		TCTCTGTGTGGGTCCCAATCA	0.463																																							uc002yju.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|pancreas(1)	4						c.(337-339)ACC>ACA		SAM domain, SH3 domain and nuclear localization							196.0	193.0	194.0					21																	15884835		1933	4146	6079	SO:0001819	synonymous_variant	64092				negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding	g.chr21:15884835G>T	AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.339C>A	21.37:g.15884835G>T						SAMSN1_uc010gky.1_Intron|SAMSN1_uc002yjv.1_Silent_p.T181T	p.T113T	NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN		Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)	4	421	-			113					B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Silent	SNP	ENST00000400566.1	37	c.339C>A	CCDS42906.1																																																																																				0.463	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157914.1			39	154	1	0	3.66082e-28	0.005524	5.72894e-28	39	154				
SEZ6L	23544	broad.mit.edu	37	22	26706748	26706748	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr22:26706748G>C	ENST00000248933.6	+	7	1722	c.1627G>C	c.(1627-1629)Gag>Cag	p.E543Q	SEZ6L_ENST00000402979.1_Missense_Mutation_p.E316Q|SEZ6L_ENST00000403121.1_Missense_Mutation_p.E316Q|SEZ6L_ENST00000360929.3_Missense_Mutation_p.E543Q|SEZ6L_ENST00000404234.3_Missense_Mutation_p.E543Q|SEZ6L_ENST00000343706.4_Missense_Mutation_p.E543Q|SEZ6L_ENST00000529632.2_Missense_Mutation_p.E543Q			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	543	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.E543Q(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CATCCGCATCGAGTTCACGTC	0.597																																							uc003acb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(1627-1629)GAG>CAG		seizure related 6 homolog (mouse)-like							127.0	105.0	112.0					22																	26706748		2203	4300	6503	SO:0001583	missense	23544					endoplasmic reticulum membrane|integral to membrane		g.chr22:26706748G>C	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1627G>C	22.37:g.26706748G>C	ENSP00000248933:p.Glu543Gln					SEZ6L_uc003acc.2_Missense_Mutation_p.E543Q|SEZ6L_uc011akc.1_Missense_Mutation_p.E543Q|SEZ6L_uc003acd.2_Missense_Mutation_p.E543Q|SEZ6L_uc011akd.1_Missense_Mutation_p.E543Q|SEZ6L_uc003ace.2_Missense_Mutation_p.E543Q|SEZ6L_uc003acf.1_Missense_Mutation_p.E316Q|SEZ6L_uc010gvc.1_Missense_Mutation_p.E316Q	p.E543Q	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN			7	1783	+			543			CUB 2.|Extracellular (Potential).		A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	c.1627G>C	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	G	9.946	1.218828	0.22373	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64	5.04	2.84	0.33178	CUB (5);	0.332748	0.24381	N	0.039011	T	0.16557	0.0398	N	0.14661	0.345	0.80722	D	1	B;B;B;P;P;B;B	0.37233	0.149;0.177;0.138;0.588;0.588;0.177;0.177	B;B;B;B;B;B;B	0.34536	0.185;0.172;0.085;0.175;0.175;0.172;0.172	T	0.06734	-1.0810	10	0.40728	T	0.16	.	11.3512	0.49589	0.0:0.1338:0.7288:0.1374	.	543;543;316;543;543;543;543	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	Q	543;543;543;543;543;316;316	ENSP00000384772:E543Q;ENSP00000437037:E543Q;ENSP00000354185:E543Q;ENSP00000248933:E543Q;ENSP00000342661:E543Q;ENSP00000384838:E316Q;ENSP00000384733:E316Q	ENSP00000248933:E543Q	E	+	1	0	SEZ6L	25036748	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	4.121000	0.57904	2.507000	0.84556	0.561000	0.74099	GAG		0.597	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3			3	152	0	0	0	0.009096	0	3	152				
GTPBP1	9567	broad.mit.edu	37	22	39122392	39122392	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr22:39122392A>T	ENST00000216044.5	+	8	1581	c.1348A>T	c.(1348-1350)Atg>Ttg	p.M450L	GTPBP1_ENST00000460605.1_3'UTR	NM_004286.4	NP_004277.2	O00178	GTPB1_HUMAN	GTP binding protein 1	450					GTP catabolic process (GO:0006184)|immune response (GO:0006955)|positive regulation of mRNA catabolic process (GO:0061014)|signal transduction (GO:0007165)	cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.M450L(1)|p.M28L(1)		endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	18	Melanoma(58;0.04)					TCGCAAGCGCATGCCTGTCAA	0.557																																							uc003awg.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1348-1350)ATG>TTG		GTP binding protein 1							102.0	87.0	92.0					22																	39122392		2203	4300	6503	SO:0001583	missense	9567				immune response|positive regulation of mRNA catabolic process|signal transduction	cytoplasmic exosome (RNase complex)|cytosol	GTP binding|GTPase activity	g.chr22:39122392A>T	U87964	CCDS13977.2	22q13.1	2008-07-01			ENSG00000100226	ENSG00000100226			4669	protein-coding gene	gene with protein product		602245				9070279	Standard	XM_005261857		Approved	GP-1, HSPC018	uc003awg.3	O00178	OTTHUMG00000151002	ENST00000216044.5:c.1348A>T	22.37:g.39122392A>T	ENSP00000216044:p.Met450Leu						p.M450L	NM_004286	NP_004277	O00178	GTPB1_HUMAN			8	1502	+	Melanoma(58;0.04)		450					Q6IC67	Missense_Mutation	SNP	ENST00000216044.5	37	c.1348A>T	CCDS13977.2	.	.	.	.	.	.	.	.	.	.	A	18.65	3.669948	0.67814	.	.	ENSG00000100226	ENST00000216044;ENST00000458073	T	0.62788	0.0	5.64	5.64	0.86602	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.072350	0.85682	D	0.000000	T	0.42245	0.1194	N	0.05259	-0.085	0.80722	D	1	B	0.15473	0.013	B	0.26969	0.075	T	0.36672	-0.9738	10	0.11182	T	0.66	.	15.8562	0.78979	1.0:0.0:0.0:0.0	.	450	O00178	GTPB1_HUMAN	L	450;28	ENSP00000216044:M450L	ENSP00000216044:M450L	M	+	1	0	GTPBP1	37452338	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.303000	0.96183	2.156000	0.67533	0.459000	0.35465	ATG		0.557	GTPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075532.1	NM_004286		14	50	0	0	0	0.016723	0	14	50				
MLC1	23209	broad.mit.edu	37	22	50502513	50502513	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr22:50502513C>T	ENST00000311597.5	-	11	1615	c.1009G>A	c.(1009-1011)Ggt>Agt	p.G337S	MLC1_ENST00000538737.1_Missense_Mutation_p.G303S|MLC1_ENST00000395876.2_Missense_Mutation_p.G337S|MLC1_ENST00000450140.2_Missense_Mutation_p.G285S|MLC1_ENST00000535444.1_Missense_Mutation_p.G258S|MLC1_ENST00000483836.1_5'UTR|MLC1_ENST00000431262.2_Missense_Mutation_p.G307S	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	337					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.G337S(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		CAGGATGCACCCTGCAGCCTT	0.697																																							uc003bjg.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(1009-1011)GGT>AGT		megalencephalic leukoencephalopathy with							48.0	45.0	46.0					22																	50502513		2202	4299	6501	SO:0001583	missense	23209					basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity	g.chr22:50502513C>T	D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.1009G>A	22.37:g.50502513C>T	ENSP00000310375:p.Gly337Ser					MLC1_uc011arl.1_Missense_Mutation_p.G285S|MLC1_uc003bjh.1_Missense_Mutation_p.G337S|MLC1_uc011arm.1_Missense_Mutation_p.G307S|MLC1_uc011arn.1_Missense_Mutation_p.G258S|MLC1_uc011aro.1_Missense_Mutation_p.G303S	p.G337S	NM_139202	NP_631941	Q15049	MLC1_HUMAN		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)	11	1282	-		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)	337					B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Missense_Mutation	SNP	ENST00000311597.5	37	c.1009G>A	CCDS14083.1	.	.	.	.	.	.	.	.	.	.	c	14.28	2.489743	0.44249	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000538737;ENST00000431262;ENST00000535444;ENST00000450140	D;D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32;-2.32	3.97	1.79	0.24919	.	0.427943	0.25798	N	0.028237	T	0.81403	0.4815	L	0.51422	1.61	0.19775	N	0.999958	B;B;B;B	0.28291	0.03;0.073;0.206;0.073	B;B;B;B	0.33454	0.075;0.107;0.164;0.107	T	0.71471	-0.4583	10	0.51188	T	0.08	-7.5652	5.1403	0.14955	0.2052:0.6815:0.0:0.1133	.	303;307;285;337	F5H1B9;B7Z659;B7Z1X1;Q15049	.;.;.;MLC1_HUMAN	S	337;337;303;307;258;285	ENSP00000379216:G337S;ENSP00000310375:G337S;ENSP00000445805:G303S;ENSP00000415877:G307S;ENSP00000438910:G258S;ENSP00000412448:G285S	ENSP00000310375:G337S	G	-	1	0	MLC1	48844640	0.237000	0.23815	0.214000	0.23707	0.114000	0.19823	1.266000	0.33039	0.395000	0.25257	0.550000	0.68814	GGT		0.697	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316979.2	NM_015166		15	57	0	0	0	0.006122	0	15	57				
CMTM7	112616	broad.mit.edu	37	3	32483336	32483336	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr3:32483336C>A	ENST00000334983.5	+	2	400	c.164C>A	c.(163-165)aCc>aAc	p.T55N	CMTM7_ENST00000349718.4_Missense_Mutation_p.T55N	NM_138410.2	NP_612419.1	Q96FZ5	CKLF7_HUMAN	CKLF-like MARVEL transmembrane domain containing 7	55	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.T55N(1)		endometrium(1)|large_intestine(1)|lung(2)	4						TGGCAGGTCACCCTGCTGATT	0.522																																							uc003cey.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(163-165)ACC>AAC		CKLF-like MARVEL transmembrane domain containing							126.0	115.0	118.0					3																	32483336		2203	4300	6503	SO:0001583	missense	112616				chemotaxis	extracellular space|integral to membrane	cytokine activity	g.chr3:32483336C>A	AF479263	CCDS33730.1, CCDS33731.1	3p22.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000153551	ENSG00000153551			19178	protein-coding gene	gene with protein product		607890	"""chemokine-like factor super family 7"", ""chemokine-like factor superfamily 7"""	CKLFSF7			Standard	NM_138410		Approved	FLJ30992	uc003cey.1	Q96FZ5	OTTHUMG00000155869	ENST00000334983.5:c.164C>A	3.37:g.32483336C>A	ENSP00000335605:p.Thr55Asn					CMTM7_uc003cez.1_Missense_Mutation_p.T55N	p.T55N	NM_138410	NP_612419	Q96FZ5	CKLF7_HUMAN			2	400	+			55			MARVEL.|Helical; (Potential).		Q5VLK1	Missense_Mutation	SNP	ENST00000334983.5	37	c.164C>A	CCDS33730.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452278	0.43531	.	.	ENSG00000153551	ENST00000334983;ENST00000349718;ENST00000465248	T	0.25912	1.77	5.32	3.51	0.40186	Marvel (1);MARVEL-like domain (1);	0.347442	0.30338	N	0.009860	T	0.24851	0.0603	M	0.61703	1.905	0.30739	N	0.746361	P;P	0.43607	0.589;0.812	B;B	0.40199	0.165;0.322	T	0.26258	-1.0108	10	0.62326	D	0.03	.	7.0034	0.24823	0.0:0.6942:0.1456:0.1602	.	55;55	Q5VLK1;Q96FZ5	.;CKLF7_HUMAN	N	55;55;11	ENSP00000335605:T55N	ENSP00000335605:T55N	T	+	2	0	CMTM7	32458340	0.003000	0.15002	0.964000	0.40570	0.925000	0.55904	0.734000	0.26101	0.611000	0.30052	0.591000	0.81541	ACC		0.522	CMTM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342084.1			4	105	1	0	0.00909568	0.009096	0.00969938	4	105				
TTC21A	199223	broad.mit.edu	37	3	39166949	39166949	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr3:39166949G>C	ENST00000431162.2	+	11	1476	c.1342G>C	c.(1342-1344)Gag>Cag	p.E448Q	TTC21A_ENST00000440121.1_Missense_Mutation_p.E399Q|TTC21A_ENST00000301819.6_Missense_Mutation_p.E448Q			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	448								p.E448Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TCTTGGCTCTGAGTACTTTGA	0.547											OREG0015487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003cjc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1342-1344)GAG>CAG		tetratricopeptide repeat domain 21A isoform 2							110.0	107.0	108.0					3																	39166949		2043	4195	6238	SO:0001583	missense	199223						binding	g.chr3:39166949G>C	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.1342G>C	3.37:g.39166949G>C	ENSP00000398211:p.Glu448Gln		OREG0015487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	883	TTC21A_uc003cje.2_Missense_Mutation_p.E448Q|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.E399Q	p.E448Q	NM_145755	NP_665698	Q8NDW8	TT21A_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)	11	1519	+			448					A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	ENST00000431162.2	37	c.1342G>C	CCDS46800.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002540	0.35320	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.64438	-0.09;-0.1;0.03	5.73	4.84	0.62591	.	0.210963	0.40554	N	0.001077	T	0.53722	0.1814	L	0.45352	1.415	0.38576	D	0.950069	P;P;B	0.35894	0.526;0.513;0.379	B;B;B	0.34873	0.141;0.191;0.093	T	0.54029	-0.8354	10	0.22109	T	0.4	-23.7629	15.4842	0.75551	0.0:0.1395:0.8605:0.0	.	399;448;448	Q8NDW8-6;Q8NDW8-7;Q8NDW8	.;.;TT21A_HUMAN	Q	448;430;448;399	ENSP00000301819:E448Q;ENSP00000398211:E448Q;ENSP00000410882:E399Q	ENSP00000301819:E448Q	E	+	1	0	TTC21A	39141953	1.000000	0.71417	0.844000	0.33320	0.790000	0.44656	5.885000	0.69736	1.392000	0.46585	0.609000	0.83330	GAG		0.547	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755		5	114	0	0	0	0.001168	0	5	114				
LTF	4057	broad.mit.edu	37	3	46490396	46490396	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr3:46490396G>T	ENST00000231751.4	-	9	1465	c.1170C>A	c.(1168-1170)tgC>tgA	p.C390*	LTF_ENST00000417439.1_Nonsense_Mutation_p.C390*|LTF_ENST00000426532.2_Nonsense_Mutation_p.C346*	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	390	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)	p.C390*(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		AGGCCGAGGAGCAGGTCACGC	0.692																																							uc003cpq.2		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(2)|ovary(1)|lung(1)	4						c.(1168-1170)TGC>TGA		lactotransferrin precursor	Pefloxacin(DB00487)						43.0	38.0	40.0					3																	46490396		2203	4296	6499	SO:0001587	stop_gained	4057				cellular iron ion homeostasis|defense response to bacterium|humoral immune response|iron ion transport	extracellular region|stored secretory granule	ferric iron binding|heparin binding|protein binding|serine-type endopeptidase activity	g.chr3:46490396G>T		CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.1170C>A	3.37:g.46490396G>T	ENSP00000231751:p.Cys390*					LTF_uc003fzr.2_Nonsense_Mutation_p.C346*|LTF_uc010hjh.2_Nonsense_Mutation_p.C390*|LTF_uc003cpr.2_Nonsense_Mutation_p.C377*	p.C390*	NM_002343	NP_002334	P02788	TRFL_HUMAN		all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)	9	1208	-			390			Transferrin-like 2.		A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Nonsense_Mutation	SNP	ENST00000231751.4	37	c.1170C>A	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	G	38	6.782776	0.97833	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496	.	.	.	4.94	-5.63	0.02474	.	0.091794	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.3795	13.3829	0.60778	0.6847:0.0:0.3153:0.0	.	.	.	.	X	390;346;390;377	.	ENSP00000231751:C390X	C	-	3	2	LTF	46465400	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.332000	0.07904	-1.026000	0.03330	0.558000	0.71614	TGC		0.692	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2	NM_002343		13	21	1	0	4.3838e-07	0.016723	5.41793e-07	13	21				
ATRIP	84126	broad.mit.edu	37	3	48491469	48491469	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr3:48491469G>T	ENST00000320211.3	+	2	387	c.274G>T	c.(274-276)Gat>Tat	p.D92Y	ATRIP_ENST00000346691.4_Missense_Mutation_p.D92Y|ATRIP_ENST00000357105.6_5'UTR|ATRIP_ENST00000412052.1_5'UTR	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	92					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.D92Y(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CAGATTATTAGATGGCATGTC	0.338								Other conserved DNA damage response genes																															uc003ctf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(274-276)GAT>TAT	Other_conserved_DNA_damage_response_genes	ATR interacting protein isoform 1							131.0	149.0	143.0					3																	48491469		2203	4298	6501	SO:0001583	missense	84126				DNA damage checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding|protein serine/threonine kinase activity	g.chr3:48491469G>T	AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.274G>T	3.37:g.48491469G>T	ENSP00000323099:p.Asp92Tyr					ATRIP_uc011bbj.1_5'UTR|ATRIP_uc003ctg.1_Missense_Mutation_p.D92Y	p.D92Y	NM_130384	NP_569055	Q8WXE1	ATRIP_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	2	306	+			92					A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Missense_Mutation	SNP	ENST00000320211.3	37	c.274G>T	CCDS2768.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346521	0.61073	.	.	ENSG00000164053	ENST00000320211;ENST00000346691	T;T	0.32753	1.45;1.44	4.98	4.98	0.66077	.	0.470469	0.24717	N	0.036173	T	0.47673	0.1458	L	0.54323	1.7	0.80722	D	1	D;D	0.61080	0.989;0.989	D;D	0.63192	0.912;0.912	T	0.40534	-0.9558	10	0.66056	D	0.02	-16.4837	13.9545	0.64140	0.0:0.0:1.0:0.0	.	92;92	Q8WXE1-2;Q8WXE1	.;ATRIP_HUMAN	Y	92	ENSP00000323099:D92Y;ENSP00000302338:D92Y	ENSP00000323099:D92Y	D	+	1	0	ATRIP	48466473	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	3.953000	0.56699	2.756000	0.94617	0.655000	0.94253	GAT		0.338	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384		77	136	1	0	1.35621e-51	0.01441	2.22345e-51	77	136				
HCLS1	3059	broad.mit.edu	37	3	121351229	121351229	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr3:121351229T>G	ENST00000314583.3	-	12	1281	c.1190A>C	c.(1189-1191)tAt>tCt	p.Y397S	HCLS1_ENST00000473883.1_5'UTR|HCLS1_ENST00000428394.2_Missense_Mutation_p.Y360S	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	397					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)	p.Y397S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		CACCTCCTCATAGTCCCCCTC	0.562																																							uc003eeh.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1189-1191)TAT>TCT		hematopoietic cell-specific Lyn substrate 1							237.0	220.0	225.0					3																	121351229		2203	4300	6503	SO:0001583	missense	3059				erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr3:121351229T>G		CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.1190A>C	3.37:g.121351229T>G	ENSP00000320176:p.Tyr397Ser					HCLS1_uc011bjj.1_Missense_Mutation_p.Y360S|HCLS1_uc011bjk.1_RNA	p.Y397S	NM_005335	NP_005326	P14317	HCLS1_HUMAN		GBM - Glioblastoma multiforme(114;0.0912)	12	1315	-			397					B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Missense_Mutation	SNP	ENST00000314583.3	37	c.1190A>C	CCDS3003.1	.	.	.	.	.	.	.	.	.	.	T	9.367	1.069450	0.20147	.	.	ENSG00000180353	ENST00000314583;ENST00000428394	T;T	0.20738	2.08;2.05	5.21	5.21	0.72293	.	1.044270	0.07471	N	0.902309	T	0.17450	0.0419	N	0.25647	0.755	0.54753	D	0.999989	B;B	0.26081	0.141;0.141	B;B	0.23574	0.047;0.028	T	0.04140	-1.0974	10	0.25106	T	0.35	-12.5319	11.3931	0.49825	0.0:0.0:0.0:1.0	.	360;397	E7EVW7;P14317	.;HCLS1_HUMAN	S	397;360	ENSP00000320176:Y397S;ENSP00000387645:Y360S	ENSP00000320176:Y397S	Y	-	2	0	HCLS1	122833919	1.000000	0.71417	1.000000	0.80357	0.227000	0.25037	2.998000	0.49465	2.195000	0.70347	0.533000	0.62120	TAT		0.562	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355144.1	NM_005335		61	199	0	0	0	0.01441	0	61	199				
SNX4	8723	broad.mit.edu	37	3	125208251	125208251	+	Splice_Site	SNP	C	C	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr3:125208251C>G	ENST00000251775.4	-	6	678		c.e6+1		SNX4_ENST00000536067.1_Splice_Site|SNX4_ENST00000473417.1_Intron	NM_003794.2	NP_003785.1	O95219	SNX4_HUMAN	sorting nexin 4						endocytic recycling (GO:0032456)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|early endosome membrane (GO:0031901)|membrane (GO:0016020)|protein complex (GO:0043234)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)	p.?(1)		breast(2)|central_nervous_system(1)|lung(6)|ovary(1)|skin(1)	11						CAAAACCTTACTTGTCTGGGT	0.303																																							uc003eib.2		NA																	1	Unknown(1)		lung(1)	breast(2)|ovary(1)|central_nervous_system(1)	4						c.e6+1		sorting nexin 4							95.0	93.0	94.0					3																	125208251		2202	4298	6500	SO:0001630	splice_region_variant	8723				cell communication|endocytic recycling|endocytosis|protein transport	cytoplasmic dynein complex|early endosome membrane	phosphatidylinositol binding|protein binding	g.chr3:125208251C>G	AF065485	CCDS3032.1	3q21.2	2014-02-12			ENSG00000114520	ENSG00000114520		"""Sorting nexins"""	11175	protein-coding gene	gene with protein product		605931				9819414	Standard	NM_003794		Approved	ATG24B	uc003eib.4	O95219	OTTHUMG00000159575	ENST00000251775.4:c.653+1G>C	3.37:g.125208251C>G						SNX4_uc011bkf.1_Splice_Site_p.K73_splice	p.K218_splice	NM_003794	NP_003785	O95219	SNX4_HUMAN			6	695	-								B3KMH0|B4DQV4|D3DNA3	Splice_Site	SNP	ENST00000251775.4	37	c.653_splice	CCDS3032.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132230	0.77662	.	.	ENSG00000114520	ENST00000251775;ENST00000536067	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.099	0.89499	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SNX4	126690941	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.835000	0.75344	2.492000	0.84095	0.591000	0.81541	.		0.303	SNX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356299.1	NM_003794	Intron	14	42	0	0	0	0.020292	0	14	42				
C3orf56	285311	broad.mit.edu	37	3	126916014	126916014	+	Silent	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr3:126916014C>A	ENST00000398112.1	+	2	726	c.486C>A	c.(484-486)gcC>gcA	p.A162A		NM_001007534.2	NP_001007535.1	Q8N813	CC056_HUMAN	chromosome 3 open reading frame 56	162								p.A162A(1)		breast(1)|endometrium(2)|kidney(1)|lung(5)	9				GBM - Glioblastoma multiforme(114;0.142)		GGACTCCAGCCAGCTCAGCCC	0.627																																							uc003eji.1		NA																	1	Substitution - coding silent(1)		lung(1)		NA						c.(484-486)GCC>GCA		RecName: Full=Putative uncharacterized protein C3orf56;							38.0	44.0	42.0					3																	126916014		1886	4113	5999	SO:0001819	synonymous_variant	0							g.chr3:126916014C>A	AK097460	CCDS63757.1	3q21.3	2012-08-08			ENSG00000214324	ENSG00000214324			32481	protein-coding gene	gene with protein product						14702039	Standard	NM_001007534		Approved	FLJ40141	uc003eji.1	Q8N813	OTTHUMG00000159593	ENST00000398112.1:c.486C>A	3.37:g.126916014C>A							p.A162A							2	726	+								B2RNW5	Silent	SNP	ENST00000398112.1	37	c.486C>A																																																																																					0.627	C3orf56-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000356354.1			45	75	1	0	2.95478e-19	0.00874	4.34208e-19	45	75				
EPHB1	2047	broad.mit.edu	37	3	134851590	134851590	+	Missense_Mutation	SNP	C	C	G	rs199903529	byFrequency	TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr3:134851590C>G	ENST00000398015.3	+	5	1366	c.996C>G	c.(994-996)atC>atG	p.I332M	EPHB1_ENST00000493838.1_5'UTR|EPHB1_ENST00000488154.1_3'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	332	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.I332M(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TTATCTCCATCGTCAATGAGA	0.547																																							uc003eqt.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						c.(994-996)ATC>ATG		ephrin receptor EphB1 precursor							55.0	56.0	55.0					3																	134851590		2034	4198	6232	SO:0001583	missense	2047					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding	g.chr3:134851590C>G	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.996C>G	3.37:g.134851590C>G	ENSP00000381097:p.Ile332Met					EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_Missense_Mutation_p.S221W|EPHB1_uc003equ.2_Translation_Start_Site	p.I332M	NM_004441	NP_004432	P54762	EPHB1_HUMAN			5	1216	+			332			Extracellular (Potential).|Fibronectin type-III 1.		A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	c.996C>G	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	C	9.386	1.074175	0.20227	.	.	ENSG00000154928	ENST00000398015	T	0.56776	0.44	5.69	-2.93	0.05598	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.118007	0.53938	D	0.000051	T	0.47173	0.1431	N	0.19112	0.55	0.80722	D	1	D	0.65815	0.995	D	0.64877	0.93	T	0.45673	-0.9245	10	0.52906	T	0.07	.	7.7031	0.28634	0.1745:0.2961:0.0:0.5294	.	332	P54762	EPHB1_HUMAN	M	332	ENSP00000381097:I332M	ENSP00000381097:I332M	I	+	3	3	EPHB1	136334280	0.000000	0.05858	0.820000	0.32676	0.442000	0.32017	-4.421000	0.00236	-1.085000	0.03088	-0.768000	0.03414	ATC		0.547	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441		10	28	0	0	0	0.006214	0	10	28				
SI	6476	broad.mit.edu	37	3	164741524	164741524	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr3:164741524C>G	ENST00000264382.3	-	26	2995	c.2933G>C	c.(2932-2934)aGa>aCa	p.R978T		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	978	Isomaltase.|P-type 2. {ECO:0000255|PROSITE- ProRule:PRU00779}.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.R978T(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GTTATCTTGTCTGGGAAAGTA	0.373										HNSCC(35;0.089)																													uc003fei.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(2932-2934)AGA>ACA		sucrase-isomaltase	Acarbose(DB00284)						99.0	95.0	96.0					3																	164741524		2203	4300	6503	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164741524C>G	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.2933G>C	3.37:g.164741524C>G	ENSP00000264382:p.Arg978Thr	HNSCC(35;0.089)					p.R978T	NM_001041	NP_001032	P14410	SUIS_HUMAN			26	2995	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	978			Lumenal.|P-type 2.|Isomaltase.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.2933G>C	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	6.423	0.446191	0.12164	.	.	ENSG00000090402	ENST00000264382	T	0.12569	2.67	5.03	-4.44	0.03557	Glycoside hydrolase-type carbohydrate-binding (1);P-type trefoil (3);	0.931594	0.09198	N	0.835007	T	0.05502	0.0145	N	0.20685	0.6	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.44159	-0.9346	10	0.09338	T	0.73	.	2.812	0.05444	0.0959:0.2678:0.1981:0.4382	.	978	P14410	SUIS_HUMAN	T	978	ENSP00000264382:R978T	ENSP00000264382:R978T	R	-	2	0	SI	166224218	0.000000	0.05858	0.001000	0.08648	0.359000	0.29487	-1.761000	0.01805	-0.671000	0.05274	-0.136000	0.14681	AGA		0.373	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		15	45	0	0	0	0.004007	0	15	45				
RTP2	344892	broad.mit.edu	37	3	187416668	187416668	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr3:187416668C>A	ENST00000358241.1	-	2	724	c.296G>T	c.(295-297)tGc>tTc	p.C99F		NM_001004312.2	NP_001004312.2	Q5QGT7	RTP2_HUMAN	receptor (chemosensory) transporter protein 2	99					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)	p.C99F(1)		large_intestine(3)|lung(14)|skin(1)	18	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)		CGCCGTGCCGCACTCATAGCA	0.647																																							uc003fro.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(295-297)TGC>TTC		receptor transporting protein 2							25.0	23.0	24.0					3																	187416668		2201	4272	6473	SO:0001583	missense	344892				protein insertion into membrane	cell surface|integral to membrane|plasma membrane	olfactory receptor binding	g.chr3:187416668C>A	AY562236	CCDS33911.1	3q27.3	2014-02-20	2006-11-21		ENSG00000198471	ENSG00000198471		"""Receptor transporter proteins"""	32486	protein-coding gene	gene with protein product	"""receptor transporting protein 2"", ""zinc finger, 3CxxC-type 2"""	609138	"""receptor transporter protein 2"""			16271481, 15550249, 16720576	Standard	NM_001004312		Approved	MGC78665, Z3CXXC2	uc003fro.1	Q5QGT7	OTTHUMG00000156458	ENST00000358241.1:c.296G>T	3.37:g.187416668C>A	ENSP00000350976:p.Cys99Phe						p.C99F	NM_001004312	NP_001004312	Q5QGT7	RTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)	2	725	-	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		99			Cytoplasmic (Potential).		Q6NVH4	Missense_Mutation	SNP	ENST00000358241.1	37	c.296G>T	CCDS33911.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.986158	0.53934	.	.	ENSG00000198471	ENST00000358241	T	0.73363	-0.74	4.17	4.17	0.49024	.	0.000000	0.85682	D	0.000000	D	0.85695	0.5756	M	0.82517	2.595	0.39669	D	0.970721	D	0.89917	1.0	D	0.91635	0.999	D	0.87832	0.2645	10	0.87932	D	0	-53.5866	12.2956	0.54844	0.0:1.0:0.0:0.0	.	99	Q5QGT7	RTP2_HUMAN	F	99	ENSP00000350976:C99F	ENSP00000350976:C99F	C	-	2	0	RTP2	188899362	1.000000	0.71417	1.000000	0.80357	0.578000	0.36192	4.317000	0.59184	2.621000	0.88768	0.563000	0.77884	TGC		0.647	RTP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344259.1	NM_001004312		7	24	1	0	1.06961e-07	0.00308	1.34259e-07	7	24				
ZNF518B	85460	broad.mit.edu	37	4	10446391	10446391	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr4:10446391T>A	ENST00000326756.3	-	3	2000	c.1562A>T	c.(1561-1563)cAc>cTc	p.H521L		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	521					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.H521L(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						TGAGCTACTGTGTAAATTTCT	0.403																																							uc003gmn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)	4						c.(1561-1563)CAC>CTC		zinc finger protein 518B							93.0	95.0	94.0					4																	10446391		2203	4300	6503	SO:0001583	missense	85460				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:10446391T>A	AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.1562A>T	4.37:g.10446391T>A	ENSP00000317614:p.His521Leu						p.H521L	NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN			3	2049	-			521					Q96LN8	Missense_Mutation	SNP	ENST00000326756.3	37	c.1562A>T	CCDS33960.1	.	.	.	.	.	.	.	.	.	.	T	13.92	2.382369	0.42207	.	.	ENSG00000178163	ENST00000326756	T	0.01495	4.83	5.43	-9.64	0.00541	.	1.287800	0.05175	N	0.500171	T	0.01558	0.0050	L	0.29908	0.895	0.09310	N	1	B	0.15141	0.012	B	0.14578	0.011	T	0.49624	-0.8920	10	0.08599	T	0.76	0.3177	16.5044	0.84266	0.0:0.1306:0.7291:0.1403	.	521	Q9C0D4	Z518B_HUMAN	L	521	ENSP00000317614:H521L	ENSP00000317614:H521L	H	-	2	0	ZNF518B	10055489	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.648000	0.01995	-1.255000	0.02481	-0.331000	0.08364	CAC		0.403	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042		25	81	0	0	0	0.004656	0	25	81				
TMPRSS11E	28983	broad.mit.edu	37	4	69343154	69343154	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr4:69343154G>T	ENST00000305363.4	+	8	839	c.775G>T	c.(775-777)Ggt>Tgt	p.G259C		NM_014058.3	NP_054777.2	Q9UL52	TM11E_HUMAN	transmembrane protease, serine 11E	259	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cognition (GO:0050890)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.G259C(2)		endometrium(1)|lung(19)|pancreas(1)|skin(3)	24						AATGAAACGGGGTCTCCGGAG	0.388																																							uc003hdz.3		NA																	2	Substitution - Missense(2)		lung(2)		NA						c.(775-777)GGT>TGT		transmembrane protease, serine 11E							166.0	178.0	174.0					4																	69343154		2203	4297	6500	SO:0001583	missense	0							g.chr4:69343154G>T	AF064819	CCDS33993.1	4q13.2	2010-04-13			ENSG00000087128	ENSG00000087128		"""Serine peptidases / Transmembrane"""	24465	protein-coding gene	gene with protein product		610399	"""transmembrane protease, serine 11E2"""	TMPRSS11E2		15328353	Standard	NM_014058		Approved	DESC1	uc003hdz.4	Q9UL52	OTTHUMG00000160438	ENST00000305363.4:c.775G>T	4.37:g.69343154G>T	ENSP00000307519:p.Gly259Cys						p.G259C	NM_014058	NP_054777					8	839	+								A6NL71|Q14DC8|Q6UW31	Missense_Mutation	SNP	ENST00000305363.4	37	c.775G>T	CCDS33993.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.456918	0.26161	.	.	ENSG00000087128	ENST00000305363	D	0.88896	-2.44	5.38	2.56	0.30785	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.632860	0.14069	N	0.343514	D	0.90762	0.7100	M	0.64997	1.995	0.09310	N	1	D	0.71674	0.998	D	0.65443	0.935	T	0.80487	-0.1361	10	0.51188	T	0.08	.	4.2884	0.10865	0.2639:0.1732:0.5629:0.0	.	259	Q9UL52	TM11E_HUMAN	C	259	ENSP00000307519:G259C	ENSP00000307519:G259C	G	+	1	0	TMPRSS11E	69025749	0.000000	0.05858	0.542000	0.28115	0.160000	0.22226	-0.033000	0.12246	1.254000	0.44035	0.585000	0.79938	GGT		0.388	TMPRSS11E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360584.1	NM_014058		41	243	1	0	2.42038e-35	0.007835	3.88875e-35	41	243				
SMR3A	26952	broad.mit.edu	37	4	71232648	71232648	+	Silent	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr4:71232648T>A	ENST00000226460.4	+	3	438	c.342T>A	c.(340-342)ccT>ccA	p.P114P		NM_012390.3	NP_036522.3	Q99954	SMR3A_HUMAN	submaxillary gland androgen regulated protein 3A	114	Pro-rich.					extracellular region (GO:0005576)		p.P114P(1)		endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)	15		all_hematologic(202;0.196)				CCTATCCACCTGGACCTCCAT	0.517																																							uc003hfg.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(340-342)CCT>CCA		submaxillary gland androgen regulated protein 3							138.0	130.0	132.0					4																	71232648		2203	4300	6503	SO:0001819	synonymous_variant	26952					extracellular region		g.chr4:71232648T>A	D89501	CCDS34000.1	4q13.3	2009-04-17	2008-02-27	2005-02-07	ENSG00000109208	ENSG00000109208			19216	protein-coding gene	gene with protein product			"""proline rich 5 (salivary)"", ""submaxillary gland androgen regulated protein 3 homolog A (mouse)"""	PROL5		9354371, 17512016	Standard	NM_012390		Approved	PBI, PRL5	uc003hfg.1	Q99954	OTTHUMG00000160839	ENST00000226460.4:c.342T>A	4.37:g.71232648T>A						SMR3B_uc011cas.1_Intron	p.P114P	NM_012390	NP_036522	Q99954	SMR3A_HUMAN			3	423	+		all_hematologic(202;0.196)	114			Pro-rich.			Silent	SNP	ENST00000226460.4	37	c.342T>A	CCDS34000.1																																																																																				0.517	SMR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362574.1	NM_012390		35	74	0	0	0	0.021022	0	35	74				
MAML3	55534	broad.mit.edu	37	4	140640665	140640665	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr4:140640665G>A	ENST00000509479.2	-	5	4085	c.3229C>T	c.(3229-3231)Cca>Tca	p.P1077S	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)									p.P1077S(2)		breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					TGGCTGCTTGGAGCAAAGCTG	0.622																																							uc003ihz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(3214-3216)CCA>TCA		mastermind-like 3							36.0	41.0	39.0					4																	140640665		2192	4294	6486	SO:0001583	missense	55534				Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity	g.chr4:140640665G>A	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.3229C>T	4.37:g.140640665G>A	ENSP00000421180:p.Pro1077Ser					MGST2_uc010ioi.1_Intron|MAML3_uc011chd.1_Missense_Mutation_p.P540S	p.P1072S	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN			7	3966	-	all_hematologic(180;0.162)		1073						Missense_Mutation	SNP	ENST00000509479.2	37	c.3214C>T	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	G	3.599	-0.081993	0.07141	.	.	ENSG00000196782	ENST00000509479;ENST00000538400	T	0.20881	2.04	4.63	-5.44	0.02624	.	0.760191	0.12368	N	0.475037	T	0.11410	0.0278	L	0.36672	1.1	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.41945	-0.9480	10	0.10377	T	0.69	.	8.7929	0.34861	0.2086:0.4952:0.2962:0.0	.	1077;1073	E7EVW8;Q96JK9	.;MAML3_HUMAN	S	1077;384	ENSP00000421180:P1077S	ENSP00000421180:P1077S	P	-	1	0	MAML3	140860115	0.249000	0.23941	0.000000	0.03702	0.662000	0.39071	0.821000	0.27338	-1.041000	0.03266	-0.191000	0.12829	CCA		0.622	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2			8	30	0	0	0	0.008291	0	8	30				
OTUD4	54726	broad.mit.edu	37	4	146077104	146077104	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr4:146077104G>C	ENST00000447906.2	-	8	861	c.674C>G	c.(673-675)cCt>cGt	p.P225R	OTUD4_ENST00000455611.2_5'UTR|OTUD4_ENST00000454497.2_Missense_Mutation_p.P160R			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	225					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)	p.P160R(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					GCCTGACAAAGGTTTAAATCC	0.313																																							uc003ika.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(478-480)CCT>CGT		OTU domain containing 4 protein isoform 3							59.0	63.0	62.0					4																	146077104		2203	4300	6503	SO:0001583	missense	54726						protein binding	g.chr4:146077104G>C		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.674C>G	4.37:g.146077104G>C	ENSP00000395487:p.Pro225Arg					OTUD4_uc003ijz.3_Missense_Mutation_p.P160R	p.P160R	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN			8	617	-	all_hematologic(180;0.151)		225					B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	ENST00000447906.2	37	c.479C>G		.	.	.	.	.	.	.	.	.	.	G	15.19	2.761333	0.49468	.	.	ENSG00000164164	ENST00000454497;ENST00000447906;ENST00000514973	T;T;T	0.32272	1.47;1.46;1.53	5.37	5.37	0.77165	.	0.477498	0.22714	N	0.056535	T	0.31606	0.0802	L	0.46157	1.445	0.80722	D	1	P;B	0.37636	0.603;0.242	B;B	0.36186	0.219;0.047	T	0.06023	-1.0850	10	0.42905	T	0.14	-2.0838	18.4546	0.90715	0.0:0.0:1.0:0.0	.	225;225	G3V0I6;Q01804	.;OTUD4_HUMAN	R	160;225;160	ENSP00000409279:P160R;ENSP00000395487:P225R;ENSP00000425972:P160R	ENSP00000395487:P225R	P	-	2	0	OTUD4	146296554	0.999000	0.42202	0.939000	0.37840	0.912000	0.54170	4.495000	0.60353	2.669000	0.90835	0.655000	0.94253	CCT		0.313	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493		13	54	0	0	0	0.016723	0	13	54				
TRIM2	23321	broad.mit.edu	37	4	154217122	154217122	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr4:154217122G>T	ENST00000437508.2	+	6	1564	c.1363G>T	c.(1363-1365)Gca>Tca	p.A455S	TRIM2_ENST00000338700.5_Missense_Mutation_p.A482S|TRIM2_ENST00000494872.1_3'UTR	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	455					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A482S(1)|p.A455S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		GAAAAGACCCGCAAGCATGTA	0.557																																							uc003ing.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(1363-1365)GCA>TCA		tripartite motif-containing 2 isoform 2							58.0	61.0	60.0					4																	154217122		2203	4300	6503	SO:0001583	missense	23321					cytoplasm	zinc ion binding	g.chr4:154217122G>T	AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.1363G>T	4.37:g.154217122G>T	ENSP00000415812:p.Ala455Ser					TRIM2_uc003inh.2_Missense_Mutation_p.A482S	p.A455S	NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)	6	1564	+	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)	455					D3DP09|O60272|Q9BSI9|Q9UFZ1	Missense_Mutation	SNP	ENST00000437508.2	37	c.1363G>T	CCDS47147.1	.	.	.	.	.	.	.	.	.	.	G	2.280	-0.364954	0.05103	.	.	ENSG00000109654	ENST00000437508;ENST00000338700	T;T	0.68765	-0.35;-0.35	5.59	4.73	0.59995	.	0.146621	0.64402	D	0.000009	T	0.36936	0.0985	N	0.01473	-0.845	0.58432	D	0.999998	B;B	0.17852	0.024;0.024	B;B	0.16289	0.015;0.008	T	0.41662	-0.9496	10	0.06099	T	0.92	-12.0336	16.3512	0.83208	0.0:0.1321:0.8678:0.0	.	482;455	D3DP09;Q9C040	.;TRIM2_HUMAN	S	455;482	ENSP00000415812:A455S;ENSP00000339659:A482S	ENSP00000339659:A482S	A	+	1	0	TRIM2	154436572	1.000000	0.71417	0.890000	0.34922	0.977000	0.68977	6.146000	0.71777	1.322000	0.45245	0.561000	0.74099	GCA		0.557	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342652.1			8	38	1	0	5.18039e-06	0.00308	6.21132e-06	8	38				
TENM3	55714	broad.mit.edu	37	4	183245345	183245345	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr4:183245345C>A	ENST00000511685.1	+	2	295	c.172C>A	c.(172-174)Ctt>Att	p.L58I	TENM3_ENST00000406950.2_Missense_Mutation_p.L58I			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	58	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.L58I(1)									CTCGCGGCTGCTTTACGGCAA	0.478																																							uc003ivd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(172-174)CTT>ATT		odz, odd Oz/ten-m homolog 3							121.0	121.0	121.0					4																	183245345		1955	4158	6113	SO:0001583	missense	55714				signal transduction	integral to membrane		g.chr4:183245345C>A	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.172C>A	4.37:g.183245345C>A	ENSP00000424226:p.Leu58Ile					ODZ3_uc010irv.1_Missense_Mutation_p.L58I	p.L58I	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)	1	209	+		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)	58			Cytoplasmic (Potential).|Teneurin N-terminal.		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	c.172C>A	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.593495	0.46214	.	.	ENSG00000218336	ENST00000512480;ENST00000511685;ENST00000406950	T;T;T	0.29655	1.56;1.56;1.56	5.65	5.65	0.86999	Teneurin intracellular, N-terminal (2);	.	.	.	.	T	0.33440	0.0863	L	0.40543	1.245	0.29421	N	0.860566	P;P	0.39920	0.695;0.58	B;B	0.40066	0.318;0.303	T	0.17776	-1.0358	9	0.46703	T	0.11	.	19.9142	0.97043	0.0:1.0:0.0:0.0	.	58;58	D6RGC5;Q9P273	.;TEN3_HUMAN	I	58	ENSP00000421320:L58I;ENSP00000424226:L58I;ENSP00000385276:L58I	ENSP00000385276:L58I	L	+	1	0	ODZ3	183482339	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.889000	0.48601	2.941000	0.99782	0.655000	0.94253	CTT		0.478	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1			23	76	1	0	0.00278032	0.016522	0.00308782	23	76				
F11	2160	broad.mit.edu	37	4	187192834	187192834	+	Missense_Mutation	SNP	G	G	T	rs281875264		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr4:187192834G>T	ENST00000403665.2	+	3	479	c.127G>T	c.(127-129)Gcc>Tcc	p.A43S	F11_ENST00000492972.2_Missense_Mutation_p.A43S|F11_ENST00000264692.4_Missense_Mutation_p.A43S	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	43	Apple 1. {ECO:0000255|PROSITE- ProRule:PRU00315}.		A -> T (in FA11D; dominant-negative mutation that results in severely decreased protein secretion; dbSNP:rs281875264). {ECO:0000269|PubMed:21457405}.		blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)	p.A43S(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	CACACCAAGCGCCAAGTACTG	0.488																																							uc003iza.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(127-129)GCC>TCC		coagulation factor XI precursor	Coagulation Factor IX(DB00100)						199.0	156.0	171.0					4																	187192834		2203	4300	6503	SO:0001583	missense	2160				blood coagulation, intrinsic pathway|plasminogen activation|positive regulation of fibrinolysis	extracellular space|plasma membrane	heparin binding|serine-type endopeptidase activity	g.chr4:187192834G>T	M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.127G>T	4.37:g.187192834G>T	ENSP00000384957:p.Ala43Ser					F11_uc003iyz.2_Missense_Mutation_p.A43S	p.A43S	NM_000128	NP_000119	P03951	FA11_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	3	460	+		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)	43			Apple 1.		D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	ENST00000403665.2	37	c.127G>T	CCDS3847.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210165	0.39003	.	.	ENSG00000088926	ENST00000403665;ENST00000264692;ENST00000492972	D;D;D	0.89746	-2.56;-2.56;-2.56	6.17	3.53	0.40419	Apple domain (2);PAN-1 domain (1);Apple-like (1);	0.225652	0.38959	N	0.001513	D	0.93969	0.8069	M	0.86953	2.85	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87033	0.2136	10	0.66056	D	0.02	.	8.7548	0.34639	0.1294:0.0:0.7461:0.1245	.	43	P03951	FA11_HUMAN	S	43	ENSP00000384957:A43S;ENSP00000264692:A43S;ENSP00000424479:A43S	ENSP00000264692:A43S	A	+	1	0	F11	187429828	0.231000	0.23751	0.004000	0.12327	0.003000	0.03518	1.842000	0.39250	0.481000	0.27557	-0.181000	0.13052	GCC		0.488	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317519.4			12	92	1	0	4.84862e-15	0.010729	6.7937e-15	12	92				
OXCT1	5019	broad.mit.edu	37	5	41853613	41853613	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr5:41853613T>A	ENST00000196371.5	-	4	482	c.322A>T	c.(322-324)Ata>Tta	p.I108L		NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	108					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)	p.I108L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	ATGCGTTTTATCTGCTTGGAC	0.423																																							uc003jmn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(322-324)ATA>TTA		3-oxoacid CoA transferase 1 precursor	Succinic acid(DB00139)						92.0	85.0	88.0					5																	41853613		2203	4300	6503	SO:0001583	missense	5019				cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity	g.chr5:41853613T>A	U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.322A>T	5.37:g.41853613T>A	ENSP00000196371:p.Ile108Leu						p.I108L	NM_000436	NP_000427	P55809	SCOT1_HUMAN			4	653	-			108					B2R5V2|B7Z528	Missense_Mutation	SNP	ENST00000196371.5	37	c.322A>T	CCDS3937.1	.	.	.	.	.	.	.	.	.	.	T	17.42	3.384026	0.61845	.	.	ENSG00000083720	ENST00000196371;ENST00000546045	T	0.80393	-1.37	5.53	5.53	0.82687	3-oxoacid CoA-transferase, subunit A (1);	0.000000	0.85682	D	0.000000	T	0.78654	0.4317	L	0.50993	1.605	0.80722	D	1	B	0.14012	0.009	B	0.27608	0.081	T	0.74970	-0.3482	10	0.49607	T	0.09	-10.6852	15.682	0.77376	0.0:0.0:0.0:1.0	.	108	P55809	SCOT1_HUMAN	L	108;20	ENSP00000196371:I108L	ENSP00000196371:I108L	I	-	1	0	OXCT1	41889370	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	7.879000	0.87236	2.112000	0.64535	0.528000	0.53228	ATA		0.423	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436		3	38	0	0	0	0.009096	0	3	38				
KCNN2	3781	broad.mit.edu	37	5	113831719	113831719	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr5:113831719T>C	ENST00000512097.3	+	9	2598	c.1580T>C	c.(1579-1581)cTc>cCc	p.L527P	KCNN2_ENST00000503706.1_Missense_Mutation_p.L179P|KCNN2_ENST00000264773.3_Missense_Mutation_p.L527P|RP11-492A10.1_ENST00000514115.1_RNA			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	527					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.L527P(1)|p.L179P(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	CTCCCTGGGCTCATAAGCCAG	0.502																																							uc003kqo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1579-1581)CTC>CCC		small conductance calcium-activated potassium							126.0	125.0	125.0					5																	113831719		2202	4300	6502	SO:0001583	missense	3781					integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity	g.chr5:113831719T>C	AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.1580T>C	5.37:g.113831719T>C	ENSP00000427120:p.Leu527Pro					KCNN2_uc003kqp.2_Missense_Mutation_p.L179P|KCNN2_uc010jcg.2_RNA|uc003kqr.1_Intron	p.L527P	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	8	2037	+		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)	527					A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Missense_Mutation	SNP	ENST00000512097.3	37	c.1580T>C	CCDS4114.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.160445	0.78226	.	.	ENSG00000080709	ENST00000264773;ENST00000503706	D;D	0.98747	-5.11;-3.58	5.28	5.28	0.74379	.	0.057751	0.64402	D	0.000001	D	0.98960	0.9646	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	D	0.99785	1.1029	10	0.72032	D	0.01	.	14.9059	0.70718	0.0:0.0:0.0:1.0	.	527	Q9H2S1	KCNN2_HUMAN	P	527;179	ENSP00000264773:L527P;ENSP00000421439:L179P	ENSP00000264773:L527P	L	+	2	0	KCNN2	113859618	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	7.596000	0.82721	2.009000	0.58944	0.523000	0.50628	CTC		0.502	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250775.2	NM_021614		3	135	0	0	0	0.004672	0	3	135				
TRIM36	55521	broad.mit.edu	37	5	114482982	114482982	+	Silent	SNP	G	G	A	rs139015715	byFrequency	TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr5:114482982G>A	ENST00000282369.3	-	3	529	c.408C>T	c.(406-408)ttC>ttT	p.F136F	TRIM36_ENST00000513154.1_Silent_p.F124F|TRIM36_ENST00000515104.1_5'UTR|TRIM36_ENST00000514154.1_5'UTR|TRIM36-IT1_ENST00000503723.1_RNA	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	136					acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.F136F(1)		breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TTTCCAAAGTGAAGTTTCGAA	0.458																																							uc003kqs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|lung(2)|breast(2)	8						c.(406-408)TTC>TTT		tripartite motif-containing 36 isoform 1							180.0	164.0	170.0					5																	114482982		2202	4300	6502	SO:0001819	synonymous_variant	55521					acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding	g.chr5:114482982G>A	AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.408C>T	5.37:g.114482982G>A						TRIM36_uc011cwc.1_Silent_p.F124F|TRIM36_uc003kqt.2_5'UTR	p.F136F	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)	3	917	-		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)	136					A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Silent	SNP	ENST00000282369.3	37	c.408C>T	CCDS4115.1																																																																																				0.458	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2	NM_018700		11	134	0	0	0	0.008291	0	11	134				
PCDHB6	56130	broad.mit.edu	37	5	140531678	140531678	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr5:140531678G>A	ENST00000231136.1	+	1	1840	c.1840G>A	c.(1840-1842)Ggc>Agc	p.G614S	PCDHB6_ENST00000543635.1_Missense_Mutation_p.G478S	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	614	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G614S(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGTCTGTTCGGCGTGTGGGC	0.667																																							uc003lir.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1840-1842)GGC>AGC		protocadherin beta 6 precursor																																				SO:0001583	missense	56130				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140531678G>A	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1840G>A	5.37:g.140531678G>A	ENSP00000231136:p.Gly614Ser					PCDHB6_uc011dah.1_Missense_Mutation_p.G478S	p.G614S	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1840	+			614			Cadherin 6.|Extracellular (Potential).		B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	c.1840G>A	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	G	0.019	-1.451822	0.01080	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.48201	0.82;0.82	4.51	-5.61	0.02489	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.13500	0.0327	N	0.00157	-1.96	0.09310	N	0.999993	B	0.17038	0.02	B	0.17098	0.017	T	0.39099	-0.9630	9	0.32370	T	0.25	.	15.5638	0.76273	0.8089:0.0:0.1911:0.0	.	614	Q9Y5E3	PCDB6_HUMAN	S	478;614	ENSP00000438466:G478S;ENSP00000231136:G614S	ENSP00000231136:G614S	G	+	1	0	PCDHB6	140511862	0.000000	0.05858	0.948000	0.38648	0.118000	0.20060	-1.973000	0.01500	-0.962000	0.03604	-0.378000	0.06908	GGC		0.667	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939		5	67	0	0	0	0.00308	0	5	67				
PCDHB11	56125	broad.mit.edu	37	5	140579865	140579865	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr5:140579865G>T	ENST00000354757.3	+	1	518	c.518G>T	c.(517-519)aGc>aTc	p.S173I	PCDHB11_ENST00000536699.1_Intron	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	173	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S173I(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TACACAATAAGCCCCAACTCT	0.428																																							uc003liy.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(517-519)AGC>ATC		protocadherin beta 11 precursor							75.0	80.0	78.0					5																	140579865		2203	4300	6503	SO:0001583	missense	56125				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140579865G>T	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.518G>T	5.37:g.140579865G>T	ENSP00000346802:p.Ser173Ile					PCDHB11_uc011daj.1_Intron	p.S173I	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	518	+			173			Extracellular (Potential).|Cadherin 2.		B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	c.518G>T	CCDS4253.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469908	0.43839	.	.	ENSG00000197479	ENST00000354757	T	0.52295	0.67	2.7	1.79	0.24919	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.60612	0.2282	M	0.78223	2.4	0.09310	N	1	B	0.22414	0.069	P	0.45971	0.499	T	0.62177	-0.6909	9	0.72032	D	0.01	.	7.053	0.25083	0.1165:0.1814:0.7021:0.0	.	173	Q9Y5F2	PCDBB_HUMAN	I	173	ENSP00000346802:S173I	ENSP00000346802:S173I	S	+	2	0	PCDHB11	140560049	0.000000	0.05858	0.055000	0.19348	0.948000	0.59901	-0.239000	0.08965	1.496000	0.48567	0.467000	0.42956	AGC		0.428	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		25	93	1	0	1.66031e-10	0.021523	2.19854e-10	25	93				
PCDHB12	56124	broad.mit.edu	37	5	140589508	140589508	+	Silent	SNP	C	C	T	rs377624441		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr5:140589508C>T	ENST00000239450.2	+	1	1218	c.1029C>T	c.(1027-1029)aaC>aaT	p.N343N	PCDHB12_ENST00000541609.1_Silent_p.N6N	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	343	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N343N(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAAACGACAACGCTCCTGAAA	0.433																																							uc003liz.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(1027-1029)AAC>AAT		protocadherin beta 12 precursor		T		1,4403	825.2+/-416.5	0,1,2201	83.0	83.0	83.0		1029	1.6	0.8	5		83	0,8600		0,0,4300	no	coding-synonymous	PCDHB12	NM_018932.3		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		343/796	140589508	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140589508C>T	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1029C>T	5.37:g.140589508C>T						PCDHB12_uc011dak.1_Silent_p.N6N	p.N343N	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1218	+			343			Extracellular (Potential).|Cadherin 3.		B4DDU1	Silent	SNP	ENST00000239450.2	37	c.1029C>T	CCDS4254.1																																																																																				0.433	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		21	59	0	0	0	0.010504	0	21	59				
JAKMIP2	9832	broad.mit.edu	37	5	146997537	146997537	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr5:146997537C>A	ENST00000265272.5	-	19	2750	c.2283G>T	c.(2281-2283)aaG>aaT	p.K761N	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.K719N|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.K740N	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	761						Golgi apparatus (GO:0005794)		p.K761N(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTCTCTGCTCTTCCTCAGCA	0.463																																							uc003loq.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(2281-2283)AAG>AAT		janus kinase and microtubule interacting protein							165.0	138.0	147.0					5																	146997537		2203	4300	6503	SO:0001583	missense	9832					Golgi apparatus		g.chr5:146997537C>A	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.2283G>T	5.37:g.146997537C>A	ENSP00000265272:p.Lys761Asn					JAKMIP2_uc011dbx.1_Missense_Mutation_p.K719N|JAKMIP2_uc003lor.1_Missense_Mutation_p.K740N|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Missense_Mutation_p.K761N	p.K761N	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		19	2665	-			761			Potential.		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	c.2283G>T	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346277	0.61073	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.23950	1.89;1.88;1.88	5.61	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.22085	0.0532	L	0.44542	1.39	0.49582	D	0.999801	P;P;P;P	0.40731	0.728;0.728;0.728;0.728	B;B;B;B	0.38616	0.277;0.219;0.219;0.16	T	0.02705	-1.1121	10	0.56958	D	0.05	.	9.5556	0.39337	0.0:0.7988:0.0:0.2012	.	719;761;740;761	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	N	740;761;719;740	ENSP00000421398:K740N;ENSP00000265272:K761N;ENSP00000328989:K719N	ENSP00000265272:K761N	K	-	3	2	JAKMIP2	146977730	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.390000	0.44416	1.516000	0.48900	-0.251000	0.11542	AAG		0.463	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790		19	80	1	0	1.45105e-14	0.006122	2.02141e-14	19	80				
SQSTM1	8878	broad.mit.edu	37	5	179249978	179249978	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr5:179249978G>T	ENST00000389805.4	+	2	404	c.226G>T	c.(226-228)Gcc>Tcc	p.A76S	SQSTM1_ENST00000510187.1_Missense_Mutation_p.A76S|SQSTM1_ENST00000376929.3_5'UTR|SQSTM1_ENST00000360718.5_5'UTR|SQSTM1_ENST00000402874.3_5'UTR	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	76	Interaction with PAWR.|Interaction with PRKCZ and dimerization. {ECO:0000250}.|OPR.				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)	p.A76S(1)	SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGACTTGGTTGCCTTTTCCAG	0.517																																							uc003mkw.3		NA																SQSTM1/ALK(2)	1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3						c.(226-228)GCC>TCC		sequestosome 1 isoform 1							138.0	121.0	127.0					5																	179249978		2203	4299	6502	SO:0001583	missense	8878	Paget_Disease_of_Bone			anti-apoptosis|apoptosis|cell differentiation|endosome transport|induction of apoptosis by extracellular signals|intracellular signal transduction|macroautophagy|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein localization|regulation of I-kappaB kinase/NF-kappaB cascade|ubiquitin-dependent protein catabolic process	cytosol|late endosome|nucleoplasm	protein kinase C binding|receptor tyrosine kinase binding|SH2 domain binding|ubiquitin binding|zinc ion binding	g.chr5:179249978G>T	U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.226G>T	5.37:g.179249978G>T	ENSP00000374455:p.Ala76Ser					SQSTM1_uc011dgr.1_5'UTR|SQSTM1_uc011dgs.1_5'UTR|SQSTM1_uc003mkv.3_Missense_Mutation_p.A76S|SQSTM1_uc003mkx.2_5'UTR	p.A76S	NM_003900	NP_003891	Q13501	SQSTM_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		2	321	+	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	76			OPR.|Interaction with PRKCZ and dimerization (By similarity).|Interaction with PAWR.		A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Missense_Mutation	SNP	ENST00000389805.4	37	c.226G>T	CCDS34317.1	.	.	.	.	.	.	.	.	.	.	G	36	5.616682	0.96649	.	.	ENSG00000161011	ENST00000389805;ENST00000504627;ENST00000510187	T;T;T	0.18810	2.19;2.19;2.19	5.47	5.47	0.80525	Phox/Bem1p (2);	0.052165	0.85682	D	0.000000	T	0.42653	0.1212	L	0.52759	1.655	0.80722	D	1	B;D	0.71674	0.064;0.998	B;D	0.87578	0.18;0.998	T	0.05370	-1.0889	10	0.35671	T	0.21	-32.1815	18.9331	0.92574	0.0:0.0:1.0:0.0	.	76;76	Q13501;E7EMC7	SQSTM_HUMAN;.	S	76;99;76	ENSP00000374455:A76S;ENSP00000425957:A99S;ENSP00000424477:A76S	ENSP00000374455:A76S	A	+	1	0	SQSTM1	179182584	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.612000	0.98347	2.562000	0.86427	0.561000	0.74099	GCC		0.517	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319344.1			7	51	1	0	5.4927e-09	0.004482	7.04118e-09	7	51				
F13A1	2162	broad.mit.edu	37	6	6167695	6167695	+	Missense_Mutation	SNP	A	A	T	rs372738301		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:6167695A>T	ENST00000264870.3	-	13	2169	c.1904T>A	c.(1903-1905)aTc>aAc	p.I635N	MIR5683_ENST00000584820.1_RNA	NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	635					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.I635N(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	ACTGACCTTGATGATGATCTC	0.498																																							uc003mwv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6						c.(1903-1905)ATC>AAC		coagulation factor XIII A1 subunit precursor	L-Glutamine(DB00130)						206.0	157.0	174.0					6																	6167695		2203	4300	6503	SO:0001583	missense	2162				peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr6:6167695A>T	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1904T>A	6.37:g.6167695A>T	ENSP00000264870:p.Ile635Asn					F13A1_uc011dib.1_Missense_Mutation_p.I572N	p.I635N	NM_000129	NP_000120	P00488	F13A_HUMAN			13	2027	-	Ovarian(93;0.0816)	all_hematologic(90;0.152)	635					Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	c.1904T>A	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.048849	0.55110	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.73897	-0.79	5.71	5.71	0.89125	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.190389	0.46145	D	0.000318	D	0.83695	0.5310	M	0.82823	2.61	0.45852	D	0.998713	D;D	0.61697	0.98;0.99	P;D	0.66602	0.73;0.945	D	0.86718	0.1940	10	0.87932	D	0	.	15.1562	0.72743	1.0:0.0:0.0:0.0	.	572;635	F5H080;P00488	.;F13A_HUMAN	N	635;572	ENSP00000264870:I635N	ENSP00000264870:I635N	I	-	2	0	F13A1	6112694	1.000000	0.71417	1.000000	0.80357	0.216000	0.24613	5.907000	0.69908	2.181000	0.69327	0.482000	0.46254	ATC		0.498	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129		22	77	0	0	0	0.016522	0	22	77				
CAGE1	285782	broad.mit.edu	37	6	7334277	7334277	+	Nonsense_Mutation	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:7334277T>A	ENST00000512086.1	-	10	2432	c.2230A>T	c.(2230-2232)Aga>Tga	p.R744*	SSR1_ENST00000488834.1_5'UTR|CAGE1_ENST00000296742.7_Nonsense_Mutation_p.R608*|CAGE1_ENST00000379918.4_Nonsense_Mutation_p.R784*|CAGE1_ENST00000502583.1_Nonsense_Mutation_p.R806*|CAGE1_ENST00000338150.4_Nonsense_Mutation_p.R771*			Q8TC20	CAGE1_HUMAN	cancer antigen 1	744								p.R771*(1)|p.R806*(1)|p.R608*(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|lung(11)|urinary_tract(1)	19	Ovarian(93;0.0418)					GCTTTTTCTCTGGGCTTTCTA	0.318																																							uc003mxi.2		NA																	3	Substitution - Nonsense(3)		lung(3)		0						c.(1822-1824)AGA>TGA		cancer antigen 1							49.0	43.0	45.0					6																	7334277		1766	3995	5761	SO:0001587	stop_gained	285782							g.chr6:7334277T>A	BC026194	CCDS47367.1, CCDS54964.1, CCDS54965.1	6p24.3	2009-08-06	2005-01-26	2005-01-27	ENSG00000164304	ENSG00000164304			21622	protein-coding gene	gene with protein product	"""cancer/testis antigen 95"""	608304	"""cancer/testis antigen 3"""	CTAG3		12531476	Standard	NM_205864		Approved	bA69L16.7, CT95	uc003mxl.2	Q8TC20	OTTHUMG00000014200	ENST00000512086.1:c.2230A>T	6.37:g.7334277T>A	ENSP00000427583:p.Arg744*					CAGE1_uc003mxh.2_RNA|CAGE1_uc003mxj.2_Nonsense_Mutation_p.R561*|CAGE1_uc003mxk.1_Nonsense_Mutation_p.R526*	p.R608*	NM_205864	NP_995586	Q8TC20	CAGE1_HUMAN			9	2543	-	Ovarian(93;0.0418)		744					D6RCT9|Q5TAM0|Q86TM4|Q8N7R5	Nonsense_Mutation	SNP	ENST00000512086.1	37	c.1822A>T		.	.	.	.	.	.	.	.	.	.	T	40	8.313821	0.98754	.	.	ENSG00000164304	ENST00000541116;ENST00000379918;ENST00000502583;ENST00000296742;ENST00000512086;ENST00000338150	.	.	.	4.62	4.62	0.57501	.	0.545594	0.16937	N	0.193420	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.4504	10.6333	0.45549	0.0:0.0:0.0:1.0	.	.	.	.	X	744;784;806;608;744;771	.	ENSP00000296742:R608X	R	-	1	2	CAGE1	7279276	0.954000	0.32549	0.973000	0.42090	0.895000	0.52256	1.904000	0.39868	2.073000	0.62155	0.477000	0.44152	AGA		0.318	CAGE1-008	PUTATIVE	non_canonical_conserved|basic	protein_coding	protein_coding	OTTHUMT00000367136.1	NM_175745		3	10	0	0	0	0.009096	0	3	10				
ATXN1	6310	broad.mit.edu	37	6	16327897	16327897	+	Missense_Mutation	SNP	C	C	A	rs184327938		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:16327897C>A	ENST00000244769.4	-	8	1581	c.645G>T	c.(643-645)caG>caT	p.Q215H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q215H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	215	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.Q215H(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgctgctgct	0.667																																							uc003nbt.2		NA																	1	Substitution - Missense(1)		central_nervous_system(1)	skin(3)|central_nervous_system(1)	4						c.(643-645)CAG>CAT		ataxin 1							4.0	8.0	7.0					6																	16327897		1730	3633	5363	SO:0001583	missense	6310				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association	g.chr6:16327897C>A	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.645G>T	6.37:g.16327897C>A	ENSP00000244769:p.Gln215His					ATXN1_uc010jpi.2_Missense_Mutation_p.Q215H|ATXN1_uc010jpj.1_Intron	p.Q215H	NM_000332	NP_000323	P54253	ATX1_HUMAN			8	1616	-	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)	215			Poly-Gln.		Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	c.645G>T	CCDS34342.1	161	0.07371794871794872	7	0.014227642276422764	16	0.04419889502762431	116	0.20279720279720279	22	0.029023746701846966	-	1.752	-0.489019	0.04352	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.56611	0.45;0.45	.	.	.	.	.	.	.	.	T	0.13713	0.0332	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.21245	-1.0251	5	0.59425	D	0.04	.	.	.	.	.	215	P54253	ATX1_HUMAN	H	215	ENSP00000244769:Q215H;ENSP00000416360:Q215H	ENSP00000244769:Q215H	Q	-	3	2	ATXN1	16435876	0.000000	0.05858	0.011000	0.14972	0.097000	0.18754	-0.615000	0.05597	0.107000	0.17824	0.109000	0.15622	CAG		0.667	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332		3	6	1	0	2.56e-06	0.009096	3.11596e-06	3	6				
HDGFL1	154150	broad.mit.edu	37	6	22569816	22569816	+	Silent	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:22569816C>T	ENST00000230012.3	+	1	139	c.12C>T	c.(10-12)taC>taT	p.Y4Y	HDGFL1_ENST00000510882.2_Silent_p.Y4Y	NM_138574.2	NP_612641.2	Q5TGJ6	HDGL1_HUMAN	hepatoma derived growth factor-like 1	4								p.Y4Y(1)		kidney(1)|large_intestine(3)|lung(7)	11	Ovarian(93;0.163)					TGTCGGCCTACGGCATGCCCA	0.647																																							uc003nds.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(10-12)TAC>TAT		hepatoma derived growth factor-like 1							50.0	52.0	51.0					6																	22569816		2203	4300	6503	SO:0001819	synonymous_variant	154150							g.chr6:22569816C>T	AK056824	CCDS34347.1	6p22.2	2008-02-05	2005-04-07	2005-04-07	ENSG00000112273	ENSG00000112273			21095	protein-coding gene	gene with protein product			"""PWWP domain containing 1"""	PWWP1			Standard	NM_138574		Approved	dJ309H15.1	uc003nds.3	Q5TGJ6	OTTHUMG00000016206	ENST00000230012.3:c.12C>T	6.37:g.22569816C>T							p.Y4Y	NM_138574	NP_612641	Q5TGJ6	HDGL1_HUMAN			1	139	+	Ovarian(93;0.163)		4					Q96MJ6	Silent	SNP	ENST00000230012.3	37	c.12C>T	CCDS34347.1																																																																																				0.647	HDGFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043500.1	NM_138574		12	36	0	0	0	0.013537	0	12	36				
KIAA0319	9856	broad.mit.edu	37	6	24596749	24596749	+	Silent	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:24596749G>A	ENST00000378214.3	-	3	677	c.153C>T	c.(151-153)acC>acT	p.T51T	KIAA0319_ENST00000543707.1_Silent_p.T51T|KIAA0319_ENST00000535378.1_Silent_p.T42T|KIAA0319_ENST00000537886.1_Silent_p.T51T|KIAA0319_ENST00000430948.2_Silent_p.T6T	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	51	MANSC. {ECO:0000255|PROSITE- ProRule:PRU00341}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T51T(1)		breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						CGACAGGGAAGGTGTGAGACA	0.582																																							uc011djo.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(151-153)ACC>ACT		KIAA0319 precursor							80.0	65.0	70.0					6																	24596749		2203	4300	6503	SO:0001819	synonymous_variant	9856				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding	g.chr6:24596749G>A	AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.153C>T	6.37:g.24596749G>A						KIAA0319_uc011djp.1_Silent_p.T6T|KIAA0319_uc003neh.1_Silent_p.T51T|KIAA0319_uc011djq.1_Silent_p.T42T|KIAA0319_uc011djr.1_Silent_p.T51T	p.T51T	NM_014809	NP_055624	Q5VV43	K0319_HUMAN			3	390	-			51			MANSC.|Extracellular (Potential).		A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Silent	SNP	ENST00000378214.3	37	c.153C>T	CCDS34348.1																																																																																				0.582	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040009.1	NM_014809		14	57	0	0	0	0.016723	0	14	57				
GPR111	222611	broad.mit.edu	37	6	47647861	47647861	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:47647861A>G	ENST00000296862.1	+	5	526	c.526A>G	c.(526-528)Act>Gct	p.T176A	GPR111_ENST00000398742.2_Missense_Mutation_p.T108A|GPR111_ENST00000507065.1_Missense_Mutation_p.T108A			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	176					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T176A(1)|p.T108A(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						AAGTGTATATACTGGAAAGTC	0.333																																							uc010jzj.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(526-528)ACT>GCT		G-protein coupled receptor 111							74.0	71.0	72.0					6																	47647861		1821	4087	5908	SO:0001583	missense	222611				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:47647861A>G	AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.526A>G	6.37:g.47647861A>G	ENSP00000296862:p.Thr176Ala					GPR111_uc010jzk.1_Missense_Mutation_p.T108A|GPR111_uc003oyy.2_RNA	p.T176A	NM_153839	NP_722581	Q8IZF7	GP111_HUMAN			5	527	+			176			Extracellular (Potential).		Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Missense_Mutation	SNP	ENST00000296862.1	37	c.526A>G		.	.	.	.	.	.	.	.	.	.	A	0.092	-1.165303	0.01673	.	.	ENSG00000164393	ENST00000507065;ENST00000296862;ENST00000398742	T;T;T	0.19806	2.12;2.12;2.12	5.31	-10.6	0.00265	.	2.179520	0.02353	N	0.076136	T	0.01029	0.0034	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20107	-1.0285	10	0.06891	T	0.86	.	2.0012	0.03467	0.3184:0.1636:0.085:0.433	.	108;176	Q8IZF7-2;Q8IZF7	.;GP111_HUMAN	A	108;176;108	ENSP00000422934:T108A;ENSP00000296862:T176A;ENSP00000381727:T108A	ENSP00000296862:T176A	T	+	1	0	GPR111	47755820	.	.	0.000000	0.03702	0.002000	0.02628	.	.	-4.491000	0.00046	-1.356000	0.01223	ACT		0.333	GPR111-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000106423.2	NM_153839		10	27	0	0	0	0.006214	0	10	27				
PRIM2	5558	broad.mit.edu	37	6	57512650	57512650	+	3'UTR	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:57512650C>A	ENST00000389488.2	+	0	1565				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)	p.S493Y(2)|p.S493C(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTAAATTCCTCTCTGGAAATG	0.403																																							uc003pdx.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(1477-1479)TCT>TAT		DNA primase polypeptide 2							406.0	390.0	395.0					6																	57512650		1932	4138	6070	SO:0001624	3_prime_UTR_variant	5558				DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding	g.chr6:57512650C>A		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1562C>A	6.37:g.57512650C>A							p.S493Y	NM_000947	NP_000938	P49643	PRI2_HUMAN		Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)	15	1565	+			493					Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	ENST00000389488.2	37	c.1478C>A																																																																																					0.403	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3	NM_000947		50	528	1	0	2.02627e-32	0.01441	3.21271e-32	50	528				
COL12A1	1303	broad.mit.edu	37	6	75875304	75875304	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:75875304C>T	ENST00000322507.8	-	14	3211	c.2902G>A	c.(2902-2904)Gag>Aag	p.E968K	COL12A1_ENST00000483888.2_Missense_Mutation_p.E968K|COL12A1_ENST00000416123.2_Missense_Mutation_p.E968K|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	968	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.E968K(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TATTTGGTCTCTGGCTGCAGA	0.408																																							uc003phs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						c.(2902-2904)GAG>AAG		collagen, type XII, alpha 1 long isoform							133.0	129.0	130.0					6																	75875304		1886	4112	5998	SO:0001583	missense	1303				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength	g.chr6:75875304C>T	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2902G>A	6.37:g.75875304C>T	ENSP00000325146:p.Glu968Lys					COL12A1_uc003pht.2_Intron	p.E968K	NM_004370	NP_004361	Q99715	COCA1_HUMAN			14	3068	-			968			Fibronectin type-III 6.		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	c.2902G>A	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	31	5.074334	0.94000	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.56776	0.44;0.44;0.44	5.55	5.55	0.83447	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000005	T	0.71341	0.3328	M	0.80847	2.515	0.58432	D	0.999999	D	0.76494	0.999	D	0.85130	0.997	T	0.73418	-0.3989	10	0.56958	D	0.05	.	19.4944	0.95065	0.0:1.0:0.0:0.0	.	968	Q99715	COCA1_HUMAN	K	968	ENSP00000325146:E968K;ENSP00000412864:E968K;ENSP00000421216:E968K	ENSP00000325146:E968K	E	-	1	0	COL12A1	75932024	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.263000	0.78421	2.597000	0.87782	0.655000	0.94253	GAG		0.408	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370		27	128	0	0	0	0.021523	0	27	128				
MDN1	23195	broad.mit.edu	37	6	90472078	90472078	+	Silent	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:90472078G>A	ENST00000369393.3	-	16	2431	c.2316C>T	c.(2314-2316)caC>caT	p.H772H	MDN1_ENST00000428876.1_Silent_p.H772H			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	772					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.H772H(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CAGCAGACTTGTGTACATGCT	0.468																																							uc003pnn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|skin(2)	10						c.(2314-2316)CAC>CAT		MDN1, midasin homolog							161.0	147.0	152.0					6																	90472078		2203	4300	6503	SO:0001819	synonymous_variant	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90472078G>A	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.2316C>T	6.37:g.90472078G>A						MDN1_uc003pno.1_Silent_p.H190H	p.H772H	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	16	2432	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	772					O15019|Q5T794	Silent	SNP	ENST00000369393.3	37	c.2316C>T	CCDS5024.1																																																																																				0.468	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			22	122	0	0	0	0.016522	0	22	122				
REV3L	5980	broad.mit.edu	37	6	111694531	111694531	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:111694531T>A	ENST00000358835.3	-	14	5481	c.5027A>T	c.(5026-5028)aAg>aTg	p.K1676M	REV3L_ENST00000368805.1_Missense_Mutation_p.K1676M|REV3L_ENST00000435970.1_Missense_Mutation_p.K1598M|REV3L_ENST00000368802.3_Missense_Mutation_p.K1676M			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1676					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.K1676M(1)|p.K1598M(1)		NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		acttaggaacttctgaggcaa	0.348								DNA polymerases (catalytic subunits)																															uc003puy.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(2)|ovary(2)|skin(2)	6						c.(5026-5028)AAG>ATG	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	DNA polymerase zeta							55.0	56.0	56.0					6																	111694531		2203	4300	6503	SO:0001583	missense	5980				DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding	g.chr6:111694531T>A	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.5027A>T	6.37:g.111694531T>A	ENSP00000351697:p.Lys1676Met					REV3L_uc003pux.3_Missense_Mutation_p.K1598M|REV3L_uc003puz.3_Missense_Mutation_p.K1598M	p.K1676M	NM_002912	NP_002903	O60673	DPOLZ_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)	13	5350	-		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)	1676					O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	c.5027A>T	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	T	17.36	3.369841	0.61624	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.02395	4.4;4.4;4.4;4.31	5.84	5.84	0.93424	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.07818	0.0196	M	0.63843	1.955	0.49582	D	0.999807	D	0.89917	1.0	D	0.87578	0.998	T	0.29243	-1.0018	10	0.36615	T	0.2	.	16.2302	0.82332	0.0:0.0:0.0:1.0	.	1676	O60673	DPOLZ_HUMAN	M	1676;1676;1676;1598	ENSP00000357792:K1676M;ENSP00000357795:K1676M;ENSP00000351697:K1676M;ENSP00000402003:K1598M	ENSP00000351697:K1676M	K	-	2	0	REV3L	111801224	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.358000	0.79466	2.228000	0.72767	0.533000	0.62120	AAG		0.348	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912		10	38	0	0	0	0.008291	0	10	38				
SYNE1	23345	broad.mit.edu	37	6	152605151	152605151	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:152605151T>A	ENST00000367255.5	-	96	18770	c.18169A>T	c.(18169-18171)Atc>Ttc	p.I6057F	SYNE1_ENST00000356820.4_Missense_Mutation_p.I581F|SYNE1_ENST00000341594.5_Missense_Mutation_p.I5669F|SYNE1_ENST00000265368.4_Missense_Mutation_p.I6057F|SYNE1_ENST00000423061.1_Missense_Mutation_p.I5986F|SYNE1_ENST00000448038.1_Missense_Mutation_p.I5986F	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6057					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.I6057F(2)|p.I5986F(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCATCCTGATGGTGGACATT	0.532										HNSCC(10;0.0054)																													uc010kiw.2		NA																	3	Substitution - Missense(3)		lung(3)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(18169-18171)ATC>TTC		spectrin repeat containing, nuclear envelope 1							71.0	70.0	70.0					6																	152605151		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152605151T>A	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18169A>T	6.37:g.152605151T>A	ENSP00000356224:p.Ile6057Phe	HNSCC(10;0.0054)				SYNE1_uc010kiv.2_Missense_Mutation_p.I581F|SYNE1_uc003qos.3_Missense_Mutation_p.I581F|SYNE1_uc003qot.3_Missense_Mutation_p.I5986F|SYNE1_uc003qou.3_Missense_Mutation_p.I6057F|SYNE1_uc010kiy.1_Missense_Mutation_p.I236F	p.I6057F	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	96	18771	-		Ovarian(120;0.0955)	6057			Spectrin 20.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.18169A>T	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	29.2	4.983579	0.93044	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000540663	T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28	5.61	4.45	0.53987	.	0.101709	0.42821	D	0.000647	T	0.47040	0.1424	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.965;0.999;0.999;0.999	T	0.53143	-0.8480	10	0.72032	D	0.01	.	11.2747	0.49159	0.0:0.0713:0.0:0.9287	.	472;6057;6057;5986	B7ZBD0;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	F	6057;5986;6057;5986;5669;581;232	ENSP00000356224:I6057F;ENSP00000396024:I5986F;ENSP00000265368:I6057F;ENSP00000390975:I5986F;ENSP00000341887:I5669F;ENSP00000349276:I581F;ENSP00000437411:I232F	ENSP00000265368:I6057F	I	-	1	0	SYNE1	152646844	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.903000	0.69877	0.975000	0.38392	0.477000	0.44152	ATC		0.532	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		15	62	0	0	0	0.00499	0	15	62				
FIGNL1	63979	broad.mit.edu	37	7	50513841	50513841	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr7:50513841T>C	ENST00000419119.1	-	2	2698	c.1145A>G	c.(1144-1146)aAg>aGg	p.K382R	FIGNL1_ENST00000356889.4_Missense_Mutation_p.K382R|FIGNL1_ENST00000433017.1_Missense_Mutation_p.K382R|FIGNL1_ENST00000395556.2_Missense_Mutation_p.K382R			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	382					ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)	p.K382R(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				TTCAATCATCTTTGGCTCCAA	0.438																																							uc003tpc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1144-1146)AAG>AGG		fidgetin-like 1							137.0	154.0	148.0					7																	50513841		2203	4300	6503	SO:0001583	missense	63979				ATP metabolic process|negative regulation of apoptosis|osteoblast differentiation|osteoblast proliferation|regulation of cell cycle	cytoplasm|nucleus	ATP binding|magnesium ion binding|nucleoside-triphosphatase activity	g.chr7:50513841T>C	AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.1145A>G	7.37:g.50513841T>C	ENSP00000410811:p.Lys382Arg					FIGNL1_uc003tpb.2_Missense_Mutation_p.K271R|FIGNL1_uc003tpd.2_Missense_Mutation_p.K382R|FIGNL1_uc003tpe.2_Missense_Mutation_p.K382R|FIGNL1_uc010kyy.2_Missense_Mutation_p.K382R	p.K382R	NM_001042762	NP_001036227	Q6PIW4	FIGL1_HUMAN			4	1522	-	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)	382					D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Missense_Mutation	SNP	ENST00000419119.1	37	c.1145A>G	CCDS5510.1	.	.	.	.	.	.	.	.	.	.	T	12.71	2.018896	0.35606	.	.	ENSG00000132436	ENST00000356889;ENST00000395556;ENST00000433017;ENST00000419119	D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09	5.88	3.54	0.40534	.	0.100558	0.64402	N	0.000003	D	0.83496	0.5267	N	0.17922	0.545	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.73398	-0.3995	10	0.27082	T	0.32	-10.6576	9.0698	0.36486	0.0:0.15:0.0:0.85	.	382	Q6PIW4	FIGL1_HUMAN	R	382	ENSP00000349356:K382R;ENSP00000378924:K382R;ENSP00000399997:K382R;ENSP00000410811:K382R	ENSP00000349356:K382R	K	-	2	0	FIGNL1	50481335	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	3.481000	0.53179	0.496000	0.27904	0.533000	0.62120	AAG		0.438	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342579.1	NM_001042762		68	186	0	0	0	0.01441	0	68	186				
VOPP1	81552	broad.mit.edu	37	7	55540620	55540620	+	Silent	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr7:55540620C>A	ENST00000285279.5	-	5	647	c.447G>T	c.(445-447)gtG>gtT	p.V149V	VOPP1_ENST00000454227.1_Silent_p.V86V|VOPP1_ENST00000453256.1_Silent_p.V82V|VOPP1_ENST00000418904.1_Silent_p.V132V|VOPP1_ENST00000428648.1_Silent_p.V82V|VOPP1_ENST00000545390.1_Silent_p.V146V|VOPP1_ENST00000433959.1_Silent_p.V140V|VOPP1_ENST00000427700.1_Silent_p.V147V|VOPP1_ENST00000428097.1_Silent_p.V82V	NM_001284282.1|NM_030796.3	NP_001271211.1|NP_110423.3	Q96AW1	VOPP1_HUMAN	vesicular, overexpressed in cancer, prosurvival protein 1	149	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|integral component of organelle membrane (GO:0031301)	signal transducer activity (GO:0004871)	p.V149V(1)|p.G112C(1)		endometrium(1)|lung(4)	5						GCGGGCAGGCCACACTCCCCT	0.637																																							uc003tqs.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)		0						c.(445-447)GTG>GTT		EGFR-coamplified and overexpressed protein							10.0	12.0	11.0					7																	55540620		1785	4012	5797	SO:0001819	synonymous_variant	81552				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic vesicle membrane|endosome|integral to organelle membrane	signal transducer activity	g.chr7:55540620C>A		CCDS47588.1, CCDS64654.1, CCDS64656.1	7p11.2	2010-06-22			ENSG00000154978	ENSG00000154978			34518	protein-coding gene	gene with protein product	"""Glioblastoma-amplified secreted protein"", ""EGFR-coamplified and overexpressed protein"""	611915				15735698	Standard	NM_030796		Approved	ECop, GASP, FLJ20532, DKFZp564K0822	uc003tqs.3	Q96AW1	OTTHUMG00000156124	ENST00000285279.5:c.447G>T	7.37:g.55540620C>A						VOPP1_uc003tqq.2_Silent_p.V140V|VOPP1_uc010kzh.2_Silent_p.V146V|VOPP1_uc010kzi.2_Silent_p.V132V|VOPP1_uc011kcr.1_Silent_p.V81V	p.V149V	NM_030796	NP_110423	Q96AW1	VOPP1_HUMAN			5	630	-			149			Pro-rich.|Cytoplasmic (Potential).		B0AZU1|B2RAT4|B3KS72|C9JWR3|Q6FIE3|Q8NBN8|Q96RE5|Q9H0W4	Silent	SNP	ENST00000285279.5	37	c.447G>T	CCDS47588.1																																																																																				0.637	VOPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343074.1	NM_030796		6	12	1	0	0.00198382	0.001984	0.00221343	6	12				
ZNF713	349075	broad.mit.edu	37	7	55980359	55980359	+	5'UTR	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr7:55980359G>T	ENST00000429591.2	+	0	29				MRPS17_ENST00000426595.1_Splice_Site|ZNF713_ENST00000482436.1_3'UTR	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TTTTTTCTCAGGAGGGGAACA	0.408																																							uc003trc.1		NA																	0				ovary(2)	2						c.(-11--7)CAGGA>CATGA		zinc finger protein 713							113.0	106.0	109.0					7																	55980359		2203	4300	6503	SO:0001623	5_prime_UTR_variant	349075				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:55980359G>T	AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.-10G>T	7.37:g.55980359G>T						ZNF713_uc003tra.1_Missense_Mutation_p.Q10H|MRPS17_uc003trb.2_Splice_Site		NM_182633	NP_872439	Q8N859	ZN713_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		1	29	+	Breast(14;0.214)								Translation_Start_Site	SNP	ENST00000429591.2	37	c.-9G>T	CCDS34639.1																																																																																				0.408	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1	NM_182633		10	30	1	0	0.00136819	0.013537	0.00154082	10	30				
MAGI2	9863	broad.mit.edu	37	7	77762279	77762279	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr7:77762279G>T	ENST00000354212.4	-	18	3383	c.3130C>A	c.(3130-3132)Cca>Aca	p.P1044T	MAGI2_ENST00000419488.1_Missense_Mutation_p.P1030T|MAGI2_ENST00000522391.1_Missense_Mutation_p.P1044T	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	1044	Pro-rich.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.P1044T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GGGGTGGCTGGGCTTGGCTGG	0.592																																							uc003ugx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|lung(4)|breast(1)|skin(1)	11						c.(3130-3132)CCA>ACA		membrane associated guanylate kinase, WW and PDZ							144.0	168.0	160.0					7																	77762279		2203	4300	6503	SO:0001583	missense	9863					cell junction|synapse|synaptosome	phosphatase binding	g.chr7:77762279G>T	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.3130C>A	7.37:g.77762279G>T	ENSP00000346151:p.Pro1044Thr					MAGI2_uc003ugy.2_Missense_Mutation_p.P1030T|MAGI2_uc010ldx.1_Missense_Mutation_p.P637T	p.P1044T	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN			18	3384	-		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)	1044			Pro-rich.		A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	c.3130C>A	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.264280	0.59431	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.12465	2.79;2.8;2.68	5.76	5.76	0.90799	.	0.000000	0.36444	U	0.002591	T	0.21103	0.0508	N	0.19112	0.55	0.80722	D	1	D;P;P	0.89917	1.0;0.928;0.883	D;P;B	0.80764	0.994;0.603;0.399	T	0.01420	-1.1359	10	0.02654	T	1	.	19.5547	0.95338	0.0:0.0:1.0:0.0	.	1044;1030;1044	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	T	1030;1044;1044;1044	ENSP00000405766:P1030T;ENSP00000346151:P1044T;ENSP00000428389:P1044T	ENSP00000346151:P1044T	P	-	1	0	MAGI2	77600215	1.000000	0.71417	0.973000	0.42090	0.969000	0.65631	3.894000	0.56250	2.726000	0.93360	0.655000	0.94253	CCA		0.592	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301		127	283	1	0	1.41444e-48	0.01441	2.30324e-48	127	283				
AASS	10157	broad.mit.edu	37	7	121773752	121773752	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr7:121773752C>T	ENST00000393376.1	-	1	124	c.29G>A	c.(28-30)gGc>gAc	p.G10D	AASS_ENST00000473553.1_Intron|AASS_ENST00000417368.2_Missense_Mutation_p.G10D			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	10					cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)	p.G10D(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						CCCCAGCCTGCCCAGTCCAGT	0.562																																							uc003vka.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(28-30)GGC>GAC		aminoadipate-semialdehyde synthase precursor	L-Glutamic Acid(DB00142)|NADH(DB00157)						100.0	102.0	101.0					7																	121773752		2203	4300	6503	SO:0001583	missense	10157				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity	g.chr7:121773752C>T	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.29G>A	7.37:g.121773752C>T	ENSP00000377040:p.Gly10Asp					AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Missense_Mutation_p.G10D|AASS_uc011knw.1_Intron	p.G10D	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN			1	125	-			10					O95462	Missense_Mutation	SNP	ENST00000393376.1	37	c.29G>A	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	.	7.409	0.634371	0.14322	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	.	.	.	5.6	1.65	0.23941	.	1.292950	0.04595	N	0.397424	T	0.27134	0.0665	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15350	-1.0440	9	0.11794	T	0.64	0.006	2.6153	0.04902	0.1142:0.5078:0.1171:0.2609	.	10	Q9UDR5	AASS_HUMAN	D	10	.	ENSP00000351834:G10D	G	-	2	0	AASS	121560988	0.000000	0.05858	0.460000	0.27093	0.120000	0.20174	0.486000	0.22340	0.285000	0.22329	0.563000	0.77884	GGC		0.562	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763		4	173	0	0	0	0.009096	0	4	173				
MGAM	8972	broad.mit.edu	37	7	141727025	141727025	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr7:141727025G>T	ENST00000549489.2	+	9	1188	c.1093G>T	c.(1093-1095)Gag>Tag	p.E365*	MGAM_ENST00000475668.2_Nonsense_Mutation_p.E365*	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	365	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.E365*(3)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGAATATCTAGAGGTAAACTT	0.413																																							uc003vwy.2		NA																	3	Substitution - Nonsense(3)		lung(3)	ovary(2)	2						c.(1093-1095)GAG>TAG		maltase-glucoamylase	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						115.0	107.0	110.0					7																	141727025		1857	4100	5957	SO:0001587	stop_gained	8972				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity	g.chr7:141727025G>T	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.1093G>T	7.37:g.141727025G>T	ENSP00000447378:p.Glu365*						p.E365*	NM_004668	NP_004659	O43451	MGA_HUMAN			9	1147	+	Melanoma(164;0.0272)		365			Lumenal (Potential).|Maltase.		Q0VAX6|Q75ME7|Q86UM5	Nonsense_Mutation	SNP	ENST00000549489.2	37	c.1093G>T	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	39	7.496462	0.98319	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	.	.	.	5.45	4.56	0.56223	.	0.114571	0.39274	N	0.001417	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	13.949	0.64104	0.0:0.1532:0.8468:0.0	.	.	.	.	X	365;365;242	.	ENSP00000316431:E242X	E	+	1	0	MGAM	141373494	0.998000	0.40836	1.000000	0.80357	0.987000	0.75469	2.730000	0.47335	1.513000	0.48852	0.655000	0.94253	GAG		0.413	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			54	75	1	0	1.32667e-27	0.01441	2.04954e-27	54	75				
PRSS1	5644	broad.mit.edu	37	7	142458502	142458502	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr7:142458502A>T	ENST00000311737.7	+	2	143	c.137A>T	c.(136-138)cAc>cTc	p.H46L	PRSS1_ENST00000486171.1_Missense_Mutation_p.H46L	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	46	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.H46L(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TCTGGCTACCACTTCTGTGGT	0.562																																							uc003wak.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|central_nervous_system(1)	2						c.(136-138)CAC>CTC		protease, serine, 1 preproprotein							111.0	109.0	110.0					7																	142458502		2203	4300	6503	SO:0001583	missense	5644	Hereditary_Pancreatitis			digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity	g.chr7:142458502A>T	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.137A>T	7.37:g.142458502A>T	ENSP00000308720:p.His46Leu					uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_Silent_p.P21P|PRSS1_uc003wam.2_5'Flank	p.H46L	NM_002769	NP_002760	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		2	154	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	46			Peptidase S1.		A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	c.137A>T	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	A	14.53	2.563849	0.45694	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243	D;D	0.93307	-3.2;-3.2	3.49	3.49	0.39957	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.191974	0.56097	D	0.000034	D	0.94470	0.8220	L	0.49513	1.565	0.80722	D	1	D	0.71674	0.998	D	0.70487	0.969	D	0.93767	0.7071	10	0.48119	T	0.1	.	11.4883	0.50367	1.0:0.0:0.0:0.0	.	46	P07477	TRY1_HUMAN	L	46	ENSP00000417854:H46L;ENSP00000308720:H46L	ENSP00000308720:H46L	H	+	2	0	PRSS1	142138076	1.000000	0.71417	1.000000	0.80357	0.066000	0.16364	4.971000	0.63749	1.531000	0.49152	0.332000	0.21555	CAC		0.562	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2			59	94	0	0	0	0.01441	0	59	94				
TAS2R39	259285	broad.mit.edu	37	7	142880730	142880730	+	Silent	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr7:142880730C>A	ENST00000446620.1	+	1	219	c.219C>A	c.(217-219)ggC>ggA	p.G73G		NM_176881.2	NP_795362.2	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	73					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.G73G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	Melanoma(164;0.059)					CCACAAGTGGCAGGATCCTGG	0.403																																							uc011ksw.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(217-219)GGC>GGA		taste receptor, type 2, member 39							117.0	111.0	113.0					7																	142880730		1901	4124	6025	SO:0001819	synonymous_variant	259285				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr7:142880730C>A	AF494230	CCDS47729.1	7q34	2012-08-22			ENSG00000236398	ENSG00000236398		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18886	protein-coding gene	gene with protein product						12379855	Standard	NM_176881		Approved		uc011ksw.2	P59534	OTTHUMG00000152636	ENST00000446620.1:c.219C>A	7.37:g.142880730C>A							p.G73G	NM_176881	NP_795362	P59534	T2R39_HUMAN			1	219	+	Melanoma(164;0.059)		73			Cytoplasmic (Potential).		A4FUI7|Q3ZCN6|Q645W4	Silent	SNP	ENST00000446620.1	37	c.219C>A	CCDS47729.1																																																																																				0.403	TAS2R39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327090.2	NM_176881		55	61	1	0	4.1673e-28	0.01441	6.47949e-28	55	61				
CLCN1	1180	broad.mit.edu	37	7	143018931	143018931	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr7:143018931T>C	ENST00000343257.2	+	5	773	c.686T>C	c.(685-687)gTg>gCg	p.V229A	CLCN1_ENST00000495612.1_3'UTR	NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	229					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.V229A(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					GGCATCCCCGTGGGGAAAGAG	0.597																																							uc003wcr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(685-687)GTG>GCG		chloride channel 1, skeletal muscle							40.0	36.0	37.0					7																	143018931		2203	4300	6503	SO:0001583	missense	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143018931T>C	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.686T>C	7.37:g.143018931T>C	ENSP00000339867:p.Val229Ala					CLCN1_uc011ktc.1_5'UTR|CLCN1_uc003wcs.1_RNA|CLCN1_uc010lox.1_RNA|CLCN1_uc010loy.1_Missense_Mutation_p.V77A	p.V229A	NM_000083	NP_000074	P35523	CLCN1_HUMAN			5	773	+	Melanoma(164;0.205)		229					A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	c.686T>C	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	.	21.6	4.180097	0.78564	.	.	ENSG00000188037	ENST00000343257	D	0.93763	-3.28	5.02	5.02	0.67125	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.94915	0.8356	L	0.54863	1.705	0.40566	D	0.981253	D	0.76494	0.999	D	0.70487	0.969	D	0.95315	0.8415	10	0.87932	D	0	.	10.9018	0.47056	0.0:0.0:0.1572:0.8428	.	229	P35523	CLCN1_HUMAN	A	229	ENSP00000339867:V229A	ENSP00000339867:V229A	V	+	2	0	CLCN1	142729053	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	8.023000	0.88764	1.911000	0.55334	0.454000	0.30748	GTG		0.597	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		11	26	0	0	0	0.008291	0	11	26				
CHPF2	54480	broad.mit.edu	37	7	150934520	150934520	+	Missense_Mutation	SNP	G	G	A	rs139006025		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr7:150934520G>A	ENST00000035307.2	+	4	2585	c.1072G>A	c.(1072-1074)Gtt>Att	p.V358I	MIR671_ENST00000390183.1_RNA|CHPF2_ENST00000495645.1_Missense_Mutation_p.V350I|RP4-548D19.3_ENST00000607902.1_RNA	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	358					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.V358I(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						GAGCTGGCCCGTTGGGCTCCC	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		19877	0.0		0.001	False		,,,				2504	0.0						uc003wjr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1072-1074)GTT>ATT		chondroitin polymerizing factor 2		G	ILE/VAL	0,4406		0,0,2203	67.0	67.0	67.0		1072	-4.9	0.0	7	dbSNP_134	67	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CHPF2	NM_019015.1	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	358/773	150934520	2,13004	2203	4300	6503	SO:0001583	missense	54480					Golgi cisterna membrane|integral to membrane	N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity	g.chr7:150934520G>A	AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.1072G>A	7.37:g.150934520G>A	ENSP00000035307:p.Val358Ile					CHPF2_uc003wjq.1_Missense_Mutation_p.V350I|MIR671_hsa-mir-671|MI0003760_5'Flank	p.V358I	NM_019015	NP_061888	Q9P2E5	CHPF2_HUMAN			4	2585	+			358			Lumenal (Potential).		B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	ENST00000035307.2	37	c.1072G>A	CCDS34779.1	.	.	.	.	.	.	.	.	.	.	G	1.117	-0.656578	0.03480	0.0	2.33E-4	ENSG00000033100	ENST00000495645;ENST00000035307;ENST00000377851	T;T	0.16457	2.34;2.34	5.33	-4.93	0.03066	.	0.501683	0.22949	N	0.053684	T	0.05777	0.0151	N	0.12182	0.205	0.24301	N	0.995129	B;B	0.30634	0.288;0.001	B;B	0.25987	0.065;0.002	T	0.38887	-0.9640	10	0.09084	T	0.74	1.3042	9.1707	0.37078	0.242:0.0785:0.6795:0.0	.	358;350	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	I	350;358;358	ENSP00000418914:V350I;ENSP00000035307:V358I	ENSP00000035307:V358I	V	+	1	0	CHPF2	150565453	0.000000	0.05858	0.002000	0.10522	0.813000	0.45954	-0.321000	0.08018	-1.388000	0.02092	-0.136000	0.14681	GTT		0.622	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348648.2	NM_019015		6	86	0	0	0	0.001168	0	6	86				
ST18	9705	broad.mit.edu	37	8	53044594	53044594	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr8:53044594G>A	ENST00000276480.7	-	22	3273	c.2590C>T	c.(2590-2592)Caa>Taa	p.Q864*		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	864					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.Q864*(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				GGTAGCTCTTGTTTGTTCAGT	0.488																																							uc003xqz.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|skin(1)	5						c.(2590-2592)CAA>TAA		suppression of tumorigenicity 18							157.0	138.0	145.0					8																	53044594		2203	4300	6503	SO:0001587	stop_gained	9705					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:53044594G>A	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2590C>T	8.37:g.53044594G>A	ENSP00000276480:p.Gln864*					ST18_uc011ldq.1_Nonsense_Mutation_p.Q511*|ST18_uc011ldr.1_Nonsense_Mutation_p.Q829*|ST18_uc011lds.1_Nonsense_Mutation_p.Q769*|ST18_uc003xra.2_Nonsense_Mutation_p.Q864*	p.Q864*	NM_014682	NP_055497	O60284	ST18_HUMAN			17	2746	-		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)	864					Q17RY1	Nonsense_Mutation	SNP	ENST00000276480.7	37	c.2590C>T	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	G	47	13.415261	0.99740	.	.	ENSG00000147488	ENST00000276480	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-17.8825	19.2617	0.93970	0.0:0.0:1.0:0.0	.	.	.	.	X	864	.	ENSP00000276480:Q864X	Q	-	1	0	ST18	53207147	1.000000	0.71417	0.938000	0.37757	0.950000	0.60333	7.823000	0.86660	2.602000	0.87976	0.591000	0.81541	CAA		0.488	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1			25	62	0	0	0	0.016522	0	25	62				
TRIM55	84675	broad.mit.edu	37	8	67086790	67086790	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr8:67086790A>T	ENST00000315962.4	+	10	1982	c.1609A>T	c.(1609-1611)Atc>Ttc	p.I537F	TRIM55_ENST00000276573.7_3'UTR|TRIM55_ENST00000350034.4_Missense_Mutation_p.I230F|TRIM55_ENST00000353317.5_Missense_Mutation_p.I441F	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	537					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.I537F(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			AGCTCGCCATATCTTCTCCTT	0.532																																							uc003xvv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|central_nervous_system(1)	5						c.(1609-1611)ATC>TTC		tripartite motif-containing 55 isoform 1							127.0	121.0	123.0					8																	67086790		2203	4300	6503	SO:0001583	missense	84675					cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding	g.chr8:67086790A>T	AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.1609A>T	8.37:g.67086790A>T	ENSP00000323913:p.Ile537Phe					TRIM55_uc003xvu.2_3'UTR|TRIM55_uc003xvw.2_Missense_Mutation_p.I441F|TRIM55_uc003xvx.2_Missense_Mutation_p.I230F	p.I537F	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		10	1835	+		Lung NSC(129;0.138)|all_lung(136;0.221)	537					B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	ENST00000315962.4	37	c.1609A>T	CCDS6184.1	.	.	.	.	.	.	.	.	.	.	A	13.26	2.185000	0.38609	.	.	ENSG00000147573	ENST00000315962;ENST00000353317;ENST00000350034	T;T;T	0.49432	1.39;1.37;0.78	5.74	1.29	0.21616	.	0.204031	0.28192	N	0.016250	T	0.25269	0.0614	N	0.08118	0	0.20074	N	0.999937	P;P;B	0.36909	0.571;0.573;0.437	B;B;B	0.35688	0.208;0.203;0.1	T	0.17167	-1.0378	10	0.87932	D	0	.	9.4381	0.38650	0.424:0.0:0.576:0.0	.	230;441;537	Q9BYV6-4;Q9BYV6-2;Q9BYV6	.;.;TRI55_HUMAN	F	537;441;230	ENSP00000323913:I537F;ENSP00000297348:I441F;ENSP00000332302:I230F	ENSP00000323913:I537F	I	+	1	0	TRIM55	67249344	0.838000	0.29461	0.502000	0.27614	0.971000	0.66376	1.005000	0.29834	0.259000	0.21709	-0.468000	0.05107	ATC		0.532	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085		5	140	0	0	0	0.001984	0	5	140				
FAM84B	157638	broad.mit.edu	37	8	127569531	127569531	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr8:127569531G>T	ENST00000304916.3	-	2	559	c.104C>A	c.(103-105)tCc>tAc	p.S35Y	RP11-103H7.5_ENST00000524320.1_RNA|RP11-89K10.1_ENST00000519880.1_RNA|RP11-89K10.1_ENST00000520512.1_RNA|FAM84B_ENST00000517458.1_5'Flank|RP11-89K10.1_ENST00000517773.1_RNA	NM_174911.4	NP_777571.1	Q96KN1	FA84B_HUMAN	family with sequence similarity 84, member B	35						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.S35Y(1)		lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	5	Ovarian(5;9.43e-05)|Esophageal squamous(12;0.0012)|Hepatocellular(40;0.128)|Myeloproliferative disorder(2;0.135)		STAD - Stomach adenocarcinoma(47;0.000556)|Colorectal(2;0.0102)|Lung(2;0.0136)|READ - Rectum adenocarcinoma(2;0.0723)			GAAAATGTAGGAGACCCCAAT	0.672																																							uc003yrz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(103-105)TCC>TAC		family with sequence similarity 84, member B							18.0	21.0	20.0					8																	127569531		2201	4298	6499	SO:0001583	missense	157638					cytoplasm|plasma membrane	protein binding	g.chr8:127569531G>T	AJ417849	CCDS6358.1	8q24.13	2006-02-09				ENSG00000168672			24166	protein-coding gene	gene with protein product	"""breast cancer membrane-associated protein 101"", ""neurological/sensory 2"""	609483				12477722	Standard	NM_174911		Approved	BCMP101, NSE2	uc003yrz.2	Q96KN1		ENST00000304916.3:c.104C>A	8.37:g.127569531G>T	ENSP00000302578:p.Ser35Tyr						p.S35Y	NM_174911	NP_777571	Q96KN1	FA84B_HUMAN	STAD - Stomach adenocarcinoma(47;0.000556)|Colorectal(2;0.0102)|Lung(2;0.0136)|READ - Rectum adenocarcinoma(2;0.0723)		2	388	-	Ovarian(5;9.43e-05)|Esophageal squamous(12;0.0012)|Hepatocellular(40;0.128)|Myeloproliferative disorder(2;0.135)		35						Missense_Mutation	SNP	ENST00000304916.3	37	c.104C>A	CCDS6358.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397601	0.83120	.	.	ENSG00000168672	ENST00000304916	T	0.04015	3.73	4.81	4.81	0.61882	.	0.000000	0.85682	U	0.000000	T	0.19725	0.0474	M	0.61703	1.905	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.00409	-1.1757	10	0.87932	D	0	-17.7907	16.8733	0.86044	0.0:0.0:1.0:0.0	.	35	Q96KN1	FA84B_HUMAN	Y	35	ENSP00000302578:S35Y	ENSP00000302578:S35Y	S	-	2	0	FAM84B	127638713	1.000000	0.71417	1.000000	0.80357	0.646000	0.38490	9.756000	0.98918	2.187000	0.69744	0.563000	0.77884	TCC		0.672	FAM84B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381487.1	NM_174911		11	25	1	0	2.80697e-09	0.010729	3.65665e-09	11	25				
AGO2	27161	broad.mit.edu	37	8	141561493	141561493	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr8:141561493G>A	ENST00000220592.5	-	11	1424	c.1312C>T	c.(1312-1314)Cgg>Tgg	p.R438W	AGO2_ENST00000519980.1_Missense_Mutation_p.R438W	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	438					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)	p.R438W(2)									TGCTTGTTCCGCATGTCCCAG	0.532																																							uc003yvn.2		NA																	2	Substitution - Missense(2)		urinary_tract(1)|lung(1)		0						c.(1312-1314)CGG>TGG		argonaute 2 isoform 1							92.0	87.0	89.0					8																	141561493		2203	4300	6503	SO:0001583	missense	27161				mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity	g.chr8:141561493G>A	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1312C>T	8.37:g.141561493G>A	ENSP00000220592:p.Arg438Trp					EIF2C2_uc010men.2_Missense_Mutation_p.R361W|EIF2C2_uc010meo.2_Missense_Mutation_p.R438W	p.R438W	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.158)		11	1352	-	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	438					Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	37	c.1312C>T	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885644	0.72410	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.06218	3.33;3.33	5.16	-3.12	0.05282	.	0.000000	0.85682	D	0.000000	T	0.23965	0.0580	M	0.93283	3.4	0.58432	D	0.999998	D;P	0.61080	0.989;0.949	P;P	0.54346	0.749;0.447	T	0.52555	-0.8560	10	0.66056	D	0.02	-4.779	17.1264	0.86715	0.0:0.0:0.6446:0.3554	.	438;438	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	W	438	ENSP00000220592:R438W;ENSP00000430176:R438W	ENSP00000220592:R438W	R	-	1	2	EIF2C2	141630675	1.000000	0.71417	0.873000	0.34254	0.917000	0.54804	0.932000	0.28884	-0.724000	0.04908	-0.573000	0.04149	CGG		0.532	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4			4	120	0	0	0	0.009096	0	4	120				
UNC13B	10497	broad.mit.edu	37	9	35377536	35377536	+	Missense_Mutation	SNP	C	C	A	rs371483220		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr9:35377536C>A	ENST00000378495.3	+	15	1882	c.1660C>A	c.(1660-1662)Cgc>Agc	p.R554S	UNC13B_ENST00000378496.4_Missense_Mutation_p.R554S|UNC13B_ENST00000396787.1_Missense_Mutation_p.R566S	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	554					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.R554S(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			CATGAAGGACCGCATGAAGAT	0.502																																							uc003zwq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|skin(1)	5						c.(1660-1662)CGC>AGC		UNC13 (C. elegans)-like							86.0	82.0	83.0					9																	35377536		2203	4300	6503	SO:0001583	missense	10497				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity	g.chr9:35377536C>A	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.1660C>A	9.37:g.35377536C>A	ENSP00000367756:p.Arg554Ser					UNC13B_uc003zwr.2_Missense_Mutation_p.R554S	p.R554S	NM_006377	NP_006368	O14795	UN13B_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)		15	1952	+	all_epithelial(49;0.212)		554					Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	37	c.1660C>A	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.481340	0.84747	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	T;T;T	0.64260	-0.09;-0.09;-0.09	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.79470	0.4451	M	0.74258	2.255	0.80722	D	1	P;D	0.64830	0.955;0.994	P;D	0.64595	0.708;0.927	T	0.78486	-0.2185	10	0.52906	T	0.07	-13.4641	20.4135	0.99023	0.0:1.0:0.0:0.0	.	554;554	F8W8M9;O14795	.;UN13B_HUMAN	S	566;554;554;141	ENSP00000380006:R566S;ENSP00000367756:R554S;ENSP00000367757:R554S	ENSP00000367756:R554S	R	+	1	0	UNC13B	35367536	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.930000	0.56522	2.835000	0.97688	0.591000	0.81541	CGC		0.502	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377		4	58	1	0	0.00909568	0.009096	0.00969938	4	58				
OR13C8	138802	broad.mit.edu	37	9	107332316	107332316	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr9:107332316A>G	ENST00000335040.1	+	1	868	c.868A>G	c.(868-870)Atg>Gtg	p.M290V		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M290V(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						GATGACTCCCATGCTTAATCC	0.408																																							uc011lvo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(868-870)ATG>GTG		olfactory receptor, family 13, subfamily C,							87.0	79.0	81.0					9																	107332316		2203	4300	6503	SO:0001583	missense	138802				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107332316A>G		CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.868A>G	9.37:g.107332316A>G	ENSP00000334068:p.Met290Val						p.M290V	NM_001004483	NP_001004483	Q8NGS7	O13C8_HUMAN			1	868	+			290			Helical; Name=7; (Potential).		Q5VVG0|Q96R44	Missense_Mutation	SNP	ENST00000335040.1	37	c.868A>G	CCDS35090.1	.	.	.	.	.	.	.	.	.	.	A	10.88	1.474694	0.26511	.	.	ENSG00000186943	ENST00000335040	T	0.36878	1.23	4.9	0.978	0.19740	GPCR, rhodopsin-like superfamily (1);	0.079191	0.53938	D	0.000047	T	0.20333	0.0489	L	0.28054	0.825	0.24843	N	0.992451	B	0.34214	0.442	B	0.31337	0.128	T	0.12372	-1.0550	10	0.72032	D	0.01	.	5.3071	0.15809	0.3999:0.305:0.0:0.2951	.	290	Q8NGS7	O13C8_HUMAN	V	290	ENSP00000334068:M290V	ENSP00000334068:M290V	M	+	1	0	OR13C8	106372137	0.000000	0.05858	0.987000	0.45799	0.938000	0.57974	-0.129000	0.10515	0.063000	0.16370	0.459000	0.35465	ATG		0.408	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053480.1			24	55	0	0	0	0.014323	0	24	55				
GARNL3	84253	broad.mit.edu	37	9	130151342	130151342	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr9:130151342C>A	ENST00000373387.4	+	26	3039	c.2687C>A	c.(2686-2688)tCc>tAc	p.S896Y	GARNL3_ENST00000435213.2_Missense_Mutation_p.S874Y|GARNL3_ENST00000314904.5_3'UTR|GARNL3_ENST00000496711.1_3'UTR	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	896					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)	p.S878Y(1)		NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						CACTCCTTGTCCCTGTCTCGC	0.532																																							uc011mae.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2686-2688)TCC>TAC		GTPase activating Rap/RanGAP domain-like 3							99.0	78.0	85.0					9																	130151342		2203	4300	6503	SO:0001583	missense	84253				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity|small GTPase regulator activity	g.chr9:130151342C>A	BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.2687C>A	9.37:g.130151342C>A	ENSP00000362485:p.Ser896Tyr					GARNL3_uc011mad.1_Missense_Mutation_p.S874Y|GARNL3_uc010mxi.2_Missense_Mutation_p.S126Y	p.S896Y	NM_032293	NP_115669	Q5VVW2	GARL3_HUMAN			26	3088	+			896					B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Missense_Mutation	SNP	ENST00000373387.4	37	c.2687C>A	CCDS6869.2	.	.	.	.	.	.	.	.	.	.	C	29.3	4.993152	0.93167	.	.	ENSG00000136895	ENST00000435213;ENST00000373387	D;D	0.90004	-2.59;-2.6	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.91583	0.7341	L	0.36672	1.1	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.75484	0.986;0.986	D	0.90376	0.4384	9	.	.	.	.	17.9811	0.89141	0.0:1.0:0.0:0.0	.	896;874	Q5VVW2;B7Z3Q6	GARL3_HUMAN;.	Y	874;896	ENSP00000396205:S874Y;ENSP00000362485:S896Y	.	S	+	2	0	GARNL3	129191163	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.589000	0.87451	0.655000	0.94253	TCC		0.532	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054151.3	NM_032293		4	45	1	0	0.00024832	0.009096	0.000284977	4	45				
MXRA5	25878	broad.mit.edu	37	X	3238683	3238683	+	Silent	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chrX:3238683G>T	ENST00000217939.6	-	5	5197	c.5043C>A	c.(5041-5043)ccC>ccA	p.P1681P		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1681						extracellular vesicular exosome (GO:0070062)		p.P1681P(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TAGGAATGCTGGGTTTGGACA	0.418																																							uc004crg.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(5041-5043)CCC>CCA		adlican precursor							172.0	163.0	166.0					X																	3238683		2203	4300	6503	SO:0001819	synonymous_variant	25878					extracellular region		g.chrX:3238683G>T	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.5043C>A	X.37:g.3238683G>T							p.P1681P	NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN			5	5200	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	1681					Q6P1M7|Q9Y3Y8	Silent	SNP	ENST00000217939.6	37	c.5043C>A	CCDS14124.1																																																																																				0.418	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		60	93	1	0	1.84395e-34	0.01441	2.94299e-34	60	93				
CT47B1	643311	broad.mit.edu	37	X	120008904	120008904	+	Silent	SNP	C	C	A			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chrX:120008904C>A	ENST00000371311.3	-	1	875	c.621G>T	c.(619-621)gtG>gtT	p.V207V		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	207								p.V207V(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						GGTCAGCTGGCACTGCAGGCT	0.706																																							uc011muc.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(619-621)GTG>GTT		cancer/testis antigen family 147, member B1							28.0	27.0	27.0					X																	120008904		692	1590	2282	SO:0001819	synonymous_variant	643311							g.chrX:120008904C>A		CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.621G>T	X.37:g.120008904C>A							p.V207V	NM_001145718	NP_001139190	P0C2W7	CT47B_HUMAN			1	876	-			207					A6NM97	Silent	SNP	ENST00000371311.3	37	c.621G>T	CCDS48161.1																																																																																				0.706	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058121.1	NM_001145718		9	84	1	0	0.00621372	0.006214	0.00668529	9	84				
FHL1	2273	broad.mit.edu	37	X	135290072	135290072	+	Silent	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chrX:135290072G>T	ENST00000345434.3	+	4	534	c.453G>T	c.(451-453)gtG>gtT	p.V151V	FHL1_ENST00000370676.3_Silent_p.V167V|FHL1_ENST00000543669.1_Silent_p.V151V|FHL1_ENST00000539015.1_Silent_p.V180V|FHL1_ENST00000394153.2_Silent_p.V151V|FHL1_ENST00000535737.1_Silent_p.V151V|FHL1_ENST00000394155.2_Silent_p.V151V|FHL1_ENST00000370683.1_Silent_p.V167V|FHL1_ENST00000370690.3_Silent_p.V151V			Q13642	FHL1_HUMAN	four and a half LIM domains 1	151	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|organ morphogenesis (GO:0009887)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane depolarization (GO:0003254)|regulation of potassium ion transmembrane transporter activity (GO:1901016)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel binding (GO:0044325)|zinc ion binding (GO:0008270)	p.V151V(2)|p.V180V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(192;0.000127)					TCTACTGCGTGACTTGCCATG	0.493																																							uc004ezo.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(451-453)GTG>GTT		four and a half LIM domains 1 isoform 1							137.0	105.0	116.0					X																	135290072		2203	4300	6503	SO:0001819	synonymous_variant	2273				cell differentiation|cell growth|muscle organ development|organ morphogenesis	cytosol|nucleus|plasma membrane	protein binding|zinc ion binding	g.chrX:135290072G>T	U60115	CCDS14655.1, CCDS55505.1, CCDS55506.1, CCDS55507.1, CCDS76036.1	Xq26.3	2014-09-17			ENSG00000022267	ENSG00000022267			3702	protein-coding gene	gene with protein product	"""Four-and-a-half LIM domains 1"", ""LIM protein SLIMMER"""	300163				8753811, 9714789	Standard	NM_001449		Approved	SLIM1, KYO-T, bA535K18.1, FHL1B, XMPMA, FLH1A, MGC111107	uc004ezo.3	Q13642	OTTHUMG00000022504	ENST00000345434.3:c.453G>T	X.37:g.135290072G>T						FHL1_uc010nrz.2_Silent_p.V151V|FHL1_uc004ezm.2_Intron|FHL1_uc004ezl.2_Silent_p.V151V|FHL1_uc004ezq.2_Silent_p.V151V|FHL1_uc011mvy.1_Silent_p.V151V|FHL1_uc011mvz.1_Silent_p.V151V|FHL1_uc004ezn.2_Silent_p.V151V|FHL1_uc011mwa.1_Silent_p.V180V|FHL1_uc011mwb.1_RNA|FHL1_uc004ezp.2_Silent_p.V167V|FHL1_uc004ezr.2_5'UTR	p.V151V	NM_001159702	NP_001153174	Q13642	FHL1_HUMAN			4	553	+	Acute lymphoblastic leukemia(192;0.000127)		151			LIM zinc-binding 2.		B7Z5T4|B7Z793|O95212|Q13230|Q13645|Q5JXI7|Q5M7Y6|Q6IB30|Q9NZ40|Q9UKZ8|Q9Y630	Silent	SNP	ENST00000345434.3	37	c.453G>T	CCDS55507.1																																																																																				0.493	FHL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058461.1	NM_001449		20	36	1	0	9.95505e-16	0.014323	1.41963e-15	20	36				
MAGEA12	4111	broad.mit.edu	37	X	151900216	151900216	+	Silent	SNP	G	G	T			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chrX:151900216G>T	ENST00000357916.4	-	2	740	c.585C>A	c.(583-585)atC>atA	p.I195I	CSAG4_ENST00000361201.4_RNA|MAGEA12_ENST00000393900.3_Silent_p.I195I|MAGEA12_ENST00000393869.3_Silent_p.I195I	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	195	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.I195I(1)		breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					TCTTGGGCACGATCTGATTGT	0.577																																							uc010ntp.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(583-585)ATC>ATA		melanoma antigen family A, 12							150.0	143.0	145.0					X																	151900216		2203	4300	6503	SO:0001819	synonymous_variant	4111							g.chrX:151900216G>T		CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.585C>A	X.37:g.151900216G>T						MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Silent_p.I195I	p.I195I	NM_005367	NP_005358	P43365	MAGAC_HUMAN			3	939	-	Acute lymphoblastic leukemia(192;6.56e-05)		195			MAGE.		Q9NSD3	Silent	SNP	ENST00000357916.4	37	c.585C>A	CCDS14710.1																																																																																				0.577	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058764.1	NM_005367		57	100	1	0	1.4374e-25	0.01441	2.20645e-25	57	100				
CACNA1E	777	broad.mit.edu	37	1	181725171	181725171	+	Frame_Shift_Del	DEL	A	A	-			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:181725171delA	ENST00000367573.2	+	29	4069	c.4069delA	c.(4069-4071)aacfs	p.N1357fs	CACNA1E_ENST00000367570.1_Frame_Shift_Del_p.N1357fs|CACNA1E_ENST00000367567.4_Frame_Shift_Del_p.N964fs|CACNA1E_ENST00000360108.3_Frame_Shift_Del_p.N1338fs|CACNA1E_ENST00000526775.1_Frame_Shift_Del_p.N1338fs|CACNA1E_ENST00000357570.5_Frame_Shift_Del_p.N1308fs|CACNA1E_ENST00000358338.5_Frame_Shift_Del_p.N1289fs	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1357					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CCACTACGACAACATTATCTG	0.498																																							uc001gow.2		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(4069-4071)AACfs		calcium channel, voltage-dependent, R type,							83.0	85.0	84.0					1																	181725171		2027	4192	6219	SO:0001589	frameshift_variant	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181725171delA	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4069delA	1.37:g.181725171delA	ENSP00000356545:p.Asn1357fs					CACNA1E_uc009wxs.2_Frame_Shift_Del_p.N1245fs|CACNA1E_uc001gox.1_Frame_Shift_Del_p.N583fs|CACNA1E_uc009wxt.2_Frame_Shift_Del_p.N583fs	p.N1357fs	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			29	4234	+			1357			Extracellular (Potential).|III.		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Frame_Shift_Del	DEL	ENST00000367573.2	37	c.4069delA	CCDS55664.1																																																																																				0.498	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		14	40	NA	NA	NA	NA	NA	14	40	---	---	---	---
RPS6KC1	26750	broad.mit.edu	37	1	213445938	213445939	+	Frame_Shift_Ins	INS	-	-	T	rs193921071		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr1:213445938_213445939insT	ENST00000366960.3	+	15	3312_3313	c.3162_3163insT	c.(3163-3165)tttfs	p.F1055fs	RPS6KC1_ENST00000490299.1_3'UTR|RPS6KC1_ENST00000543470.1_Frame_Shift_Ins_p.F843fs|RPS6KC1_ENST00000366959.3_Frame_Shift_Ins_p.F1043fs	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	1055	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		AATCTCATCCATTTTTTACCCC	0.441																																							uc010ptr.1		NA																	0				lung(4)|ovary(3)|breast(1)	8						c.(3160-3165)CCATTTfs		ribosomal protein S6 kinase, 52kDa, polypeptide																																				SO:0001589	frameshift_variant	26750				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity	g.chr1:213445938_213445939insT	AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.3168dupT	1.37:g.213445944_213445944dupT	ENSP00000355927:p.Phe1055fs					RPS6KC1_uc001hkd.2_Frame_Shift_Ins_p.P1042fs|RPS6KC1_uc010pts.1_Frame_Shift_Ins_p.P842fs|RPS6KC1_uc010ptt.1_Frame_Shift_Ins_p.P842fs|RPS6KC1_uc010ptu.1_Frame_Shift_Ins_p.P873fs|RPS6KC1_uc010ptv.1_Frame_Shift_Ins_p.P589fs|RPS6KC1_uc001hke.2_Frame_Shift_Ins_p.P873fs	p.P1054fs	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)	15	3321_3322	+			1054_1055			Protein kinase 2.		B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Frame_Shift_Ins	INS	ENST00000366960.3	37	c.3162_3163insT	CCDS1513.1																																																																																				0.441	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089690.3	NM_012424		11	137	NA	NA	NA	NA	NA	11	137	---	---	---	---
ARID4A	5926	broad.mit.edu	37	14	58825910	58825911	+	Frame_Shift_Ins	INS	-	-	A	rs151278543		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr14:58825910_58825911insA	ENST00000355431.3	+	18	2287_2288	c.1914_1915insA	c.(1915-1917)aaafs	p.K639fs	ARID4A_ENST00000395168.3_Frame_Shift_Ins_p.K639fs|ARID4A_ENST00000348476.3_Frame_Shift_Ins_p.K639fs|ARID4A_ENST00000431317.2_Frame_Shift_Ins_p.K639fs	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	639					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K638K(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GTGGACCAAAGAAAAAACAGAA	0.292																																							uc001xdp.2		NA																	1	Substitution - coding silent(1)	p.K638K(1)	skin(1)	ovary(3)|skin(2)|lung(1)	6						c.(1912-1917)AAGAAAfs		retinoblastoma-binding protein 1 isoform I																																				SO:0001589	frameshift_variant	5926				negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr14:58825910_58825911insA	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.1920dupA	14.37:g.58825916_58825916dupA	ENSP00000347602:p.Lys639fs					ARID4A_uc001xdo.2_Frame_Shift_Ins_p.K638fs|ARID4A_uc001xdq.2_Frame_Shift_Ins_p.K638fs|ARID4A_uc010apg.1_Frame_Shift_Ins_p.K316fs	p.K638fs	NM_002892	NP_002883	P29374	ARI4A_HUMAN			18	2168_2169	+			638_639					Q15991|Q15992|Q15993	Frame_Shift_Ins	INS	ENST00000355431.3	37	c.1914_1915insA	CCDS9732.1																																																																																				0.292	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001		29	78	NA	NA	NA	NA	NA	29	78	---	---	---	---
TDP1	55775	broad.mit.edu	37	14	90455406	90455415	+	Frame_Shift_Del	DEL	CAGGAAAAAG	CAGGAAAAAG	-	rs202147730|rs369207170	byFrequency	TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	CAGGAAAAAG	CAGGAAAAAG	-	-	CAGGAAAAAG	CAGGAAAAAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr14:90455406_90455415delCAGGAAAAAG	ENST00000335725.4	+	11	1539_1548	c.1289_1298delCAGGAAAAAG	c.(1288-1299)ccaggaaaaagcfs	p.PGKS430fs	TDP1_ENST00000357382.3_Frame_Shift_Del_p.PGKS191fs|TDP1_ENST00000555880.1_Frame_Shift_Del_p.PGKS430fs|TDP1_ENST00000393452.3_Frame_Shift_Del_p.PGKS430fs|TDP1_ENST00000393454.2_Frame_Shift_Del_p.PGKS430fs	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	430					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		AGCAAGACTCCAGGAAAAAGCTCTGTTCCT	0.424								Repair of DNA-protein crosslinks																															uc001xxy.2		NA																	0				ovary(2)	2						c.(1288-1299)CCAGGAAAAAGCfs	Repair_of_DNA-protein_crosslinks	tyrosyl-DNA phosphodiesterase 1																																				SO:0001589	frameshift_variant	55775				cell death|double-strand break repair|single strand break repair	cytoplasm|nucleus	3'-tyrosyl-DNA phosphodiesterase activity|double-stranded DNA binding|exonuclease activity|protein binding|single-stranded DNA binding	g.chr14:90455406_90455415delCAGGAAAAAG	AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.1289_1298delCAGGAAAAAG	14.37:g.90455406_90455415delCAGGAAAAAG	ENSP00000337353:p.Pro430fs					TDP1_uc010atm.2_RNA|TDP1_uc001xxz.2_Frame_Shift_Del_p.P430fs|TDP1_uc010atn.2_Frame_Shift_Del_p.P430fs|TDP1_uc001xya.2_Frame_Shift_Del_p.P191fs|TDP1_uc001xyb.2_RNA|TDP1_uc010ato.2_Frame_Shift_Del_p.P430fs|TDP1_uc001xyd.1_Frame_Shift_Del_p.P45fs	p.P430fs	NM_018319	NP_060789	Q9NUW8	TYDP1_HUMAN		COAD - Colon adenocarcinoma(157;0.23)	11	1588_1597	+		all_cancers(154;0.185)	430_433					Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Frame_Shift_Del	DEL	ENST00000335725.4	37	c.1289_1298delCAGGAAAAAG	CCDS9888.1																																																																																				0.424	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411239.1	NM_018319		9	89	NA	NA	NA	NA	NA	9	89	---	---	---	---
FURIN	5045	broad.mit.edu	37	15	91425068	91425073	+	In_Frame_Del	DEL	GCGAGA	GCGAGA	-	rs571395407		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	GCGAGA	GCGAGA	-	-	GCGAGA	GCGAGA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr15:91425068_91425073delGCGAGA	ENST00000268171.3	+	16	2624_2629	c.2345_2350delGCGAGA	c.(2344-2352)ggcgagagg>ggg	p.ER783del	FES_ENST00000394302.1_5'Flank|FES_ENST00000414248.2_5'Flank|FES_ENST00000328850.3_5'Flank	NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	783					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.G782fs*>13(2)		breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GAGGGCCGGGGCGAGAGGACCGCCTT	0.597																																							uc002bpu.1		NA																	2	Deletion - Frameshift(2)		liver(2)	central_nervous_system(4)|lung(2)|breast(1)	7						c.(2344-2352)GGCGAGAGG>GGG		furin preproprotein																																				SO:0001651	inframe_deletion	5045				cell proliferation|negative regulation of low-density lipoprotein particle receptor catabolic process|negative regulation of transforming growth factor-beta1 production|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|Notch signaling pathway|peptide biosynthetic process|peptidyl-glutamic acid carboxylation|post-translational protein modification|secretion by cell|signal peptide processing|transforming growth factor beta receptor signaling pathway|viral assembly, maturation, egress, and release	cell surface|Golgi lumen|Golgi membrane|integral to membrane|membrane raft|plasma membrane|trans-Golgi network|trans-Golgi network transport vesicle	metal ion binding|nerve growth factor binding|peptide binding|protease binding|serine-type endopeptidase activity|serine-type endopeptidase inhibitor activity	g.chr15:91425068_91425073delGCGAGA	X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.2345_2350delGCGAGA	15.37:g.91425068_91425073delGCGAGA	ENSP00000268171:p.Glu783_Arg784del					FES_uc010uqj.1_5'Flank|FES_uc010uqk.1_5'Flank|FES_uc002bpw.2_5'Flank|FES_uc002bpv.2_5'Flank	p.ER783del	NM_002569	NP_002560	P09958	FURIN_HUMAN	Lung(145;0.189)		16	2561_2566	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		783_784					Q14336|Q6LBS3|Q9UCZ5	In_Frame_Del	DEL	ENST00000268171.3	37	c.2345_2350delGCGAGA	CCDS10364.1																																																																																				0.597	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569		8	68	NA	NA	NA	NA	NA	8	68	---	---	---	---
ZSWIM4	65249	broad.mit.edu	37	19	13941261	13941261	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr19:13941261delC	ENST00000254323.2	+	13	2556	c.2367delC	c.(2365-2367)tacfs	p.Y789fs	ZSWIM4_ENST00000440752.2_Frame_Shift_Del_p.Y623fs	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	789							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			AGGCGGCCTACCAGATCGTGC	0.692																																							uc002mxh.1		NA																	0				central_nervous_system(2)	2						c.(2365-2367)TACfs		zinc finger, SWIM-type containing 4							64.0	67.0	66.0					19																	13941261		2203	4300	6503	SO:0001589	frameshift_variant	65249						zinc ion binding	g.chr19:13941261delC	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.2367delC	19.37:g.13941261delC	ENSP00000254323:p.Tyr789fs					ZSWIM4_uc010xng.1_Frame_Shift_Del_p.Y712fs	p.Y789fs	NM_023072	NP_075560	Q9H7M6	ZSWM4_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)		13	2556	+			789						Frame_Shift_Del	DEL	ENST00000254323.2	37	c.2367delC	CCDS32924.1																																																																																				0.692	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342		39	77	NA	NA	NA	NA	NA	39	77	---	---	---	---
TTN	7273	broad.mit.edu	37	2	179588160	179588160	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr2:179588160delG	ENST00000591111.1	-	72	20940	c.20716delC	c.(20716-20718)cgtfs	p.R6906fs	TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Frame_Shift_Del_p.R7223fs|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Frame_Shift_Del_p.R5979fs|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12493	Ig-like 50.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAAAGAGACGGGTAGTGCAA	0.413																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(17935-17937)CGTfs		titin isoform N2-A							73.0	74.0	74.0					2																	179588160		1940	4147	6087	SO:0001589	frameshift_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179588160delG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.20716delC	2.37:g.179588160delG	ENSP00000465570:p.Arg6906fs					TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Frame_Shift_Del_p.R2640fs	p.R5979fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		71	18159	-			6906					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	37	c.17935delC																																																																																					0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		12	36	NA	NA	NA	NA	NA	12	36	---	---	---	---
SEPT3	55964	broad.mit.edu	37	22	42392949	42392949	+	Frame_Shift_Del	DEL	C	C	-	rs369867839		TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr22:42392949delC	ENST00000396426.3	+	11	1310	c.1055delC	c.(1054-1056)accfs	p.T352fs	SEPT3_ENST00000328414.8_3'UTR|WBP2NL_ENST00000328823.9_5'Flank|SEPT3_ENST00000396425.3_3'UTR|SEPT3_ENST00000406029.1_Frame_Shift_Del_p.T288fs	NM_145733.2	NP_663786.2	Q9UH03	SEPT3_HUMAN	septin 3	352					cell cycle (GO:0007049)|cell division (GO:0051301)	cell junction (GO:0030054)|septin complex (GO:0031105)|synapse (GO:0045202)	GTP binding (GO:0005525)			breast(1)|kidney(3)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	17						GTGCCAGCCACCCCCTGCCCC	0.587																																							uc003bbr.3		NA																	0					0						c.(1054-1056)ACCfs		septin 3 isoform A							148.0	125.0	133.0					22																	42392949		2203	4300	6503	SO:0001589	frameshift_variant	55964				cell cycle|cytokinesis	cell junction|septin complex	GTP binding	g.chr22:42392949delC	AF285107	CCDS14026.2, CCDS14027.2	22q13.2	2013-01-21			ENSG00000100167	ENSG00000100167		"""Septins"""	10750	protein-coding gene	gene with protein product		608314		SEP3			Standard	NM_019106		Approved		uc003bbr.4	Q9UH03	OTTHUMG00000030494	ENST00000396426.3:c.1055delC	22.37:g.42392949delC	ENSP00000379704:p.Thr352fs					WBP2NL_uc011ape.1_Intron|SEPT3_uc003bbs.3_3'UTR|SEPT3_uc010gyr.2_Frame_Shift_Del_p.T288fs|SEPT3_uc011apj.1_3'UTR|SEPT3_uc010gys.2_Frame_Shift_Del_p.T132fs|WBP2NL_uc003bbt.2_5'Flank|WBP2NL_uc011apk.1_5'Flank|WBP2NL_uc003bbu.2_5'Flank	p.T352fs	NM_145733	NP_663786	Q9UH03	SEPT3_HUMAN			11	1193	+			352					B1AHR0|Q2NKJ7|Q59GF7|Q6IBZ6|Q8N3P3|Q9HD35	Frame_Shift_Del	DEL	ENST00000396426.3	37	c.1055delC	CCDS14026.2																																																																																				0.587	SEPT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322051.1	NM_145734		36	124	NA	NA	NA	NA	NA	36	124	---	---	---	---
SPDL1	54908	broad.mit.edu	37	5	169023598	169023599	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr5:169023598_169023599delTC	ENST00000265295.4	+	8	1204_1205	c.925_926delTC	c.(925-927)tctfs	p.S309fs		NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1																		GATGAAAGGGTCTCAAACTGAA	0.347																																							uc003mae.3		NA																	0				ovary(1)|liver(1)	2						c.(925-927)TCTfs		coiled-coil domain containing 99																																				SO:0001589	frameshift_variant	54908				cell division|establishment of mitotic spindle orientation|mitotic metaphase plate congression|mitotic prometaphase|protein localization to kinetochore	condensed chromosome outer kinetochore|cytosol|microtubule organizing center|nucleus|spindle pole	kinetochore binding|protein binding	g.chr5:169023598_169023599delTC	BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.925_926delTC	5.37:g.169023600_169023601delTC	ENSP00000265295:p.Ser309fs					CCDC99_uc010jjj.2_Frame_Shift_Del_p.S238fs|CCDC99_uc011deq.1_Frame_Shift_Del_p.S126fs|CCDC99_uc010jjk.2_Frame_Shift_Del_p.S35fs	p.S309fs	NM_017785	NP_060255	Q96EA4	SPDLY_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		8	1204_1205	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	309			Potential.			Frame_Shift_Del	DEL	ENST00000265295.4	37	c.925_926delTC	CCDS4370.1																																																																																				0.347	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785		25	82	NA	NA	NA	NA	NA	25	82	---	---	---	---
SMOC2	64094	broad.mit.edu	37	6	169053663	169053663	+	Frame_Shift_Del	DEL	T	T	-			TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr6:169053663delT	ENST00000356284.2	+	11	1260	c.1040delT	c.(1039-1041)ctafs	p.L347fs	SMOC2_ENST00000354536.5_Frame_Shift_Del_p.L358fs	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	347	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		AGCCATACCCTAGAGGAGCGG	0.542																																							uc003qws.1		NA																	0				ovary(1)	1						c.(1039-1041)CTAfs		SPARC related modular calcium binding 2							44.0	46.0	46.0					6																	169053663		2203	4300	6503	SO:0001589	frameshift_variant	64094				signal transduction	basement membrane	calcium ion binding	g.chr6:169053663delT	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.1040delT	6.37:g.169053663delT	ENSP00000348630:p.Leu347fs					SMOC2_uc003qwr.1_Frame_Shift_Del_p.L358fs|SMOC2_uc011egu.1_Frame_Shift_Del_p.L24fs	p.L347fs	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)	11	1060	+		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)	347			EF-hand 1.		B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Frame_Shift_Del	DEL	ENST00000356284.2	37	c.1040delT	CCDS55076.1																																																																																				0.542	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1			9	48	NA	NA	NA	NA	NA	9	48	---	---	---	---
ZNF395	55893	broad.mit.edu	37	8	28209226	28209228	+	In_Frame_Del	DEL	GCA	GCA	-	rs142343457|rs368917144	byFrequency	TCGA-50-5072-01A-21D-1855-08	TCGA-50-5072-10A-01D-1855-08	GCA	GCA	-	-	GCA	GCA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c6dcba5-1312-40ca-b589-07f7d88b3477	96a904cf-e50e-4320-8d23-2dd095845c5e	g.chr8:28209226_28209228delGCA	ENST00000344423.5	-	7	1148_1150	c.1017_1019delTGC	c.(1015-1020)gctgcc>gcc	p.339_340AA>A	ZNF395_ENST00000523202.1_In_Frame_Del_p.339_340AA>A|ZNF395_ENST00000523095.1_In_Frame_Del_p.339_340AA>A	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GGTGCCTgcggcagcagcagcag	0.606																																							uc003xgq.2		NA																	0					0						c.(1015-1020)GCTGCC>GCC		zinc finger protein 395				554,80,3604		203,0,148,2,76,1690						-6.6	0.0			63	1049,5,7094		390,0,269,0,5,3410	no	codingComplex	ZNF395	NM_018660.2		593,0,417,2,81,5100	A1A1,A1A2,A1R,A2A2,A2R,RR		12.9357,14.9599,13.6283				1603,85,10698				SO:0001651	inframe_deletion	55893				transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	g.chr8:28209226_28209228delGCA	AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.1017_1019delTGC	8.37:g.28209235_28209237delGCA	ENSP00000340494:p.Ala341del					ZNF395_uc003xgt.2_In_Frame_Del_p.339_340AA>A|ZNF395_uc003xgr.2_In_Frame_Del_p.339_340AA>A|ZNF395_uc003xgs.2_In_Frame_Del_p.339_340AA>A	p.339_340AA>A	NM_018660	NP_061130	Q9H8N7	ZN395_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)	7	1105_1107	-		Ovarian(32;2.06e-05)	339_340					B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	In_Frame_Del	DEL	ENST00000344423.5	37	c.1017_1019delTGC	CCDS6067.1																																																																																				0.606	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1			7	162	NA	NA	NA	NA	NA	7	162	---	---	---	---
