#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
SPSB1	80176	broad.mit.edu	37	1	9416202	9416202	+	Silent	SNP	G	G	T	rs376085384		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:9416202G>T	ENST00000328089.6	+	2	593	c.252G>T	c.(250-252)acG>acT	p.T84T	SPSB1_ENST00000377399.2_Silent_p.T84T|SPSB1_ENST00000357898.3_Silent_p.T84T	NM_025106.3	NP_079382.2	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box containing 1	84	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)		p.T84T(1)		breast(1)|endometrium(3)|kidney(2)|lung(5)|prostate(2)	13	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		CCCAGAGCACGGACGCTATCA	0.602																																							uc010oae.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(250-252)ACG>ACT		splA/ryanodine receptor domain and SOCS box							146.0	149.0	148.0					1																	9416202		2203	4300	6503	SO:0001819	synonymous_variant	80176				intracellular signal transduction	cytoplasm		g.chr1:9416202G>T		CCDS102.1	1p36.22	2008-02-05			ENSG00000171621	ENSG00000171621			30628	protein-coding gene	gene with protein product		611657				15713673, 12076535	Standard	NM_025106		Approved	SSB-1	uc010oae.2	Q96BD6	OTTHUMG00000001279	ENST00000328089.6:c.252G>T	1.37:g.9416202G>T						SPSB1_uc001apv.2_Silent_p.T84T	p.T84T	NM_025106	NP_079382	Q96BD6	SPSB1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)	2	591	+	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)	84			B30.2/SPRY.		A2A275|Q59FA1|Q5TIH9|Q9BRY9|Q9H6C5	Silent	SNP	ENST00000328089.6	37	c.252G>T	CCDS102.1																																																																																				0.602	SPSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003727.2	NM_025106		35	184	1	0	5.43694e-19	0.005524	9.14905e-19	35	184				
ZFP69	339559	broad.mit.edu	37	1	40961204	40961204	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:40961204G>A	ENST00000372706.1	+	6	2060	c.1054G>A	c.(1054-1056)Gag>Aag	p.E352K	RP11-656D10.3_ENST00000450713.1_RNA|ZFP69_ENST00000372705.3_Missense_Mutation_p.E352K			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	352					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E352K(1)									TCACACTGGGGAGAAACCCTA	0.418																																							uc001cfo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1054-1056)GAG>AAG		zinc finger protein 642							93.0	91.0	92.0					1																	40961204		2203	4300	6503	SO:0001583	missense	339559				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:40961204G>A	AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.1054G>A	1.37:g.40961204G>A	ENSP00000361791:p.Glu352Lys					ZNF642_uc009vwb.2_Missense_Mutation_p.E352K|ZNF642_uc010ojk.1_Missense_Mutation_p.E353K	p.E352K	NM_198494	NP_940896	Q49AA0	ZN642_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;8.81e-19)		6	1348	+	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	352					Q5SWM5|Q6ZWK8	Missense_Mutation	SNP	ENST00000372706.1	37	c.1054G>A	CCDS30686.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354000	0.82243	.	.	ENSG00000187815	ENST00000372706;ENST00000372705	T;T	0.24350	1.86;1.86	4.65	4.65	0.58169	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44285	D	0.000480	T	0.32526	0.0832	N	0.25957	0.775	0.37925	D	0.931812	P	0.51791	0.948	P	0.55824	0.785	T	0.13845	-1.0494	10	0.62326	D	0.03	-16.8438	15.8405	0.78842	0.0:0.0:1.0:0.0	.	352	Q49AA0	ZN642_HUMAN	K	352	ENSP00000361791:E352K;ENSP00000361790:E352K	ENSP00000361790:E352K	E	+	1	0	ZNF642	40733791	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.637000	0.61346	2.854000	0.98071	0.655000	0.94253	GAG		0.418	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019082.1	NM_198494		15	110	0	0	0	0.004007	0	15	110				
CYP4X1	260293	broad.mit.edu	37	1	47489621	47489621	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:47489621C>A	ENST00000371901.3	+	1	382	c.132C>A	c.(130-132)cgC>cgA	p.R44R	CYP4X1_ENST00000538609.1_Intron	NM_178033.1	NP_828847.1	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X, polypeptide 1	44						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R44R(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	17						GGGACCTGCGCCCCTTCCCAG	0.687																																							uc001cqt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(130-132)CGC>CGA		cytochrome P450, family 4, subfamily X,							22.0	26.0	24.0					1																	47489621		2203	4299	6502	SO:0001819	synonymous_variant	260293					endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding	g.chr1:47489621C>A	AK091806	CCDS544.1	1p33	2008-02-05			ENSG00000186377	ENSG00000186377		"""Cytochrome P450s"""	20244	protein-coding gene	gene with protein product		614999				12176035	Standard	NM_178033		Approved	MGC40051	uc001cqt.3	Q8N118	OTTHUMG00000008017	ENST00000371901.3:c.132C>A	1.37:g.47489621C>A						CYP4X1_uc001cqr.2_Intron|CYP4X1_uc001cqs.2_Intron	p.R44R	NM_178033	NP_828847	Q8N118	CP4X1_HUMAN			1	382	+			44					G3V1U1|Q5VVE5|Q6ZN67|Q8NAZ3	Silent	SNP	ENST00000371901.3	37	c.132C>A	CCDS544.1																																																																																				0.687	CYP4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022017.1	NM_178033		5	27	1	0	0.000602214	0.000602	0.000699466	5	27				
RAB3B	5865	broad.mit.edu	37	1	52403027	52403027	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:52403027T>A	ENST00000371655.3	-	3	498	c.286A>T	c.(286-288)Atg>Ttg	p.M96L		NM_002867.3	NP_002858.2	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family	96					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of vesicle size (GO:0097494)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.M96L(1)		large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9						ATGAAGCCCATGGCCCCACGG	0.458																																							uc001cth.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(286-288)ATG>TTG		RAB3B, member RAS oncogene family							164.0	150.0	155.0					1																	52403027		2203	4300	6503	SO:0001583	missense	5865				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity	g.chr1:52403027T>A	BC005035	CCDS560.1	1p32-p31	2008-02-05			ENSG00000169213	ENSG00000169213		"""RAB, member RAS oncogene"""	9778	protein-coding gene	gene with protein product		179510					Standard	NM_002867		Approved		uc001cth.3	P20337	OTTHUMG00000008627	ENST00000371655.3:c.286A>T	1.37:g.52403027T>A	ENSP00000360718:p.Met96Leu						p.M96L	NM_002867	NP_002858	P20337	RAB3B_HUMAN			3	411	-			96					Q5VUL2|Q9BSI1	Missense_Mutation	SNP	ENST00000371655.3	37	c.286A>T	CCDS560.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.950897	0.92660	.	.	ENSG00000169213	ENST00000371655;ENST00000537650	T	0.79247	-1.25	4.75	4.75	0.60458	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.81692	0.4876	L	0.37850	1.14	0.80722	D	1	D	0.60160	0.987	D	0.83275	0.996	T	0.79117	-0.1935	10	0.27082	T	0.32	.	14.3764	0.66881	0.0:0.0:0.0:1.0	.	96	P20337	RAB3B_HUMAN	L	96	ENSP00000360718:M96L	ENSP00000360718:M96L	M	-	1	0	RAB3B	52175615	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.589000	0.82641	2.119000	0.64992	0.379000	0.24179	ATG		0.458	RAB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023816.1	NM_002867		15	114	0	0	0	0.00499	0	15	114				
USP1	7398	broad.mit.edu	37	1	62915921	62915921	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:62915921G>A	ENST00000339950.4	+	9	2442	c.1627G>A	c.(1627-1629)Gat>Aat	p.D543N	USP1_ENST00000371146.1_Missense_Mutation_p.D543N	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	543	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.D543N(1)		breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		CCAAAGGTTTGATTGTTATGG	0.363																																					Ovarian(122;1846 2315 3982 19504)	Ovarian(122;1846 2315 3982 19504)	uc001daj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1627-1629)GAT>AAT		ubiquitin specific protease 1							81.0	78.0	79.0					1																	62915921		2203	4300	6503	SO:0001583	missense	7398				DNA repair|monoubiquitinated protein deubiquitination|regulation of DNA repair|response to UV|ubiquitin-dependent protein catabolic process	nucleoplasm	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr1:62915921G>A		CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.1627G>A	1.37:g.62915921G>A	ENSP00000343526:p.Asp543Asn					USP1_uc001dak.1_Missense_Mutation_p.D543N|USP1_uc001dal.1_Missense_Mutation_p.D543N	p.D543N	NM_001017415	NP_001017415	O94782	UBP1_HUMAN		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)	9	1955	+		all_neural(321;0.0281)	543					A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	ENST00000339950.4	37	c.1627G>A	CCDS621.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.917137	0.73098	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	T;T	0.75154	-0.91;-0.91	5.37	5.37	0.77165	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.85314	0.5668	M	0.66560	2.04	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.83353	-0.0002	10	0.38643	T	0.18	-22.4661	19.3071	0.94167	0.0:0.0:1.0:0.0	.	543	O94782	UBP1_HUMAN	N	543	ENSP00000360188:D543N;ENSP00000343526:D543N	ENSP00000343526:D543N	D	+	1	0	USP1	62688509	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	9.080000	0.94040	2.793000	0.96121	0.563000	0.77884	GAT		0.363	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024881.1	NM_001017415		7	109	0	0	0	0.004482	0	7	109				
NEGR1	257194	broad.mit.edu	37	1	72400931	72400931	+	Silent	SNP	C	C	A	rs376667297		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:72400931C>A	ENST00000357731.5	-	2	479	c.240G>T	c.(238-240)gcG>gcT	p.A80A	NEGR1_ENST00000434200.1_Silent_p.A78A|NEGR1_ENST00000306821.3_5'UTR|NEGR1_ENST00000467479.1_5'UTR	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	80	Ig-like C2-type 1.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.A80A(1)		endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		TATCACCTCCCGCAAAAATAA	0.398																																							uc001dfw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(238-240)GCG>GCT		neuronal growth regulator 1 precursor							100.0	98.0	99.0					1																	72400931		2203	4300	6503	SO:0001819	synonymous_variant	257194				cell adhesion	anchored to membrane|plasma membrane		g.chr1:72400931C>A	AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.240G>T	1.37:g.72400931C>A						NEGR1_uc001dfv.2_5'UTR|NEGR1_uc010oqs.1_Silent_p.A80A	p.A80A	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)	2	340	-		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)	80			Ig-like C2-type 1.		Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Silent	SNP	ENST00000357731.5	37	c.240G>T	CCDS661.1																																																																																				0.398	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808		15	67	1	0	4.7546e-09	0.004007	6.94618e-09	15	67				
COL11A1	1301	broad.mit.edu	37	1	103428231	103428231	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:103428231G>T	ENST00000370096.3	-	39	3314	c.3002C>A	c.(3001-3003)gCt>gAt	p.A1001D	COL11A1_ENST00000358392.2_Missense_Mutation_p.A1013D|COL11A1_ENST00000512756.1_Missense_Mutation_p.A885D|COL11A1_ENST00000353414.4_Missense_Mutation_p.A962D	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1001	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.A1013D(1)|p.A1001D(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTTTCCTGCAGCACCAGGAAG	0.473																																							uc001dul.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(3001-3003)GCT>GAT		alpha 1 type XI collagen isoform A							96.0	94.0	95.0					1																	103428231		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103428231G>T	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3002C>A	1.37:g.103428231G>T	ENSP00000359114:p.Ala1001Asp					COL11A1_uc001duk.2_Missense_Mutation_p.A197D|COL11A1_uc001dum.2_Missense_Mutation_p.A1013D|COL11A1_uc001dun.2_Missense_Mutation_p.A962D|COL11A1_uc009weh.2_Missense_Mutation_p.A885D	p.A1001D	NM_001854	NP_001845	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	39	3320	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	1001			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.3002C>A	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199386	0.58126	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42	5.67	5.67	0.87782	.	0.156649	0.48767	D	0.000166	D	0.85071	0.5613	N	0.12611	0.24	0.58432	D	0.999997	B;B;P;B;B	0.39480	0.319;0.447;0.675;0.319;0.447	B;B;B;B;B	0.40940	0.134;0.261;0.344;0.134;0.261	D	0.85938	0.1456	10	0.12430	T	0.62	.	19.7741	0.96385	0.0:0.0:1.0:0.0	.	885;962;1013;1001;221	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	D	1001;1013;962;221;885	ENSP00000359114:A1001D;ENSP00000351163:A1013D;ENSP00000302551:A962D;ENSP00000426533:A885D	ENSP00000302551:A962D	A	-	2	0	COL11A1	103200819	1.000000	0.71417	0.991000	0.47740	0.956000	0.61745	7.893000	0.87330	2.673000	0.90976	0.557000	0.71058	GCT		0.473	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		19	87	1	0	6.33239e-15	0.010504	1.01499e-14	19	87				
SYT6	148281	broad.mit.edu	37	1	114682455	114682455	+	Silent	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:114682455A>G	ENST00000610222.1	-	2	440	c.294T>C	c.(292-294)tcT>tcC	p.S98S	SYT6_ENST00000369547.1_Silent_p.S13S|SYT6_ENST00000609117.1_Silent_p.S13S|SYT6_ENST00000607941.1_Silent_p.S13S|SYT6_ENST00000393296.1_Silent_p.S98S			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	98					acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)	p.S13S(1)		central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGGGATTAGCAGAAGAGGGAC	0.597																																							uc001eev.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(37-39)TCT>TCC		synaptotagmin VI							90.0	99.0	96.0					1																	114682455		2203	4300	6503	SO:0001819	synonymous_variant	148281				acrosomal vesicle exocytosis	cell junction|cytosol|integral to membrane|perinuclear endoplasmic reticulum|peripheral to membrane of membrane fraction|synaptic vesicle membrane	clathrin binding|metal ion binding|protein homodimerization activity|syntaxin binding|transporter activity	g.chr1:114682455A>G		CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.294T>C	1.37:g.114682455A>G							p.S13S	NM_205848	NP_995320	Q5T7P8	SYT6_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	2	289	-	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)	98			Cytoplasmic (Potential).		B1AMB8|B3KPK1	Silent	SNP	ENST00000610222.1	37	c.39T>C																																																																																					0.597	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000314819.2	NM_205848		10	189	0	0	0	0.001368	0	10	189				
IGSF3	3321	broad.mit.edu	37	1	117127643	117127643	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:117127643C>A	ENST00000369486.3	-	9	3237	c.2472G>T	c.(2470-2472)ggG>ggT	p.G824G	IGSF3_ENST00000318837.6_Silent_p.G844G|IGSF3_ENST00000369483.1_Silent_p.G844G	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	824	Ig-like C2-type 7.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.G824G(1)|p.G844G(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		CCGACAGGTTCCCCTGGGCTT	0.562																																							uc001egr.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(2470-2472)GGG>GGT		immunoglobulin superfamily, member 3 isoform 2							34.0	36.0	35.0					1																	117127643		2203	4300	6503	SO:0001819	synonymous_variant	3321					integral to membrane		g.chr1:117127643C>A	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2472G>T	1.37:g.117127643C>A						IGSF3_uc001egq.1_Silent_p.G844G|IGSF3_uc001egs.1_Silent_p.G497G	p.G824G	NM_001007237	NP_001007238	O75054	IGSF3_HUMAN		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)	9	3177	-	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)	824			Ig-like C2-type 7.|Extracellular (Potential).		A6NJZ6|A6NMC7	Silent	SNP	ENST00000369486.3	37	c.2472G>T	CCDS30813.1																																																																																				0.562	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542		10	42	1	0	3.86212e-05	0.008291	4.79347e-05	10	42				
PTGFRN	5738	broad.mit.edu	37	1	117504136	117504136	+	Silent	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:117504136A>G	ENST00000393203.2	+	5	1632	c.1485A>G	c.(1483-1485)acA>acG	p.T495T	RNA5SP55_ENST00000516701.1_RNA	NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	495	Ig-like C2-type 4.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.T495T(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		AGGAACATACAGACACGTTCA	0.493																																							uc001egv.1		NA																	1	Substitution - coding silent(1)		lung(1)	liver(1)	1						c.(1483-1485)ACA>ACG		prostaglandin F2 receptor negative regulator							94.0	89.0	91.0					1																	117504136		2203	4300	6503	SO:0001819	synonymous_variant	5738					endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding	g.chr1:117504136A>G	AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.1485A>G	1.37:g.117504136A>G							p.T495T	NM_020440	NP_065173	Q9P2B2	FPRP_HUMAN		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)	5	1622	+	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)	495			Extracellular (Potential).|Ig-like C2-type 4.		Q5VVU9|Q8N2K6	Silent	SNP	ENST00000393203.2	37	c.1485A>G	CCDS890.1																																																																																				0.493	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033271.1	NM_020440		16	55	0	0	0	0.003163	0	16	55				
HMGCS2	3158	broad.mit.edu	37	1	120298057	120298057	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:120298057G>C	ENST00000369406.3	-	6	1229	c.1180C>G	c.(1180-1182)Ctg>Gtg	p.L394V	HMGCS2_ENST00000476640.1_5'Flank|HMGCS2_ENST00000544913.2_Missense_Mutation_p.L352V	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	394					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)	p.L394V(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		CACTGGGACAGAAGCGAGGCC	0.552																																							uc001eid.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1180-1182)CTG>GTG		hydroxymethylglutaryl-CoA synthase 2 isoform 1							275.0	256.0	262.0					1																	120298057		2203	4300	6503	SO:0001583	missense	3158				acetoacetic acid biosynthetic process|cholesterol biosynthetic process|isoprenoid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA synthase activity	g.chr1:120298057G>C	BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.1180C>G	1.37:g.120298057G>C	ENSP00000358414:p.Leu394Val					HMGCS2_uc010oxj.1_Missense_Mutation_p.L352V|HMGCS2_uc001eie.2_Missense_Mutation_p.L302V	p.L394V	NM_005518	NP_005509	P54868	HMCS2_HUMAN		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)	6	1231	-	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)	394					B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Missense_Mutation	SNP	ENST00000369406.3	37	c.1180C>G	CCDS905.1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.176829	0.38413	.	.	ENSG00000134240	ENST00000369406;ENST00000544913	D;D	0.82803	-1.65;-1.65	5.26	3.38	0.38709	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.000000	0.49305	D	0.000151	T	0.81389	0.4812	M	0.69823	2.125	0.25288	N	0.989381	D;P	0.56521	0.976;0.948	P;P	0.58130	0.817;0.833	T	0.74383	-0.3683	10	0.52906	T	0.07	-9.6397	9.9644	0.41715	0.1684:0.0:0.8316:0.0	.	352;394	B7Z8R3;P54868	.;HMCS2_HUMAN	V	394;352	ENSP00000358414:L394V;ENSP00000439495:L352V	ENSP00000358414:L394V	L	-	1	2	HMGCS2	120099580	1.000000	0.71417	0.023000	0.16930	0.655000	0.38815	3.118000	0.50414	0.698000	0.31739	0.563000	0.77884	CTG		0.552	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033469.2	NM_005518		72	278	0	0	0	0.00361	0	72	278				
NBPF7	343505	broad.mit.edu	37	1	120384050	120384050	+	IGR	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:120384050C>G								REG4 (29767 upstream) : ADAM30 (52105 downstream)														p.G171A(1)									CAGCCTACACCCCTCAGCCAG	0.587																																							uc010oxk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(511-513)GGG>GCG		hypothetical protein LOC343505							92.0	102.0	98.0					1																	120384050		2202	4300	6502	SO:0001628	intergenic_variant	343505					cytoplasm		g.chr1:120384050C>G																													1.37:g.120384050C>G							p.G171A	NM_001047980	NP_001041445	P0C2Y1	NBPF7_HUMAN		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)	3	1133	-	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)	171						Missense_Mutation	SNP		37	c.512G>C																																																																																				0	0.587									22	119	0	0	0	0.001882	0	22	119				
GJA8	2703	broad.mit.edu	37	1	147381011	147381011	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:147381011G>T	ENST00000369235.1	+	1	929	c.929G>T	c.(928-930)gGg>gTg	p.G310V	GJA8_ENST00000240986.4_Missense_Mutation_p.G310V			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	310					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)	p.G310V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					GGACCCCTGGGGGACTTGTCC	0.617																																					Melanoma(76;1255 1795 8195 52096)	Melanoma(76;1255 1795 8195 52096)	uc001epu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|breast(1)|skin(1)	6						c.(928-930)GGG>GTG		connexin 50							31.0	31.0	31.0					1																	147381011		2201	4300	6501	SO:0001583	missense	2703				cell communication|visual perception	connexon complex|integral to plasma membrane	channel activity	g.chr1:147381011G>T	U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.929G>T	1.37:g.147381011G>T	ENSP00000358238:p.Gly310Val						p.G310V	NM_005267	NP_005258	P48165	CXA8_HUMAN			2	992	+	all_hematologic(923;0.0276)		310			Cytoplasmic (Potential).		A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	ENST00000369235.1	37	c.929G>T	CCDS30834.1	.	.	.	.	.	.	.	.	.	.	g	1.127	-0.653653	0.03480	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	T;T	0.76186	-1.0;-1.0	4.95	2.0	0.26442	.	1.140920	0.06557	N	0.746110	T	0.43411	0.1246	N	0.14661	0.345	0.26920	N	0.966706	P	0.43885	0.82	P	0.47299	0.543	T	0.36016	-0.9765	10	0.27785	T	0.31	.	6.2582	0.20885	0.2785:0.3285:0.393:0.0	.	310	P48165	CXA8_HUMAN	V	310	ENSP00000240986:G310V;ENSP00000358238:G310V	ENSP00000240986:G310V	G	+	2	0	GJA8	145847635	1.000000	0.71417	0.001000	0.08648	0.066000	0.16364	3.218000	0.51192	0.014000	0.14944	-1.134000	0.01955	GGG		0.617	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267		6	30	1	0	0.00116845	0.001168	0.00133503	6	30				
FLG	2312	broad.mit.edu	37	1	152276020	152276020	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:152276020G>T	ENST00000368799.1	-	3	11377	c.11342C>A	c.(11341-11343)tCt>tAt	p.S3781Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3781	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S3781Y(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGTGTCCAGACCTATCTAC	0.577									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(11341-11343)TCT>TAT		filaggrin							355.0	342.0	346.0					1																	152276020		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152276020G>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11342C>A	1.37:g.152276020G>T	ENSP00000357789:p.Ser3781Tyr						p.S3781Y	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	11378	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		3781			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.11342C>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	7.853	0.724443	0.15439	.	.	ENSG00000143631	ENST00000368799	T	0.03801	3.8	2.62	0.56	0.17279	.	.	.	.	.	T	0.07007	0.0178	M	0.78049	2.395	0.09310	N	1	D	0.61697	0.99	D	0.71656	0.974	T	0.23297	-1.0192	9	0.27082	T	0.32	.	7.0243	0.24932	0.0:0.0:0.5104:0.4896	.	3781	P20930	FILA_HUMAN	Y	3781	ENSP00000357789:S3781Y	ENSP00000357789:S3781Y	S	-	2	0	FLG	150542644	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.308000	0.19314	0.154000	0.19237	0.552000	0.68991	TCT		0.577	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		137	412	1	0	5.26942e-46	0.00361	9.3549e-46	137	412				
FLG2	388698	broad.mit.edu	37	1	152325492	152325492	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:152325492G>C	ENST00000388718.5	-	3	4842	c.4770C>G	c.(4768-4770)caC>caG	p.H1590Q	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1590					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H1590Q(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGTGTGGTCTGTGTGAGCCCC	0.512																																							uc001ezw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(4768-4770)CAC>CAG		filaggrin family member 2							342.0	300.0	314.0					1																	152325492		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152325492G>C	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.4770C>G	1.37:g.152325492G>C	ENSP00000373370:p.His1590Gln					uc001ezv.2_Intron	p.H1590Q	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	4843	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1590					Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.4770C>G	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.555289	0.00918	.	.	ENSG00000143520	ENST00000388718	T	0.18502	2.21	3.07	-4.2	0.03823	.	.	.	.	.	T	0.01765	0.0056	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.46925	-0.9156	9	0.13108	T	0.6	0.2027	4.0338	0.09721	0.1261:0.549:0.1922:0.1327	.	1590	Q5D862	FILA2_HUMAN	Q	1590	ENSP00000373370:H1590Q	ENSP00000373370:H1590Q	H	-	3	2	FLG2	150592116	0.000000	0.05858	0.013000	0.15412	0.037000	0.13140	-3.374000	0.00493	-0.489000	0.06716	-0.749000	0.03505	CAC		0.512	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		46	286	0	0	0	0.002522	0	46	286				
LCE2C	353140	broad.mit.edu	37	1	152648533	152648533	+	Silent	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:152648533C>G	ENST00000368783.1	+	2	97	c.42C>G	c.(40-42)ccC>ccG	p.P14P	LCE2B_ENST00000417924.2_Intron	NM_178429.2	NP_848516.1	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	14	Cys-rich.				keratinization (GO:0031424)			p.P14P(1)		endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	13	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCCCcctcccaagtgtcctc	0.493																																							uc001fah.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(40-42)CCC>CCG		late cornified envelope 2C							107.0	116.0	113.0					1																	152648533		2203	4298	6501	SO:0001819	synonymous_variant	353140				keratinization			g.chr1:152648533C>G		CCDS1019.1	1q21.3	2008-02-05			ENSG00000187180	ENSG00000187180		"""Late cornified envelopes"""	29460	protein-coding gene	gene with protein product		612611				11698679	Standard	NM_178429		Approved	LEP11	uc001fah.4	Q5TA81	OTTHUMG00000012389	ENST00000368783.1:c.42C>G	1.37:g.152648533C>G							p.P14P	NM_178429	NP_848516	Q5TA81	LCE2C_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	97	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		14			Cys-rich.			Silent	SNP	ENST00000368783.1	37	c.42C>G	CCDS1019.1																																																																																				0.493	LCE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034509.1	NM_178429		21	109	0	0	0	0.00278	0	21	109				
SLC39A1	27173	broad.mit.edu	37	1	153932916	153932916	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:153932916G>A	ENST00000368623.3	-	3	1392	c.633C>T	c.(631-633)tgC>tgT	p.C211C	SLC39A1_ENST00000461071.1_5'Flank|SLC39A1_ENST00000356205.4_Silent_p.C211C|CRTC2_ENST00000368633.1_5'Flank|CRTC2_ENST00000368630.3_5'Flank|SLC39A1_ENST00000368621.1_Silent_p.C211C|CRTC2_ENST00000476883.1_5'Flank|SLC39A1_ENST00000537590.1_Silent_p.C109C|SLC39A1_ENST00000310483.6_Silent_p.C211C			Q9NY26	S39A1_HUMAN	solute carrier family 39 (zinc transporter), member 1	211					cation transport (GO:0006812)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic cation transmembrane transporter activity (GO:0022890)|zinc ion transmembrane transporter activity (GO:0005385)	p.C211C(1)		kidney(2)|large_intestine(2)|lung(7)|urinary_tract(1)	12	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)	Colorectal(1306;0.019)		GCAAAGCCAGGCACAGCTCCA	0.662																																							uc001fdh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(631-633)TGC>TGT		solute carrier family 39 (zinc transporter),							40.0	39.0	39.0					1																	153932916		2203	4300	6503	SO:0001819	synonymous_variant	27173					endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	zinc ion transmembrane transporter activity	g.chr1:153932916G>A	BC007886	CCDS1055.1, CCDS72920.1	1q21	2013-05-22		2002-02-15	ENSG00000143570	ENSG00000143570		"""Solute carriers"""	12876	protein-coding gene	gene with protein product		604740	"""zinc/iron regulated transporter-like"""	ZIRTL		10610721, 10681536	Standard	NM_014437		Approved	ZIP1	uc031ppi.1	Q9NY26	OTTHUMG00000037158	ENST00000368623.3:c.633C>T	1.37:g.153932916G>A						CRTC2_uc010ped.1_5'Flank|SLC39A1_uc001fdi.2_Silent_p.C211C|SLC39A1_uc001fdj.2_Silent_p.C211C|SLC39A1_uc001fdk.2_Silent_p.C211C|SLC39A1_uc010pee.1_Silent_p.C109C|SLC39A1_uc001fdl.2_Silent_p.C211C	p.C211C	NM_014437	NP_055252	Q9NY26	S39A1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)	Colorectal(1306;0.019)	4	802	-	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		211			Helical; (Potential).		B4DDY7|Q5T4K1|Q8N2H7|Q9BTV0|Q9UBI7|Q9Y2Z7|Q9Y380	Silent	SNP	ENST00000368623.3	37	c.633C>T	CCDS1055.1																																																																																				0.662	SLC39A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090284.1	NM_014437		3	43	0	0	0	0.004672	0	3	43				
CD5L	922	broad.mit.edu	37	1	157805847	157805847	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:157805847C>A	ENST00000368174.4	-	3	250	c.154G>T	c.(154-156)Ggc>Tgc	p.G52C	CD5L_ENST00000484609.1_5'UTR	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	52	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)	p.G52C(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ATGTCCCAGCCGTCATCACAC	0.617																																							uc001frk.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(154-156)GGC>TGC		CD5 molecule-like precursor							116.0	115.0	115.0					1																	157805847		2203	4300	6503	SO:0001583	missense	922				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity	g.chr1:157805847C>A	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.154G>T	1.37:g.157805847C>A	ENSP00000357156:p.Gly52Cys						p.G52C	NM_005894	NP_005885	O43866	CD5L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		3	297	-	all_hematologic(112;0.0378)		52			SRCR 1.		A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	c.154G>T	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	C	12.04	1.819436	0.32145	.	.	ENSG00000073754	ENST00000368174	T	0.33216	1.42	4.85	0.39	0.16275	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	1.046730	0.07554	N	0.915978	T	0.42200	0.1192	H	0.96460	3.825	0.09310	N	1	P	0.49635	0.926	P	0.57324	0.818	T	0.27331	-1.0077	10	0.72032	D	0.01	.	1.7814	0.03032	0.1481:0.3484:0.3204:0.1831	.	52	O43866	CD5L_HUMAN	C	52	ENSP00000357156:G52C	ENSP00000357156:G52C	G	-	1	0	CD5L	156072471	0.000000	0.05858	0.015000	0.15790	0.423000	0.31445	-0.542000	0.06091	0.205000	0.20568	0.563000	0.77884	GGC		0.617	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894		28	139	1	0	2.41591e-17	0.004656	3.97456e-17	28	139				
SPTA1	6708	broad.mit.edu	37	1	158627350	158627350	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:158627350G>T	ENST00000368147.4	-	19	2902	c.2722C>A	c.(2722-2724)Ctg>Atg	p.L908M		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	908					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.L908M(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GCTTCATGCAGGTCAGCCAGG	0.483																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(2722-2724)CTG>ATG		spectrin, alpha, erythrocytic 1							171.0	172.0	172.0					1																	158627350		2023	4201	6224	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158627350G>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2722C>A	1.37:g.158627350G>T	ENSP00000357129:p.Leu908Met						p.L908M	NM_003126	NP_003117	P02549	SPTA1_HUMAN			19	2921	-	all_hematologic(112;0.0378)		908			Spectrin 10.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.2722C>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.172368	0.57584	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.51574	0.7;0.7	4.68	1.78	0.24846	.	0.000000	0.26704	N	0.022923	T	0.45518	0.1346	M	0.73217	2.22	0.29509	N	0.854311	D	0.69078	0.997	D	0.75484	0.986	T	0.29212	-1.0019	10	0.40728	T	0.16	.	5.49	0.16771	0.2272:0.2273:0.5455:0.0	.	908	P02549	SPTA1_HUMAN	M	908	ENSP00000357130:L908M;ENSP00000357129:L908M	ENSP00000357129:L908M	L	-	1	2	SPTA1	156893974	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	1.924000	0.40065	0.293000	0.22520	-0.126000	0.14955	CTG		0.483	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		28	148	1	0	1.2476e-16	0.00632	2.0346e-16	28	148				
SPTA1	6708	broad.mit.edu	37	1	158632506	158632506	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:158632506G>C	ENST00000368147.4	-	17	2630	c.2450C>G	c.(2449-2451)aCt>aGt	p.T817S		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	817					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.T817S(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GTAGGTGGAAGTAGCTGAGGG	0.498																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(2449-2451)ACT>AGT		spectrin, alpha, erythrocytic 1							95.0	96.0	96.0					1																	158632506		1938	4129	6067	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158632506G>C	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2450C>G	1.37:g.158632506G>C	ENSP00000357129:p.Thr817Ser						p.T817S	NM_003126	NP_003117	P02549	SPTA1_HUMAN			17	2649	-	all_hematologic(112;0.0378)		817			Spectrin 9.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.2450C>G	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	9.534	1.111547	0.20714	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.47177	0.85;0.85	4.28	3.36	0.38483	.	0.265185	0.19961	N	0.102201	T	0.08582	0.0213	N	0.05534	-0.03	0.25359	N	0.988792	B	0.06786	0.001	B	0.09377	0.004	T	0.34304	-0.9834	10	0.11485	T	0.65	.	9.2079	0.37300	0.1024:0.0:0.8976:0.0	.	817	P02549	SPTA1_HUMAN	S	817	ENSP00000357130:T817S;ENSP00000357129:T817S	ENSP00000357129:T817S	T	-	2	0	SPTA1	156899130	1.000000	0.71417	0.283000	0.24790	0.283000	0.27025	8.593000	0.90832	1.004000	0.39156	0.563000	0.77884	ACT		0.498	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		4	69	0	0	0	0.009096	0	4	69				
OR6K2	81448	broad.mit.edu	37	1	158670176	158670176	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:158670176C>T	ENST00000359610.2	-	1	310	c.267G>A	c.(265-267)agG>agA	p.R89R		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R89R(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					AGGAAATGCTCCTCTCACTAA	0.458																																							uc001fsu.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(265-267)AGG>AGA		olfactory receptor, family 6, subfamily K,							102.0	98.0	99.0					1																	158670176		2203	4300	6503	SO:0001819	synonymous_variant	81448				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158670176C>T	BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.267G>A	1.37:g.158670176C>T							p.R89R	NM_001005279	NP_001005279	Q8NGY2	OR6K2_HUMAN			1	267	-	all_hematologic(112;0.0378)		89			Extracellular (Potential).		B9EH33|Q6IFR6	Silent	SNP	ENST00000359610.2	37	c.267G>A	CCDS30902.1																																																																																				0.458	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279		15	82	0	0	0	0.004007	0	15	82				
FCER1A	2205	broad.mit.edu	37	1	159275977	159275977	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:159275977G>T	ENST00000368115.1	+	5	630	c.531G>T	c.(529-531)acG>acT	p.T177T	FCER1A_ENST00000368114.1_Silent_p.T144T	NM_002001.3	NP_001992.1	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide	177	Ig-like 2.				activation of JUN kinase activity (GO:0007257)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leukotriene biosynthetic process (GO:0019370)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of type I hypersensitivity (GO:0001812)|serotonin secretion (GO:0001820)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)	p.T177T(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(19)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	ACTACTGTACGGGCAAAGTGT	0.438																																							uc001ftq.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|skin(2)|prostate(1)	5						c.(529-531)ACG>ACT		Fc fragment of IgE, high affinity I, receptor	Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)						139.0	120.0	127.0					1																	159275977		2203	4300	6503	SO:0001819	synonymous_variant	2205					integral to plasma membrane		g.chr1:159275977G>T	BC015195	CCDS1184.1	1q23	2013-01-11			ENSG00000179639	ENSG00000179639		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3609	protein-coding gene	gene with protein product		147140		FCE1A		8245459	Standard	NM_002001		Approved		uc001ftq.3	P12319	OTTHUMG00000037176	ENST00000368115.1:c.531G>T	1.37:g.159275977G>T							p.T177T	NM_002001	NP_001992	P12319	FCERA_HUMAN			5	630	+	all_hematologic(112;0.0429)		177			Ig-like 2.|Extracellular (Potential).			Silent	SNP	ENST00000368115.1	37	c.531G>T	CCDS1184.1																																																																																				0.438	FCER1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090328.2	NM_002001		32	81	1	0	2.08457e-15	0.002096	3.36047e-15	32	81				
VANGL2	57216	broad.mit.edu	37	1	160388876	160388876	+	Nonsense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:160388876A>T	ENST00000368061.2	+	4	751	c.277A>T	c.(277-279)Aag>Tag	p.K93*		NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	93					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)		p.K93*(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACGCATCGCCAAGGACATGGA	0.612																																							uc001fwb.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(277-279)AAG>TAG		vang-like 2							113.0	109.0	110.0					1																	160388876		2203	4300	6503	SO:0001587	stop_gained	57216				apical protein localization|heart looping|nonmotile primary cilium assembly	apical plasma membrane|integral to membrane		g.chr1:160388876A>T	AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.277A>T	1.37:g.160388876A>T	ENSP00000357040:p.Lys93*					VANGL2_uc001fwc.1_Nonsense_Mutation_p.K93*	p.K93*	NM_020335	NP_065068	Q9ULK5	VANG2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		5	576	+	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		93			Cytoplasmic (Potential).		D3DVE9|Q5T212	Nonsense_Mutation	SNP	ENST00000368061.2	37	c.277A>T	CCDS30915.1	.	.	.	.	.	.	.	.	.	.	A	42	9.217600	0.99103	.	.	ENSG00000162738	ENST00000368061	.	.	.	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.656	13.025	0.58810	1.0:0.0:0.0:0.0	.	.	.	.	X	93	.	ENSP00000357040:K93X	K	+	1	0	VANGL2	158655500	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.835000	0.92100	1.812000	0.52913	0.460000	0.39030	AAG		0.612	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080677.1	NM_020335		6	124	0	0	0	0.001168	0	6	124				
ASTN1	460	broad.mit.edu	37	1	176863929	176863929	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:176863929T>A	ENST00000367654.3	-	17	2944	c.2733A>T	c.(2731-2733)agA>agT	p.R911S	ASTN1_ENST00000424564.2_Missense_Mutation_p.R903S|ASTN1_ENST00000367657.3_Missense_Mutation_p.R903S|ASTN1_ENST00000361833.2_Missense_Mutation_p.R903S	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	911					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.R903S(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CCTTGGGGTCTCTTTCCCGCT	0.522																																							uc001glc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(2707-2709)AGA>AGT		astrotactin isoform 1							117.0	117.0	117.0					1																	176863929		2203	4300	6503	SO:0001583	missense	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:176863929T>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2733A>T	1.37:g.176863929T>A	ENSP00000356626:p.Arg911Ser					ASTN1_uc001glb.1_Missense_Mutation_p.R903S|ASTN1_uc001gld.1_Missense_Mutation_p.R903S	p.R903S	NM_004319	NP_004310	O14525	ASTN1_HUMAN			17	2921	-			911					A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37	c.2709A>T		.	.	.	.	.	.	.	.	.	.	T	11.16	1.558205	0.27827	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.14391	2.51;2.93;2.93;2.51	5.26	0.218	0.15270	.	0.044666	0.85682	D	0.000000	T	0.06371	0.0164	L	0.29908	0.895	0.48901	D	0.999721	P;P	0.36535	0.557;0.557	B;B	0.31101	0.124;0.124	T	0.41805	-0.9488	10	0.14656	T	0.56	-21.5527	5.8163	0.18494	0.0:0.3017:0.1377:0.5607	.	903;903	O14525-2;B1AJS1	.;.	S	903;903;911;903;903	ENSP00000356629:R903S;ENSP00000354536:R903S;ENSP00000356626:R911S;ENSP00000395041:R903S	ENSP00000354536:R903S	R	-	3	2	ASTN1	175130552	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	0.408000	0.21065	0.431000	0.26258	0.533000	0.62120	AGA		0.522	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		41	158	0	0	0	0.00361	0	41	158				
TPR	7175	broad.mit.edu	37	1	186286693	186286693	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:186286693C>G	ENST00000367478.4	-	49	7157	c.6861G>C	c.(6859-6861)caG>caC	p.Q2287H		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	2287					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)	p.Q2274H(1)|p.Q2287H(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GCTCTTCTTCCTGCTGGCTAT	0.438			T	NTRK1	papillary thyroid																																		uc001grv.2		NA		Dom	yes		1	1q25	7175	T	translocated promoter region			E	NTRK1		papillary thyroid		2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7						c.(6859-6861)CAG>CAC		nuclear pore complex-associated protein TPR							83.0	80.0	81.0					1																	186286693		1872	4108	5980	SO:0001583	missense	7175				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity	g.chr1:186286693C>G	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.6861G>C	1.37:g.186286693C>G	ENSP00000356448:p.Gln2287His						p.Q2287H	NM_003292	NP_003283	P12270	TPR_HUMAN		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)	49	7158	-		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)	2287					Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	c.6861G>C	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	C	17.97	3.518233	0.64634	.	.	ENSG00000047410	ENST00000367478	T	0.23348	1.91	5.75	2.55	0.30701	.	0.129914	0.52532	D	0.000063	T	0.14270	0.0345	L	0.27053	0.805	0.30626	N	0.75795	B	0.02656	0.0	B	0.01281	0.0	T	0.07214	-1.0784	10	0.28530	T	0.3	.	5.6126	0.17414	0.0:0.5929:0.1499:0.2572	.	2287	P12270	TPR_HUMAN	H	2287	ENSP00000356448:Q2287H	ENSP00000356448:Q2287H	Q	-	3	2	TPR	184553316	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.172000	0.31908	1.352000	0.45808	0.655000	0.94253	CAG		0.438	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292		13	59	0	0	0	0.00245	0	13	59				
CFHR2	3080	broad.mit.edu	37	1	196928191	196928191	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:196928191C>A	ENST00000367415.5	+	5	894	c.794C>A	c.(793-795)cCc>cAc	p.P265H	CFHR2_ENST00000496448.1_3'UTR|CFHR2_ENST00000367421.3_Missense_Mutation_p.P265H|CFHR2_ENST00000476712.2_Missense_Mutation_p.P249H	NM_005666.2	NP_005657.1	P36980	FHR2_HUMAN	complement factor H-related 2	265	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)		p.P265H(1)		large_intestine(2)|ovary(1)|skin(3)	6						CTGGTATATCCCAGTTGTGAA	0.303																																							uc001gtq.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(793-795)CCC>CAC		H factor (complement)-like 3 precursor							42.0	44.0	43.0					1																	196928191		2203	4296	6499	SO:0001583	missense	3080					extracellular region		g.chr1:196928191C>A	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367415.5:c.794C>A	1.37:g.196928191C>A	ENSP00000356385:p.Pro265His					CFHR2_uc001gtr.1_Missense_Mutation_p.P141H	p.P265H	NM_005666	NP_005657	P36980	FHR2_HUMAN			5	871	+			265			Sushi 4.		Q14310|Q5T9T1	Missense_Mutation	SNP	ENST00000367415.5	37	c.794C>A	CCDS30959.1	.	.	.	.	.	.	.	.	.	.	.	13.97	2.395984	0.42512	.	.	ENSG00000080910	ENST00000367421;ENST00000367415	D;D	0.94497	-3.44;-3.44	3.52	3.52	0.40303	Complement control module (2);Sushi/SCR/CCP (1);	.	.	.	.	D	0.97012	0.9024	M	0.85945	2.785	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.90701	0.4620	9	0.87932	D	0	.	10.4176	0.44331	0.0:1.0:0.0:0.0	.	238;265	P36980-2;P36980	.;FHR2_HUMAN	H	265	ENSP00000356391:P265H;ENSP00000356385:P265H	ENSP00000356385:P265H	P	+	2	0	CFHR2	195194814	0.892000	0.30473	0.045000	0.18777	0.014000	0.08584	1.956000	0.40382	1.782000	0.52362	0.543000	0.68304	CCC		0.303	CFHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088815.2	NM_005666		10	53	1	0	3.07112e-06	0.000978	4.11193e-06	10	53				
LRRN2	10446	broad.mit.edu	37	1	204588512	204588512	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:204588512G>T	ENST00000367175.1	-	1	2821	c.609C>A	c.(607-609)gcC>gcA	p.A203A	RP11-430C7.4_ENST00000453895.1_RNA|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367177.3_Silent_p.A203A|LRRN2_ENST00000367176.3_Silent_p.A203A			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	203					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.A203A(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			TGTCCAGGATGGCATCTACCT	0.582																																							uc001hbe.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)	2						c.(607-609)GCC>GCA		leucine rich repeat neuronal 2 precursor							55.0	56.0	55.0					1																	204588512		2203	4300	6503	SO:0001819	synonymous_variant	10446				cell adhesion	integral to membrane	receptor activity	g.chr1:204588512G>T	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.609C>A	1.37:g.204588512G>T						MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Silent_p.A203A|LRRN2_uc009xbf.1_Silent_p.A203A|MDM4_uc001hbc.2_Intron	p.A203A	NM_006338	NP_006329	O75325	LRRN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)		3	997	-	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		203			Extracellular (Potential).|LRR 6.		B2R624|Q5T0Y0|Q6UXM0|Q8N182	Silent	SNP	ENST00000367175.1	37	c.609C>A	CCDS1448.1																																																																																				0.582	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338		17	63	1	0	2.48551e-13	0.00499	3.9278e-13	17	63				
MARK1	4139	broad.mit.edu	37	1	220752872	220752872	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:220752872G>T	ENST00000366917.4	+	2	494	c.228G>T	c.(226-228)ttG>ttT	p.L76F	MARK1_ENST00000402574.1_5'UTR|MARK1_ENST00000366918.4_Missense_Mutation_p.L76F					MAP/microtubule affinity-regulating kinase 1									p.L76F(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		AAGTCAAATTGGCAAGACACG	0.408																																							uc001hmn.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10						c.(226-228)TTG>TTT		MAP/microtubule affinity-regulating kinase 1							88.0	83.0	85.0					1																	220752872		2203	4300	6503	SO:0001583	missense	4139				intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr1:220752872G>T	AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.228G>T	1.37:g.220752872G>T	ENSP00000355884:p.Leu76Phe					MARK1_uc001hml.2_Missense_Mutation_p.L76F|MARK1_uc009xdw.2_Missense_Mutation_p.L76F|MARK1_uc010pun.1_Missense_Mutation_p.L76F|MARK1_uc001hmm.3_Missense_Mutation_p.L76F	p.L76F	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN		GBM - Glioblastoma multiforme(131;0.0407)	2	825	+			76			Protein kinase.			Missense_Mutation	SNP	ENST00000366917.4	37	c.228G>T	CCDS31029.2	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248528	0.80024	.	.	ENSG00000116141	ENST00000366918;ENST00000366917	T;T	0.29397	1.57;1.57	5.76	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.60586	0.2280	M	0.91459	3.21	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.998	T	0.67158	-0.5741	10	0.87932	D	0	.	9.9505	0.41636	0.0715:0.0:0.7889:0.1396	.	76;76;76	B4DIB3;Q9P0L2;Q9P0L2-3	.;MARK1_HUMAN;.	F	76	ENSP00000355885:L76F;ENSP00000355884:L76F	ENSP00000355884:L76F	L	+	3	2	MARK1	218819495	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.254000	0.51477	2.715000	0.92844	0.563000	0.77884	TTG		0.408	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1			12	68	1	0	1.49906e-05	0.00245	1.92884e-05	12	68				
OBSCN	84033	broad.mit.edu	37	1	228471364	228471364	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:228471364G>T	ENST00000422127.1	+	33	8942	c.8898G>T	c.(8896-8898)gaG>gaT	p.E2966D	OBSCN_ENST00000570156.2_Missense_Mutation_p.E3395D|OBSCN_ENST00000359599.6_Missense_Mutation_p.E1813D|OBSCN_ENST00000366707.4_Missense_Mutation_p.E85D|OBSCN_ENST00000366709.4_Missense_Mutation_p.E85D|OBSCN_ENST00000284548.11_Missense_Mutation_p.E2966D	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2966	Ig-like 29.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.E3020D(1)|p.E3150D(1)|p.E3249D(1)|p.E2966D(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCAGCCAGGAGGGCCTGACCC	0.667																																							uc009xez.1		NA																	4	Substitution - Missense(4)		lung(4)	stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(8896-8898)GAG>GAT		obscurin, cytoskeletal calmodulin and							33.0	41.0	38.0					1																	228471364		2133	4238	6371	SO:0001583	missense	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228471364G>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.8898G>T	1.37:g.228471364G>T	ENSP00000409493:p.Glu2966Asp					OBSCN_uc001hsn.2_Missense_Mutation_p.E2966D|OBSCN_uc001hsp.1_Missense_Mutation_p.E665D|OBSCN_uc001hsq.1_Missense_Mutation_p.E222D	p.E2966D	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN			33	8942	+		Prostate(94;0.0405)	2966			Ig-like 29.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	c.8898G>T	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	g	13.49	2.252560	0.39797	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599;ENST00000366706;ENST00000366704	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.67	-1.9	0.07665	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.321128	0.28821	N	0.014023	T	0.35451	0.0932	N	0.05534	-0.03	0.25443	N	0.98808	B;B;B	0.16802	0.015;0.001;0.019	B;B;B	0.24155	0.022;0.003;0.051	T	0.16100	-1.0414	10	0.17832	T	0.49	.	3.8297	0.08868	0.2693:0.1917:0.4438:0.0952	.	2966;2966;2966	Q5VST9;Q5VST9-2;Q5VST9-3	OBSCN_HUMAN;.;.	D	2966;2966;85;85;1813;665;372	ENSP00000284548:E2966D;ENSP00000409493:E2966D;ENSP00000355668:E85D;ENSP00000355670:E85D;ENSP00000352613:E1813D	ENSP00000284548:E2966D	E	+	3	2	OBSCN	226537987	0.552000	0.26505	0.803000	0.32268	0.111000	0.19643	-0.305000	0.08188	-0.467000	0.06932	-1.469000	0.01011	GAG		0.667	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		20	39	1	0	8.00594e-06	0.007413	1.05678e-05	20	39				
DISC1	27185	broad.mit.edu	37	1	232172460	232172460	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:232172460G>A	ENST00000439617.2	+	13	2501	c.2448G>A	c.(2446-2448)caG>caA	p.Q816Q	DISC1_ENST00000366637.3_Silent_p.Q126Q	NM_001164537.1|NM_001164540.1|NM_018662.2	NP_001158009.1|NP_001158012.1|NP_061132.2	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	816	Interaction with ATF4 and ATF5.|Interaction with NDEL1.|Interaction with PAFAH1B1.|Necessary and sufficient for interaction with PCNT and localization at the centrosome.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)		p.Q848H(1)|p.Q848Q(1)		breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				GGGAGCTCCAGATGGTGAAGG	0.582																																							uc001huz.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	skin(1)	1						c.(2446-2448)CAG>CAA		disrupted in schizophrenia 1 isoform L							33.0	37.0	36.0					1																	232172460		2000	4170	6170	SO:0001819	synonymous_variant	27185				microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding	g.chr1:232172460G>A	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000439617.2:c.2448G>A	1.37:g.232172460G>A						DISC1_uc001hva.2_Silent_p.Q794Q	p.Q816Q	NM_018662	NP_061132	Q9NRI5	DISC1_HUMAN			13	2501	+		all_cancers(173;0.0208)|Prostate(94;0.0975)	816			Necessary and sufficient for interaction with PCNT and localization at the centrosome.|Interaction with NDEL1.|Interaction with ATF4 and ATF5.|Interaction with PAFAH1B1.|Potential.		A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Silent	SNP	ENST00000439617.2	37	c.2448G>A																																																																																					0.582	DISC1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000092351.2	NM_018662		3	18	0	0	0	0.004672	0	3	18				
PCNXL2	80003	broad.mit.edu	37	1	233394396	233394396	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:233394396G>A	ENST00000258229.9	-	5	1446	c.1212C>T	c.(1210-1212)acC>acT	p.T404T	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	404						integral component of membrane (GO:0016021)		p.T404T(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				ACTTTACACTGGTCTTCTCTG	0.527																																							uc001hvl.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|pancreas(1)	2						c.(1210-1212)ACC>ACT		pecanex-like 2							74.0	76.0	76.0					1																	233394396		1922	4132	6054	SO:0001819	synonymous_variant	80003					integral to membrane		g.chr1:233394396G>A	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.1212C>T	1.37:g.233394396G>A						PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA	p.T404T	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN			5	1447	-		all_cancers(173;0.0347)|Prostate(94;0.137)	404					O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Silent	SNP	ENST00000258229.9	37	c.1212C>T	CCDS44335.1																																																																																				0.527	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801		7	130	0	0	0	0.001984	0	7	130				
LYST	1130	broad.mit.edu	37	1	235860531	235860531	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:235860531G>A	ENST00000389794.3	-	46	10590	c.10416C>T	c.(10414-10416)taC>taT	p.Y3472Y	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Silent_p.Y3472Y			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3472					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.Y3472Y(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GGGAACCCACGTATTCCCCCC	0.463																																							uc001hxj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|breast(4)|central_nervous_system(2)	12						c.(10414-10416)TAC>TAT		lysosomal trafficking regulator							57.0	62.0	60.0					1																	235860531		2203	4300	6503	SO:0001819	synonymous_variant	1130	Chediak-Higashsyndrome			defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding	g.chr1:235860531G>A	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.10416C>T	1.37:g.235860531G>A						LYST_uc001hxi.2_Silent_p.Y696Y	p.Y3472Y	NM_000081	NP_000072	Q99698	LYST_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000674)		46	10591	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	3472					O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	37	c.10416C>T	CCDS31062.1																																																																																				0.463	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			7	49	0	0	0	0.001984	0	7	49				
NID1	4811	broad.mit.edu	37	1	236201523	236201523	+	Missense_Mutation	SNP	G	G	A	rs142155830	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:236201523G>A	ENST00000264187.6	-	5	1248	c.1166C>T	c.(1165-1167)aCg>aTg	p.T389M	NID1_ENST00000366595.3_Missense_Mutation_p.T389M	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	389	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)	p.T389M(1)		breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GTTAGCACACGTCTGGCGGGA	0.552													G|||	3	0.000599042	0.0	0.0	5008	,	,		20006	0.0		0.0	False		,,,				2504	0.0031						uc001hxo.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|pancreas(1)	2						c.(1165-1167)ACG>ATG		nidogen 1 precursor	Becaplermin(DB00102)|Urokinase(DB00013)	G	MET/THR	0,4406		0,0,2203	117.0	111.0	113.0		1166	5.4	1.0	1	dbSNP_134	113	4,8596	3.7+/-12.6	0,4,4296	yes	missense	NID1	NM_002508.2	81	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	probably-damaging	389/1248	236201523	4,13002	2203	4300	6503	SO:0001583	missense	4811				cell-matrix adhesion	basement membrane	calcium ion binding	g.chr1:236201523G>A	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.1166C>T	1.37:g.236201523G>A	ENSP00000264187:p.Thr389Met					NID1_uc009xgd.2_Missense_Mutation_p.T389M	p.T389M	NM_002508	NP_002499	P14543	NID1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		5	1268	-	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	389			EGF-like 1.		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	ENST00000264187.6	37	c.1166C>T	CCDS1608.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495318	0.85069	0.0	4.65E-4	ENSG00000116962	ENST00000264187;ENST00000366595	D;D	0.87809	-2.3;-2.3	5.4	5.4	0.78164	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.92731	0.7689	M	0.63428	1.95	0.47276	D	0.999373	D;D	0.89917	1.0;0.989	D;P	0.76575	0.988;0.711	D	0.93216	0.6604	10	0.87932	D	0	.	19.1797	0.93617	0.0:0.0:1.0:0.0	.	389;389	P14543-2;P14543	.;NID1_HUMAN	M	389	ENSP00000264187:T389M;ENSP00000355554:T389M	ENSP00000264187:T389M	T	-	2	0	NID1	234268146	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.421000	0.73353	2.537000	0.85549	0.650000	0.86243	ACG		0.552	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508		5	109	0	0	0	0.000602	0	5	109				
RYR2	6262	broad.mit.edu	37	1	237551440	237551440	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:237551440T>A	ENST00000366574.2	+	10	1047	c.730T>A	c.(730-732)Tgt>Agt	p.C244S	RYR2_ENST00000542537.1_Missense_Mutation_p.C228S|RYR2_ENST00000360064.6_Missense_Mutation_p.C242S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	244	MIR 3. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.C242S(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CATGGACGAGTGTCTCACTGT	0.473																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(730-732)TGT>AGT		cardiac muscle ryanodine receptor							116.0	114.0	115.0					1																	237551440		2061	4208	6269	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237551440T>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.730T>A	1.37:g.237551440T>A	ENSP00000355533:p.Cys244Ser						p.C244S	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		10	850	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	244			Cytoplasmic (By similarity).|MIR 3.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.730T>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	19.07	3.755405	0.69648	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.86956	-2.19;-2.19;-2.19	5.34	5.34	0.76211	MIR motif (2);MIR (2);	0.000000	0.64402	D	0.000002	D	0.85492	0.5709	M	0.64567	1.98	0.80722	D	1	P	0.40360	0.714	B	0.39805	0.31	D	0.85729	0.1330	10	0.46703	T	0.11	.	12.8336	0.57761	0.0:0.0:0.0:1.0	.	244	Q92736	RYR2_HUMAN	S	244;242;228	ENSP00000355533:C244S;ENSP00000353174:C242S;ENSP00000443798:C228S	ENSP00000353174:C242S	C	+	1	0	RYR2	235618063	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.860000	0.75473	2.025000	0.59659	0.533000	0.62120	TGT		0.473	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		11	33	0	0	0	0.008291	0	11	33				
GREM2	64388	broad.mit.edu	37	1	240656352	240656352	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:240656352G>T	ENST00000318160.4	-	2	690	c.424C>A	c.(424-426)Cca>Aca	p.P142T		NM_022469.3	NP_071914.3	Q9H772	GREM2_HUMAN	gremlin 2, DAN family BMP antagonist	142	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				BMP signaling pathway (GO:0030509)|cytokine-mediated signaling pathway (GO:0019221)|determination of dorsal identity (GO:0048263)|embryonic body morphogenesis (GO:0010172)|regulation of cytokine activity (GO:0060300)|sequestering of BMP from receptor via BMP binding (GO:0038098)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	heparin binding (GO:0008201)	p.P142T(1)		endometrium(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	10		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			CGGAAGGGTGGGTCCAGGCCG	0.642																																							uc001hys.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(424-426)CCA>ACA		gremlin 2 precursor							55.0	59.0	58.0					1																	240656352		2203	4300	6503	SO:0001583	missense	64388				BMP signaling pathway	extracellular space	cytokine activity	g.chr1:240656352G>T	AK024848	CCDS31070.1	1q43	2013-02-26	2013-02-26		ENSG00000180875	ENSG00000180875			17655	protein-coding gene	gene with protein product	"""protein related to DAN and cerberus"""	608832	"""gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 2"""			15039429	Standard	XM_005273226		Approved	Prdc, FLJ21195, CKTSF1B2, DAND3	uc001hys.3	Q9H772	OTTHUMG00000039909	ENST00000318160.4:c.424C>A	1.37:g.240656352G>T	ENSP00000318650:p.Pro142Thr						p.P142T	NM_022469	NP_071914	Q9H772	GREM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0123)		2	704	-		all_cancers(173;0.0196)	142			CTCK.		Q86UD9	Missense_Mutation	SNP	ENST00000318160.4	37	c.424C>A	CCDS31070.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.859920	0.91433	.	.	ENSG00000180875	ENST00000318160	T	0.29917	1.55	4.97	4.97	0.65823	DAN (1);Cystine knot, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.57417	0.2052	M	0.78049	2.395	0.80722	D	1	P	0.50943	0.94	D	0.64687	0.928	T	0.62215	-0.6901	10	0.62326	D	0.03	-24.2199	18.2256	0.89916	0.0:0.0:1.0:0.0	.	142	Q9H772	GREM2_HUMAN	T	142	ENSP00000318650:P142T	ENSP00000318650:P142T	P	-	1	0	GREM2	238722975	1.000000	0.71417	0.961000	0.40146	0.994000	0.84299	7.874000	0.87199	2.290000	0.77057	0.557000	0.71058	CCA		0.642	GREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096286.1	NM_022469		23	81	1	0	1.33986e-20	0.004656	2.30571e-20	23	81				
PLD5	200150	broad.mit.edu	37	1	242383324	242383324	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:242383324C>A	ENST00000536534.2	-	5	942	c.701G>T	c.(700-702)gGc>gTc	p.G234V	PLD5_ENST00000442594.2_Missense_Mutation_p.G142V|PLD5_ENST00000427495.1_Missense_Mutation_p.G172V			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	234	PLD phosphodiesterase 1.					integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.G142V(1)|p.G234V(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			ACCGGCACTGCCGATATACAC	0.517																																							uc001hzn.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)	6						c.(700-702)GGC>GTC		RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							122.0	104.0	110.0					1																	242383324		2203	4300	6503	SO:0001583	missense	200150					integral to membrane	catalytic activity	g.chr1:242383324C>A	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.701G>T	1.37:g.242383324C>A	ENSP00000440896:p.Gly234Val					PLD5_uc001hzl.3_Missense_Mutation_p.G172V|PLD5_uc001hzm.3_Missense_Mutation_p.G24V|PLD5_uc001hzo.1_Missense_Mutation_p.G142V	p.G234V			Q8N7P1	PLD5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0329)		5	828	-	Melanoma(84;0.242)		234			PLD phosphodiesterase 1.		A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	37	c.701G>T	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	C	24.5	4.540330	0.85917	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.53640	0.61;0.61;0.61	5.58	5.58	0.84498	Phospholipase D/Transphosphatidylase (1);	0.000000	0.85682	D	0.000000	T	0.76062	0.3935	H	0.94264	3.515	0.80722	D	1	D;D;D	0.69078	0.997;0.995;0.997	D;P;D	0.67231	0.95;0.892;0.916	T	0.82874	-0.0241	10	0.87932	D	0	-12.8691	15.0715	0.72040	0.0:1.0:0.0:0.0	.	142;234;172	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	V	172;142;234	ENSP00000401285:G172V;ENSP00000414188:G142V;ENSP00000440896:G234V	ENSP00000401285:G172V	G	-	2	0	PLD5	240449947	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.510000	0.73729	2.626000	0.88956	0.655000	0.94253	GGC		0.517	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666		10	56	1	0	3.86212e-05	0.008291	4.79347e-05	10	56				
PLD5	200150	broad.mit.edu	37	1	242383405	242383405	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:242383405G>A	ENST00000536534.2	-	5	861	c.620C>T	c.(619-621)aCg>aTg	p.T207M	PLD5_ENST00000442594.2_Missense_Mutation_p.T115M|PLD5_ENST00000427495.1_Missense_Mutation_p.T145M			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	207						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.T115M(3)|p.T207M(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			GTTCATGTACGTCACCTCGGC	0.557																																							uc001hzn.1		NA																	4	Substitution - Missense(4)	p.T115M(1)	lung(2)|ovary(1)|large_intestine(1)	ovary(6)	6						c.(619-621)ACG>ATG		RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							131.0	118.0	123.0					1																	242383405		2203	4300	6503	SO:0001583	missense	200150					integral to membrane	catalytic activity	g.chr1:242383405G>A	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.620C>T	1.37:g.242383405G>A	ENSP00000440896:p.Thr207Met					PLD5_uc001hzl.3_Missense_Mutation_p.T145M|PLD5_uc001hzm.3_Translation_Start_Site|PLD5_uc001hzo.1_Missense_Mutation_p.T115M	p.T207M			Q8N7P1	PLD5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0329)		5	747	-	Melanoma(84;0.242)		207					A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	37	c.620C>T	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	G	13.40	2.226328	0.39300	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.13778	2.56;2.56;2.56	5.52	4.6	0.57074	.	0.238118	0.43747	D	0.000527	T	0.07548	0.0190	N	0.17474	0.49	0.33978	D	0.647606	B;B;B	0.33694	0.421;0.297;0.421	B;B;B	0.21360	0.034;0.015;0.023	T	0.14420	-1.0473	10	0.54805	T	0.06	-20.8238	10.7734	0.46336	0.0909:0.0:0.9091:0.0	.	115;207;145	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	M	145;115;207	ENSP00000401285:T145M;ENSP00000414188:T115M;ENSP00000440896:T207M	ENSP00000401285:T145M	T	-	2	0	PLD5	240450028	0.983000	0.35010	0.999000	0.59377	0.995000	0.86356	1.828000	0.39111	2.591000	0.87537	0.655000	0.94253	ACG		0.557	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666		18	54	0	0	0	0.00499	0	18	54				
PLD5	200150	broad.mit.edu	37	1	242428646	242428646	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:242428646T>A	ENST00000536534.2	-	4	841	c.600A>T	c.(598-600)aaA>aaT	p.K200N	PLD5_ENST00000474177.1_5'UTR|PLD5_ENST00000442594.2_Missense_Mutation_p.K108N|PLD5_ENST00000427495.1_Missense_Mutation_p.K138N			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	200						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.K200N(1)|p.K108N(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TACCCTTTAATTTCAAGGCTT	0.333																																							uc001hzn.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)	6						c.(598-600)AAA>AAT		RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							52.0	52.0	52.0					1																	242428646		2203	4300	6503	SO:0001583	missense	200150					integral to membrane	catalytic activity	g.chr1:242428646T>A	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.600A>T	1.37:g.242428646T>A	ENSP00000440896:p.Lys200Asn					PLD5_uc001hzl.3_Missense_Mutation_p.K138N|PLD5_uc001hzm.3_5'UTR|PLD5_uc001hzo.1_Missense_Mutation_p.K108N	p.K200N			Q8N7P1	PLD5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0329)		4	727	-	Melanoma(84;0.242)		200					A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	37	c.600A>T	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	T	12.60	1.985336	0.35036	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534;ENST00000459864	T;T;T;T	0.50548	2.5;2.5;2.5;0.74	5.55	3.25	0.37280	.	0.242918	0.41938	D	0.000789	T	0.31638	0.0803	L	0.35644	1.08	0.27865	N	0.940233	P;P;P	0.44195	0.589;0.828;0.589	B;B;B	0.39027	0.288;0.236;0.288	T	0.11251	-1.0595	10	0.23302	T	0.38	-9.3265	7.1046	0.25356	0.0:0.1828:0.0:0.8172	.	108;200;138	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	N	138;108;200;138	ENSP00000401285:K138N;ENSP00000414188:K108N;ENSP00000440896:K200N;ENSP00000438191:K138N	ENSP00000401285:K138N	K	-	3	2	PLD5	240495269	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.410000	0.44592	1.054000	0.40438	0.533000	0.62120	AAA		0.333	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666		8	104	0	0	0	0.006214	0	8	104				
KIF26B	55083	broad.mit.edu	37	1	245850143	245850143	+	Missense_Mutation	SNP	C	C	A	rs199903097		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:245850143C>A	ENST00000407071.2	+	12	4298	c.3858C>A	c.(3856-3858)agC>agA	p.S1286R	KIF26B_ENST00000366518.4_Missense_Mutation_p.S905R	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1286					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.S1286R(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GCGAGATGAGCGCGGGCAGTG	0.602																																							uc001ibf.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(3856-3858)AGC>AGA		kinesin family member 26B							36.0	42.0	40.0					1																	245850143		2130	4226	6356	SO:0001583	missense	55083				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr1:245850143C>A	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.3858C>A	1.37:g.245850143C>A	ENSP00000385545:p.Ser1286Arg					KIF26B_uc001ibg.1_Missense_Mutation_p.S904R|KIF26B_uc001ibh.1_Missense_Mutation_p.S528R	p.S1286R	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.022)		12	4298	+	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		1286					Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	c.3858C>A	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474259	0.26423	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.86030	-2.06;-2.05	5.92	5.01	0.66863	.	.	.	.	.	D	0.92974	0.7764	M	0.82630	2.6	0.51482	D	0.99992	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.98	D	0.93388	0.6749	9	0.87932	D	0	.	18.2727	0.90073	0.0:0.9369:0.0:0.0631	.	905;1286	B7WPD9;Q2KJY2	.;KI26B_HUMAN	R	1286;905;902	ENSP00000385545:S1286R;ENSP00000355475:S905R	ENSP00000355475:S905R	S	+	3	2	KIF26B	243916766	0.997000	0.39634	0.970000	0.41538	0.361000	0.29550	3.249000	0.51437	0.859000	0.35456	-1.134000	0.01955	AGC		0.602	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354		4	23	1	0	3.59834e-05	0.001168	4.51603e-05	4	23				
SCCPDH	51097	broad.mit.edu	37	1	246927551	246927551	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:246927551G>A	ENST00000366510.3	+	10	1370	c.994G>A	c.(994-996)Gat>Aat	p.D332N		NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)	332						lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)	p.D332Y(1)|p.D332N(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		TTCACAGATTGATGCTGCCTC	0.403																																							uc001ibr.2		NA																	2	Substitution - Missense(2)		lung(1)|kidney(1)	ovary(1)	1						c.(994-996)GAT>AAT		saccharopine dehydrogenase (putative)							123.0	111.0	115.0					1																	246927551		2203	4300	6503	SO:0001583	missense	51097					midbody	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity	g.chr1:246927551G>A		CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.994G>A	1.37:g.246927551G>A	ENSP00000355467:p.Asp332Asn						p.D332N	NM_016002	NP_057086	Q8NBX0	SCPDH_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)	10	1341	+	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	332					Q8TAR0|Q9Y363	Missense_Mutation	SNP	ENST00000366510.3	37	c.994G>A	CCDS31084.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278040	0.59758	.	.	ENSG00000143653	ENST00000366510;ENST00000366509	T	0.52983	0.64	5.79	5.79	0.91817	.	0.134853	0.64402	D	0.000002	T	0.56587	0.1995	L	0.51853	1.615	0.80722	D	1	P	0.35050	0.482	P	0.47346	0.544	T	0.44034	-0.9354	10	0.23891	T	0.37	.	19.6515	0.95815	0.0:0.0:1.0:0.0	.	332	Q8NBX0	SCPDL_HUMAN	N	332;144	ENSP00000355467:D332N	ENSP00000355466:D144N	D	+	1	0	SCCPDH	244994174	1.000000	0.71417	0.569000	0.28460	0.004000	0.04260	8.052000	0.89448	2.739000	0.93911	0.655000	0.94253	GAT		0.403	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096902.2	NM_016002		12	92	0	0	0	0.001368	0	12	92				
NLRP3	114548	broad.mit.edu	37	1	247588044	247588044	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:247588044C>A	ENST00000336119.3	+	3	2045	c.1299C>A	c.(1297-1299)gcC>gcA	p.A433A	NLRP3_ENST00000391828.3_Silent_p.A433A|NLRP3_ENST00000348069.2_Silent_p.A433A|NLRP3_ENST00000391827.2_Silent_p.A433A|NLRP3_ENST00000366496.2_Silent_p.A433A|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366497.2_Silent_p.A433A	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	433	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.A433A(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGAGCCTTGCCCAGACATCCA	0.602																																							uc001icr.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(1297-1299)GCC>GCA		NLR family, pyrin domain containing 3 isoform a							102.0	83.0	89.0					1																	247588044		2203	4300	6503	SO:0001819	synonymous_variant	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247588044C>A	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1299C>A	1.37:g.247588044C>A						NLRP3_uc001ics.2_Silent_p.A433A|NLRP3_uc001icu.2_Silent_p.A433A|NLRP3_uc001icw.2_Silent_p.A433A|NLRP3_uc001icv.2_Silent_p.A433A|NLRP3_uc010pyw.1_Silent_p.A431A|NLRP3_uc001ict.1_Silent_p.A431A	p.A433A	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	1437	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	433			NACHT.		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Silent	SNP	ENST00000336119.3	37	c.1299C>A	CCDS1632.1																																																																																				0.602	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		15	34	1	0	2.32078e-09	0.003163	3.44434e-09	15	34				
OR2W3	343171	broad.mit.edu	37	1	248059379	248059379	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:248059379T>A	ENST00000360358.3	+	1	491	c.491T>A	c.(490-492)cTg>cAg	p.L164Q	OR2W3_ENST00000537741.1_Missense_Mutation_p.L164Q	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L164Q(1)		breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CCTGTGACCCTGCGCTTACCC	0.642																																							uc001idp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|pancreas(1)	3						c.(490-492)CTG>CAG		olfactory receptor, family 2, subfamily W,							94.0	71.0	79.0					1																	248059379		2203	4300	6503	SO:0001583	missense	343171				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248059379T>A	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.491T>A	1.37:g.248059379T>A	ENSP00000353516:p.Leu164Gln					OR2W3_uc010pzb.1_Missense_Mutation_p.L164Q	p.L164Q	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		3	760	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		164			Extracellular (Potential).		Q6IF06|Q8NG86	Missense_Mutation	SNP	ENST00000360358.3	37	c.491T>A	CCDS31099.1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.157168	0.38119	.	.	ENSG00000238243	ENST00000537741;ENST00000360358	T;T	0.00224	8.51;8.51	5.28	5.28	0.74379	GPCR, rhodopsin-like superfamily (1);	0.270475	0.25848	N	0.027916	T	0.00468	0.0015	M	0.61703	1.905	0.09310	N	1	D	0.57571	0.98	D	0.64877	0.93	T	0.55891	-0.8069	10	0.87932	D	0	.	15.0464	0.71830	0.0:0.0:0.0:1.0	.	164	Q7Z3T1	OR2W3_HUMAN	Q	164	ENSP00000445853:L164Q;ENSP00000353516:L164Q	ENSP00000353516:L164Q	L	+	2	0	OR2W3	246126002	0.000000	0.05858	0.005000	0.12908	0.263000	0.26337	0.318000	0.19504	2.224000	0.72417	0.491000	0.48974	CTG		0.642	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		14	58	0	0	0	0.003163	0	14	58				
OR2M4	26245	broad.mit.edu	37	1	248402653	248402653	+	Silent	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:248402653T>C	ENST00000306687.1	+	1	423	c.423T>C	c.(421-423)tgT>tgC	p.C141C		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	141					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C141C(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CGAAACTCTGTGTCTTCATGA	0.468																																							uc010pzh.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)	2						c.(421-423)TGT>TGC		olfactory receptor, family 2, subfamily M,							162.0	136.0	145.0					1																	248402653		2203	4300	6503	SO:0001819	synonymous_variant	26245				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248402653T>C	X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.423T>C	1.37:g.248402653T>C							p.C141C	NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	423	+	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		141			Helical; Name=4; (Potential).		Q15611|Q8NG82	Silent	SNP	ENST00000306687.1	37	c.423T>C	CCDS31108.1																																																																																				0.468	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	NM_017504		18	134	0	0	0	0.006122	0	18	134				
OR2T6	254879	broad.mit.edu	37	1	248550949	248550949	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:248550949C>T	ENST00000355728.2	+	1	40	c.40C>T	c.(40-42)Ctc>Ttc	p.L14F		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L14F(1)		endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGCTTTACCCTCATGGGGCT	0.418																																							uc001iei.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(40-42)CTC>TTC		olfactory receptor, family 2, subfamily T,							121.0	120.0	120.0					1																	248550949		2203	4300	6503	SO:0001583	missense	254879				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248550949C>T	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.40C>T	1.37:g.248550949C>T	ENSP00000347965:p.Leu14Phe						p.L14F	NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	40	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		14			Extracellular (Potential).		A6NE36	Missense_Mutation	SNP	ENST00000355728.2	37	c.40C>T	CCDS31114.1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.360070	0.24598	.	.	ENSG00000198104	ENST00000355728	T	0.02369	4.32	4.9	4.9	0.64082	.	0.182499	0.26955	N	0.021653	T	0.06781	0.0173	M	0.65975	2.015	0.29958	N	0.819656	B	0.21381	0.055	B	0.29440	0.102	T	0.01657	-1.1302	10	0.52906	T	0.07	.	17.2161	0.86944	0.0:1.0:0.0:0.0	.	14	Q8NHC8	OR2T6_HUMAN	F	14	ENSP00000347965:L14F	ENSP00000347965:L14F	L	+	1	0	OR2T6	246617572	0.001000	0.12720	0.795000	0.32087	0.008000	0.06430	0.266000	0.18534	2.423000	0.82170	0.643000	0.83706	CTC		0.418	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471		50	103	0	0	0	0.00361	0	50	103				
KIN	22944	broad.mit.edu	37	10	7804421	7804421	+	Splice_Site	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:7804421T>A	ENST00000379562.4	-	11	1064	c.1017A>T	c.(1015-1017)ccA>ccT	p.P339P	KIN_ENST00000543003.1_Splice_Site_p.P233P|KIN_ENST00000535925.1_Splice_Site_p.P339P|KIN_ENST00000463666.1_5'UTR	NM_012311.3	NP_036443.1			Kin17 DNA and RNA binding protein									p.P339P(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(2)	19						CAGATTTACCTGGTGCTGGAA	0.363																																							uc001ijt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(1015-1017)CCA>CCT		HsKin17 protein							148.0	146.0	147.0					10																	7804421		2203	4300	6503	SO:0001630	splice_region_variant	22944				DNA recombination|DNA repair|DNA replication|interspecies interaction between organisms|mRNA processing	cytoplasm|nuclear matrix	double-stranded DNA binding|RNA binding|zinc ion binding	g.chr10:7804421T>A	AJ005273	CCDS7080.1	10p15-p14	2014-07-15	2014-07-15		ENSG00000151657	ENSG00000151657			6327	protein-coding gene	gene with protein product		601720	"""antigenic determinant of recA protein (mouse) homolog"", ""KIN, antigenic determinant of recA protein homolog (mouse)"""			1923796, 24140279	Standard	NM_012311		Approved	KIN17, Rts2	uc001ijt.3	O60870	OTTHUMG00000017634	ENST00000379562.4:c.1018+1A>T	10.37:g.7804421T>A						KIN_uc010qaz.1_RNA|KIN_uc009xip.2_Silent_p.P339P|KIN_uc010qba.1_Silent_p.P233P	p.P339P	NM_012311	NP_036443	O60870	KIN17_HUMAN			11	1065	-			339						Silent	SNP	ENST00000379562.4	37	c.1017A>T	CCDS7080.1																																																																																				0.363	KIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046683.2	NM_012311	Silent	12	106	0	0	0	0.001368	0	12	106				
FAM171A1	221061	broad.mit.edu	37	10	15290756	15290756	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:15290756G>T	ENST00000378116.4	-	5	642	c.636C>A	c.(634-636)agC>agA	p.S212R	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	212						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.S212R(2)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TTCCATTACTGCTCAGCAAGT	0.572																																							uc001iob.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(1)|skin(1)	4						c.(634-636)AGC>AGA		hypothetical protein LOC221061 precursor							85.0	77.0	80.0					10																	15290756		2203	4300	6503	SO:0001583	missense	221061					integral to membrane		g.chr10:15290756G>T	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.636C>A	10.37:g.15290756G>T	ENSP00000367356:p.Ser212Arg						p.S212R	NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN			5	643	-			212			Extracellular (Potential).		D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	c.636C>A	CCDS31154.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961251	0.53400	.	.	ENSG00000148468	ENST00000378116;ENST00000378114;ENST00000396781;ENST00000455654	T;T	0.33438	1.41;1.41	5.39	5.39	0.77823	.	0.145790	0.64402	D	0.000006	T	0.30510	0.0767	L	0.50333	1.59	0.36096	D	0.843826	B	0.12630	0.006	B	0.12156	0.007	T	0.19224	-1.0312	10	0.37606	T	0.19	-10.8046	15.1476	0.72671	0.0:0.0:0.8581:0.1419	.	212	Q5VUB5	F1711_HUMAN	R	212;159;213;159	ENSP00000367356:S212R;ENSP00000407796:S159R	ENSP00000367354:S159R	S	-	3	2	FAM171A1	15330762	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.171000	0.58236	2.673000	0.90976	0.563000	0.77884	AGC		0.572	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		9	56	1	0	0.000274275	0.004482	0.000324617	9	56				
ITGA8	8516	broad.mit.edu	37	10	15639265	15639265	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:15639265C>G	ENST00000378076.3	-	21	2505	c.2152G>C	c.(2152-2154)Gaa>Caa	p.E718Q	ITGA8_ENST00000477064.1_5'UTR	NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	718					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.E718Q(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						GTTACATTTTCCATCTTGTAC	0.448																																							uc001ioc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)	6						c.(2152-2154)GAA>CAA		integrin, alpha 8 precursor							177.0	155.0	162.0					10																	15639265		2203	4300	6503	SO:0001583	missense	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15639265C>G	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2152G>C	10.37:g.15639265C>G	ENSP00000367316:p.Glu718Gln					ITGA8_uc010qcb.1_Missense_Mutation_p.E703Q	p.E718Q	NM_003638	NP_003629	P53708	ITA8_HUMAN			21	2152	-			718			Extracellular (Potential).		B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	c.2152G>C	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325029	0.81580	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.54675	0.56	5.71	5.71	0.89125	Integrin alpha-2 (1);	0.332419	0.35291	N	0.003311	T	0.67268	0.2875	M	0.74467	2.265	0.52501	D	0.999956	P;P	0.44006	0.789;0.824	P;P	0.51945	0.558;0.685	T	0.61950	-0.6957	10	0.26408	T	0.33	.	19.8579	0.96771	0.0:1.0:0.0:0.0	.	703;718	F5H818;P53708	.;ITA8_HUMAN	Q	718;703	ENSP00000367316:E718Q	ENSP00000367316:E718Q	E	-	1	0	ITGA8	15679271	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.089000	0.57685	2.687000	0.91594	0.655000	0.94253	GAA		0.448	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		6	106	0	0	0	0.001984	0	6	106				
ST8SIA6	338596	broad.mit.edu	37	10	17362912	17362912	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:17362912G>C	ENST00000377602.4	-	8	1236	c.1162C>G	c.(1162-1164)Ctc>Gtc	p.L388V		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	388					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)	p.L388V(1)		endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						TGCAGTTTGAGGATTCCTTTC	0.363																																							uc001ipd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1162-1164)CTC>GTC		ST8 alpha-N-acetyl-neuraminide							217.0	205.0	209.0					10																	17362912		2203	4300	6503	SO:0001583	missense	338596				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity	g.chr10:17362912G>C		CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.1162C>G	10.37:g.17362912G>C	ENSP00000366827:p.Leu388Val					ST8SIA6_uc010qce.1_RNA	p.L388V	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN			8	1162	-			388			Lumenal (Potential).		B0YJ97|B9EH72|Q5VZH4	Missense_Mutation	SNP	ENST00000377602.4	37	c.1162C>G	CCDS31158.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.752586	0.31046	.	.	ENSG00000148488	ENST00000377602	T	0.31247	1.5	5.5	3.55	0.40652	.	0.183689	0.45867	D	0.000329	T	0.24198	0.0586	L	0.46947	1.48	0.43385	D	0.995492	B	0.27166	0.17	B	0.26310	0.068	T	0.07908	-1.0748	10	0.45353	T	0.12	-12.8727	6.6815	0.23123	0.0749:0.1301:0.6607:0.1343	.	388	P61647	SIA8F_HUMAN	V	388	ENSP00000366827:L388V	ENSP00000366827:L388V	L	-	1	0	ST8SIA6	17402918	0.735000	0.28153	0.997000	0.53966	0.922000	0.55478	0.818000	0.27295	1.523000	0.49018	0.650000	0.86243	CTC		0.363	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	NM_001004470		22	271	0	0	0	0.00278	0	22	271				
NSUN6	221078	broad.mit.edu	37	10	18940128	18940128	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:18940128G>C	ENST00000377304.4	-	1	423	c.5C>G	c.(4-6)tCt>tGt	p.S2C	RP11-139J15.7_ENST00000606425.1_Intron	NM_182543.2	NP_872349.1	Q8TEA1	NSUN6_HUMAN	NOP2/Sun domain family, member 6	2							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.S2C(1)		endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15						AGGGAAAATAGACATTTTTCC	0.343																																							uc010qcp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(4-6)TCT>TGT		NOL1/NOP2/Sun domain family, member 6							83.0	84.0	83.0					10																	18940128		2202	4300	6502	SO:0001583	missense	221078						methyltransferase activity|RNA binding	g.chr10:18940128G>C	BC035778	CCDS7130.1	10p13	2014-06-23	2009-11-23	2004-08-26	ENSG00000241058	ENSG00000241058		"""NOP2/Sun domain containing"""	23529	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 6"", ""NOL1/NOP2/Sun domain family, member 6"", ""ARL5B antisense RNA 1"""	NOPD1, ARL5B-AS1			Standard	XM_005252394		Approved	FLJ23743	uc010qcp.1	Q8TEA1	OTTHUMG00000017767	ENST00000377304.4:c.5C>G	10.37:g.18940128G>C	ENSP00000366519:p.Ser2Cys						p.S2C	NM_182543	NP_872349	Q8TEA1	NSUN6_HUMAN			1	423	-			2					B0YJ54	Missense_Mutation	SNP	ENST00000377304.4	37	c.5C>G	CCDS7130.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517704	0.64634	.	.	ENSG00000241058	ENST00000377304	T	0.33654	1.4	5.32	3.41	0.39046	.	0.468932	0.26140	N	0.026112	T	0.38585	0.1046	M	0.62723	1.935	0.09310	N	0.999999	P	0.51791	0.948	P	0.46362	0.514	T	0.27673	-1.0067	10	0.62326	D	0.03	.	8.9016	0.35499	0.0792:0.0:0.7672:0.1536	.	2	Q8TEA1	NSUN6_HUMAN	C	2	ENSP00000366519:S2C	ENSP00000366519:S2C	S	-	2	0	NSUN6	18980134	0.975000	0.34042	0.075000	0.20258	0.382000	0.30200	3.170000	0.50816	0.691000	0.31592	0.655000	0.94253	TCT		0.343	NSUN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047083.1	NM_182543		9	102	0	0	0	0.000978	0	9	102				
SLC18A3	6572	broad.mit.edu	37	10	50820036	50820036	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:50820036A>T	ENST00000374115.3	+	1	1690	c.1250A>T	c.(1249-1251)tAt>tTt	p.Y417F	CHAT_ENST00000339797.1_Intron|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000395562.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	417					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)	p.Y417F(1)		endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						GTCTCAGTCTATGGCAGCGTC	0.612																																							uc001jhw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1249-1251)TAT>TTT		vesicular acetylcholine transporter							46.0	39.0	42.0					10																	50820036		2203	4300	6503	SO:0001583	missense	6572				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity	g.chr10:50820036A>T	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.1250A>T	10.37:g.50820036A>T	ENSP00000363229:p.Tyr417Phe					CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank|CHAT_uc010qgs.1_5'Flank	p.Y417F	NM_003055	NP_003046	Q16572	VACHT_HUMAN			1	1690	+			417			Cytoplasmic (Potential).		B2R7S1	Missense_Mutation	SNP	ENST00000374115.3	37	c.1250A>T	CCDS7231.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.561260	0.86335	.	.	ENSG00000187714	ENST00000374115	T	0.80480	-1.38	5.11	5.11	0.69529	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	U	0.000000	D	0.91771	0.7397	M	0.92555	3.32	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	D	0.93748	0.7056	10	0.87932	D	0	0.3726	14.9005	0.70675	1.0:0.0:0.0:0.0	.	417	Q16572	VACHT_HUMAN	F	417	ENSP00000363229:Y417F	ENSP00000363229:Y417F	Y	+	2	0	SLC18A3	50490042	1.000000	0.71417	0.997000	0.53966	0.876000	0.50452	9.253000	0.95501	1.928000	0.55862	0.459000	0.35465	TAT		0.612	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055		3	21	0	0	0	0.004672	0	3	21				
PCDH15	65217	broad.mit.edu	37	10	55582022	55582022	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:55582022G>C	ENST00000320301.6	-	33	5858	c.5464C>G	c.(5464-5466)Cct>Gct	p.P1822A	PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395433.1_Missense_Mutation_p.P1799A|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395432.2_Missense_Mutation_p.P1782A|PCDH15_ENST00000437009.1_Missense_Mutation_p.P1753A|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395430.1_Missense_Mutation_p.P1819A|PCDH15_ENST00000361849.3_Missense_Mutation_p.P1824A	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1822	Poly-Pro.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.P1822A(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				atagaaggaggtggtggagga	0.493										HNSCC(58;0.16)																													uc001jju.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(5464-5466)CCT>GCT		protocadherin 15 isoform CD1-4 precursor							104.0	92.0	96.0					10																	55582022		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55582022G>C	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.5464C>G	10.37:g.55582022G>C	ENSP00000322604:p.Pro1822Ala	HNSCC(58;0.16)				PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.P1819A|PCDH15_uc010qhw.1_Missense_Mutation_p.P1782A|PCDH15_uc010qhx.1_Missense_Mutation_p.P1753A|PCDH15_uc010qhy.1_Missense_Mutation_p.P1829A|PCDH15_uc010qhz.1_Missense_Mutation_p.P1824A|PCDH15_uc010qia.1_Missense_Mutation_p.P1802A|PCDH15_uc010qib.1_Missense_Mutation_p.P1799A	p.P1822A	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN			33	5859	-		Melanoma(3;0.117)|Lung SC(717;0.238)	1822			Poly-Pro.|Cytoplasmic (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.5464C>G	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.465137	0.63513	.	.	ENSG00000150275	ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T	0.56444	0.5;0.46;0.51;0.6;0.6;0.59	4.01	0.688	0.18027	.	.	.	.	.	T	0.26340	0.0643	N	0.08118	0	0.27003	N	0.96486	B;B;B;B;B;B;B;B	0.23591	0.088;0.088;0.088;0.088;0.088;0.088;0.088;0.088	B;B;B;B;B;B;B;B	0.21151	0.033;0.033;0.033;0.033;0.033;0.033;0.033;0.033	T	0.17137	-1.0379	9	0.27785	T	0.31	.	4.2169	0.10539	0.2177:0.0:0.6104:0.1719	.	1799;1822;1824;1829;1753;1782;1819;1822	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;Q96QU1	.;.;.;.;.;.;.;PCD15_HUMAN	A	1782;1824;1799;1822;1819;1829;1753	ENSP00000378820:P1782A;ENSP00000354950:P1824A;ENSP00000378821:P1799A;ENSP00000322604:P1822A;ENSP00000378818:P1819A;ENSP00000412628:P1753A	ENSP00000322604:P1822A	P	-	1	0	PCDH15	55252028	0.562000	0.26586	0.026000	0.17262	0.980000	0.70556	1.319000	0.33655	0.024000	0.15214	0.591000	0.81541	CCT		0.493	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		4	59	0	0	0	0.009096	0	4	59				
MYPN	84665	broad.mit.edu	37	10	69957180	69957180	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:69957180A>C	ENST00000358913.5	+	16	3718	c.3230A>C	c.(3229-3231)cAg>cCg	p.Q1077P	MYPN_ENST00000354393.2_Missense_Mutation_p.Q802P|MYPN_ENST00000540630.1_Missense_Mutation_p.Q1077P	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	1077	Ig-like 4.|Interaction with ACTN.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.Q1077P(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						CATTTCCTGCAGGCTCCTGGG	0.488																																							uc001jnm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(3229-3231)CAG>CCG		myopalladin							120.0	123.0	122.0					10																	69957180		2203	4300	6503	SO:0001583	missense	84665					nucleus|sarcomere	actin binding	g.chr10:69957180A>C	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.3230A>C	10.37:g.69957180A>C	ENSP00000351790:p.Gln1077Pro					MYPN_uc001jnn.3_Missense_Mutation_p.Q802P|MYPN_uc001jno.3_Missense_Mutation_p.Q1077P|MYPN_uc009xpt.2_Missense_Mutation_p.Q1077P|MYPN_uc010qit.1_Missense_Mutation_p.Q783P|MYPN_uc010qiu.1_RNA	p.Q1077P	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN			17	3415	+			1077			Ig-like 4.|Interaction with ACTN.		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	c.3230A>C	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.765275	0.90020	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.70045	-0.45;-0.45;-0.45	5.16	5.16	0.70880	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.147891	0.46758	D	0.000261	T	0.74627	0.3741	L	0.41079	1.255	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.87578	0.991;0.984;0.998	T	0.73688	-0.3904	9	.	.	.	.	14.9763	0.71277	1.0:0.0:0.0:0.0	.	1077;802;1077	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	P	802;802;1077;1077	ENSP00000346369:Q802P;ENSP00000351790:Q1077P;ENSP00000441668:Q1077P	.	Q	+	2	0	MYPN	69627186	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.328000	0.79160	1.946000	0.56461	0.533000	0.62120	CAG		0.488	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578		14	168	0	0	0	0.004007	0	14	168				
SAR1A	56681	broad.mit.edu	37	10	71913618	71913618	+	Silent	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:71913618C>G	ENST00000373242.2	-	7	652	c.456G>C	c.(454-456)ggG>ggC	p.G152G	SAR1A_ENST00000431664.2_Silent_p.G152G|SAR1A_ENST00000373238.1_Silent_p.G152G|SAR1A_ENST00000458634.2_Silent_p.G109G|SAR1A_ENST00000373241.4_Silent_p.G152G	NM_001142648.1	NP_001136120.1	Q9NR31	SAR1A_HUMAN	secretion associated, Ras related GTPase 1A	152					intracellular protein transport (GO:0006886)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)	p.G152G(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(3)	6						GTCCATAAAGCCCAAATATCT	0.343																																							uc010qjh.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(454-456)GGG>GGC		SAR1a gene homolog 1							229.0	236.0	233.0					10																	71913618		2203	4300	6503	SO:0001819	synonymous_variant	56681				ER to Golgi vesicle-mediated transport|intracellular protein transport	Golgi apparatus	GTP binding|GTPase activity	g.chr10:71913618C>G		CCDS7298.1	10q22.1	2014-03-07	2014-03-07	2005-10-21	ENSG00000079332	ENSG00000079332			10534	protein-coding gene	gene with protein product		607691	"""SAR1a gene homolog (S. cerevisiae) 1"", ""SAR1a gene homolog 1 (S. cerevisiae)"", ""SAR1 homolog A (S. cerevisiae)"""	SARA1		10871277	Standard	NM_020150		Approved	SAR1, Sara	uc010qji.2	Q9NR31	OTTHUMG00000018400	ENST00000373242.2:c.456G>C	10.37:g.71913618C>G						SAR1A_uc010qji.1_Silent_p.G152G|SAR1A_uc010qjj.1_Silent_p.G109G	p.G152G	NM_001142648	NP_001136120	Q9NR31	SAR1A_HUMAN			7	659	-			152					B4DQ19	Silent	SNP	ENST00000373242.2	37	c.456G>C	CCDS7298.1	.	.	.	.	.	.	.	.	.	.	C	8.824	0.938360	0.18206	.	.	ENSG00000079332	ENST00000452767	.	.	.	5.38	1.5	0.22942	.	.	.	.	.	T	0.55529	0.1926	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44697	-0.9311	4	.	.	.	.	8.2708	0.31842	0.0:0.609:0.0:0.391	.	.	.	.	P	69	.	.	A	-	1	0	SAR1A	71583624	0.466000	0.25823	0.998000	0.56505	0.981000	0.71138	-0.156000	0.10100	0.018000	0.15052	-0.137000	0.14449	GCT		0.343	SAR1A-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048500.2			16	352	0	0	0	0.00499	0	16	352				
FUT11	170384	broad.mit.edu	37	10	75533453	75533453	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:75533453A>T	ENST00000372841.3	+	2	1257	c.1214A>T	c.(1213-1215)cAc>cTc	p.H405L	AC022400.2_ENST00000595757.1_5'Flank|FUT11_ENST00000465695.1_3'UTR|FUT11_ENST00000394790.1_Missense_Mutation_p.H405L|RMRPP1_ENST00000517236.1_RNA	NM_173540.2	NP_775811.2	Q495W5	FUT11_HUMAN	fucosyltransferase 11 (alpha (1,3) fucosyltransferase)	405					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)	p.H405L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7	Prostate(51;0.0112)					GAGAAAGCCCACGCGGCCTCT	0.597																																							uc001jva.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1213-1215)CAC>CTC		fucosyltransferase 11 (alpha (1,3)							72.0	74.0	74.0					10																	75533453		2203	4300	6503	SO:0001583	missense	170384				protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity	g.chr10:75533453A>T	BC036037	CCDS7333.1, CCDS60558.1	10q22.3	2014-01-02			ENSG00000196968	ENSG00000196968		"""Fucosyltransferases"""	19233	protein-coding gene	gene with protein product						11698403, 24318988	Standard	NM_173540		Approved	MGC33202	uc001jva.3	Q495W5	OTTHUMG00000018483	ENST00000372841.3:c.1214A>T	10.37:g.75533453A>T	ENSP00000361932:p.His405Leu					FUT11_uc001juy.1_3'UTR|FUT11_uc001juz.1_Missense_Mutation_p.H405L	p.H405L	NM_173540	NP_775811	Q495W5	FUT11_HUMAN			2	1257	+	Prostate(51;0.0112)		405			Lumenal (Potential).		Q495W7|Q8IYE4	Missense_Mutation	SNP	ENST00000372841.3	37	c.1214A>T	CCDS7333.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.009951	0.93346	.	.	ENSG00000196968	ENST00000372841;ENST00000394790	T;T	0.35421	1.32;1.31	5.68	5.68	0.88126	.	0.300521	0.40908	D	0.000997	T	0.48132	0.1483	M	0.65975	2.015	0.80722	D	1	P;D	0.57899	0.936;0.981	P;P	0.51550	0.673;0.595	T	0.41520	-0.9504	10	0.28530	T	0.3	-13.2648	15.9259	0.79615	1.0:0.0:0.0:0.0	.	405;405	Q495W5;Q495W5-2	FUT11_HUMAN;.	L	405	ENSP00000361932:H405L;ENSP00000378270:H405L	ENSP00000361932:H405L	H	+	2	0	FUT11	75203459	1.000000	0.71417	0.896000	0.35187	0.986000	0.74619	6.124000	0.71620	2.161000	0.67846	0.460000	0.39030	CAC		0.597	FUT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048689.1	NM_173540		7	76	0	0	0	0.001984	0	7	76				
HECTD2	143279	broad.mit.edu	37	10	93220264	93220264	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:93220264G>T	ENST00000298068.5	+	3	443	c.349G>T	c.(349-351)Gcc>Tcc	p.A117S	HECTD2_ENST00000371681.4_Missense_Mutation_p.A117S|HECTD2_ENST00000536715.1_5'Flank|HECTD2_ENST00000446394.1_Missense_Mutation_p.A117S	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	117					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.A117S(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						CGAAATGAAGGCCCCAGTCCT	0.393																																					NSCLC(12;376 469 1699 39910 41417)	NSCLC(12;376 469 1699 39910 41417)	uc001khl.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(349-351)GCC>TCC		HECT domain containing 2 isoform a							144.0	128.0	133.0					10																	93220264		2203	4300	6503	SO:0001583	missense	143279				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity	g.chr10:93220264G>T	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.349G>T	10.37:g.93220264G>T	ENSP00000298068:p.Ala117Ser					LOC100188947_uc010qnl.1_Intron|HECTD2_uc001khk.2_Missense_Mutation_p.A117S|HECTD2_uc010qnm.1_Missense_Mutation_p.A117S|HECTD2_uc001khm.2_RNA|HECTD2_uc009xty.1_5'Flank	p.A117S	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN			3	449	+			117					Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	ENST00000298068.5	37	c.349G>T	CCDS7414.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584354	0.46110	.	.	ENSG00000165338	ENST00000446394;ENST00000371681;ENST00000298068	T;T;T	0.51574	1.28;0.7;1.28	5.39	3.53	0.40419	.	0.115570	0.64402	D	0.000018	T	0.55449	0.1921	L	0.54323	1.7	0.80722	D	1	P;P;D	0.59767	0.682;0.682;0.986	B;B;P	0.56278	0.174;0.174;0.795	T	0.55140	-0.8187	10	0.54805	T	0.06	.	11.5368	0.50641	0.1476:0.0:0.8524:0.0	.	117;117;117	E7ERR3;Q5U5R9;Q5VZ98	.;HECD2_HUMAN;.	S	117	ENSP00000401023:A117S;ENSP00000360746:A117S;ENSP00000298068:A117S	ENSP00000298068:A117S	A	+	1	0	HECTD2	93210244	1.000000	0.71417	0.994000	0.49952	0.452000	0.32318	4.393000	0.59665	0.634000	0.30469	0.563000	0.77884	GCC		0.393	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1			30	125	1	0	2.4375e-19	0.007291	4.13123e-19	30	125				
BTRC	8945	broad.mit.edu	37	10	103292158	103292158	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:103292158T>C	ENST00000370187.3	+	8	1065	c.947T>C	c.(946-948)aTa>aCa	p.I316T	BTRC_ENST00000408038.2_Missense_Mutation_p.I280T|BTRC_ENST00000393441.4_Missense_Mutation_p.I275T	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	316					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.I316T(1)		endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		GATCAGAAAATAGTAAGCGGC	0.413																																							uc001kta.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(946-948)ATA>ACA		beta-transducin repeat containing protein							129.0	126.0	127.0					10																	103292158		2203	4300	6503	SO:0001583	missense	8945				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex		g.chr10:103292158T>C	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.947T>C	10.37:g.103292158T>C	ENSP00000359206:p.Ile316Thr					BTRC_uc001ktb.2_Missense_Mutation_p.I280T|BTRC_uc001ktc.2_Missense_Mutation_p.I290T	p.I316T	NM_033637	NP_378663	Q9Y297	FBW1A_HUMAN		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)	8	1060	+		Colorectal(252;0.234)	316			WD 1.		B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	ENST00000370187.3	37	c.947T>C	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.710007	0.68730	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.64618	-0.11;-0.11;-0.11	5.96	5.96	0.96718	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83686	0.5308	M	0.91920	3.255	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.85130	0.997;0.989;0.99	D	0.87375	0.2353	10	0.87932	D	0	-17.9991	16.4277	0.83824	0.0:0.0:0.0:1.0	.	290;280;316	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	T	316;275;280	ENSP00000359206:I316T;ENSP00000377088:I275T;ENSP00000385339:I280T	ENSP00000359206:I316T	I	+	2	0	BTRC	103282148	1.000000	0.71417	1.000000	0.80357	0.260000	0.26232	8.040000	0.89188	2.279000	0.76181	0.533000	0.62120	ATA		0.413	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637		10	112	0	0	0	0.000978	0	10	112				
CFAP58	159686	broad.mit.edu	37	10	106209934	106209934	+	Missense_Mutation	SNP	G	G	T	rs138183014		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:106209934G>T	ENST00000369704.3	+	17	2616	c.2482G>T	c.(2482-2484)Gct>Tct	p.A828S		NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		828						extracellular space (GO:0005615)		p.A828S(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		GAAATACCTCGCTCAGAAACG	0.323																																							uc001kyh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|skin(1)	5						c.(2482-2484)GCT>TCT		coiled-coil domain containing 147							75.0	78.0	77.0					10																	106209934		2203	4300	6503	SO:0001583	missense	159686							g.chr10:106209934G>T																												ENST00000369704.3:c.2482G>T	10.37:g.106209934G>T	ENSP00000358718:p.Ala828Ser						p.A828S	NM_001008723	NP_001008723	Q5T655	CC147_HUMAN		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)	17	2616	+		Colorectal(252;0.103)|Breast(234;0.122)	828			Potential.		D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	37	c.2482G>T	CCDS31282.1	.	.	.	.	.	.	.	.	.	.	G	5.685	0.311027	0.10733	.	.	ENSG00000120051	ENST00000369704	T	0.49139	0.79	5.76	1.75	0.24633	.	0.306970	0.35936	N	0.002884	T	0.25717	0.0626	L	0.28458	0.855	0.44555	D	0.997519	B	0.16603	0.018	B	0.17722	0.019	T	0.04650	-1.0936	10	0.11182	T	0.66	-1.8913	2.5159	0.04667	0.1343:0.1131:0.4068:0.3457	.	828	Q5T655	CC147_HUMAN	S	828	ENSP00000358718:A828S	ENSP00000358718:A828S	A	+	1	0	CCDC147	106199924	0.431000	0.25546	0.973000	0.42090	0.924000	0.55760	0.559000	0.23485	0.756000	0.33013	-0.188000	0.12872	GCT		0.323	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1			17	80	1	0	3.45872e-05	0.004007	4.40986e-05	17	80				
SORCS1	114815	broad.mit.edu	37	10	108923853	108923853	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:108923853C>G	ENST00000263054.6	-	1	439	c.432G>C	c.(430-432)gaG>gaC	p.E144D	SORCS1_ENST00000344440.6_Missense_Mutation_p.E144D	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	144					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.E144D(2)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CCGGGTCCCGCTCCCGAGTCC	0.662																																							uc001kym.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(430-432)GAG>GAC		SORCS receptor 1 isoform a							46.0	46.0	46.0					10																	108923853		2202	4299	6501	SO:0001583	missense	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108923853C>G	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.432G>C	10.37:g.108923853C>G	ENSP00000263054:p.Glu144Asp					SORCS1_uc001kyl.2_Missense_Mutation_p.E144D|SORCS1_uc009xxs.2_Missense_Mutation_p.E144D|SORCS1_uc001kyn.1_Missense_Mutation_p.E144D|SORCS1_uc001kyo.2_Missense_Mutation_p.E144D	p.E144D	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	1	440	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	144			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	c.432G>C	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.612977	0.28712	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.15017	2.46;2.47	3.95	3.03	0.35002	.	0.577418	0.16576	N	0.208391	T	0.09905	0.0243	N	0.14661	0.345	0.23519	N	0.9975	B;B;B;B;B	0.06786	0.001;0.001;0.0;0.0;0.001	B;B;B;B;B	0.10450	0.001;0.003;0.001;0.0;0.005	T	0.29941	-0.9995	9	.	.	.	-14.2953	11.6593	0.51337	0.0:0.9077:0.0:0.0923	.	144;144;144;144;144	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	D	144	ENSP00000263054:E144D;ENSP00000345964:E144D	.	E	-	3	2	SORCS1	108913843	0.999000	0.42202	0.935000	0.37517	0.930000	0.56654	1.475000	0.35409	1.206000	0.43276	0.655000	0.94253	GAG		0.662	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		6	39	0	0	0	0.00308	0	6	39				
HABP2	3026	broad.mit.edu	37	10	115334134	115334134	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:115334134C>A	ENST00000351270.3	+	3	289	c.193C>A	c.(193-195)Cct>Act	p.P65T	HABP2_ENST00000541666.1_Missense_Mutation_p.P65T|HABP2_ENST00000537906.1_Silent_p.I53I|HABP2_ENST00000542051.1_Missense_Mutation_p.P39T	NM_004132.3	NP_004123.1	Q14520	HABP2_HUMAN	hyaluronan binding protein 2	65					cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	glycosaminoglycan binding (GO:0005539)|serine-type endopeptidase activity (GO:0004252)	p.P65T(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)	Hyaluronan(DB08818)	CGCTGAGAATCCTGACTGGTA	0.507																																							uc001lai.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(193-195)CCT>ACT		hyaluronan binding protein 2 preproprotein							143.0	119.0	127.0					10																	115334134		2203	4300	6503	SO:0001583	missense	3026				cell adhesion|proteolysis	extracellular space	glycosaminoglycan binding|serine-type endopeptidase activity	g.chr10:115334134C>A		CCDS7577.1, CCDS53579.1	10q25.3	2008-08-01	2001-11-28		ENSG00000148702	ENSG00000148702			4798	protein-coding gene	gene with protein product	"""plasma hyaluronan binding protein"", ""factor VII activating protein"""	603924	"""hyaluronan-binding protein 2"""			8827452, 12437095	Standard	NM_004132		Approved	HABP, PHBP, HGFAL, FSAP	uc001lai.4	Q14520	OTTHUMG00000019073	ENST00000351270.3:c.193C>A	10.37:g.115334134C>A	ENSP00000277903:p.Pro65Thr					HABP2_uc010qrz.1_RNA|HABP2_uc010qry.1_Silent_p.I53I	p.P65T	NM_004132	NP_004123	Q14520	HABP2_HUMAN		Epithelial(162;0.00319)|all cancers(201;0.0112)	3	296	+		Colorectal(252;0.0233)|Breast(234;0.0672)	65					A8K467|B7Z8U5|F5H5M6|O00663	Missense_Mutation	SNP	ENST00000351270.3	37	c.193C>A	CCDS7577.1	.	.	.	.	.	.	.	.	.	.	C	9.418	1.082298	0.20309	.	.	ENSG00000148702	ENST00000542051;ENST00000351270;ENST00000541666	D;D;D	0.87103	-2.2;-2.21;-1.92	4.31	4.31	0.51392	.	0.450854	0.23945	N	0.043001	T	0.79269	0.4417	L	0.32530	0.975	0.80722	D	1	B	0.24533	0.105	B	0.18263	0.021	T	0.73030	-0.4111	10	0.14252	T	0.57	.	14.6019	0.68447	0.0:1.0:0.0:0.0	.	65	Q14520	HABP2_HUMAN	T	39;65;65	ENSP00000443283:P39T;ENSP00000277903:P65T;ENSP00000438373:P65T	ENSP00000277903:P65T	P	+	1	0	HABP2	115324124	0.127000	0.22367	0.989000	0.46669	0.466000	0.32739	1.258000	0.32944	2.691000	0.91804	0.563000	0.77884	CCT		0.507	HABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050428.1	NM_004132		18	95	1	0	1.99824e-07	0.00499	2.78858e-07	18	95				
PNLIPRP3	119548	broad.mit.edu	37	10	118220524	118220524	+	Silent	SNP	C	C	A	rs199970109	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:118220524C>A	ENST00000369230.3	+	6	758	c.612C>A	c.(610-612)gtC>gtA	p.V204V		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	204					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)	p.V204V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		CAAAGGAAGTCAGGCTAGACC	0.438																																							uc001lcl.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(610-612)GTC>GTA		pancreatic lipase-related protein 3 precursor							125.0	113.0	117.0					10																	118220524		2203	4300	6503	SO:0001819	synonymous_variant	119548				lipid catabolic process	extracellular region	triglyceride lipase activity	g.chr10:118220524C>A	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.612C>A	10.37:g.118220524C>A							p.V204V	NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN		all cancers(201;0.0131)	6	713	+			204						Silent	SNP	ENST00000369230.3	37	c.612C>A	CCDS31292.1																																																																																				0.438	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	XM_058404		12	76	1	0	4.36969e-10	0.001855	6.58978e-10	12	76				
PNLIPRP1	5407	broad.mit.edu	37	10	118360618	118360618	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:118360618C>T	ENST00000528052.1	+	10	1039	c.968C>T	c.(967-969)cCa>cTa	p.P323L	PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.P323L|PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.P323L			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	323					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)	p.P323L(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		CAAGGATGCCCACAGATGGGT	0.448																																							uc001lco.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(967-969)CCA>CTA		pancreatic lipase-related protein 1 precursor							144.0	128.0	133.0					10																	118360618		2203	4300	6503	SO:0001583	missense	5407				lipid metabolic process		calcium ion binding|triglyceride lipase activity	g.chr10:118360618C>T	BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.968C>T	10.37:g.118360618C>T	ENSP00000433933:p.Pro323Leu					PNLIPRP1_uc001lcp.2_Missense_Mutation_p.P323L	p.P323L	NM_006229	NP_006220	P54315	LIPR1_HUMAN		all cancers(201;0.0161)	10	986	+			323					Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	ENST00000528052.1	37	c.968C>T	CCDS7595.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850640	0.71719	.	.	ENSG00000187021	ENST00000358834;ENST00000528052;ENST00000534537	D;D;D	0.90732	-2.72;-2.72;-2.72	5.25	5.25	0.73442	Lipase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95661	0.8589	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96057	0.9036	10	0.87932	D	0	-12.2064	17.9599	0.89082	0.0:1.0:0.0:0.0	.	323	P54315	LIPR1_HUMAN	L	323	ENSP00000351695:P323L;ENSP00000433933:P323L;ENSP00000434159:P323L	ENSP00000351695:P323L	P	+	2	0	PNLIPRP1	118350608	1.000000	0.71417	0.964000	0.40570	0.872000	0.50106	6.539000	0.73856	2.601000	0.87937	0.591000	0.81541	CCA		0.448	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384633.1	NM_006229		5	118	0	0	0	0.001984	0	5	118				
PNLIPRP2	5408	broad.mit.edu	37	10	118386413	118386414	+	RNA	DNP	GG	GG	CA			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:118386413_118386414GG>CA	ENST00000298771.7	+	0	394_395				PNLIPRP2_ENST00000433618.4_RNA|PNLIPRP2_ENST00000537242.1_RNA	NR_103727.1		P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process (GO:0019376)|lipid digestion (GO:0044241)|phospholipid catabolic process (GO:0009395)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	acylglycerol lipase activity (GO:0047372)|calcium ion binding (GO:0005509)|galactolipase activity (GO:0047714)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)	p.D124N(2)		endometrium(1)|large_intestine(1)|lung(11)|prostate(3)	16				all cancers(201;0.015)		GCATCTGTGTGGACTGGAGGCA	0.505																																							uc001lcq.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)	1						c.(370-375)GTGGAC>GTCAAC		pancreatic lipase-related protein 2																																						5408				galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity	g.chr10:118386413_118386414GG>CA	M93284		10q26.12	2014-03-14				ENSG00000266200	3.1.1.3		9157	protein-coding gene	gene with protein product		604423				1379598	Standard	NM_005396		Approved	PLRP2	uc001lcq.3	P54317		Exception_encountered	10.37:g.118386413_118386414delinsCA						PNLIPRP2_uc009xyu.1_RNA|PNLIPRP2_uc009xyv.1_RNA	p.D125N	NM_005396	NP_005387	P54317	LIPR2_HUMAN		all cancers(201;0.015)	7	395_396	+			124					A8K627|Q6IB55	Missense_Mutation	DNP	ENST00000298771.7	37	c.372_373GG>CA																																																																																					0.505	PNLIPRP2-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000050546.6	NM_005396		3	18	0	0	0	0.004672	0	3	18				
DMBT1	1755	broad.mit.edu	37	10	124345771	124345771	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr10:124345771G>T	ENST00000338354.3	+	16	1761	c.1655G>T	c.(1654-1656)gGc>gTc	p.G552V	DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000368909.3_Missense_Mutation_p.G552V|DMBT1_ENST00000368955.3_Missense_Mutation_p.G542V|DMBT1_ENST00000330163.4_Intron|DMBT1_ENST00000368956.2_Intron|DMBT1_ENST00000344338.3_Missense_Mutation_p.G542V			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	552	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.G552V(3)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TTTGGTCAGGGCTCAGGACCC	0.592																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	3	Substitution - Missense(3)		lung(3)	central_nervous_system(7)	7						c.(1654-1656)GGC>GTC		deleted in malignant brain tumors 1 isoform b							196.0	149.0	164.0					10																	124345771		2041	4148	6189	SO:0001583	missense	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124345771G>T		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.1655G>T	10.37:g.124345771G>T	ENSP00000342210:p.Gly552Val					DMBT1_uc001lgl.1_Missense_Mutation_p.G542V|DMBT1_uc001lgm.1_Intron|DMBT1_uc009xzz.1_Missense_Mutation_p.G552V|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yaa.1_Intron	p.G552V	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN			16	1761	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	552			SRCR 4.		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37	c.1655G>T		.	.	.	.	.	.	.	.	.	.	G	17.88	3.496793	0.64186	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000344338;ENST00000368909;ENST00000368955	T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63	4.5	3.59	0.41128	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	D	0.89444	0.6717	H	0.98577	4.27	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.91790	0.5443	9	0.72032	D	0.01	.	12.3874	0.55340	0.0828:0.0:0.9172:0.0	.	552;542;552	Q9UGM3-6;Q9UGM3-3;Q9UGM3	.;.;DMBT1_HUMAN	V	552;552;552;552;552;552;542;552;542	ENSP00000342210:G552V;ENSP00000343175:G542V;ENSP00000357905:G552V;ENSP00000357951:G542V	ENSP00000342210:G552V	G	+	2	0	DMBT1	124335761	1.000000	0.71417	0.127000	0.21898	0.425000	0.31504	7.429000	0.80309	0.901000	0.36495	0.456000	0.33151	GGC		0.592	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		20	187	1	0	1.37522e-17	0.007413	2.28255e-17	20	187				
PSMD13	5719	broad.mit.edu	37	11	249047	249047	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:249047G>T	ENST00000532097.1	+	9	1268	c.764G>T	c.(763-765)tGg>tTg	p.W255L	PSMD13_ENST00000352303.5_Missense_Mutation_p.W255L|PSMD13_ENST00000431206.2_Missense_Mutation_p.W257L	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13	255	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)		p.W257L(1)|p.W255L(1)		NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		AAGACTGCCTGGGGCCAGCAG	0.552																																							uc001lol.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(763-765)TGG>TTG		proteasome 26S non-ATPase subunit 13 isoform 1							65.0	59.0	61.0					11																	249047		2203	4300	6503	SO:0001583	missense	5719				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding	g.chr11:249047G>T	AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.764G>T	11.37:g.249047G>T	ENSP00000436186:p.Trp255Leu					PSMD13_uc010qvr.1_RNA|PSMD13_uc001loo.2_Missense_Mutation_p.W257L|PSMD13_uc001lon.2_Missense_Mutation_p.W190L|PSMD13_uc001lom.2_Missense_Mutation_p.W230L|PSMD13_uc001lop.2_Missense_Mutation_p.W38L	p.W255L	NM_002817	NP_002808	Q9UNM6	PSD13_HUMAN		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)	9	1006	+		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)	255			PCI.		B3KT15|O75831|Q53XU2|Q9UNV3	Missense_Mutation	SNP	ENST00000532097.1	37	c.764G>T	CCDS7692.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.1|29.1	4.979897|4.979897	0.92982|0.92982	.|.	.|.	ENSG00000185627|ENSG00000185627	ENST00000526783|ENST00000532097;ENST00000538343;ENST00000431206;ENST00000528906;ENST00000352303	.|T;T;T;T	.|0.24538	.|1.85;1.85;2.41;2.4	5.59|5.59	5.59|5.59	0.84812|0.84812	.|Proteasome component (PCI) domain (1);	.|0.193741	.|0.49916	.|D	.|0.000135	T|T	0.30572|0.30572	0.0769|0.0769	N|N	0.25647|0.25647	0.755|0.755	0.80722|0.80722	D|D	1|1	.|B;P;D;D	.|0.54207	.|0.284;0.878;0.965;0.965	.|B;P;P;P	.|0.54965	.|0.076;0.682;0.765;0.765	T|T	0.01245|0.01245	-1.1407|-1.1407	5|10	.|0.11182	.|T	.|0.66	.|.	18.6185|18.6185	0.91313|0.91313	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|257;190;255;255	.|Q9UNM6-2;B4DJ66;B2RBM7;Q9UNM6	.|.;.;.;PSD13_HUMAN	W|L	166|255;190;257;217;255	.|ENSP00000436186:W255L;ENSP00000396937:W257L;ENSP00000433364:W217L;ENSP00000333811:W255L	.|ENSP00000333811:W255L	G|W	+|+	1|2	0|0	PSMD13|PSMD13	239047|239047	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.955000|0.955000	0.61496|0.61496	9.735000|9.735000	0.98825|0.98825	2.820000|2.820000	0.97059|0.97059	0.650000|0.650000	0.86243|0.86243	GGG|TGG		0.552	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239286.2	NM_002817		11	31	1	0	4.3838e-07	0.001855	6.07238e-07	11	31				
OR51F1	256892	broad.mit.edu	37	11	4790230	4790230	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:4790230G>A	ENST00000380383.1	-	1	938	c.939C>T	c.(937-939)ctC>ctT	p.L313L	MMP26_ENST00000380390.1_Intron|OR51F1_ENST00000343430.3_Silent_p.L306L|MMP26_ENST00000477339.1_Intron			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L306L(1)		kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		GCAGCAGACTGAGCATAGCCT	0.418																																							uc010qyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(916-918)CTC>CTT		olfactory receptor, family 51, subfamily F,							96.0	92.0	93.0					11																	4790230		2201	4298	6499	SO:0001819	synonymous_variant	256892					integral to membrane	olfactory receptor activity	g.chr11:4790230G>A	BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.939C>T	11.37:g.4790230G>A							p.L306L	NM_001004752	NP_001004752	A6NLW9	A6NLW9_HUMAN		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)	1	918	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)	306						Silent	SNP	ENST00000380383.1	37	c.918C>T																																																																																					0.418	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001004752		6	77	0	0	0	0.001168	0	6	77				
OR51F2	119694	broad.mit.edu	37	11	4843470	4843470	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:4843470T>G	ENST00000322110.5	+	1	920	c.855T>G	c.(853-855)ttT>ttG	p.F285L	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	285						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F285L(1)		breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACCTCCATTTGTCCACATCA	0.443																																							uc010qyn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(853-855)TTT>TTG		olfactory receptor, family 51, subfamily F,							276.0	205.0	229.0					11																	4843470		2201	4298	6499	SO:0001583	missense	119694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4843470T>G	BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.855T>G	11.37:g.4843470T>G	ENSP00000323952:p.Phe285Leu						p.F285L	NM_001004753	NP_001004753	Q8NH61	O51F2_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	855	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)	285			Extracellular (Potential).		Q6IFI1	Missense_Mutation	SNP	ENST00000322110.5	37	c.855T>G	CCDS31361.1	.	.	.	.	.	.	.	.	.	.	T	1.998	-0.430212	0.04701	.	.	ENSG00000176925	ENST00000322110	T	0.00058	8.79	4.71	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	0.382628	0.18947	U	0.126800	T	0.00039	0.0001	N	0.00879	-1.12	0.09310	N	0.999998	B	0.12630	0.006	B	0.21360	0.034	T	0.15292	-1.0442	10	0.02654	T	1	.	8.7001	0.34320	0.0:0.0:0.1922:0.8077	.	285	Q8NH61	O51F2_HUMAN	L	285	ENSP00000323952:F285L	ENSP00000323952:F285L	F	+	3	2	OR51F2	4800046	0.000000	0.05858	1.000000	0.80357	0.660000	0.38997	-0.867000	0.04241	2.099000	0.63709	0.459000	0.35465	TTT		0.443	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753		16	102	0	0	0	0.010504	0	16	102				
OR52B2	255725	broad.mit.edu	37	11	6191076	6191076	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:6191076C>A	ENST00000530810.1	-	1	562	c.481G>T	c.(481-483)Gtc>Ttc	p.V161F	RP11-290F24.3_ENST00000529961.1_RNA	NM_001004052.1	NP_001004052.1	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B, member 2	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V161F(2)		NS(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(15)	21		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAGAATATGACTGGGAAGATG	0.507																																					NSCLC(5;186 261 1778 7098 14207)	NSCLC(5;186 261 1778 7098 14207)	uc010qzy.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(481-483)GTC>TTC		olfactory receptor, family 52, subfamily B,							61.0	62.0	62.0					11																	6191076		2116	4239	6355	SO:0001583	missense	255725				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6191076C>A	AB065763	CCDS53598.1	11p15.4	2012-08-09				ENSG00000255307		"""GPCR / Class A : Olfactory receptors"""	15207	protein-coding gene	gene with protein product							Standard	NM_001004052		Approved		uc010qzy.2	Q96RD2		ENST00000530810.1:c.481G>T	11.37:g.6191076C>A	ENSP00000432011:p.Val161Phe						p.V161F	NM_001004052	NP_001004052	Q96RD2	O52B2_HUMAN		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	481	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	161			Helical; Name=4; (Potential).		Q8NGM7	Missense_Mutation	SNP	ENST00000530810.1	37	c.481G>T	CCDS53598.1	.	.	.	.	.	.	.	.	.	.	C	7.129	0.579498	0.13686	.	.	ENSG00000255307	ENST00000530810	T	0.00145	8.67	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00144	0.0004	N	0.11313	0.125	0.30071	N	0.810088	D	0.54772	0.968	P	0.52909	0.713	T	0.61969	-0.6953	9	0.02654	T	1	.	12.5414	0.56172	0.0:0.7267:0.2733:0.0	.	161	Q96RD2	O52B2_HUMAN	F	161	ENSP00000432011:V161F	ENSP00000432011:V161F	V	-	1	0	OR52B2	6147652	0.000000	0.05858	0.997000	0.53966	0.824000	0.46624	-0.835000	0.04386	2.680000	0.91292	0.551000	0.68910	GTC		0.507	OR52B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385977.1	NM_001004052		10	27	1	0	1.58986e-06	0.008291	2.16484e-06	10	27				
NLRP14	338323	broad.mit.edu	37	11	7070935	7070935	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:7070935G>T	ENST00000299481.4	+	6	2503	c.2157G>T	c.(2155-2157)caG>caT	p.Q719H		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	719					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.Q719H(1)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		ATGGTTGTCAGGATATCTCTA	0.383																																							uc001mfb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(2155-2157)CAG>CAT		NLR family, pyrin domain containing 14							168.0	162.0	164.0					11																	7070935		2201	4296	6497	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7070935G>T	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2157G>T	11.37:g.7070935G>T	ENSP00000299481:p.Gln719His						p.Q719H	NM_176822	NP_789792	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	6	2480	+			719					Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.2157G>T	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	G	5.155	0.214159	0.09810	.	.	ENSG00000158077	ENST00000299481	D	0.89270	-2.49	5.2	0.689	0.18033	.	0.885835	0.09520	N	0.791037	T	0.79240	0.4412	L	0.33668	1.02	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.59627	-0.7419	10	0.15499	T	0.54	.	4.408	0.11418	0.3229:0.1601:0.517:0.0	.	719	Q86W24	NAL14_HUMAN	H	719	ENSP00000299481:Q719H	ENSP00000299481:Q719H	Q	+	3	2	NLRP14	7027511	0.000000	0.05858	0.000000	0.03702	0.146000	0.21551	-0.179000	0.09768	-0.057000	0.13199	0.573000	0.79308	CAG		0.383	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		33	138	1	0	4.74835e-14	0.002096	7.54625e-14	33	138				
KCNA4	3739	broad.mit.edu	37	11	30032822	30032822	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:30032822G>T	ENST00000328224.6	-	2	2637	c.1404C>A	c.(1402-1404)ggC>ggA	p.G468G	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	468					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)	p.G468G(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	TGAGGGTGTGGCCCAGGATCT	0.537																																							uc001msk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1402-1404)GGC>GGA		potassium voltage-gated channel, shaker-related							54.0	57.0	56.0					11																	30032822		2091	4247	6338	SO:0001819	synonymous_variant	3739					voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity	g.chr11:30032822G>T	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.1404C>A	11.37:g.30032822G>T							p.G468G	NM_002233	NP_002224	P22459	KCNA4_HUMAN			2	2556	-			468						Silent	SNP	ENST00000328224.6	37	c.1404C>A	CCDS41629.1																																																																																				0.537	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233		4	74	1	0	0.00909568	0.009096	0.00994674	4	74				
ARL14EP	120534	broad.mit.edu	37	11	30352778	30352778	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:30352778T>G	ENST00000282032.3	+	2	498	c.283T>G	c.(283-285)Tta>Gta	p.L95V		NM_152316.1	NP_689529.1	Q8N8R7	AL14E_HUMAN	ADP-ribosylation factor-like 14 effector protein	95						cytoplasm (GO:0005737)		p.L95V(1)									TGTAATTGACTTAGATGATGC	0.348																																							uc001mso.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(283-285)TTA>GTA		hypothetical protein LOC120534							105.0	103.0	104.0					11																	30352778		2202	4299	6501	SO:0001583	missense	120534							g.chr11:30352778T>G	AK096287	CCDS7869.1	11p14.1	2014-09-17	2012-07-09	2012-07-09	ENSG00000152219	ENSG00000152219			26798	protein-coding gene	gene with protein product		612295	"""chromosome 11 open reading frame 46"""	C11orf46		21458045	Standard	XM_005252792		Approved	FLJ38968, ARF7EP	uc001mso.1	Q8N8R7	OTTHUMG00000166154	ENST00000282032.3:c.283T>G	11.37:g.30352778T>G	ENSP00000282032:p.Leu95Val						p.L95V	NM_152316	NP_689529	Q8N8R7	CK046_HUMAN			2	447	+			95					Q5HYH9	Missense_Mutation	SNP	ENST00000282032.3	37	c.283T>G	CCDS7869.1	.	.	.	.	.	.	.	.	.	.	T	10.85	1.466594	0.26335	.	.	ENSG00000152219	ENST00000282032;ENST00000530909	T	0.69685	-0.42	5.57	5.57	0.84162	.	0.311474	0.32401	N	0.006142	T	0.50803	0.1637	L	0.29908	0.895	0.31164	N	0.704045	B	0.24426	0.103	B	0.27608	0.081	T	0.52298	-0.8594	10	0.27082	T	0.32	-13.777	6.2796	0.20999	0.142:0.077:0.0:0.781	.	95	Q8N8R7	CK046_HUMAN	V	95	ENSP00000282032:L95V	ENSP00000282032:L95V	L	+	1	2	C11orf46	30309354	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.391000	0.34475	2.125000	0.65367	0.533000	0.62120	TTA		0.348	ARL14EP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388129.1	NM_152316		9	210	0	0	0	0.000978	0	9	210				
WT1	7490	broad.mit.edu	37	11	32413601	32413601	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:32413601G>T	ENST00000379079.2	-	9	986	c.713C>A	c.(712-714)cCa>cAa	p.P238Q	WT1_ENST00000448076.3_Missense_Mutation_p.P450Q|WT1_ENST00000530998.1_Missense_Mutation_p.P221Q|WT1_ENST00000332351.3_Missense_Mutation_p.P450Q	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	382					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V380_S410del(1)|p.P382Q(1)|p.P238Q(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			ACACTGGAATGGTTTCACACC	0.522			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																														uc001mtn.1		NA	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	D|Mis|N|F|S	Wilms tumour 1 gene			O	EWSR1	Wilms	Wilms|desmoplastic small round cell tumor	EWSR1/WT1(231)	3	Substitution - Missense(2)|Deletion - In frame(1)	p.V380_S410del(1)	lung(2)|haematopoietic_and_lymphoid_tissue(1)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687						c.(1348-1350)CCA>CAA		Wilms tumor 1 isoform D							151.0	141.0	144.0					11																	32413601		2202	4299	6501	SO:0001583	missense	7490	Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr11:32413601G>T		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.713C>A	11.37:g.32413601G>T	ENSP00000368370:p.Pro238Gln					WT1_uc001mtl.1_Missense_Mutation_p.P238Q|WT1_uc001mtm.1_Missense_Mutation_p.P221Q|WT1_uc001mto.1_Missense_Mutation_p.P450Q|WT1_uc001mtp.1_Missense_Mutation_p.P433Q|WT1_uc001mtq.1_Missense_Mutation_p.P433Q|WT1_uc009yjs.1_RNA	p.P450Q	NM_024426	NP_077744	P19544	WT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(30;0.128)		9	1545	-	Breast(20;0.247)		382					A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	ENST00000379079.2	37	c.1349C>A	CCDS55751.1	.	.	.	.	.	.	.	.	.	.	G	32	5.128494	0.94473	.	.	ENSG00000184937	ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076	T;T;T;T;T	0.28454	2.29;1.61;1.61;2.29;2.29	6.04	6.04	0.98038	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000002	T	0.57799	0.2078	M	0.65677	2.01	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.996;0.998;0.998;0.995	D;D;D;D;D	0.79108	0.99;0.992;0.992;0.974;0.98	T	0.56159	-0.8025	10	0.87932	D	0	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	438;382;455;221;238	P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.;WT1_HUMAN;.;.;.	Q	238;450;221;433;450	ENSP00000368370:P238Q;ENSP00000331327:P450Q;ENSP00000435307:P221Q;ENSP00000415516:P433Q;ENSP00000413452:P450Q	ENSP00000331327:P450Q	P	-	2	0	WT1	32370177	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.837000	0.99465	2.873000	0.98535	0.561000	0.74099	CCA		0.522	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1	NM_000378		33	194	1	0	1.36615e-20	0.002836	2.34375e-20	33	194				
LRRC4C	57689	broad.mit.edu	37	11	40136858	40136858	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:40136858G>A	ENST00000278198.2	-	2	2948	c.985C>T	c.(985-987)Cgg>Tgg	p.R329W	LRRC4C_ENST00000528697.1_Missense_Mutation_p.R329W|LRRC4C_ENST00000530763.1_Missense_Mutation_p.R329W|LRRC4C_ENST00000527150.1_Missense_Mutation_p.R329W			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	329	LRRCT.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.R329W(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GTGTTACACCGGGCACAACAA	0.502																																							uc001mxa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(3)|central_nervous_system(1)	8						c.(985-987)CGG>TGG		netrin-G1 ligand precursor							84.0	73.0	76.0					11																	40136858		2203	4300	6503	SO:0001583	missense	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136858G>A	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.985C>T	11.37:g.40136858G>A	ENSP00000278198:p.Arg329Trp					LRRC4C_uc001mxc.1_Missense_Mutation_p.R325W|LRRC4C_uc001mxd.1_Missense_Mutation_p.R325W|LRRC4C_uc001mxb.1_Missense_Mutation_p.R325W	p.R329W	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN			2	2949	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	329			LRRCT.		A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	c.985C>T	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.580767	0.46006	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	5.76	1.56	0.23342	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80544	0.4643	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.84395	0.0557	10	0.66056	D	0.02	.	15.0044	0.71501	0.0:0.0:0.5439:0.456	.	329	Q9HCJ2	LRC4C_HUMAN	W	329	ENSP00000278198:R329W;ENSP00000436976:R329W;ENSP00000437132:R329W;ENSP00000434761:R329W	ENSP00000278198:R329W	R	-	1	2	LRRC4C	40093434	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	4.745000	0.62125	0.031000	0.15407	0.655000	0.94253	CGG		0.502	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		4	44	0	0	0	0.009096	0	4	44				
LRRC4C	57689	broad.mit.edu	37	11	40137192	40137192	+	Silent	SNP	C	C	G	rs370666599		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:40137192C>G	ENST00000278198.2	-	2	2614	c.651G>C	c.(649-651)ccG>ccC	p.P217P	LRRC4C_ENST00000528697.1_Silent_p.P217P|LRRC4C_ENST00000530763.1_Silent_p.P217P|LRRC4C_ENST00000527150.1_Silent_p.P217P			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	217					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.P217P(2)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GTTTTATGAGCGGTGTGAGGT	0.458																																							uc001mxa.1		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)	ovary(4)|skin(3)|central_nervous_system(1)	8						c.(649-651)CCG>CCC		netrin-G1 ligand precursor							83.0	82.0	82.0					11																	40137192		2203	4300	6503	SO:0001819	synonymous_variant	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40137192C>G	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.651G>C	11.37:g.40137192C>G						LRRC4C_uc001mxc.1_Silent_p.P213P|LRRC4C_uc001mxd.1_Silent_p.P213P|LRRC4C_uc001mxb.1_Silent_p.P213P	p.P217P	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN			2	2615	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	217			LRR 6.		A8K0T1|Q7L0N3	Silent	SNP	ENST00000278198.2	37	c.651G>C	CCDS31464.1																																																																																				0.458	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		19	93	0	0	0	0.008871	0	19	93				
OR4A47	403253	broad.mit.edu	37	11	48511136	48511136	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:48511136C>T	ENST00000446524.1	+	1	868	c.792C>T	c.(790-792)ccC>ccT	p.P264P		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P264P(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						GGACCTTCCCCATTGACAAAT	0.423																																							uc010rhx.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(790-792)CCC>CCT		olfactory receptor, family 4, subfamily A,							221.0	214.0	216.0					11																	48511136		2201	4298	6499	SO:0001819	synonymous_variant	403253				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48511136C>T	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.792C>T	11.37:g.48511136C>T							p.P264P	NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN			1	792	+			264			Extracellular (Potential).			Silent	SNP	ENST00000446524.1	37	c.792C>T	CCDS31490.1																																																																																				0.423	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	NM_001005512		13	407	0	0	0	0.00245	0	13	407				
TRIM48	79097	broad.mit.edu	37	11	55032690	55032690	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:55032690G>T	ENST00000417545.2	+	2	445	c.359G>T	c.(358-360)tGt>tTt	p.C120F		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	104						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.C104F(1)|p.C120F(1)		endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						AAGATGTTCTGTGAAGTGGAC	0.537																																							uc010rid.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(358-360)TGT>TTT		tripartite motif-containing 48							73.0	67.0	69.0					11																	55032690		2188	4260	6448	SO:0001583	missense	79097					intracellular	zinc ion binding	g.chr11:55032690G>T	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.359G>T	11.37:g.55032690G>T	ENSP00000402414:p.Cys120Phe						p.C120F	NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN			2	445	+			104			B box-type.		Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	c.359G>T	CCDS7947.2	.	.	.	.	.	.	.	.	.	.	g	17.33	3.361895	0.61403	.	.	ENSG00000150244	ENST00000417545	D	0.99080	-5.4	0.596	0.596	0.17496	Zinc finger, B-box (3);	.	.	.	.	D	0.99510	0.9825	H	0.99130	4.44	0.27160	N	0.961199	D	0.89917	1.0	D	0.97110	1.0	D	0.95905	0.8918	9	0.87932	D	0	.	7.1377	0.25537	1.0E-4:0.0:0.9999:0.0	.	104	Q8IWZ4	TRI48_HUMAN	F	120	ENSP00000402414:C120F	ENSP00000402414:C120F	C	+	2	0	TRIM48	54789266	1.000000	0.71417	0.873000	0.34254	0.849000	0.48306	4.307000	0.59123	0.629000	0.30376	0.413000	0.27773	TGT		0.537	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1			9	60	1	0	0.00448238	0.004482	0.00502923	9	60				
TRIM48	79097	broad.mit.edu	37	11	55036774	55036774	+	Missense_Mutation	SNP	G	G	A	rs183137757	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:55036774G>A	ENST00000417545.2	+	5	721	c.635G>A	c.(634-636)gGg>gAg	p.G212E		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	196						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.G212E(1)|p.G196E(1)		endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CTCAGGGCAGGGCCCATCACT	0.502													g|||	2	0.000399361	0.0	0.0	5008	,	,		11776	0.002		0.0	False		,,,				2504	0.0						uc010rid.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(634-636)GGG>GAG		tripartite motif-containing 48							50.0	41.0	44.0					11																	55036774		2097	3971	6068	SO:0001583	missense	79097					intracellular	zinc ion binding	g.chr11:55036774G>A	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.635G>A	11.37:g.55036774G>A	ENSP00000402414:p.Gly212Glu						p.G212E	NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN			5	721	+			196					Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	c.635G>A	CCDS7947.2	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	g	5.426	0.263785	0.10294	.	.	ENSG00000150244	ENST00000417545	T	0.75477	-0.94	0.596	-1.19	0.09585	.	.	.	.	.	T	0.68210	0.2976	N	0.20685	0.6	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.57093	-0.7870	8	0.17369	T	0.5	.	.	.	.	.	196	Q8IWZ4	TRI48_HUMAN	E	212	ENSP00000402414:G212E	ENSP00000402414:G212E	G	+	2	0	TRIM48	54793350	0.118000	0.22208	0.001000	0.08648	0.009000	0.06853	0.439000	0.21575	-1.193000	0.02688	-0.506000	0.04501	GGG		0.502	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1			3	53	0	0	0	0.009096	0	3	53				
OR4C15	81309	broad.mit.edu	37	11	55322383	55322383	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:55322383G>A	ENST00000314644.2	+	1	601	c.601G>A	c.(601-603)Gcc>Acc	p.A201T		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A201T(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						GATGGGGGTAGCCTGGACAGG	0.473										HNSCC(20;0.049)																													uc010rig.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(601-603)GCC>ACC		olfactory receptor, family 4, subfamily C,							95.0	91.0	92.0					11																	55322383		2201	4296	6497	SO:0001583	missense	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55322383G>A	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.601G>A	11.37:g.55322383G>A	ENSP00000324958:p.Ala201Thr	HNSCC(20;0.049)					p.A201T	NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN			1	601	+			147			Helical; Name=4; (Potential).		Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	c.601G>A	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.976537	0.53720	.	.	ENSG00000181939	ENST00000314644	T	0.37584	1.19	5.0	4.08	0.47627	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.43942	0.1270	N	0.25332	0.735	0.32908	D	0.514198	D	0.63046	0.992	D	0.71414	0.973	T	0.54741	-0.8248	9	0.54805	T	0.06	.	10.5532	0.45101	0.0:0.0:0.8071:0.1929	.	147	Q8NGM1	OR4CF_HUMAN	T	201	ENSP00000324958:A201T	ENSP00000324958:A201T	A	+	1	0	OR4C15	55078959	0.000000	0.05858	0.875000	0.34327	0.275000	0.26752	-0.035000	0.12205	1.314000	0.45095	0.385000	0.25706	GCC		0.473	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		23	79	0	0	0	0.00278	0	23	79				
OR4C16	219428	broad.mit.edu	37	11	55340091	55340091	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:55340091G>T	ENST00000314634.3	+	1	488	c.488G>T	c.(487-489)aGt>aTt	p.S163I		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	163						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S163I(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				CTTGCCCTGAGTTTGCCATTC	0.468																																							uc010rih.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(487-489)AGT>ATT		olfactory receptor, family 4, subfamily C,							131.0	121.0	124.0					11																	55340091		2201	4296	6497	SO:0001583	missense	219428				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55340091G>T	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.488G>T	11.37:g.55340091G>T	ENSP00000324913:p.Ser163Ile						p.S163I	NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN			1	488	+		all_epithelial(135;0.0748)	163			Extracellular (Potential).		Q6IEV8	Missense_Mutation	SNP	ENST00000314634.3	37	c.488G>T	CCDS31502.1	.	.	.	.	.	.	.	.	.	.	G	9.188	1.025345	0.19433	.	.	ENSG00000181935	ENST00000314634	T	0.00231	8.49	4.98	1.86	0.25419	GPCR, rhodopsin-like superfamily (1);	0.232848	0.38720	N	0.001596	T	0.00178	0.0005	L	0.55743	1.74	0.09310	N	1	B	0.17465	0.022	B	0.27715	0.082	T	0.28364	-1.0046	10	0.40728	T	0.16	.	7.1153	0.25412	0.3974:0.0:0.6026:0.0	.	163	Q8NGL9	OR4CG_HUMAN	I	163	ENSP00000324913:S163I	ENSP00000324913:S163I	S	+	2	0	OR4C16	55096667	0.000000	0.05858	0.052000	0.19188	0.851000	0.48451	-4.814000	0.00182	0.611000	0.30052	0.549000	0.68633	AGT		0.468	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701		38	156	1	0	8.16277e-20	0.006999	1.39613e-19	38	156				
OR5D14	219436	broad.mit.edu	37	11	55563864	55563864	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:55563864T>A	ENST00000335605.1	+	1	833	c.833T>A	c.(832-834)gTa>gAa	p.V278E		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V278E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				GTGGCCTCTGTATTTTACACA	0.438																																							uc010rim.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(832-834)GTA>GAA		olfactory receptor, family 5, subfamily D,							68.0	64.0	65.0					11																	55563864		2200	4296	6496	SO:0001583	missense	219436				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55563864T>A	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.833T>A	11.37:g.55563864T>A	ENSP00000334456:p.Val278Glu						p.V278E	NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN			1	833	+		all_epithelial(135;0.196)	278			Helical; Name=7; (Potential).		Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	37	c.833T>A	CCDS31508.1	.	.	.	.	.	.	.	.	.	.	t	18.69	3.678461	0.68042	.	.	ENSG00000186113	ENST00000335605	T	0.00285	8.3	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39274	N	0.001402	T	0.01156	0.0038	H	0.96576	3.845	0.32316	N	0.563116	D	0.71674	0.998	D	0.76575	0.988	T	0.01839	-1.1263	10	0.87932	D	0	-19.3581	13.7086	0.62654	0.0:0.0:0.0:1.0	.	278	Q8NGL3	OR5DE_HUMAN	E	278	ENSP00000334456:V278E	ENSP00000334456:V278E	V	+	2	0	OR5D14	55320440	0.116000	0.22171	0.921000	0.36526	0.961000	0.63080	2.834000	0.48167	1.916000	0.55485	0.523000	0.50628	GTA		0.438	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735		4	84	0	0	0	0.009096	0	4	84				
OR5I1	10798	broad.mit.edu	37	11	55703071	55703071	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:55703071G>A	ENST00000301532.3	-	1	805	c.806C>T	c.(805-807)tCt>tTt	p.S269F		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	269					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S269F(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						AGTGTTTGGAGAATACAGGTA	0.408																																							uc010ris.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(805-807)TCT>TTT		olfactory receptor, family 5, subfamily I,							71.0	70.0	70.0					11																	55703071		2201	4295	6496	SO:0001583	missense	10798				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55703071G>A	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.806C>T	11.37:g.55703071G>A	ENSP00000301532:p.Ser269Phe						p.S269F	NM_006637	NP_006628	Q13606	OR5I1_HUMAN			1	806	-			269			Extracellular (Potential).		Q6IEU4	Missense_Mutation	SNP	ENST00000301532.3	37	c.806C>T	CCDS7949.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397333	0.62177	.	.	ENSG00000167825	ENST00000301532	T	0.00277	8.34	5.16	5.16	0.70880	GPCR, rhodopsin-like superfamily (1);	0.147193	0.31949	N	0.006816	T	0.00552	0.0018	M	0.73430	2.235	0.29587	N	0.848709	P	0.51933	0.949	P	0.55824	0.785	T	0.49698	-0.8912	10	0.72032	D	0.01	.	16.5095	0.84280	0.0:0.0:1.0:0.0	.	269	Q13606	OR5I1_HUMAN	F	269	ENSP00000301532:S269F	ENSP00000301532:S269F	S	-	2	0	OR5I1	55459647	0.176000	0.23096	0.425000	0.26659	0.815000	0.46073	2.161000	0.42358	2.548000	0.85928	0.643000	0.83706	TCT		0.408	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637		7	35	0	0	0	0.00308	0	7	35				
OR10AG1	282770	broad.mit.edu	37	11	55735247	55735247	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:55735247G>A	ENST00000312345.2	-	1	743	c.693C>T	c.(691-693)acC>acT	p.T231T		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T231T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					GAGATGAGCAGGTGGAGAAGG	0.403																																							uc010rit.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(691-693)ACC>ACT		olfactory receptor, family 10, subfamily AG,							69.0	67.0	68.0					11																	55735247		2201	4296	6497	SO:0001819	synonymous_variant	282770				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55735247G>A	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.693C>T	11.37:g.55735247G>A							p.T231T	NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN			1	693	-	Esophageal squamous(21;0.0137)		231			Helical; Name=6; (Potential).		B2RNH4|Q6IEU3	Silent	SNP	ENST00000312345.2	37	c.693C>T	CCDS31514.1																																																																																				0.403	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		13	54	0	0	0	0.001368	0	13	54				
OR5T3	390154	broad.mit.edu	37	11	56020011	56020011	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:56020011G>T	ENST00000303059.3	+	1	336	c.336G>T	c.(334-336)ttG>ttT	p.L112F		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L112F(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					CAAAAATGTTGGTCAATTTCC	0.358																																							uc010rjd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(334-336)TTG>TTT		olfactory receptor, family 5, subfamily T,							129.0	129.0	129.0					11																	56020011		2201	4296	6497	SO:0001583	missense	390154				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56020011G>T	AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.336G>T	11.37:g.56020011G>T	ENSP00000305403:p.Leu112Phe						p.L112F	NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN			1	336	+	Esophageal squamous(21;0.00448)		112			Extracellular (Potential).		Q6IFC7	Missense_Mutation	SNP	ENST00000303059.3	37	c.336G>T	CCDS31524.1	.	.	.	.	.	.	.	.	.	.	g	10.19	1.281871	0.23392	.	.	ENSG00000172489	ENST00000303059	T	0.00428	7.44	4.55	-1.99	0.07457	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37483	U	0.002065	T	0.01254	0.0041	M	0.93678	3.445	0.09310	N	1	D	0.67145	0.996	D	0.69142	0.962	T	0.09952	-1.0651	10	0.87932	D	0	.	9.9114	0.41408	0.5197:0.0:0.4803:0.0	.	112	Q8NGG3	OR5T3_HUMAN	F	112	ENSP00000305403:L112F	ENSP00000305403:L112F	L	+	3	2	OR5T3	55776587	0.000000	0.05858	0.001000	0.08648	0.158000	0.22134	-1.384000	0.02542	-0.492000	0.06687	-0.148000	0.13756	TTG		0.358	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391599.1	NM_001004747		41	154	1	0	1.57019e-19	0.007835	2.66933e-19	41	154				
OR9G1	390174	broad.mit.edu	37	11	56468089	56468089	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:56468089T>A	ENST00000312153.1	+	1	226	c.226T>A	c.(226-228)Tac>Aac	p.Y76N		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y76N(1)		breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						TTCTTCTGTCTACACCCCAAA	0.478																																							uc010rjn.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(226-228)TAC>AAC		olfactory receptor, family 9, subfamily G,							149.0	137.0	141.0					11																	56468089		2201	4296	6497	SO:0001583	missense	504191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56468089T>A	AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.226T>A	11.37:g.56468089T>A	ENSP00000309012:p.Tyr76Asn						p.Y76N	NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN			1	226	+			76			Helical; Name=2; (Potential).		Q6IEU9|Q8NGQ0	Missense_Mutation	SNP	ENST00000312153.1	37	c.226T>A	CCDS31536.1	.	.	.	.	.	.	.	.	.	.	T	2.278	-0.365344	0.05103	.	.	ENSG00000174914	ENST00000312153	T	0.00882	5.58	4.54	2.16	0.27623	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000162	T	0.00784	0.0026	N	0.19112	0.55	0.09310	N	1	B	0.28636	0.218	B	0.30782	0.12	T	0.49588	-0.8924	10	0.87932	D	0	-12.0938	5.1245	0.14876	0.3774:0.0791:0.0:0.5435	.	76	Q8NH87	OR9G1_HUMAN	N	76	ENSP00000309012:Y76N	ENSP00000309012:Y76N	Y	+	1	0	OR9G1	56224665	0.000000	0.05858	0.300000	0.25030	0.022000	0.10575	-1.044000	0.03532	0.321000	0.23259	-0.359000	0.07587	TAC		0.478	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393253.1	NM_001005213		14	81	0	0	0	0.003163	0	14	81				
EFEMP2	30008	broad.mit.edu	37	11	65635362	65635362	+	Silent	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:65635362A>T	ENST00000307998.6	-	10	1370	c.1140T>A	c.(1138-1140)gcT>gcA	p.A380A	EFEMP2_ENST00000528176.1_Silent_p.A380A|EFEMP2_ENST00000532648.1_5'Flank	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	380					blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)	p.A380A(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		GCGAGTTTCCAGCACGGATCT	0.547																																							uc001ofy.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1138-1140)GCT>GCA		EGF-containing fibulin-like extracellular matrix							94.0	94.0	94.0					11																	65635362		2201	4296	6497	SO:0001819	synonymous_variant	30008				blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity	g.chr11:65635362A>T	AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.1140T>A	11.37:g.65635362A>T						EFEMP2_uc001ofz.2_RNA|EFEMP2_uc001oga.2_Silent_p.A380A	p.A380A	NM_016938	NP_058634	O95967	FBLN4_HUMAN		READ - Rectum adenocarcinoma(159;0.169)	10	1334	-			380					A8K7R4|B3KM31|B3KQT1|O75967	Silent	SNP	ENST00000307998.6	37	c.1140T>A	CCDS8116.1																																																																																				0.547	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391047.4	NM_016938		31	84	0	0	0	0.003755	0	31	84				
DPP3	10072	broad.mit.edu	37	11	66272113	66272113	+	Missense_Mutation	SNP	G	G	C	rs35493089		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:66272113G>C	ENST00000360510.2	+	17	1974	c.1909G>C	c.(1909-1911)Ggg>Cgg	p.G637R	DPP3_ENST00000531863.1_Missense_Mutation_p.G657R|DPP3_ENST00000453114.1_Missense_Mutation_p.G637R|DPP3_ENST00000530165.1_Missense_Mutation_p.G607R|DPP3_ENST00000541961.1_Missense_Mutation_p.G637R|DPP3_ENST00000532677.1_Missense_Mutation_p.G656R			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	637					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G637R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						TGTGGCCGGAGGGCGGGCCCT	0.607																																							uc001oig.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1909-1911)GGG>CGG		dipeptidyl peptidase III							90.0	81.0	84.0					11																	66272113		2200	4295	6495	SO:0001583	missense	10072				proteolysis	cytoplasm	aminopeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity	g.chr11:66272113G>C	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.1909G>C	11.37:g.66272113G>C	ENSP00000353701:p.Gly637Arg					DPP3_uc001oif.1_Missense_Mutation_p.G637R|DPP3_uc010rpe.1_Missense_Mutation_p.G626R|DPP3_uc001oih.1_Missense_Mutation_p.E4D	p.G637R	NM_005700	NP_005691	Q9NY33	DPP3_HUMAN			17	1971	+			637					B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Missense_Mutation	SNP	ENST00000360510.2	37	c.1909G>C	CCDS8141.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107363	0.77096	.	.	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000530165;ENST00000543807;ENST00000347422	T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55	5.42	4.48	0.54585	.	0.179530	0.48286	D	0.000196	T	0.60689	0.2288	M	0.89095	3.005	0.53688	D	0.999978	D;D	0.89917	1.0;1.0	D;D	0.83275	0.991;0.996	T	0.68123	-0.5492	10	0.62326	D	0.03	.	13.1889	0.59697	0.0:0.0:0.8394:0.1606	.	656;637	G3V1D3;Q9NY33	.;DPP3_HUMAN	R	657;656;637;637;637;607;535;217	ENSP00000432782:G657R;ENSP00000435284:G656R;ENSP00000353701:G637R;ENSP00000389943:G637R;ENSP00000440502:G637R;ENSP00000436941:G607R	ENSP00000309957:G217R	G	+	1	0	DPP3	66028689	1.000000	0.71417	0.984000	0.44739	0.697000	0.40408	8.398000	0.90195	1.277000	0.44412	0.543000	0.68304	GGG		0.607	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2			10	86	0	0	0	0.008291	0	10	86				
NUDT8	254552	broad.mit.edu	37	11	67395479	67395479	+	Nonsense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:67395479T>A	ENST00000376693.2	-	4	658	c.649A>T	c.(649-651)Aag>Tag	p.K217*	RP11-655M14.13_ENST00000533311.1_lincRNA|NUDT8_ENST00000301490.4_3'UTR	NM_001243750.1	NP_001230679.1	Q8WV74	NUDT8_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 8	217						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(1)|prostate(1)|skin(1)	4						AGGGGCTGCTTAGGGCGGGCC	0.617																																							uc001omo.1		NA																	0					0						c.(649-651)AAG>TAG		nudix-type motif 8							35.0	38.0	37.0					11																	67395479		872	1985	2857	SO:0001587	stop_gained	254552					mitochondrion	hydrolase activity|metal ion binding	g.chr11:67395479T>A	AI743601	CCDS8174.1, CCDS58151.1	11q13.2	2008-07-21			ENSG00000167799	ENSG00000167799		"""Nudix motif containing"""	8055	protein-coding gene	gene with protein product						11415433	Standard	NM_181843		Approved	FLJ41567	uc001omo.2	Q8WV74	OTTHUMG00000167292	ENST00000376693.2:c.649A>T	11.37:g.67395479T>A	ENSP00000365883:p.Lys217*					NUDT8_uc001omn.2_3'UTR	p.K217*	NM_181843	NP_862826	Q8WV74	NUDT8_HUMAN			4	668	-			217					Q6ZW59	Nonsense_Mutation	SNP	ENST00000376693.2	37	c.649A>T	CCDS58151.1	.	.	.	.	.	.	.	.	.	.	T	5.996	0.367675	0.11352	.	.	ENSG00000167799	ENST00000376693	.	.	.	3.75	-7.51	0.01346	.	2.123600	0.02608	N	0.101768	.	.	.	.	.	.	0.29670	N	0.842518	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.1948	0.01872	0.2003:0.1651:0.3602:0.2743	.	.	.	.	X	217	.	ENSP00000365883:K217X	K	-	1	0	NUDT8	67152055	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-3.070000	0.00619	-3.383000	0.00174	-2.303000	0.00259	AAG		0.617	NUDT8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394036.1	NM_181843		7	23	0	0	0	0.00308	0	7	23				
TRIM49	57093	broad.mit.edu	37	11	89537473	89537473	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:89537473G>A	ENST00000329758.1	-	3	493	c.165C>T	c.(163-165)tgC>tgT	p.C55C	TRIM49_ENST00000532501.2_Silent_p.C55C	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	55						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.C55C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TTGACTTTGTGCATTCAGAGC	0.468																																							uc001pdb.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(163-165)TGC>TGT		ring finger protein 18							116.0	105.0	108.0					11																	89537473		2191	4297	6488	SO:0001819	synonymous_variant	57093					intracellular	zinc ion binding	g.chr11:89537473G>A	AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.165C>T	11.37:g.89537473G>A							p.C55C	NM_020358	NP_065091	P0CI25	TRI49_HUMAN			3	494	-		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)	55			RING-type.		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Silent	SNP	ENST00000329758.1	37	c.165C>T	CCDS8287.1																																																																																				0.468	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395435.1	NM_020358		17	92	0	0	0	0.00278	0	17	92				
FAT3	120114	broad.mit.edu	37	11	92534672	92534672	+	Silent	SNP	C	C	G	rs369269637	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:92534672C>G	ENST00000298047.6	+	9	8510	c.8493C>G	c.(8491-8493)acC>acG	p.T2831T	FAT3_ENST00000409404.2_Silent_p.T2831T|FAT3_ENST00000525166.1_Silent_p.T2681T			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2831	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T2831T(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CTGTTGGCACCAAACTCACAC	0.448										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(8491-8493)ACC>ACG		FAT tumor suppressor homolog 3							48.0	48.0	48.0					11																	92534672		1919	4132	6051	SO:0001819	synonymous_variant	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92534672C>G	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8493C>G	11.37:g.92534672C>G		TCGA Ovarian(4;0.039)					p.T2831T	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			9	8510	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	2831			Cadherin 26.|Extracellular (Potential).		B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37	c.8493C>G																																																																																					0.448	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		9	7	0	0	0	0.004482	0	9	7				
DIXDC1	85458	broad.mit.edu	37	11	111864309	111864309	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:111864309C>A	ENST00000440460.2	+	14	1656	c.1359C>A	c.(1357-1359)caC>caA	p.H453Q	DIXDC1_ENST00000315253.5_Missense_Mutation_p.H242Q|DIXDC1_ENST00000389821.4_3'UTR	NM_001037954.2	NP_001033043.1	Q155Q3	DIXC1_HUMAN	DIX domain containing 1	454					camera-type eye development (GO:0043010)|cell cycle (GO:0007049)|cerebellar cortex development (GO:0021695)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain development (GO:0030900)|forebrain ventricular zone progenitor cell division (GO:0021869)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of axonogenesis (GO:0050772)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JNK cascade (GO:0046330)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of JNK cascade (GO:0046328)|regulation of microtubule cytoskeleton organization (GO:0070507)|Wnt signaling pathway (GO:0016055)	axon terminus (GO:0043679)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytosol (GO:0005829)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	gamma-tubulin binding (GO:0043015)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)	p.H453Q(1)		cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	17		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		TCAGTTACCACCAGGTCAGAA	0.473																																							uc001pml.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1360-1362)CAC>CAA		DIX domain containing 1 isoform a							86.0	88.0	87.0					11																	111864309		1960	4143	6103	SO:0001583	missense	85458				multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytosol|focal adhesion	actin binding|gamma-tubulin binding|signal transducer activity	g.chr11:111864309C>A	AB051522	CCDS60957.1, CCDS73381.1, CCDS73382.1	11q23.1	2014-03-20			ENSG00000150764	ENSG00000150764			23695	protein-coding gene	gene with protein product		610493				12792787	Standard	NM_001037954		Approved	KIAA1735, Dixin	uc001pmm.3	Q155Q3	OTTHUMG00000166912	ENST00000440460.2:c.1359C>A	11.37:g.111864309C>A	ENSP00000394352:p.His453Gln					DIXDC1_uc001pmm.2_Missense_Mutation_p.H243Q|DIXDC1_uc001pmn.2_Missense_Mutation_p.H160Q|DIXDC1_uc010rwq.1_Missense_Mutation_p.H119Q	p.H454Q	NM_001037954	NP_001033043	Q155Q3	DIXC1_HUMAN		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)	14	1659	+		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	454					A1A5D8|E9PRV4|Q6P2J8|Q6PIK4|Q86SR7|Q8IVY4|Q96N69|Q9C0C8	Missense_Mutation	SNP	ENST00000440460.2	37	c.1362C>A		.	.	.	.	.	.	.	.	.	.	C	4.229	0.041428	0.08196	.	.	ENSG00000150764	ENST00000440460;ENST00000315253	T;T	0.20332	2.08;2.08	5.65	2.77	0.32553	.	0.174280	0.51477	N	0.000086	T	0.07007	0.0178	.	.	.	0.27793	N	0.942768	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.38908	-0.9639	9	0.02654	T	1	-38.8058	6.0023	0.19527	0.2344:0.1564:0.6092:0.0	.	119;242;454	B4DH68;E7EQ17;Q155Q3	.;.;DIXC1_HUMAN	Q	453;242	ENSP00000394352:H453Q;ENSP00000314068:H242Q	ENSP00000314068:H242Q	H	+	3	2	DIXDC1	111369519	0.998000	0.40836	1.000000	0.80357	0.993000	0.82548	0.310000	0.19356	0.753000	0.32945	0.650000	0.86243	CAC		0.473	DIXDC1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001037954		20	73	1	0	1.00905e-13	0.008871	1.59908e-13	20	73				
DSCAML1	57453	broad.mit.edu	37	11	117310107	117310107	+	Missense_Mutation	SNP	C	C	A	rs61730454	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:117310107C>A	ENST00000321322.6	-	23	4200	c.4199G>T	c.(4198-4200)cGg>cTg	p.R1400L	DSCAML1_ENST00000527706.1_Missense_Mutation_p.R1130L	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1340	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.R1400L(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GTGGATGAGCCGGTGCCCATC	0.622																																							uc001prh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(4198-4200)CGG>CTG		Down syndrome cell adhesion molecule like 1							92.0	79.0	83.0					11																	117310107		2201	4296	6497	SO:0001583	missense	57453				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	g.chr11:117310107C>A		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.4199G>T	11.37:g.117310107C>A	ENSP00000315465:p.Arg1400Leu						p.R1400L	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	23	4201	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	1340			Extracellular (Potential).|Ig-like C2-type 10.		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	c.4199G>T	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163271	0.78226	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.64260	-0.09;-0.09	4.89	4.89	0.63831	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68860	0.3047	L	0.37850	1.14	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.60855	-0.7180	9	0.08179	T	0.78	.	18.2491	0.89997	0.0:1.0:0.0:0.0	.	1340	Q8TD84	DSCL1_HUMAN	L	1130;1400;1107	ENSP00000434335:R1130L;ENSP00000315465:R1400L	ENSP00000315465:R1400L	R	-	2	0	DSCAML1	116815317	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	5.917000	0.69989	2.549000	0.85964	0.561000	0.74099	CGG		0.622	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		20	46	1	0	8.34094e-07	0.008871	1.14128e-06	20	46				
OR10G4	390264	broad.mit.edu	37	11	123886884	123886884	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:123886884C>T	ENST00000320891.4	+	1	603	c.603C>T	c.(601-603)gaC>gaT	p.D201D		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D201D(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TCTTTGTGGACATTGGGATAG	0.562																																							uc010sac.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(601-603)GAC>GAT		olfactory receptor, family 10, subfamily G,							281.0	231.0	248.0					11																	123886884		2201	4299	6500	SO:0001819	synonymous_variant	390264				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123886884C>T	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.603C>T	11.37:g.123886884C>T							p.D201D	NM_001004462	NP_001004462	Q8NGN3	O10G4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)	1	603	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	201			Helical; Name=5; (Potential).		Q6IEW0	Silent	SNP	ENST00000320891.4	37	c.603C>T	CCDS31702.1																																																																																				0.562	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462		16	98	0	0	0	0.002836	0	16	98				
OR10G4	390264	broad.mit.edu	37	11	123886904	123886904	+	Missense_Mutation	SNP	G	G	C	rs201229870		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:123886904G>C	ENST00000320891.4	+	1	623	c.623G>C	c.(622-624)gGc>gCc	p.G208A		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G208A(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GTGGCCTCAGGCTGCTTTGTC	0.562													g|||	1	0.000199681	0.0008	0.0	5008	,	,		22330	0.0		0.0	False		,,,				2504	0.0						uc010sac.1		NA																	1	Substitution - Missense(1)	p.G208G(1)	lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(622-624)GGC>GCC		olfactory receptor, family 10, subfamily G,							293.0	243.0	260.0					11																	123886904		2201	4299	6500	SO:0001583	missense	390264				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123886904G>C	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.623G>C	11.37:g.123886904G>C	ENSP00000325076:p.Gly208Ala						p.G208A	NM_001004462	NP_001004462	Q8NGN3	O10G4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)	1	623	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	208			Helical; Name=5; (Potential).		Q6IEW0	Missense_Mutation	SNP	ENST00000320891.4	37	c.623G>C	CCDS31702.1	.	.	.	.	.	.	.	.	.	.	g	1.522	-0.546585	0.04024	.	.	ENSG00000254737	ENST00000320891	T	0.36520	1.25	3.33	2.3	0.28687	GPCR, rhodopsin-like superfamily (1);	0.129961	0.34986	N	0.003530	T	0.30262	0.0759	L	0.35723	1.085	0.34805	D	0.737099	B	0.19073	0.033	B	0.30495	0.116	T	0.42783	-0.9431	10	0.34782	T	0.22	.	12.6802	0.56918	0.0:0.1675:0.8325:0.0	.	208	Q8NGN3	O10G4_HUMAN	A	208	ENSP00000325076:G208A	ENSP00000325076:G208A	G	+	2	0	OR10G4	123392114	0.000000	0.05858	0.986000	0.45419	0.077000	0.17291	-0.248000	0.08854	1.878000	0.54408	0.580000	0.79431	GGC		0.562	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462		16	88	0	0	0	0.002096	0	16	88				
FGF23	8074	broad.mit.edu	37	12	4488554	4488554	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:4488554G>T	ENST00000237837.1	-	1	340	c.195C>A	c.(193-195)ccC>ccA	p.P65P		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	65					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.P65P(1)		NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			TGGTCTGATGGGGTGCGCCAT	0.587																																							uc001qmq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|skin(1)	4						c.(193-195)CCC>CCA		fibroblast growth factor 23 precursor							166.0	127.0	141.0					12																	4488554		2203	4300	6503	SO:0001819	synonymous_variant	8074				cell differentiation|insulin receptor signaling pathway|negative regulation of bone mineralization|negative regulation of hormone secretion|negative regulation of osteoblast differentiation|positive regulation of vitamin D 24-hydroxylase activity|regulation of phosphate transport|vitamin D catabolic process	extracellular space	growth factor activity	g.chr12:4488554G>T	AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.195C>A	12.37:g.4488554G>T							p.P65P	NM_020638	NP_065689	Q9GZV9	FGF23_HUMAN	Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)		1	341	-			65					Q4V758	Silent	SNP	ENST00000237837.1	37	c.195C>A	CCDS8526.1																																																																																				0.587	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398936.1			5	115	1	0	4.096e-09	0.001168	6.01533e-09	5	115				
CD163	9332	broad.mit.edu	37	12	7639558	7639558	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:7639558G>T	ENST00000359156.4	-	9	2277	c.2075C>A	c.(2074-2076)tCg>tAg	p.S692*	CD163_ENST00000539632.1_5'Flank|CD163_ENST00000541972.1_Nonsense_Mutation_p.S680*|CD163_ENST00000432237.2_Nonsense_Mutation_p.S692*|CD163_ENST00000396620.3_Nonsense_Mutation_p.S725*	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	692					acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.S692*(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	TGAATTGCACGAGGACAGTGT	0.438																																							uc001qsz.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|pancreas(1)|skin(1)	8						c.(2074-2076)TCG>TAG		CD163 antigen isoform a							101.0	89.0	93.0					12																	7639558		2203	4300	6503	SO:0001587	stop_gained	9332				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity	g.chr12:7639558G>T	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.2075C>A	12.37:g.7639558G>T	ENSP00000352071:p.Ser692*					CD163_uc001qta.3_Nonsense_Mutation_p.S692*|CD163_uc009zfw.2_Nonsense_Mutation_p.S725*	p.S692*	NM_004244	NP_004235	Q86VB7	C163A_HUMAN			9	2203	-			692			Extracellular (Potential).		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Nonsense_Mutation	SNP	ENST00000359156.4	37	c.2075C>A	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	G	37	6.169549	0.97343	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	.	.	.	5.54	1.42	0.22433	.	0.582684	0.15740	N	0.246961	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	4.1135	0.10070	0.3063:0.1722:0.5215:0.0	.	.	.	.	X	692;680;725;692	.	ENSP00000352071:S692X	S	-	2	0	CD163	7530825	0.000000	0.05858	0.001000	0.08648	0.266000	0.26442	0.537000	0.23144	0.321000	0.23259	0.650000	0.86243	TCG		0.438	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		11	47	1	0	3.86212e-05	0.008291	4.79347e-05	11	47				
PDE3A	5139	broad.mit.edu	37	12	20803388	20803388	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:20803388G>A	ENST00000359062.3	+	14	2819	c.2779G>A	c.(2779-2781)Gat>Aat	p.D927N	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	927	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.D927N(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	GGTAAATGATGATGTTGGAAT	0.294																																							uc001reh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)	4						c.(2779-2781)GAT>AAT		phosphodiesterase 3A	Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)						134.0	132.0	133.0					12																	20803388		2203	4300	6503	SO:0001583	missense	5139				lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr12:20803388G>A		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2779G>A	12.37:g.20803388G>A	ENSP00000351957:p.Asp927Asn						p.D927N	NM_000921	NP_000912	Q14432	PDE3A_HUMAN			14	2801	+	Esophageal squamous(101;0.125)	Breast(259;0.134)	927			Catalytic (By similarity).		O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	c.2779G>A	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.385904	0.82902	.	.	ENSG00000172572	ENST00000359062	T	0.75821	-0.97	5.78	5.78	0.91487	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.394132	0.29369	N	0.012359	T	0.67906	0.2943	L	0.28649	0.875	0.58432	D	0.999998	P	0.42161	0.772	B	0.39876	0.312	T	0.68838	-0.5303	10	0.44086	T	0.13	.	20.0203	0.97492	0.0:0.0:1.0:0.0	.	927	Q14432	PDE3A_HUMAN	N	927	ENSP00000351957:D927N	ENSP00000351957:D927N	D	+	1	0	PDE3A	20694655	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.600000	0.82769	2.730000	0.93505	0.655000	0.94253	GAT		0.294	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2			145	80	0	0	0	0.00361	0	145	80				
SLCO1C1	53919	broad.mit.edu	37	12	20874923	20874923	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:20874923G>T	ENST00000266509.2	+	8	1329	c.961G>T	c.(961-963)Gat>Tat	p.D321Y	SLCO1C1_ENST00000540354.1_Missense_Mutation_p.D272Y|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.D203Y|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.D321Y|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.D321Y	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	321					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TATTATAGATGATCACACAGA	0.358																																							uc001rej.3		NA																	0				ovary(5)|pancreas(1)|skin(1)	7						c.(961-963)GAT>TAT		solute carrier organic anion transporter family,							53.0	56.0	55.0					12																	20874923		2203	4300	6503	SO:0001583	missense	53919				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity	g.chr12:20874923G>T	AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.961G>T	12.37:g.20874923G>T	ENSP00000266509:p.Asp321Tyr					SLCO1C1_uc010sii.1_Missense_Mutation_p.D321Y|SLCO1C1_uc010sij.1_Missense_Mutation_p.D272Y|SLCO1C1_uc009zip.2_Missense_Mutation_p.D155Y|SLCO1C1_uc001rei.2_Missense_Mutation_p.D321Y|SLCO1C1_uc010sik.1_Missense_Mutation_p.D203Y	p.D321Y	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN			9	1316	+	Esophageal squamous(101;0.149)		321			Cytoplasmic (Potential).		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	ENST00000266509.2	37	c.961G>T	CCDS8683.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.111824	0.37242	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	4.52	3.62	0.41486	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.402040	0.04227	N	0.334495	T	0.58380	0.2118	M	0.64170	1.965	0.27473	N	0.952805	P;P;P;P	0.41366	0.742;0.586;0.747;0.537	B;B;P;P	0.50896	0.309;0.436;0.537;0.653	T	0.53634	-0.8411	10	0.72032	D	0.01	.	13.407	0.60919	0.0806:0.0:0.9194:0.0	.	203;272;321;321	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	Y	321;272;321;321;203	ENSP00000444149:D321Y;ENSP00000438665:D272Y;ENSP00000266509:D321Y;ENSP00000370964:D321Y;ENSP00000444527:D203Y	ENSP00000266509:D321Y	D	+	1	0	SLCO1C1	20766190	0.988000	0.35896	0.803000	0.32268	0.920000	0.55202	3.507000	0.53371	2.503000	0.84419	0.563000	0.77884	GAT		0.358	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435		6	105	1	0	3.59834e-05	0.001168	4.51603e-05	6	105				
SLCO1A2	6579	broad.mit.edu	37	12	21428305	21428305	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:21428305G>C	ENST00000307378.6	-	14	2384	c.1664C>G	c.(1663-1665)aCa>aGa	p.T555R	SLCO1A2_ENST00000390670.3_Missense_Mutation_p.T553R|SLCO1A2_ENST00000537524.1_Missense_Mutation_p.T423R|SLCO1A2_ENST00000458504.1_Missense_Mutation_p.T423R|SLCO1A2_ENST00000452078.1_Missense_Mutation_p.T555R	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	555					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.T555R(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	AAATACTCTTGTGCAAAATGT	0.264																																							uc001rer.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						c.(1663-1665)ACA>AGA		organic anion transporting polypeptide A							27.0	24.0	25.0					12																	21428305		2200	4290	6490	SO:0001583	missense	6579				bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity	g.chr12:21428305G>C		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.1664C>G	12.37:g.21428305G>C	ENSP00000305974:p.Thr555Arg					SLCO1A2_uc001res.2_Missense_Mutation_p.T555R|SLCO1A2_uc010siq.1_Missense_Mutation_p.T423R|SLCO1A2_uc010sio.1_Missense_Mutation_p.T423R|SLCO1A2_uc010sip.1_Missense_Mutation_p.T423R|SLCO1A2_uc001ret.2_Missense_Mutation_p.T553R	p.T555R	NM_021094	NP_066580	P46721	SO1A2_HUMAN			12	1915	-			555			Helical; Name=11; (Potential).		Q9UGP7|Q9UL38	Missense_Mutation	SNP	ENST00000307378.6	37	c.1664C>G	CCDS8686.1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.850281	0.51270	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	4.37	3.45	0.39498	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.571525	0.19526	N	0.112153	T	0.46889	0.1416	L	0.57536	1.79	0.24976	N	0.991632	P;P	0.46952	0.887;0.738	P;P	0.51385	0.668;0.652	T	0.35450	-0.9788	10	0.62326	D	0.03	.	7.1809	0.25772	0.0915:0.0:0.7415:0.167	.	553;555	P46721-2;P46721	.;SO1A2_HUMAN	R	555;555;423;423;553	ENSP00000305974:T555R;ENSP00000393973:T555R;ENSP00000394854:T423R;ENSP00000439401:T423R;ENSP00000375088:T553R	ENSP00000305974:T555R	T	-	2	0	SLCO1A2	21319572	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	1.837000	0.39201	1.156000	0.42514	0.484000	0.47621	ACA		0.264	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094		5	56	0	0	0	0.001984	0	5	56				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	G	rs121913529		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:25398284C>G	ENST00000256078.4	-	2	98	c.35G>C	c.(34-36)gGt>gCt	p.G12A	KRAS_ENST00000556131.1_Missense_Mutation_p.G12A|KRAS_ENST00000311936.3_Missense_Mutation_p.G12A|KRAS_ENST00000557334.1_Missense_Mutation_p.G12A	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GCT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>C	12.37:g.25398284C>G	ENSP00000256078:p.Gly12Ala	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12A|KRAS_uc001rgr.2_RNA	p.G12A	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>C	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996285	0.93167	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85643	0.5744	M	0.74546	2.27	0.80722	D	1	P;P	0.52842	0.898;0.956	P;P	0.55303	0.658;0.773	D	0.87064	0.2155	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	A	12	ENSP00000308495:G12A;ENSP00000452512:G12A;ENSP00000256078:G12A;ENSP00000451856:G12A	ENSP00000256078:G12A	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		22	32	0	0	0	0.00278	0	22	32				
ITPR2	3709	broad.mit.edu	37	12	26493144	26493144	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:26493144G>C	ENST00000381340.3	-	56	8391	c.7975C>G	c.(7975-7977)Ctg>Gtg	p.L2659V	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2659					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.L2659V(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TGTTTGACCAGACTCATGGTC	0.547																																							uc001rhg.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14						c.(7975-7977)CTG>GTG		inositol 1,4,5-triphosphate receptor, type 2							65.0	68.0	67.0					12																	26493144		2061	4227	6288	SO:0001583	missense	3709				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	g.chr12:26493144G>C	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7975C>G	12.37:g.26493144G>C	ENSP00000370744:p.Leu2659Val						p.L2659V	NM_002223	NP_002214	Q14571	ITPR2_HUMAN			56	8392	-	Colorectal(261;0.0847)		2659			Cytoplasmic (Potential).		O94773	Missense_Mutation	SNP	ENST00000381340.3	37	c.7975C>G	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.730925	0.48939	.	.	ENSG00000123104	ENST00000381340	T	0.41400	1.0	5.58	4.69	0.59074	.	0.000000	0.64402	D	0.000008	T	0.35248	0.0925	L	0.41710	1.295	0.80722	D	1	B	0.32939	0.391	B	0.33254	0.16	T	0.27226	-1.0080	10	0.66056	D	0.02	.	11.6421	0.51240	0.1419:0.0:0.8581:0.0	.	2659	Q14571	ITPR2_HUMAN	V	2659	ENSP00000370744:L2659V	ENSP00000370744:L2659V	L	-	1	2	ITPR2	26384411	1.000000	0.71417	0.996000	0.52242	0.710000	0.40934	4.728000	0.62000	1.504000	0.48704	0.655000	0.94253	CTG		0.547	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		11	90	0	0	0	0.001855	0	11	90				
PTHLH	5744	broad.mit.edu	37	12	28116578	28116578	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:28116578G>T	ENST00000545234.1	-	5	767	c.227C>A	c.(226-228)tCg>tAg	p.S76*	PTHLH_ENST00000539239.1_Nonsense_Mutation_p.S76*|PTHLH_ENST00000201015.4_Nonsense_Mutation_p.S76*|PTHLH_ENST00000395868.3_Nonsense_Mutation_p.S76*|RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000354417.3_Nonsense_Mutation_p.S76*|PTHLH_ENST00000535992.1_Nonsense_Mutation_p.S76*|PTHLH_ENST00000538310.1_Nonsense_Mutation_p.S76*|PTHLH_ENST00000395872.1_Nonsense_Mutation_p.S76*			P12272	PTHR_HUMAN	parathyroid hormone-like hormone	76					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)	p.S76*(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					GGACACCTCCGAGGTAGCTCT	0.512																																							uc001rik.2		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(1)	1						c.(226-228)TCG>TAG		parathyroid hormone-like hormone isoform 1							181.0	183.0	182.0					12																	28116578		2203	4300	6503	SO:0001587	stop_gained	5744				activation of adenylate cyclase activity by G-protein signaling pathway|cAMP metabolic process|cell-cell signaling|epidermis development|female pregnancy|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation	cytoplasm|extracellular space|nucleus	hormone activity|peptide hormone receptor binding	g.chr12:28116578G>T		CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.227C>A	12.37:g.28116578G>T	ENSP00000441765:p.Ser76*					PTHLH_uc001ril.2_Nonsense_Mutation_p.S76*|PTHLH_uc001rim.2_Nonsense_Mutation_p.S76*|PTHLH_uc001rin.2_Nonsense_Mutation_p.S76*	p.S76*	NM_198966	NP_945317	P12272	PTHR_HUMAN			3	530	-	Lung SC(9;0.184)		76					Q15251|Q6FH74	Nonsense_Mutation	SNP	ENST00000545234.1	37	c.227C>A	CCDS44853.1	.	.	.	.	.	.	.	.	.	.	G	37	6.538089	0.97646	.	.	ENSG00000087494	ENST00000395872;ENST00000539239;ENST00000545234;ENST00000538310;ENST00000354417;ENST00000201015;ENST00000535992;ENST00000395868;ENST00000542963;ENST00000534890	.	.	.	5.83	4.76	0.60689	.	0.330490	0.33180	N	0.005198	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.4776	14.8975	0.70654	0.0807:0.0:0.9193:0.0	.	.	.	.	X	76;76;76;76;76;76;76;76;76;84	.	ENSP00000201015:S76X	S	-	2	0	PTHLH	28007845	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	4.606000	0.61126	2.762000	0.94881	0.585000	0.79938	TCG		0.512	PTHLH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402913.1	NM_198965		22	195	1	0	3.28513e-13	0.003954	5.16234e-13	22	195				
OVCH1	341350	broad.mit.edu	37	12	29614829	29614829	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:29614829G>T	ENST00000318184.5	-	19	2237	c.2238C>A	c.(2236-2238)atC>atA	p.I746I	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	746	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.I746I(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					AGCCAGCACAGATCATCTTCT	0.458																																							uc001rix.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10						c.(2236-2238)ATC>ATA		ovochymase 1 precursor							118.0	116.0	117.0					12																	29614829		1940	4145	6085	SO:0001819	synonymous_variant	341350				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity	g.chr12:29614829G>T	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.2238C>A	12.37:g.29614829G>T							p.I746I	NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN			19	2238	-	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)		746			Peptidase S1 2.			Silent	SNP	ENST00000318184.5	37	c.2238C>A		.	.	.	.	.	.	.	.	.	.	G	12.19	1.862889	0.32884	.	.	ENSG00000257599	ENST00000550906	.	.	.	2.82	1.91	0.25777	.	.	.	.	.	T	0.56543	0.1992	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51084	-0.8750	4	.	.	.	.	8.8991	0.35484	0.0:0.4545:0.5455:0.0	.	.	.	.	H	93	.	.	Q	+	3	2	RP11-677C1.2	29506096	1.000000	0.71417	0.892000	0.35008	0.865000	0.49528	0.855000	0.27805	0.751000	0.32900	0.655000	0.94253	CAG		0.458	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378		7	164	1	0	2.7689e-08	0.001984	3.98295e-08	7	164				
TMTC1	83857	broad.mit.edu	37	12	29669365	29669365	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:29669365G>A	ENST00000539277.1	-	15	2282	c.2224C>T	c.(2224-2226)Cac>Tac	p.H742Y	TMTC1_ENST00000551659.1_Missense_Mutation_p.H804Y|TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000552618.1_Missense_Mutation_p.H766Y|TMTC1_ENST00000256062.5_Missense_Mutation_p.H634Y	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	742						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.H634Y(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GACACAATGTGATTGGTCATC	0.468																																							uc001rjb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1900-1902)CAC>TAC		transmembrane and tetratricopeptide repeat							163.0	148.0	153.0					12																	29669365		2203	4300	6503	SO:0001583	missense	83857					integral to membrane	binding	g.chr12:29669365G>A		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.2224C>T	12.37:g.29669365G>A	ENSP00000442046:p.His742Tyr					TMTC1_uc001riz.2_Missense_Mutation_p.H391Y|TMTC1_uc001rja.2_Missense_Mutation_p.H478Y|TMTC1_uc001riy.2_Missense_Mutation_p.H87Y	p.H634Y	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN			15	2374	-	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)		742					D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	c.1900C>T	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958585	0.53400	.	.	ENSG00000133687	ENST00000540901;ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277	T;T;T;T	0.52754	0.65;0.65;0.65;1.21	5.26	4.37	0.52481	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.381629	0.32401	N	0.006157	T	0.45796	0.1360	L	0.59436	1.845	0.80722	D	1	P;P;P	0.41313	0.626;0.745;0.572	B;B;B	0.40506	0.331;0.288;0.304	T	0.42799	-0.9430	9	.	.	.	-12.2579	13.3665	0.60687	0.0:0.3023:0.6977:0.0	.	742;804;87	Q8IUR5;F8VTQ9;Q8IUR5-4	TMTC1_HUMAN;.;.	Y	505;634;804;766;742	ENSP00000256062:H634Y;ENSP00000448112:H804Y;ENSP00000449043:H766Y;ENSP00000442046:H742Y	.	H	-	1	0	TMTC1	29560632	1.000000	0.71417	0.463000	0.27130	0.927000	0.56198	4.202000	0.58446	1.435000	0.47434	0.655000	0.94253	CAC		0.468	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920		63	76	0	0	0	0.00361	0	63	76				
CNTN1	1272	broad.mit.edu	37	12	41337491	41337492	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:41337491_41337492GG>TT	ENST00000551295.2	+	13	1589_1590	c.1472_1473GG>TT	c.(1471-1473)gGG>gTT	p.G491V	CNTN1_ENST00000547702.1_Missense_Mutation_p.G491V|CNTN1_ENST00000347616.1_Missense_Mutation_p.G491V|CNTN1_ENST00000547849.1_Missense_Mutation_p.G491V|CNTN1_ENST00000360099.3_Missense_Mutation_p.G491V|CNTN1_ENST00000348761.2_Missense_Mutation_p.G480V	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	491	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.G491V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AATAACAGAGGGAAAGCTAATA	0.356																																							uc001rmm.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(3)|large_intestine(1)|skin(1)	9						c.(1471-1473)GGG>GTT		contactin 1 isoform 1 precursor																																				SO:0001583	missense	1272				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane		g.chr12:41337491_41337492GG>TT	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		Exception_encountered	12.37:g.41337491_41337492delinsTT	ENSP00000447006:p.Gly491Val					CNTN1_uc009zjy.1_Missense_Mutation_p.G491V|CNTN1_uc001rmn.1_Missense_Mutation_p.G480V|CNTN1_uc001rmo.2_Missense_Mutation_p.G491V	p.G491V	NM_001843	NP_001834	Q12860	CNTN1_HUMAN			13	1585_1586	+	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)	491			Ig-like C2-type 5.		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	DNP	ENST00000551295.2	37	c.1472_1473GG>TT	CCDS8737.1																																																																																				0.356	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843		5	63	0	0	0	0.004672	0	5	63				
ADAMTS20	80070	broad.mit.edu	37	12	43826499	43826499	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:43826499C>G	ENST00000389420.3	-	20	2835	c.2836G>C	c.(2836-2838)Gac>Cac	p.D946H	ADAMTS20_ENST00000395541.2_Missense_Mutation_p.D100H|ADAMTS20_ENST00000553158.1_Missense_Mutation_p.D946H	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	946	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D946H(1)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CAGTAGTGGTCATCAACTTGA	0.423																																							uc010skx.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(2836-2838)GAC>CAC		a disintegrin-like and metalloprotease with							191.0	163.0	172.0					12																	43826499		2203	4300	6503	SO:0001583	missense	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43826499C>G	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2836G>C	12.37:g.43826499C>G	ENSP00000374071:p.Asp946His					ADAMTS20_uc001rno.1_Missense_Mutation_p.D100H|ADAMTS20_uc001rnp.1_Missense_Mutation_p.D100H	p.D946H	NM_025003	NP_079279	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	20	2836	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	946			TSP type-1 3.		A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	c.2836G>C	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	13.61	2.288277	0.40494	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.64260	0.12;0.02;0.02;-0.09	4.43	3.5	0.40072	.	0.236514	0.28700	N	0.014437	T	0.75057	0.3798	M	0.69185	2.1	0.45403	D	0.998386	D;D	0.89917	1.0;1.0	D;D	0.72982	0.976;0.979	T	0.77466	-0.2577	10	0.87932	D	0	.	12.2834	0.54779	0.0:0.9121:0.0:0.0879	.	946;100	P59510;E9PBD5	ATS20_HUMAN;.	H	946;112;100;946;946	ENSP00000374071:D946H;ENSP00000447427:D112H;ENSP00000378911:D100H;ENSP00000448341:D946H	ENSP00000374068:D946H	D	-	1	0	ADAMTS20	42112766	1.000000	0.71417	0.937000	0.37676	0.138000	0.21146	2.780000	0.47742	1.089000	0.41292	0.655000	0.94253	GAC		0.423	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		10	80	0	0	0	0.006214	0	10	80				
ADAMTS20	80070	broad.mit.edu	37	12	43925915	43925915	+	Missense_Mutation	SNP	G	G	T	rs80268015		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:43925915G>T	ENST00000389420.3	-	3	536	c.537C>A	c.(535-537)caC>caA	p.H179Q	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.H179Q	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	179					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.H179Q(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GTGGCTTGTTGTGACCATCTT	0.358																																							uc010skx.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(535-537)CAC>CAA		a disintegrin-like and metalloprotease with							135.0	130.0	132.0					12																	43925915		2203	4300	6503	SO:0001583	missense	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43925915G>T	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.537C>A	12.37:g.43925915G>T	ENSP00000374071:p.His179Gln						p.H179Q	NM_025003	NP_079279	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	3	537	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	179					A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	c.537C>A	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	G	8.493	0.862370	0.17178	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.04758	3.56;3.56	4.82	1.82	0.25136	Peptidase M12B, propeptide (1);	0.000000	0.45867	D	0.000329	T	0.03959	0.0111	L	0.45051	1.395	0.80722	D	1	B	0.26445	0.149	B	0.28553	0.091	T	0.35943	-0.9768	10	0.08179	T	0.78	.	7.025	0.24934	0.4284:0.0:0.5716:0.0	.	179	P59510	ATS20_HUMAN	Q	179	ENSP00000374071:H179Q;ENSP00000448341:H179Q	ENSP00000374068:H179Q	H	-	3	2	ADAMTS20	42212182	1.000000	0.71417	0.967000	0.41034	0.012000	0.07955	1.116000	0.31221	0.613000	0.30089	0.637000	0.83480	CAC		0.358	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		12	61	1	0	2.35188e-11	0.006122	3.60493e-11	12	61				
OR6C6	283365	broad.mit.edu	37	12	55688106	55688106	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:55688106T>C	ENST00000358433.2	-	1	910	c.911A>G	c.(910-912)cAa>cGa	p.Q304R		NM_001005493.1	NP_001005493.1	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C, member 6	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q304R(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						CAAATTCTTTTGTAATACATC	0.383																																							uc010sph.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|skin(1)	2						c.(910-912)CAA>CGA		olfactory receptor, family 6, subfamily C,							48.0	52.0	50.0					12																	55688106		2202	4300	6502	SO:0001583	missense	283365				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55688106T>C		CCDS31817.1	12q13.13	2012-08-09			ENSG00000188324	ENSG00000188324		"""GPCR / Class A : Olfactory receptors"""	31293	protein-coding gene	gene with protein product							Standard	NM_001005493		Approved		uc010sph.2	A6NF89	OTTHUMG00000168101	ENST00000358433.2:c.911A>G	12.37:g.55688106T>C	ENSP00000351211:p.Gln304Arg						p.Q304R	NM_001005493	NP_001005493	A6NF89	OR6C6_HUMAN			1	911	-			304			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000358433.2	37	c.911A>G	CCDS31817.1	.	.	.	.	.	.	.	.	.	.	-	9.350	1.065185	0.20067	.	.	ENSG00000188324	ENST00000358433	T	0.35048	1.33	4.28	1.87	0.25490	.	0.685403	0.12906	N	0.429376	T	0.15522	0.0374	N	0.04162	-0.26	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.28713	-1.0035	10	0.20046	T	0.44	.	7.8912	0.29680	0.0:0.1803:0.0:0.8197	.	304	A6NF89	OR6C6_HUMAN	R	304	ENSP00000351211:Q304R	ENSP00000351211:Q304R	Q	-	2	0	OR6C6	53974373	0.001000	0.12720	0.003000	0.11579	0.835000	0.47333	0.392000	0.20801	0.300000	0.22699	0.519000	0.50382	CAA		0.383	OR6C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398151.1			9	73	0	0	0	0.004482	0	9	73				
NAV3	89795	broad.mit.edu	37	12	78452876	78452876	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:78452876G>T	ENST00000397909.2	+	12	2790	c.2617G>T	c.(2617-2619)Gtg>Ttg	p.V873L	NAV3_ENST00000536525.2_Missense_Mutation_p.V873L|NAV3_ENST00000266692.7_Missense_Mutation_p.V873L|RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000228327.6_Missense_Mutation_p.V873L			Q8IVL0	NAV3_HUMAN	neuron navigator 3	873						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.V873L(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GGTTCACGATGTGACAGTGGA	0.398										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(2617-2619)GTG>TTG		neuron navigator 3							100.0	96.0	97.0					12																	78452876		1936	4148	6084	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78452876G>T	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2617G>T	12.37:g.78452876G>T	ENSP00000381007:p.Val873Leu	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.V873L|NAV3_uc010sub.1_Missense_Mutation_p.V373L	p.V873L	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			12	2790	+			873					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.2617G>T		.	.	.	.	.	.	.	.	.	.	G	11.21	1.572805	0.28092	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.27256	1.78;1.78;1.78;1.68	5.82	5.82	0.92795	.	0.000000	0.36167	U	0.002754	T	0.18425	0.0442	N	0.22421	0.69	0.80722	D	1	B;B;P	0.37955	0.046;0.029;0.612	B;B;B	0.33750	0.01;0.012;0.169	T	0.04708	-1.0932	10	0.11485	T	0.65	-14.3553	20.1142	0.97922	0.0:0.0:1.0:0.0	.	873;873;873	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	L	873	ENSP00000446132:V873L;ENSP00000381007:V873L;ENSP00000228327:V873L;ENSP00000266692:V873L	ENSP00000228327:V873L	V	+	1	0	NAV3	76977007	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	5.541000	0.67212	2.765000	0.95021	0.650000	0.86243	GTG		0.398	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		8	73	1	0	1.06961e-07	0.00308	1.50767e-07	8	73				
NAV3	89795	broad.mit.edu	37	12	78511934	78511934	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:78511934C>G	ENST00000397909.2	+	14	3070	c.2897C>G	c.(2896-2898)tCt>tGt	p.S966C	NAV3_ENST00000536525.2_Missense_Mutation_p.S966C|NAV3_ENST00000266692.7_Missense_Mutation_p.S966C|NAV3_ENST00000228327.6_Missense_Mutation_p.S966C			Q8IVL0	NAV3_HUMAN	neuron navigator 3	966						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ACTGTGTCCTCTGGACTTCCT	0.542										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(2896-2898)TCT>TGT		neuron navigator 3							119.0	127.0	124.0					12																	78511934		1952	4145	6097	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78511934C>G	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2897C>G	12.37:g.78511934C>G	ENSP00000381007:p.Ser966Cys	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.S966C|NAV3_uc010sub.1_Missense_Mutation_p.S466C|NAV3_uc009zsf.2_5'UTR	p.S966C	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			14	3070	+			966					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.2897C>G		.	.	.	.	.	.	.	.	.	.	C	21.8	4.199836	0.79015	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	5.85	5.85	0.93711	.	0.210963	0.23627	U	0.046167	T	0.41880	0.1178	L	0.57536	1.79	0.80722	D	1	P;D;P	0.58620	0.897;0.983;0.8	P;P;P	0.46758	0.469;0.522;0.526	T	0.33828	-0.9853	10	0.72032	D	0.01	-3.2413	20.1542	0.98100	0.0:1.0:0.0:0.0	.	966;966;966	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	C	966	ENSP00000446132:S966C;ENSP00000381007:S966C;ENSP00000228327:S966C;ENSP00000266692:S966C	ENSP00000228327:S966C	S	+	2	0	NAV3	77036065	0.135000	0.22499	0.145000	0.22337	0.907000	0.53573	3.796000	0.55507	2.767000	0.95098	0.563000	0.77884	TCT		0.542	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		5	126	0	0	0	0.001168	0	5	126				
NAV3	89795	broad.mit.edu	37	12	78569175	78569175	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:78569175G>C	ENST00000397909.2	+	25	5244	c.5071G>C	c.(5071-5073)Gcc>Ccc	p.A1691P	NAV3_ENST00000536525.2_Missense_Mutation_p.A1691P|NAV3_ENST00000266692.7_Missense_Mutation_p.A1514P|NAV3_ENST00000228327.6_Missense_Mutation_p.A1691P			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1691						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.A1691P(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TGGTAATGATGCCGACTCCAA	0.393										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(5071-5073)GCC>CCC		neuron navigator 3							97.0	93.0	94.0					12																	78569175		1876	4106	5982	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78569175G>C	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.5071G>C	12.37:g.78569175G>C	ENSP00000381007:p.Ala1691Pro	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.A1691P|NAV3_uc010sub.1_Missense_Mutation_p.A1177P|NAV3_uc009zsf.2_Missense_Mutation_p.A522P	p.A1691P	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			25	5244	+			1691					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.5071G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.25|19.25	3.791942|3.791942	0.70452|0.70452	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	D;D;D;D;D|.	0.93859|.	-3.3;-3.3;-3.3;-3.3;-3.3|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.000000|.	0.36234|.	U|.	0.002709|.	T|T	0.53286|0.53286	0.1787|0.1787	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D;B;D;B|.	0.89917|.	0.997;0.002;1.0;0.021|.	D;B;D;B|.	0.74348|.	0.922;0.004;0.983;0.021|.	T|T	0.47142|0.47142	-0.9140|-0.9140	10|5	0.46703|.	T|.	0.11|.	-18.5216|-18.5216	12.8554|12.8554	0.57882|0.57882	0.0746:0.0:0.9254:0.0|0.0746:0.0:0.9254:0.0	.|.	1691;1514;1691;1691|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	P|S	1691;1691;1691;1514;312;320|585	ENSP00000446132:A1691P;ENSP00000381007:A1691P;ENSP00000228327:A1691P;ENSP00000266692:A1514P;ENSP00000448303:A320P|.	ENSP00000228327:A1691P|.	A|C	+|+	1|2	0|0	NAV3|NAV3	77093306|77093306	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.816000|0.816000	0.46133|0.46133	5.356000|5.356000	0.66052|0.66052	2.687000|2.687000	0.91594|0.91594	0.655000|0.655000	0.94253|0.94253	GCC|TGC		0.393	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		5	93	0	0	0	0.001168	0	5	93				
LRRIQ1	84125	broad.mit.edu	37	12	85531700	85531700	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:85531700G>A	ENST00000393217.2	+	19	4343	c.4282G>A	c.(4282-4284)Gat>Aat	p.D1428N		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1428								p.D1428N(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TGAAGAATCCGATGAAGAATA	0.299																																							uc001tac.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(4282-4284)GAT>AAT		leucine-rich repeats and IQ motif containing 1							97.0	91.0	93.0					12																	85531700		1790	4072	5862	SO:0001583	missense	84125							g.chr12:85531700G>A	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4282G>A	12.37:g.85531700G>A	ENSP00000376910:p.Asp1428Asn						p.D1428N	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	19	4393	+			1428					Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	c.4282G>A	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.798127	0.50208	.	.	ENSG00000133640	ENST00000393217	T	0.55588	0.51	5.31	5.31	0.75309	.	.	.	.	.	T	0.36026	0.0952	N	0.14661	0.345	0.26080	N	0.981103	P	0.48640	0.913	B	0.33121	0.158	T	0.41980	-0.9478	9	0.66056	D	0.02	.	18.9862	0.92771	0.0:0.0:1.0:0.0	.	1428	Q96JM4	LRIQ1_HUMAN	N	1428	ENSP00000376910:D1428N	ENSP00000376910:D1428N	D	+	1	0	LRRIQ1	84055831	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	6.766000	0.74970	2.488000	0.83962	0.650000	0.86243	GAT		0.299	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		7	98	0	0	0	0.001984	0	7	98				
IGF1	3479	broad.mit.edu	37	12	102813420	102813420	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:102813420C>A	ENST00000307046.8	-	3	450	c.269G>T	c.(268-270)gGc>gTc	p.G90V	IGF1_ENST00000456098.1_Missense_Mutation_p.G90V|IGF1_ENST00000424202.2_Missense_Mutation_p.G74V|IGF1_ENST00000392904.1_Missense_Mutation_p.G90V|IGF1_ENST00000337514.6_Missense_Mutation_p.G90V	NM_001111285.1	NP_001104755.1	P05019	IGF1_HUMAN	insulin-like growth factor 1 (somatomedin C)	90	A.				blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|bone mineralization involved in bone maturation (GO:0035630)|branching morphogenesis of an epithelial tube (GO:0048754)|cell activation (GO:0001775)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|DNA replication (GO:0006260)|exocrine pancreas development (GO:0031017)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|glial cell differentiation (GO:0010001)|glycolate metabolic process (GO:0009441)|inner ear development (GO:0048839)|insulin-like growth factor receptor signaling pathway (GO:0048009)|lung alveolus development (GO:0048286)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mammary gland development (GO:0030879)|multicellular organism growth (GO:0035264)|muscle hypertrophy (GO:0014896)|muscle organ development (GO:0007517)|myoblast differentiation (GO:0045445)|myoblast proliferation (GO:0051450)|myotube cell development (GO:0014904)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate gland growth (GO:0060736)|prostate gland stromal morphogenesis (GO:0060741)|proteoglycan biosynthetic process (GO:0030166)|Ras protein signal transduction (GO:0007265)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of multicellular organism growth (GO:0040014)|signal transduction (GO:0007165)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|skeletal system development (GO:0001501)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)|water homeostasis (GO:0030104)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|insulin-like growth factor binding protein complex (GO:0016942)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	hormone activity (GO:0005179)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|integrin binding (GO:0005178)	p.G90V(2)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)	11						ATCCACGATGCCTGTCTGAGG	0.572																																							uc001tjp.3		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)|pancreas(1)	2						c.(268-270)GGC>GTC		insulin-like growth factor 1 isoform 3							81.0	68.0	72.0					12																	102813420		2203	4300	6503	SO:0001583	missense	3479				anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding	g.chr12:102813420C>A	X00173	CCDS9091.1, CCDS44960.1, CCDS44961.1, CCDS44962.1	12q23.2	2014-09-16			ENSG00000017427	ENSG00000017427		"""Endogenous ligands"""	5464	protein-coding gene	gene with protein product		147440				2982726, 6358902	Standard	NM_001111283		Approved	IGF1A, IGFI, IGF-I	uc001tjp.4	P05019	OTTHUMG00000149910	ENST00000307046.8:c.269G>T	12.37:g.102813420C>A	ENSP00000302665:p.Gly90Val					IGF1_uc001tjn.2_Missense_Mutation_p.G74V|IGF1_uc001tjm.2_Missense_Mutation_p.G90V|IGF1_uc001tjo.2_Missense_Mutation_p.G90V	p.G90V	NM_001111285	NP_001104755	P05019	IGF1_HUMAN			3	488	-			90			A.		B2RWM7|E9PD02|P01343|Q14620	Missense_Mutation	SNP	ENST00000307046.8	37	c.269G>T	CCDS44962.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.939000	0.92526	.	.	ENSG00000017427	ENST00000456098;ENST00000337514;ENST00000392904;ENST00000424202;ENST00000392905;ENST00000307046	D;D;D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37;-3.37;-3.37	5.84	5.84	0.93424	Insulin-like (4);	0.000000	0.85682	D	0.000000	D	0.98128	0.9382	H	0.96604	3.85	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98768	1.0727	10	0.87932	D	0	-10.5112	20.1535	0.98095	0.0:1.0:0.0:0.0	.	90;121;74;90	P05019;Q59GC5;Q14620;E9PD02	IGF1_HUMAN;.;.;.	V	90;90;90;74;71;90	ENSP00000394999:G90V;ENSP00000337612:G90V;ENSP00000376637:G90V;ENSP00000416811:G74V;ENSP00000376638:G71V;ENSP00000302665:G90V	ENSP00000302665:G90V	G	-	2	0	IGF1	101337550	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.416000	0.80143	2.764000	0.94973	0.650000	0.86243	GGC		0.572	IGF1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313855.1	NM_000618		6	49	1	0	0.00116845	0.001168	0.00133503	6	49				
WSCD2	9671	broad.mit.edu	37	12	108600180	108600180	+	Splice_Site	SNP	G	G	T	rs371095870		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:108600180G>T	ENST00000332082.4	+	4	1315	c.497G>T	c.(496-498)cGg>cTg	p.R166L	WSCD2_ENST00000547525.1_Splice_Site_p.R166L|WSCD2_ENST00000549903.1_Splice_Site_p.R166L|WSCD2_ENST00000261400.3_Splice_Site_p.R166L			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	166	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)		p.R166L(2)		breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						TGTGCTGAACGGTAGGGTCCC	0.527																																							uc001tms.2		NA																	2	Substitution - Missense(2)		lung(1)|breast(1)	ovary(1)|large_intestine(1)|breast(1)	3						c.(496-498)CGG>CTG		WSC domain containing 2							54.0	55.0	54.0					12																	108600180		1958	4141	6099	SO:0001630	splice_region_variant	9671					integral to membrane		g.chr12:108600180G>T		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.497+1G>T	12.37:g.108600180G>T						WSCD2_uc001tmt.2_Missense_Mutation_p.R166L	p.R166L	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN			3	1241	+			166			WSC 1.		B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	c.497G>T	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.030582	0.93575	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000551638;ENST00000332082;ENST00000549903	T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53	5.29	5.29	0.74685	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.64972	0.2647	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66424	-0.5927	10	0.56958	D	0.05	-28.5793	17.5137	0.87767	0.0:0.0:1.0:0.0	.	166	Q2TBF2	WSCD2_HUMAN	L	166;166;13;166;166	ENSP00000448047:R166L;ENSP00000261400:R166L;ENSP00000446744:R13L;ENSP00000331933:R166L;ENSP00000447272:R166L	ENSP00000261400:R166L	R	+	2	0	WSCD2	107124310	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.173000	0.94815	2.480000	0.83734	0.650000	0.86243	CGG		0.527	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	Missense_Mutation	4	37	1	0	1.23904e-05	0.000602	1.60532e-05	4	37				
CCDC63	160762	broad.mit.edu	37	12	111296569	111296569	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:111296569T>G	ENST00000308208.5	+	4	601	c.359T>G	c.(358-360)cTg>cGg	p.L120R	CCDC63_ENST00000552694.1_Missense_Mutation_p.L41R|CCDC63_ENST00000545036.1_Missense_Mutation_p.L80R|CCDC63_ENST00000550317.1_3'UTR	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	120								p.L120R(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						TTGGCTGAACTGGATGAGAAG	0.483																																							uc001trv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(1)|pancreas(1)	8						c.(358-360)CTG>CGG		coiled-coil domain containing 63							142.0	132.0	135.0					12																	111296569		2203	4300	6503	SO:0001583	missense	160762							g.chr12:111296569T>G	AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.359T>G	12.37:g.111296569T>G	ENSP00000312399:p.Leu120Arg					CCDC63_uc009zvt.1_Missense_Mutation_p.L35R|CCDC63_uc010sye.1_Missense_Mutation_p.L80R|CCDC63_uc001trw.1_Missense_Mutation_p.L35R	p.L120R	NM_152591	NP_689804	Q8NA47	CCD63_HUMAN			4	554	+			120			Potential.		B4DY03|Q0P603|Q6P2E1	Missense_Mutation	SNP	ENST00000308208.5	37	c.359T>G	CCDS9151.1	.	.	.	.	.	.	.	.	.	.	T	16.71	3.199973	0.58126	.	.	ENSG00000173093	ENST00000545036;ENST00000308208;ENST00000552694	T;T;T	0.59906	0.27;0.23;0.62	5.61	5.61	0.85477	.	0.071299	0.56097	D	0.000025	T	0.75968	0.3922	M	0.80746	2.51	0.41661	D	0.989187	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79876	-0.1618	10	0.87932	D	0	.	12.2005	0.54321	0.0:0.0:0.0:1.0	.	80;120	B4DY03;Q8NA47	.;CCD63_HUMAN	R	80;120;41	ENSP00000445881:L80R;ENSP00000312399:L120R;ENSP00000450217:L41R	ENSP00000312399:L120R	L	+	2	0	CCDC63	109780952	1.000000	0.71417	0.993000	0.49108	0.480000	0.33159	4.152000	0.58111	2.136000	0.66102	0.454000	0.30748	CTG		0.483	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404673.2	NM_152591		8	65	0	0	0	0.004482	0	8	65				
OAS1	4938	broad.mit.edu	37	12	113344990	113344990	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:113344990G>C	ENST00000202917.5	+	1	409	c.146G>C	c.(145-147)aGc>aCc	p.S49T	RP1-71H24.1_ENST00000552784.1_RNA|OAS1_ENST00000551241.1_Missense_Mutation_p.S49T|OAS1_ENST00000445409.2_Missense_Mutation_p.S49T|OAS1_ENST00000553185.1_Missense_Mutation_p.S49T|OAS1_ENST00000452357.2_Missense_Mutation_p.S49T	NM_016816.2	NP_058132.2	P00973	OAS1_HUMAN	2'-5'-oligoadenylate synthetase 1, 40/46kDa	49	Interaction with dsRNA.				cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|protein oligomerization (GO:0051259)|purine nucleotide biosynthetic process (GO:0006164)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.S49T(3)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)|skin(1)	16						TTCCGAGGTAGCTCCTACCCT	0.517																																							uc001tud.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(145-147)AGC>ACC		2',5'-oligoadenylate synthetase 1 isoform 1							218.0	185.0	196.0					12																	113344990		2203	4300	6503	SO:0001583	missense	4938				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding	g.chr12:113344990G>C	X04371	CCDS31905.1, CCDS41838.1, CCDS44980.1	12q24.2	2014-05-21	2011-07-21				2.7.7.-		8086	protein-coding gene	gene with protein product		164350	"""2',5'-oligoadenylate synthetase 1 (40-46 kD)"""	OIAS		9344649, 9325053	Standard	XM_006719434		Approved	OIASI, IFI-4	uc001tud.3	P00973		ENST00000202917.5:c.146G>C	12.37:g.113344990G>C	ENSP00000202917:p.Ser49Thr					OAS1_uc010syn.1_Missense_Mutation_p.S48T|OAS1_uc010syo.1_Missense_Mutation_p.S48T|OAS1_uc001tub.2_Missense_Mutation_p.S49T|OAS1_uc001tuc.2_Missense_Mutation_p.S49T|OAS1_uc009zwf.2_Missense_Mutation_p.S48T	p.S49T	NM_016816	NP_058132	P00973	OAS1_HUMAN			1	252	+			49					A8K4N8|P04820|P29080|P29081|P78485|P78486|Q16700|Q16701|Q1PG42|Q3ZM01|Q53GC5|Q53YA4|Q6A1Z3|Q6IPC6|Q6P7N9|Q96J61	Missense_Mutation	SNP	ENST00000202917.5	37	c.146G>C	CCDS41838.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340896	0.24339	.	.	ENSG00000089127	ENST00000202917;ENST00000445409;ENST00000452357;ENST00000550883;ENST00000549820;ENST00000551241;ENST00000377508;ENST00000553185;ENST00000550689	T;T;T;T;T;T;T	0.21932	1.98;1.98;1.98;3.25;1.98;1.98;1.98	5.18	3.32	0.38043	2-5-oligoadenylate synthetase, N-terminal (1);	1.514720	0.03960	N	0.289925	T	0.19327	0.0464	N	0.21508	0.67	0.09310	N	1	B;B;B;B;B;B	0.24576	0.106;0.016;0.01;0.005;0.012;0.004	B;B;B;B;B;B	0.32393	0.145;0.01;0.016;0.015;0.01;0.006	T	0.34329	-0.9833	10	0.40728	T	0.16	-4.8602	8.0215	0.30412	0.1663:0.6213:0.2124:0.0	.	49;49;49;49;49;49	B4DWE7;E7EMI9;F8VXY3;P00973;P00973-3;P00973-2	.;.;.;OAS1_HUMAN;.;.	T	49;49;49;49;49;49;49;49;45	ENSP00000202917:S49T;ENSP00000388001:S49T;ENSP00000415721:S49T;ENSP00000450286:S49T;ENSP00000448790:S49T;ENSP00000448001:S49T;ENSP00000448348:S45T	ENSP00000202917:S49T	S	+	2	0	OAS1	111829373	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.003000	0.12901	0.710000	0.31997	-0.211000	0.12701	AGC		0.517	OAS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405896.2			5	74	0	0	0	0.001168	0	5	74				
MED13L	23389	broad.mit.edu	37	12	116410034	116410034	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:116410034A>T	ENST00000281928.3	-	26	5945	c.5739T>A	c.(5737-5739)agT>agA	p.S1913R		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1913						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.S1913R(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CAAGGAGGATACTCCAATCTG	0.418																																							uc001tvw.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8						c.(5737-5739)AGT>AGA		mediator complex subunit 13-like							97.0	91.0	93.0					12																	116410034		2203	4300	6503	SO:0001583	missense	23389				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent			g.chr12:116410034A>T	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.5739T>A	12.37:g.116410034A>T	ENSP00000281928:p.Ser1913Arg						p.S1913R	NM_015335	NP_056150	Q71F56	MD13L_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0407)	26	5794	-	all_neural(191;0.117)|Medulloblastoma(191;0.163)		1913					A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	c.5739T>A	CCDS9177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.80|18.80	3.701626|3.701626	0.68501|0.68501	.|.	.|.	ENSG00000123066|ENSG00000123066	ENST00000281928|ENST00000552447	D|.	0.82984|.	-1.67|.	4.76|4.76	1.25|1.25	0.21368|0.21368	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71484|0.71484	0.3345|0.3345	M|M	0.83012|0.83012	2.62|2.62	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.87578|.	0.998|.	T|T	0.70033|0.70033	-0.4983|-0.4983	10|5	0.87932|.	D|.	0|.	-12.2036|-12.2036	8.8148|8.8148	0.34989|0.34989	0.6979:0.0:0.3021:0.0|0.6979:0.0:0.3021:0.0	.|.	1913|.	Q71F56|.	MD13L_HUMAN|.	R|N	1913|118	ENSP00000281928:S1913R|.	ENSP00000281928:S1913R|.	S|Y	-|-	3|1	2|0	MED13L|MED13L	114894417|114894417	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	0.851000|0.851000	0.27751|0.27751	0.424000|0.424000	0.26061|0.26061	0.460000|0.460000	0.39030|0.39030	AGT|TAT		0.418	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3			10	73	0	0	0	0.008291	0	10	73				
MED13L	23389	broad.mit.edu	37	12	116421096	116421096	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:116421096G>A	ENST00000281928.3	-	21	4987	c.4781C>T	c.(4780-4782)cCt>cTt	p.P1594L		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1594	Ser-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.P1594L(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GCTAATACCAGGAGCAGAGGC	0.507																																							uc001tvw.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8						c.(4780-4782)CCT>CTT		mediator complex subunit 13-like							117.0	109.0	112.0					12																	116421096		2203	4300	6503	SO:0001583	missense	23389				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent			g.chr12:116421096G>A	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.4781C>T	12.37:g.116421096G>A	ENSP00000281928:p.Pro1594Leu						p.P1594L	NM_015335	NP_056150	Q71F56	MD13L_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0407)	21	4836	-	all_neural(191;0.117)|Medulloblastoma(191;0.163)		1594			Ser-rich.		A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	c.4781C>T	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.797174	0.70567	.	.	ENSG00000123066	ENST00000281928	T	0.74947	-0.89	5.87	5.87	0.94306	.	0.319242	0.33670	N	0.004669	T	0.64461	0.2600	N	0.19112	0.55	0.80722	D	1	P	0.37423	0.594	B	0.34722	0.188	T	0.65804	-0.6079	10	0.49607	T	0.09	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	1594	Q71F56	MD13L_HUMAN	L	1594	ENSP00000281928:P1594L	ENSP00000281928:P1594L	P	-	2	0	MED13L	114905479	1.000000	0.71417	0.967000	0.41034	0.963000	0.63663	6.366000	0.73095	2.941000	0.99782	0.655000	0.94253	CCT		0.507	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3			5	36	0	0	0	0.001168	0	5	36				
CIT	11113	broad.mit.edu	37	12	120214178	120214178	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:120214178T>A	ENST00000261833.7	-	15	1923	c.1871A>T	c.(1870-1872)tAt>tTt	p.Y624F	CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Missense_Mutation_p.Y624F	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	624					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.Y624F(2)|p.Y625F(1)		breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		CAGTTTCGCATATTCTCCCAC	0.358																																							uc001txi.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10						c.(1870-1872)TAT>TTT		citron							165.0	176.0	173.0					12																	120214178		2203	4300	6503	SO:0001583	missense	11113				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity	g.chr12:120214178T>A	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.1871A>T	12.37:g.120214178T>A	ENSP00000261833:p.Tyr624Phe					CIT_uc001txh.1_Missense_Mutation_p.Y158F|CIT_uc001txj.1_Missense_Mutation_p.Y624F	p.Y624F	NM_007174	NP_009105	O14578	CTRO_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.211)	15	1924	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)	624			Potential.		Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	c.1871A>T	CCDS9192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.061|5.061	0.196873|0.196873	0.09599|0.09599	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392520|ENST00000392521;ENST00000261833	.|T;T	.|0.77620	.|-1.11;-0.07	5.94|5.94	3.46|3.46	0.39613|0.39613	.|.	.|0.386686	.|0.25487	.|N	.|0.030323	T|T	0.53578|0.53578	0.1805|0.1805	N|N	0.08118|0.08118	0|0	0.31437|0.31437	N|N	0.672441|0.672441	.|B;B;B	.|0.13145	.|0.007;0.0;0.0	.|B;B;B	.|0.12156	.|0.007;0.0;0.001	T|T	0.47586|0.47586	-0.9106|-0.9106	5|10	.|0.12103	.|T	.|0.63	.|.	8.1565|8.1565	0.31171|0.31171	0.1205:0.0658:0.0:0.8137|0.1205:0.0658:0.0:0.8137	.|.	.|624;624;157	.|Q2M5E1;O14578;O14578-3	.|.;CTRO_HUMAN;.	L|F	252|624	.|ENSP00000376306:Y624F;ENSP00000261833:Y624F	.|ENSP00000261833:Y624F	M|Y	-|-	1|2	0|0	CIT|CIT	118698561|118698561	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.516000|0.516000	0.34256|0.34256	3.501000|3.501000	0.53325|0.53325	0.430000|0.430000	0.26230|0.26230	0.459000|0.459000	0.35465|0.35465	ATG|TAT		0.358	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174		48	199	0	0	0	0.00361	0	48	199				
LRRC43	254050	broad.mit.edu	37	12	122684775	122684775	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:122684775G>T	ENST00000339777.4	+	8	1417	c.1389G>T	c.(1387-1389)gaG>gaT	p.E463D	LRRC43_ENST00000425921.1_Missense_Mutation_p.E278D	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	463								p.E278D(1)|p.E463D(1)		NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		CCTGGGCTGAGGTCATCCCCT	0.652																																							uc009zxm.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1387-1389)GAG>GAT		leucine rich repeat containing 43 isoform 1							110.0	116.0	114.0					12																	122684775		2113	4219	6332	SO:0001583	missense	254050							g.chr12:122684775G>T	AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1389G>T	12.37:g.122684775G>T	ENSP00000344233:p.Glu463Asp					LRRC43_uc001ubw.3_Missense_Mutation_p.E278D|LRRC43_uc009zxn.2_Missense_Mutation_p.E224D	p.E463D	NM_001098519	NP_001091989	Q8N309	LRC43_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)	8	1414	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		463					Q6ZVT9	Missense_Mutation	SNP	ENST00000339777.4	37	c.1389G>T	CCDS45001.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.171489	0.00315	.	.	ENSG00000158113	ENST00000339777;ENST00000289014;ENST00000425921	T;T	0.56103	0.48;0.91	4.85	-5.55	0.02536	.	0.600314	0.16377	N	0.217057	T	0.17619	0.0423	N	0.03281	-0.365	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.33523	-0.9865	10	0.02654	T	1	-17.806	7.8039	0.29191	0.0:0.2489:0.3968:0.3543	.	463	Q8N309	LRC43_HUMAN	D	463;334;278	ENSP00000344233:E463D;ENSP00000416628:E278D	ENSP00000289014:E334D	E	+	3	2	LRRC43	121250728	0.000000	0.05858	0.001000	0.08648	0.033000	0.12548	-3.189000	0.00565	-1.155000	0.02822	-0.344000	0.07964	GAG		0.652	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	NM_152759		11	57	1	0	0.000978159	0.000978	0.00112448	11	57				
P2RX2	22953	broad.mit.edu	37	12	133196474	133196474	+	Nonsense_Mutation	SNP	C	C	A	rs201447971	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:133196474C>A	ENST00000389110.3	+	4	463	c.426C>A	c.(424-426)tgC>tgA	p.C142*	P2RX2_ENST00000449132.2_Nonsense_Mutation_p.C118*|P2RX2_ENST00000351222.4_Nonsense_Mutation_p.C50*|P2RX2_ENST00000352418.4_Intron|P2RX2_ENST00000350048.5_Nonsense_Mutation_p.C118*|P2RX2_ENST00000348800.5_Nonsense_Mutation_p.C142*|P2RX2_ENST00000343948.4_Nonsense_Mutation_p.C142*	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	142					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)	p.C142*(1)		NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		ACGCCGACTGCGTGGCTGGGG	0.697													C|||	2	0.000399361	0.0	0.0	5008	,	,		9506	0.0		0.002	False		,,,				2504	0.0						uc001ukj.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(424-426)TGC>TGA		purinergic receptor P2X2 isoform A							13.0	15.0	14.0					12																	133196474		2182	4283	6465	SO:0001587	stop_gained	22953				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|protein homooligomerization	integral to membrane	ATP binding|extracellular ATP-gated cation channel activity|identical protein binding|purinergic nucleotide receptor activity	g.chr12:133196474C>A	AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.426C>A	12.37:g.133196474C>A	ENSP00000373762:p.Cys142*					P2RX2_uc001uki.1_Nonsense_Mutation_p.C142*|P2RX2_uc001ukk.1_Nonsense_Mutation_p.C142*|P2RX2_uc001ukl.1_Nonsense_Mutation_p.C118*|P2RX2_uc001ukm.1_Intron|P2RX2_uc001ukn.1_Nonsense_Mutation_p.C50*|P2RX2_uc009zyt.1_Nonsense_Mutation_p.C142*|P2RX2_uc001uko.1_Nonsense_Mutation_p.C118*	p.C142*	NM_170682	NP_733782	Q9UBL9	P2RX2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)	4	426	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)	142			Extracellular (Potential).		A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Nonsense_Mutation	SNP	ENST00000389110.3	37	c.426C>A	CCDS31931.1	3|3	0.0013736263736263737|0.0013736263736263737	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	3|3	0.00395778364116095|0.00395778364116095	C|C	6.980|6.980	0.550783|0.550783	0.13374|0.13374	.|.	.|.	ENSG00000187848|ENSG00000187848	ENST00000542301;ENST00000536121;ENST00000535910|ENST00000389110;ENST00000449132;ENST00000343948;ENST00000350048;ENST00000351222;ENST00000348800	.|.	.|.	.|.	4.32|4.32	-3.58|-3.58	0.04597|0.04597	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.23249|.	0.0562|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.41998|.	-0.9477|.	3|.	.|0.02654	.|T	.|1	-22.8712|-22.8712	12.9057|12.9057	0.58152|0.58152	0.0:0.3952:0.0:0.6048|0.0:0.3952:0.0:0.6048	.|.	.|.	.|.	.|.	E|X	153;128;98|142;118;142;118;50;142	.|.	.|ENSP00000343339:C142X	A|C	+|+	2|3	0|2	P2RX2|P2RX2	131706547|131706547	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-2.068000|-2.068000	0.01382|0.01382	-1.650000|-1.650000	0.01506|0.01506	-1.134000|-1.134000	0.01955|0.01955	GCG|TGC		0.697	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397542.1			4	15	1	0	0.00909568	0.009096	0.00994674	4	15				
TPTE2	93492	broad.mit.edu	37	13	20024286	20024286	+	Silent	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:20024286G>C	ENST00000400230.2	-	13	947	c.903C>G	c.(901-903)acC>acG	p.T301T	TPTE2_ENST00000400103.2_Silent_p.T190T|TPTE2_ENST00000390680.2_Silent_p.T224T|TPTE2_ENST00000382975.4_Silent_p.T261T|TPTE2_ENST00000457266.2_Silent_p.T190T|TPTE2_ENST00000382978.1_Silent_p.T261T|TPTE2_ENST00000382977.4_Silent_p.T301T|TPTE2_ENST00000255310.6_Silent_p.T224T			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	301	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.T301T(1)|p.T224T(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		TTACTTCCTTGGTGAAAACCA	0.333																																							uc001umd.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(901-903)ACC>ACG		TPTE and PTEN homologous inositol lipid							43.0	45.0	45.0					13																	20024286		2194	4278	6472	SO:0001819	synonymous_variant	93492					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr13:20024286G>C	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.903C>G	13.37:g.20024286G>C						TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Silent_p.T190T|TPTE2_uc001ume.2_Silent_p.T224T|TPTE2_uc009zzm.2_Intron|TPTE2_uc010tcm.1_RNA	p.T301T	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)	14	1114	-		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)	301			Phosphatase tensin-type.		A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Silent	SNP	ENST00000400230.2	37	c.903C>G	CCDS45014.1																																																																																				0.333	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254		11	87	0	0	0	0.001855	0	11	87				
HSPH1	10808	broad.mit.edu	37	13	31711466	31711466	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:31711466C>A	ENST00000320027.5	-	18	2910	c.2566G>T	c.(2566-2568)Gac>Tac	p.D856Y	HSPH1_ENST00000380406.5_Missense_Mutation_p.D815Y|HSPH1_ENST00000380405.4_Missense_Mutation_p.D812Y|HSPH1_ENST00000445273.2_Missense_Mutation_p.D858Y|HSPH1_ENST00000429785.2_Missense_Mutation_p.D675Y	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	856					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.D856Y(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		TAGTCCAAGTCCATATTAACA	0.299																																							uc001utj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2566-2568)GAC>TAC		heat shock 105kD							146.0	137.0	140.0					13																	31711466		2203	4300	6503	SO:0001583	missense	10808				positive regulation of MHC class I biosynthetic process|positive regulation of NK T cell activation|response to unfolded protein	cytoplasm|extracellular region	ATP binding	g.chr13:31711466C>A	AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.2566G>T	13.37:g.31711466C>A	ENSP00000318687:p.Asp856Tyr					HSPH1_uc001utk.2_Missense_Mutation_p.D812Y|HSPH1_uc010aaw.2_Missense_Mutation_p.D815Y|HSPH1_uc001utl.2_Missense_Mutation_p.D858Y|HSPH1_uc010tds.1_Missense_Mutation_p.D780Y	p.D856Y	NM_006644	NP_006635	Q92598	HS105_HUMAN		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)	18	2964	-		Lung SC(185;0.0257)	856					B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Missense_Mutation	SNP	ENST00000320027.5	37	c.2566G>T	CCDS9340.1	.	.	.	.	.	.	.	.	.	.	C	19.33	3.807345	0.70797	.	.	ENSG00000120694	ENST00000320027;ENST00000380405;ENST00000380406;ENST00000445273;ENST00000429785	T;T;T;T;T	0.06068	4.79;4.67;4.7;4.6;3.35	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.28599	0.0708	M	0.75777	2.31	0.58432	D	0.999992	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.982;0.996;0.98;0.991;0.98	T	0.00254	-1.1874	10	0.87932	D	0	-35.1568	20.1542	0.98100	0.0:1.0:0.0:0.0	.	675;815;858;812;856	B4DY72;Q92598-3;B4DYH1;Q92598-2;Q92598	.;.;.;.;HS105_HUMAN	Y	856;812;815;858;675	ENSP00000318687:D856Y;ENSP00000369768:D812Y;ENSP00000369769:D815Y;ENSP00000396090:D858Y;ENSP00000388778:D675Y	ENSP00000318687:D856Y	D	-	1	0	HSPH1	30609466	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.822000	0.69265	2.767000	0.95098	0.563000	0.77884	GAC		0.299	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044384.1			22	128	1	0	3.5997e-14	0.002299	5.73702e-14	22	128				
ENOX1	55068	broad.mit.edu	37	13	43933986	43933986	+	Splice_Site	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:43933986C>G	ENST00000261488.6	-	7	1167		c.e7+1		ENOX1_ENST00000412891.1_Splice_Site|ENOX1_ENST00000482207.1_5'UTR|ENOX1_ENST00000540032.1_Splice_Site	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1						rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)	p.?(2)		breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		ATGCAAAGTACCAGAAAGGTA	0.358																																							uc001uza.3		NA																	2	Unknown(2)		lung(2)	pancreas(1)|skin(1)	2						c.e7+1		ecto-NOX disulfide-thiol exchanger 1							96.0	92.0	94.0					13																	43933986		2203	4300	6503	SO:0001630	splice_region_variant	55068				electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity	g.chr13:43933986C>G	EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.589+1G>C	13.37:g.43933986C>G						ENOX1_uc001uzb.3_Splice_Site_p.G197_splice|ENOX1_uc001uzc.3_Splice_Site_p.G197_splice|ENOX1_uc010tfm.1_Splice_Site_p.G10_splice	p.G197_splice	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)	7	889	-		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)						A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Splice_Site	SNP	ENST00000261488.6	37	c.589_splice	CCDS9389.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767507	0.69878	.	.	ENSG00000120658	ENST00000261488;ENST00000412891;ENST00000540032	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ENOX1	42831986	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.350000	0.79385	2.824000	0.97209	0.655000	0.94253	.		0.358	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2	NM_017993	Intron	7	134	0	0	0	0.001984	0	7	134				
NUDT15	55270	broad.mit.edu	37	13	48619794	48619794	+	Splice_Site	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:48619794A>T	ENST00000258662.2	+	3	535		c.e3-1			NM_018283.1	NP_060753.1	Q9NV35	NUD15_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 15						dGTP catabolic process (GO:0006203)|GTP catabolic process (GO:0006184)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity (GO:0035539)|8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity (GO:0008413)|metal ion binding (GO:0046872)	p.?(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(1)	7		all_cancers(8;3.75e-25)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|all_hematologic(8;0.000219)|Lung NSC(96;0.000226)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;4.83e-07)		TTTCTTTTCTAGGTTGGGAGT	0.353																																							uc001vbw.1		NA																	1	Unknown(1)		lung(1)		0						c.e3-2		nudix-type motif 15							59.0	63.0	61.0					13																	48619794		2203	4300	6503	SO:0001630	splice_region_variant	55270						hydrolase activity|metal ion binding	g.chr13:48619794A>T		CCDS9407.1	13q14.12	2006-04-12			ENSG00000136159	ENSG00000136159		"""Nudix motif containing"""	23063	protein-coding gene	gene with protein product		615792				12767940	Standard	NM_018283		Approved	MTH2, FLJ10956	uc001vbw.1	Q9NV35	OTTHUMG00000016890	ENST00000258662.2:c.356-1A>T	13.37:g.48619794A>T							p.S119_splice	NM_018283	NP_060753	Q9NV35	NUD15_HUMAN		GBM - Glioblastoma multiforme(144;4.83e-07)	3	536	+		all_cancers(8;3.75e-25)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|all_hematologic(8;0.000219)|Lung NSC(96;0.000226)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)						A2RUR6|Q32Q27|Q6P2C9	Splice_Site	SNP	ENST00000258662.2	37	c.356_splice	CCDS9407.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.614749	0.46631	.	.	ENSG00000136159	ENST00000258662	.	.	.	5.67	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5178	0.44900	0.9237:0.0:0.0763:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NUDT15	47517795	1.000000	0.71417	0.975000	0.42487	0.545000	0.35147	6.063000	0.71162	1.003000	0.39130	-0.250000	0.11733	.		0.353	NUDT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044862.3	NM_018283	Intron	4	59	0	0	0	0.009096	0	4	59				
PCDH8	5100	broad.mit.edu	37	13	53422253	53422253	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:53422253C>G	ENST00000377942.3	-	1	522	c.319G>C	c.(319-321)Gat>Cat	p.D107H	PCDH8_ENST00000338862.4_Missense_Mutation_p.D107H	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	107	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.D107H(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CTGACCACATCGAAGGCCAGC	0.711																																					GBM(36;25 841 9273 49207)	GBM(36;25 841 9273 49207)	uc001vhi.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(319-321)GAT>CAT		protocadherin 8 isoform 1 precursor							40.0	37.0	38.0					13																	53422253		2203	4299	6502	SO:0001583	missense	5100				cell-cell signaling|homophilic cell adhesion	cell junction|dendrite|integral to plasma membrane|postsynaptic membrane|presynaptic membrane	calcium ion binding	g.chr13:53422253C>G	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.319G>C	13.37:g.53422253C>G	ENSP00000367177:p.Asp107His					PCDH8_uc001vhj.2_Missense_Mutation_p.D107H	p.D107H	NM_002590	NP_002581	O95206	PCDH8_HUMAN		GBM - Glioblastoma multiforme(99;2.19e-08)	1	522	-		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	107			Extracellular (Potential).|Cadherin 1.		B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	37	c.319G>C	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.193134	0.78902	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.28255	1.62;1.62	4.46	4.46	0.54185	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.42682	D	0.000661	T	0.64757	0.2627	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75280	-0.3373	10	0.87932	D	0	.	17.3354	0.87278	0.0:1.0:0.0:0.0	.	107;107	O95206-2;O95206	.;PCDH8_HUMAN	H	107	ENSP00000367177:D107H;ENSP00000341350:D107H	ENSP00000341350:D107H	D	-	1	0	PCDH8	52320254	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.872000	0.69636	2.337000	0.79520	0.561000	0.74099	GAT		0.711	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590		4	36	0	0	0	0.009096	0	4	36				
LMO7	4008	broad.mit.edu	37	13	76379705	76379705	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:76379705A>T	ENST00000321797.8	+	7	1027	c.306A>T	c.(304-306)aaA>aaT	p.K102N	LMO7_ENST00000465261.2_Missense_Mutation_p.K102N|LMO7_ENST00000341547.4_Intron|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000377534.3_Missense_Mutation_p.K387N|LMO7_ENST00000526202.1_Intron|LMO7_ENST00000357063.3_Missense_Mutation_p.K387N			Q8WWI1	LMO7_HUMAN	LIM domain 7	387	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K102N(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AAGAGGAAAAAGCAAAGACAA	0.428																																							uc001vjv.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5						c.(304-306)AAA>AAT		LIM domain only 7 isoform 2							228.0	205.0	212.0					13																	76379705		1568	3582	5150	SO:0001583	missense	4008					cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding	g.chr13:76379705A>T	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.306A>T	13.37:g.76379705A>T	ENSP00000317802:p.Lys102Asn					LMO7_uc010thv.1_Intron|LMO7_uc001vjt.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vjw.1_Intron	p.K102N	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN		GBM - Glioblastoma multiforme(99;0.0109)	6	1066	+		Breast(118;0.0992)	387					E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	37	c.306A>T		.	.	.	.	.	.	.	.	.	.	A	12.46	1.944542	0.34283	.	.	ENSG00000136153	ENST00000357063;ENST00000377534;ENST00000321797;ENST00000465261;ENST00000526371	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.8	2.08	0.27032	.	0.452188	0.24330	N	0.039467	T	0.25044	0.0608	N	0.08118	0	0.22199	N	0.999292	B	0.21520	0.057	B	0.18871	0.023	T	0.07712	-1.0758	10	0.27082	T	0.32	-4.3915	4.1213	0.10106	0.536:0.1772:0.2867:0.0	.	102	E9PLH4	.	N	387;387;102;102;102	ENSP00000349571:K387N;ENSP00000366757:K387N;ENSP00000317802:K102N;ENSP00000433352:K102N;ENSP00000432269:K102N	ENSP00000317802:K102N	K	+	3	2	LMO7	75277706	0.990000	0.36364	0.767000	0.31495	0.675000	0.39556	0.490000	0.22403	0.982000	0.38575	0.383000	0.25322	AAA		0.428	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358		22	172	0	0	0	0.010504	0	22	172				
SLITRK1	114798	broad.mit.edu	37	13	84453826	84453826	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:84453826G>A	ENST00000377084.2	-	1	2702	c.1817C>T	c.(1816-1818)tCc>tTc	p.S606F		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	606					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.S606F(1)|p.S606>?(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GTAGGAGTTGGAGTGCGTCCC	0.587																																							uc001vlk.2		NA																	2	Substitution - Missense(1)|Complex(1)		lung(2)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(1816-1818)TCC>TTC		slit and trk like 1 protein precursor							99.0	85.0	90.0					13																	84453826		2203	4300	6503	SO:0001583	missense	114798					integral to membrane		g.chr13:84453826G>A	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1817C>T	13.37:g.84453826G>A	ENSP00000366288:p.Ser606Phe						p.S606F	NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	2703	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	606			Extracellular (Potential).		Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	c.1817C>T	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527961	0.44969	.	.	ENSG00000178235	ENST00000377084	T	0.59772	0.24	5.41	5.41	0.78517	.	0.059006	0.64402	D	0.000001	T	0.57548	0.2061	L	0.58101	1.795	0.53005	D	0.999961	B	0.10296	0.003	B	0.13407	0.009	T	0.54721	-0.8251	10	0.52906	T	0.07	-11.7241	18.1337	0.89610	0.0:0.0:1.0:0.0	.	606	Q96PX8	SLIK1_HUMAN	F	606	ENSP00000366288:S606F	ENSP00000366288:S606F	S	-	2	0	SLITRK1	83351827	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.544000	0.73878	2.709000	0.92574	0.655000	0.94253	TCC		0.587	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		3	12	0	0	0	0.004672	0	3	12				
SLITRK6	84189	broad.mit.edu	37	13	86368638	86368638	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:86368638G>C	ENST00000400286.2	-	2	2604	c.2006C>G	c.(2005-2007)aCt>aGt	p.T669S		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	669					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.T669S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TCTTTCAGTAGTGTGATGAGT	0.443																																							uc001vll.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(2005-2007)ACT>AGT		slit and trk like 6 precursor							208.0	200.0	202.0					13																	86368638		2005	4165	6170	SO:0001583	missense	84189					integral to membrane		g.chr13:86368638G>C	AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.2006C>G	13.37:g.86368638G>C	ENSP00000383143:p.Thr669Ser					SLITRK6_uc010afe.1_Intron	p.T669S	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN		GBM - Glioblastoma multiforme(99;0.0456)	2	2465	-	all_neural(89;0.117)|Medulloblastoma(90;0.163)		669			Cytoplasmic (Potential).		A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	ENST00000400286.2	37	c.2006C>G	CCDS41903.1	.	.	.	.	.	.	.	.	.	.	G	6.585	0.476220	0.12521	.	.	ENSG00000184564	ENST00000400286	T	0.56444	0.46	5.84	4.97	0.65823	.	0.194551	0.32578	U	0.005914	T	0.30479	0.0766	N	0.08118	0	0.44789	D	0.997793	B	0.18968	0.032	B	0.22152	0.038	T	0.10222	-1.0639	10	0.12430	T	0.62	-4.6165	11.6763	0.51432	0.0907:0.0:0.9093:0.0	.	669	Q9H5Y7	SLIK6_HUMAN	S	669	ENSP00000383143:T669S	ENSP00000383143:T669S	T	-	2	0	SLITRK6	85266639	1.000000	0.71417	0.755000	0.31263	0.962000	0.63368	5.202000	0.65169	1.383000	0.46405	0.655000	0.94253	ACT		0.443	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2	NM_032229		33	191	0	0	0	0.002836	0	33	191				
UGGT2	55757	broad.mit.edu	37	13	96519616	96519616	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:96519616T>G	ENST00000376747.3	-	30	3605	c.3535A>C	c.(3535-3537)Aaa>Caa	p.K1179Q		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1179					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.K1179Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						ATCTTGCTTTTGAAGCTGTTT	0.289																																							uc001vmt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(3535-3537)AAA>CAA		UDP-glucose ceramide glucosyltransferase-like 2							130.0	142.0	138.0					13																	96519616		2203	4295	6498	SO:0001583	missense	55757				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity	g.chr13:96519616T>G	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.3535A>C	13.37:g.96519616T>G	ENSP00000365938:p.Lys1179Gln						p.K1179Q	NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN			30	3705	-			1179					A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	37	c.3535A>C	CCDS9480.1	.	.	.	.	.	.	.	.	.	.	T	17.91	3.505553	0.64410	.	.	ENSG00000102595	ENST00000376747	T	0.07908	3.15	5.22	4.04	0.47022	.	0.190001	0.51477	D	0.000083	T	0.09642	0.0237	M	0.64676	1.99	0.80722	D	1	B	0.32731	0.382	B	0.32465	0.146	T	0.10730	-1.0617	10	0.12766	T	0.61	-11.4003	11.1062	0.48203	0.0:0.0731:0.0:0.9269	.	1179	Q9NYU1	UGGG2_HUMAN	Q	1179	ENSP00000365938:K1179Q	ENSP00000365938:K1179Q	K	-	1	0	UGGT2	95317617	1.000000	0.71417	0.995000	0.50966	0.848000	0.48234	5.013000	0.64023	0.934000	0.37316	0.455000	0.32223	AAA		0.289	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121		9	147	0	0	0	0.001368	0	9	147				
SLC15A1	6564	broad.mit.edu	37	13	99356687	99356687	+	Silent	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:99356687T>C	ENST00000376503.5	-	17	1327	c.1272A>G	c.(1270-1272)acA>acG	p.T424T		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	424					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)	p.T424T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TAAATGCATTTGTCTATAGAG	0.423																																							uc001vno.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1270-1272)ACA>ACG		solute carrier family 15 (oligopeptide	Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)						160.0	150.0	153.0					13																	99356687		2203	4300	6503	SO:0001819	synonymous_variant	6564				digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity	g.chr13:99356687T>C	U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.1272A>G	13.37:g.99356687T>C							p.T424T	NM_005073	NP_005064	P46059	S15A1_HUMAN			17	1349	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		424			Extracellular (Potential).		Q5VW82	Silent	SNP	ENST00000376503.5	37	c.1272A>G	CCDS9489.1																																																																																				0.423	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045560.3	NM_005073		14	129	0	0	0	0.00245	0	14	129				
SLC15A1	6564	broad.mit.edu	37	13	99378453	99378453	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:99378453G>T	ENST00000376503.5	-	4	224	c.169C>A	c.(169-171)Cat>Aat	p.H57N		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	57					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)	p.H57N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	ACAAACGTATGGTAGATGGCG	0.498																																							uc001vno.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(169-171)CAT>AAT		solute carrier family 15 (oligopeptide	Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)						94.0	78.0	83.0					13																	99378453		2203	4300	6503	SO:0001583	missense	6564				digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity	g.chr13:99378453G>T	U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.169C>A	13.37:g.99378453G>T	ENSP00000365686:p.His57Asn					SLC15A1_uc001vnp.1_Missense_Mutation_p.H25N	p.H57N	NM_005073	NP_005064	P46059	S15A1_HUMAN			4	246	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		57			Helical; (Potential).		Q5VW82	Missense_Mutation	SNP	ENST00000376503.5	37	c.169C>A	CCDS9489.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857859	0.91433	.	.	ENSG00000088386	ENST00000376503;ENST00000376494;ENST00000313260	T	0.58210	0.35	6.17	6.17	0.99709	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.68860	0.3047	L	0.45137	1.4	0.80722	D	1	B;D	0.89917	0.449;1.0	B;D	0.91635	0.168;0.999	T	0.66586	-0.5886	10	0.59425	D	0.04	-15.2555	20.8794	0.99867	0.0:0.0:1.0:0.0	.	25;57	Q9BZ22;P46059	.;S15A1_HUMAN	N	57;25;67	ENSP00000365686:H57N	ENSP00000318937:H67N	H	-	1	0	SLC15A1	98176454	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	9.837000	0.99465	2.941000	0.99782	0.655000	0.94253	CAT		0.498	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045560.3	NM_005073		9	41	1	0	0.000274275	0.004482	0.000324617	9	41				
GPR183	1880	broad.mit.edu	37	13	99947695	99947696	+	Missense_Mutation	DNP	TT	TT	GA			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	TT	TT	-	-	TT	TT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:99947695_99947696TT>GA	ENST00000376414.4	-	2	787_788	c.704_705AA>TC	c.(703-705)aAA>aTC	p.K235I	UBAC2_ENST00000403766.3_Intron|UBAC2_ENST00000376440.2_Intron	NM_004951.4	NP_004942.1	P32249	GP183_HUMAN	G protein-coupled receptor 183	235					G-protein coupled receptor signaling pathway (GO:0007186)|humoral immune response (GO:0006959)|immune response (GO:0006955)|mature B cell differentiation involved in immune response (GO:0002313)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|oxysterol binding (GO:0008142)	p.K235I(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	23						TTACACCAGATTTCTCAGTGAG	0.351																																							uc001vog.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(703-705)AAA>ATC		EBV-induced G protein-coupled receptor 2																																				SO:0001583	missense	1880				humoral immune response|mature B cell differentiation involved in immune response	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr13:99947695_99947696TT>GA	L08177	CCDS9492.1	13q32.3	2012-08-21	2008-07-21	2008-07-21	ENSG00000169508	ENSG00000169508		"""GPCR / Class A : Orphans"""	3128	protein-coding gene	gene with protein product	"""EBV-induced G-protein coupled receptor 2"""	605741	"""Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor)"""	EBI2		8383238	Standard	NM_004951		Approved		uc001vog.3	P32249	OTTHUMG00000017263	ENST00000376414.4:c.704_705delinsGA	13.37:g.99947695_99947696delinsGA	ENSP00000365596:p.Lys235Ile					UBAC2_uc001voa.3_Intron|UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	p.K235I	NM_004951	NP_004942	P32249	GP183_HUMAN			2	878_879	-			235			Cytoplasmic (Potential).		B2R8N5|Q53F99|Q5JUH7	Missense_Mutation	DNP	ENST00000376414.4	37	c.704_705AA>TC	CCDS9492.1																																																																																				0.351	GPR183-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045582.2	NM_004951		12	124	0	0	0	0.004672	0	12	124				
NALCN	259232	broad.mit.edu	37	13	101756709	101756709	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:101756709T>A	ENST00000251127.6	-	25	2907	c.2826A>T	c.(2824-2826)ttA>ttT	p.L942F		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	942					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.L942F(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GAGTGAAAAATAAGCCATCTG	0.363																																							uc001vox.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(2824-2826)TTA>TTT		voltage gated channel like 1							99.0	94.0	96.0					13																	101756709		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101756709T>A	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2826A>T	13.37:g.101756709T>A	ENSP00000251127:p.Leu942Phe						p.L942F	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN			25	3015	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		942			Helical; Name=S2 of repeat III; (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.2826A>T	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	T	19.18	3.776990	0.70107	.	.	ENSG00000102452	ENST00000251127	D	0.98221	-4.8	5.66	-1.38	0.09027	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.95351	0.8491	N	0.17901	0.54	0.80722	D	1	P	0.49307	0.922	P	0.51701	0.677	D	0.91133	0.4939	10	0.21014	T	0.42	.	11.2203	0.48851	0.0:0.511:0.0:0.489	.	942	Q8IZF0	NALCN_HUMAN	F	942	ENSP00000251127:L942F	ENSP00000251127:L942F	L	-	3	2	NALCN	100554710	0.948000	0.32251	0.997000	0.53966	0.995000	0.86356	0.016000	0.13377	-0.107000	0.12088	-0.256000	0.11100	TTA		0.363	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		9	66	0	0	0	0.006214	0	9	66				
NALCN	259232	broad.mit.edu	37	13	101756712	101756712	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr13:101756712G>A	ENST00000251127.6	-	25	2904	c.2823C>T	c.(2821-2823)ggC>ggT	p.G941G		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	941					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.G941G(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGAAAAATAAGCCATCTGCCA	0.368																																							uc001vox.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(2821-2823)GGC>GGT		voltage gated channel like 1							100.0	94.0	96.0					13																	101756712		2203	4300	6503	SO:0001819	synonymous_variant	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101756712G>A	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2823C>T	13.37:g.101756712G>A							p.G941G	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN			25	3012	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		941			Helical; Name=S2 of repeat III; (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	ENST00000251127.6	37	c.2823C>T	CCDS9498.1																																																																																				0.368	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		8	66	0	0	0	0.006214	0	8	66				
OR4K5	79317	broad.mit.edu	37	14	20389008	20389008	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:20389008G>T	ENST00000315915.4	+	1	268	c.243G>T	c.(241-243)atG>atT	p.M81I		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M81I(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCCCTAAAATGATTGCAGATT	0.438																																							uc010tkw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(241-243)ATG>ATT		olfactory receptor, family 4, subfamily K,							283.0	304.0	297.0					14																	20389008		2203	4300	6503	SO:0001583	missense	79317				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20389008G>T	BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.243G>T	14.37:g.20389008G>T	ENSP00000319511:p.Met81Ile						p.M81I	NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	243	+	all_cancers(95;0.00108)		81			Extracellular (Potential).		Q6IFA7	Missense_Mutation	SNP	ENST00000315915.4	37	c.243G>T	CCDS32024.1	.	.	.	.	.	.	.	.	.	.	.	15.88	2.964055	0.53507	.	.	ENSG00000176281	ENST00000315915	T	0.05513	3.43	4.31	4.31	0.51392	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000012	T	0.20129	0.0484	M	0.71871	2.18	0.09310	N	1	D	0.64830	0.994	P	0.60173	0.87	T	0.01436	-1.1355	10	0.72032	D	0.01	.	14.2937	0.66298	0.0:0.0:1.0:0.0	.	81	Q8NGD3	OR4K5_HUMAN	I	81	ENSP00000319511:M81I	ENSP00000319511:M81I	M	+	3	0	OR4K5	19458848	0.028000	0.19301	0.837000	0.33122	0.875000	0.50365	0.724000	0.25954	2.212000	0.71576	0.655000	0.94253	ATG		0.438	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409867.1	NM_001005483		33	362	1	0	2.80507e-11	0.002445	4.28786e-11	33	362				
RNASE2	6036	broad.mit.edu	37	14	21424014	21424014	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:21424014A>T	ENST00000304625.2	+	2	174	c.84A>T	c.(82-84)aaA>aaT	p.K28N		NM_002934.2	NP_002925.1	P10153	RNAS2_HUMAN	ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)	28					chemotaxis (GO:0006935)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)|ribonuclease activity (GO:0004540)	p.K28N(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	17	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)		TCCATGTCAAACCTCCACAGT	0.453																																							uc010aif.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(82-84)AAA>AAT		ribonuclease, RNase A family, 2 (liver,							77.0	77.0	77.0					14																	21424014		2203	4300	6503	SO:0001583	missense	6036				chemotaxis|RNA catabolic process	extracellular region|lysosome	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:21424014A>T	X55988	CCDS9561.1	14q11.2	2014-03-13			ENSG00000169385	ENSG00000169385		"""Ribonucleases, RNase A"""	10045	protein-coding gene	gene with protein product		131410		RNS2		1577491, 2734298	Standard	NM_002934		Approved	EDN	uc001vyl.1	P10153	OTTHUMG00000029607	ENST00000304625.2:c.84A>T	14.37:g.21424014A>T	ENSP00000303276:p.Lys28Asn					RNASE2_uc001vyl.1_Missense_Mutation_p.K28N	p.K28N	NM_002934	NP_002925	P10153	RNAS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	2	153	+	all_cancers(95;0.00381)		28					Q52M39|Q9H2B7|Q9UCG7	Missense_Mutation	SNP	ENST00000304625.2	37	c.84A>T	CCDS9561.1	.	.	.	.	.	.	.	.	.	.	a	8.328	0.825889	0.16749	.	.	ENSG00000169385	ENST00000304625	T	0.14266	2.52	1.83	-0.81	0.10860	Ribonuclease A, domain (1);	.	.	.	.	T	0.04770	0.0129	N	0.08118	0	0.09310	N	1	P	0.35139	0.486	B	0.27170	0.077	T	0.31613	-0.9937	9	0.51188	T	0.08	.	2.2776	0.04106	0.4786:0.3156:0.2058:0.0	.	28	P10153	RNAS2_HUMAN	N	28	ENSP00000303276:K28N	ENSP00000303276:K28N	K	+	3	2	RNASE2	20493854	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.569000	0.05902	-0.192000	0.10432	0.374000	0.22700	AAA		0.453	RNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073799.2			5	56	0	0	0	0.000602	0	5	56				
MYH6	4624	broad.mit.edu	37	14	23876236	23876236	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:23876236C>A	ENST00000356287.3	-	2	226	c.197G>T	c.(196-198)gGg>gTg	p.G66V	MYH6_ENST00000405093.3_Missense_Mutation_p.G66V			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	66					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.G66V(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		ACTCACCTTCCCATTCTCGGT	0.572																																							uc001wjv.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(196-198)GGG>GTG		myosin heavy chain 6							244.0	244.0	244.0					14																	23876236		2203	4300	6503	SO:0001583	missense	4624				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle	g.chr14:23876236C>A	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.197G>T	14.37:g.23876236C>A	ENSP00000348634:p.Gly66Val					MYH6_uc010akp.1_Missense_Mutation_p.G66V	p.G66V	NM_002471	NP_002462	P13533	MYH6_HUMAN		GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)	3	264	-	all_cancers(95;2.54e-05)		66			Myosin head-like.		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	c.197G>T	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	.	13.22	2.172501	0.38315	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.86497	-2.13;-2.13	3.53	3.53	0.40419	Myosin, N-terminal, SH3-like (1);	.	.	.	.	D	0.93465	0.7915	M	0.85373	2.75	0.80722	D	1	D;D	0.56287	0.975;0.975	D;D	0.71870	0.975;0.975	D	0.94725	0.7904	9	0.87932	D	0	.	15.2325	0.73401	0.0:1.0:0.0:0.0	.	66;66	D9YZU2;P13533	.;MYH6_HUMAN	V	66	ENSP00000386041:G66V;ENSP00000348634:G66V	ENSP00000348634:G66V	G	-	2	0	MYH6	22946076	1.000000	0.71417	0.987000	0.45799	0.014000	0.08584	3.756000	0.55205	1.974000	0.57490	0.455000	0.32223	GGG		0.572	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3			21	447	1	0	3.28513e-13	0.003954	5.16234e-13	21	447				
MYH7	4625	broad.mit.edu	37	14	23894495	23894495	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:23894495G>T	ENST00000355349.3	-	21	2581	c.2419C>A	c.(2419-2421)Cgt>Agt	p.R807S		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	807	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.R807S(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCTCACCTACGTTCCAGCAGC	0.552																																							uc001wjx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(2419-2421)CGT>AGT		myosin, heavy chain 7, cardiac muscle, beta							100.0	81.0	88.0					14																	23894495		2203	4300	6503	SO:0001583	missense	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23894495G>T	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2419C>A	14.37:g.23894495G>T	ENSP00000347507:p.Arg807Ser						p.R807S	NM_000257	NP_000248	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	21	2525	-	all_cancers(95;2.54e-05)		807			IQ.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	c.2419C>A	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.670708	0.67814	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.95482	-3.72	4.36	3.38	0.38709	.	.	.	.	.	D	0.97028	0.9029	M	0.87269	2.87	0.53688	D	0.999971	P	0.48407	0.91	P	0.54664	0.758	D	0.97566	1.0101	9	0.87932	D	0	.	13.9489	0.64104	0.0:0.0:0.7654:0.2346	.	807	P12883	MYH7_HUMAN	S	807	ENSP00000347507:R807S	ENSP00000347507:R807S	R	-	1	0	MYH7	22964335	0.193000	0.23313	1.000000	0.80357	0.928000	0.56348	0.480000	0.22244	2.426000	0.82243	0.563000	0.77884	CGT		0.552	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		11	36	1	0	0.00010058	0.001368	0.000121606	11	36				
MYH7	4625	broad.mit.edu	37	14	23898510	23898510	+	Silent	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:23898510C>G	ENST00000355349.3	-	13	1347	c.1185G>C	c.(1183-1185)ctG>ctC	p.L395L		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	395	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.L395L(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GCCCCTTGAGCAGGTCGGCTG	0.547																																							uc001wjx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(1183-1185)CTG>CTC		myosin, heavy chain 7, cardiac muscle, beta							111.0	96.0	101.0					14																	23898510		2203	4300	6503	SO:0001819	synonymous_variant	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23898510C>G	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.1185G>C	14.37:g.23898510C>G							p.L395L	NM_000257	NP_000248	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	13	1291	-	all_cancers(95;2.54e-05)		395			Myosin head-like.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	c.1185G>C	CCDS9601.1																																																																																				0.547	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		20	71	0	0	0	0.008871	0	20	71				
AKAP6	9472	broad.mit.edu	37	14	33293463	33293463	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:33293463C>A	ENST00000280979.4	+	13	6614	c.6444C>A	c.(6442-6444)gaC>gaA	p.D2148E	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	2148					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.D2148E(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GCTTAGATGACAAGGAAGATA	0.463																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(6442-6444)GAC>GAA		A-kinase anchor protein 6							91.0	86.0	88.0					14																	33293463		2203	4300	6503	SO:0001583	missense	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33293463C>A	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.6444C>A	14.37:g.33293463C>A	ENSP00000280979:p.Asp2148Glu						p.D2148E	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	13	6614	+	Breast(36;0.0388)|Prostate(35;0.15)		2148					A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	c.6444C>A	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	C	8.737	0.917960	0.17982	.	.	ENSG00000151320	ENST00000280979	T	0.51071	0.72	6.03	1.45	0.22620	.	0.424072	0.26210	N	0.025687	T	0.31009	0.0783	L	0.29908	0.895	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.06373	-1.0830	10	0.27785	T	0.31	-4.0743	8.9069	0.35530	0.3686:0.4073:0.2241:0.0	.	2148	Q13023	AKAP6_HUMAN	E	2148	ENSP00000280979:D2148E	ENSP00000280979:D2148E	D	+	3	2	AKAP6	32363214	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	0.425000	0.21346	0.350000	0.24002	0.655000	0.94253	GAC		0.463	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		4	43	1	0	0.00909568	0.009096	0.00994674	4	43				
PELI2	57161	broad.mit.edu	37	14	56763705	56763705	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:56763705C>T	ENST00000267460.4	+	6	1370	c.1084C>T	c.(1084-1086)Cca>Tca	p.P362S		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	362					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)	p.P362S(1)		kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						CGCAGGACCGCCAACTCATGC	0.557																																							uc001xch.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1084-1086)CCA>TCA		pellino 2							167.0	137.0	147.0					14																	56763705		2203	4300	6503	SO:0001583	missense	57161				innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of protein phosphorylation|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	protein binding	g.chr14:56763705C>T	AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.1084C>T	14.37:g.56763705C>T	ENSP00000267460:p.Pro362Ser						p.P362S	NM_021255	NP_067078	Q9HAT8	PELI2_HUMAN			6	1370	+			362					B2RDY5	Missense_Mutation	SNP	ENST00000267460.4	37	c.1084C>T	CCDS9726.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615205	0.87359	.	.	ENSG00000139946	ENST00000267460	T	0.51325	0.71	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.62196	0.2408	M	0.80982	2.52	0.80722	D	1	P	0.40332	0.713	P	0.45377	0.478	T	0.63019	-0.6730	10	0.49607	T	0.09	-17.4774	20.3437	0.98782	0.0:1.0:0.0:0.0	.	362	Q9HAT8	PELI2_HUMAN	S	362	ENSP00000267460:P362S	ENSP00000267460:P362S	P	+	1	0	PELI2	55833458	1.000000	0.71417	0.146000	0.22360	0.969000	0.65631	7.818000	0.86416	2.821000	0.97095	0.555000	0.69702	CCA		0.557	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276925.1			9	138	0	0	0	0.006214	0	9	138				
KIAA0586	9786	broad.mit.edu	37	14	58934504	58934504	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:58934504G>A	ENST00000556134.1	+	17	2535	c.2261G>A	c.(2260-2262)aGc>aAc	p.S754N	KIAA0586_ENST00000261244.5_Missense_Mutation_p.S693N|KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000354386.6_Missense_Mutation_p.S822N|KIAA0586_ENST00000423743.3_Missense_Mutation_p.S725N	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	754					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GTGATTGTCAGCAAGCCACAC	0.393																																							uc001xdv.3		NA																	0				ovary(1)	1						c.(2077-2079)AGC>AAC		talpid3 protein							152.0	148.0	149.0					14																	58934504		1918	4143	6061	SO:0001583	missense	9786							g.chr14:58934504G>A	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.2261G>A	14.37:g.58934504G>A	ENSP00000452351:p.Ser754Asn					KIAA0586_uc010trr.1_Missense_Mutation_p.S810N|KIAA0586_uc001xdt.3_Missense_Mutation_p.S725N|KIAA0586_uc001xdu.3_Missense_Mutation_p.S754N|KIAA0586_uc010trs.1_Missense_Mutation_p.S684N|KIAA0586_uc010trt.1_Missense_Mutation_p.S629N|KIAA0586_uc010tru.1_Missense_Mutation_p.S629N	p.S693N	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN			15	2351	+			693					B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	c.2078G>A	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	G	0.096	-1.158864	0.01686	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.14	-4.42	0.03579	.	0.815866	0.11357	N	0.572307	T	0.13030	0.0316	N	0.00926	-1.1	0.09310	N	1	B;B;B;B;B;B	0.06786	0.0;0.0;0.001;0.0;0.0;0.0	B;B;B;B;B;B	0.06405	0.001;0.001;0.002;0.0;0.001;0.001	T	0.38178	-0.9673	10	0.08179	T	0.78	.	14.8271	0.70122	0.3786:0.0:0.6214:0.0	.	629;629;822;693;754;725	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	N	822;754;725;693;629	ENSP00000346359:S822N;ENSP00000452351:S754N;ENSP00000399427:S725N;ENSP00000261244:S693N	ENSP00000261244:S693N	S	+	2	0	KIAA0586	58004257	0.136000	0.22515	0.047000	0.18901	0.711000	0.40976	0.401000	0.20948	-0.744000	0.04778	-0.345000	0.07892	AGC		0.393	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749		32	203	0	0	0	0.005524	0	32	203				
DAAM1	23002	broad.mit.edu	37	14	59793303	59793303	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:59793303A>T	ENST00000395125.1	+	10	1273	c.1250A>T	c.(1249-1251)gAc>gTc	p.D417V	DAAM1_ENST00000351081.1_Missense_Mutation_p.D417V|DAAM1_ENST00000360909.3_Missense_Mutation_p.D417V	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	417	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)	p.D417V(1)		breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		ATCCAGAATGACAAAGGACAG	0.373																																							uc001xdz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1249-1251)GAC>GTC		dishevelled-associated activator of							80.0	82.0	81.0					14																	59793303		2203	4300	6503	SO:0001583	missense	23002				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding	g.chr14:59793303A>T	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.1250A>T	14.37:g.59793303A>T	ENSP00000378557:p.Asp417Val					DAAM1_uc001xea.1_Missense_Mutation_p.D417V|DAAM1_uc001xeb.1_Missense_Mutation_p.D417V	p.D417V	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.165)	11	1375	+			417			GBD/FH3.		Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	37	c.1250A>T	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.035589	0.75617	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000395125	D;D;D	0.83673	-1.75;-1.75;-1.75	5.91	5.91	0.95273	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.039938	0.85682	D	0.000000	D	0.87370	0.6160	M	0.71581	2.175	0.80722	D	1	P;P	0.42456	0.739;0.78	P;P	0.49387	0.474;0.609	D	0.88332	0.2969	10	0.66056	D	0.02	.	16.3351	0.83056	1.0:0.0:0.0:0.0	.	417;417	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	V	417	ENSP00000354162:D417V;ENSP00000247170:D417V;ENSP00000378557:D417V	ENSP00000247170:D417V	D	+	2	0	DAAM1	58863056	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.262000	0.75019	0.528000	0.53228	GAC		0.373	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992		12	110	0	0	0	0.001855	0	12	110				
HSPA2	3306	broad.mit.edu	37	14	65008300	65008300	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:65008300G>A	ENST00000394709.1	+	2	809	c.733G>A	c.(733-735)Gcg>Acg	p.A245T	RP11-973N13.4_ENST00000554918.1_RNA|HSPA2_ENST00000247207.6_Missense_Mutation_p.A245T			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	245					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)	p.A245T(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		GAGCCACCTGGCGGAGGAGTT	0.652																																					Pancreas(136;1211 1835 24894 31984 38227)	Pancreas(136;1211 1835 24894 31984 38227)	uc001xhj.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(733-735)GCG>ACG		heat shock 70kDa protein 2							44.0	49.0	47.0					14																	65008300		2203	4300	6503	SO:0001583	missense	3306				response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding	g.chr14:65008300G>A	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.733G>A	14.37:g.65008300G>A	ENSP00000378199:p.Ala245Thr					HSPA2_uc001xhk.3_Missense_Mutation_p.A245T	p.A245T	NM_021979	NP_068814	P54652	HSP72_HUMAN		all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)	2	809	+			245					Q15508|Q53XM3|Q9UE78	Missense_Mutation	SNP	ENST00000394709.1	37	c.733G>A	CCDS9766.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658664	0.47467	.	.	ENSG00000126803	ENST00000394709;ENST00000247207	T;T	0.01051	5.4;5.4	5.07	5.07	0.68467	.	0.143874	0.31648	U	0.007288	T	0.02047	0.0064	L	0.47190	1.495	0.28680	N	0.905152	B	0.02656	0.0	B	0.04013	0.001	T	0.29761	-1.0001	10	0.72032	D	0.01	-5.9621	18.4353	0.90643	0.0:0.0:1.0:0.0	.	245	P54652	HSP72_HUMAN	T	245	ENSP00000378199:A245T;ENSP00000247207:A245T	ENSP00000247207:A245T	A	+	1	0	HSPA2	64078053	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.908000	0.48750	2.345000	0.79718	0.563000	0.77884	GCG		0.652	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280651.1			4	61	0	0	0	0.000602	0	4	61				
MAP3K9	4293	broad.mit.edu	37	14	71209068	71209068	+	Splice_Site	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:71209068C>A	ENST00000554752.2	-	6	1566	c.1567G>T	c.(1567-1569)Gat>Tat	p.D523Y	MAP3K9_ENST00000554146.1_Splice_Site_p.D260Y|MAP3K9_ENST00000381250.4_Splice_Site_p.D523Y|MAP3K9_ENST00000555993.2_Splice_Site_p.D523Y|MAP3K9_ENST00000553414.1_Splice_Site_p.D217Y	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	523				KLKDGNRISLPSDFQHKFTVQASPT -> AQPVLPFPHGHS RCPGGTGSSWGGQ (in Ref. 4). {ECO:0000305}.	activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.D523Y(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GGCCACTGACCAGAAGGGAGG	0.607																																					GBM(114;411 1587 13539 28235 50070)	GBM(114;411 1587 13539 28235 50070)	uc001xmm.2		NA																	1	Substitution - Missense(1)		lung(1)	stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5						c.(1567-1569)GAT>TAT		mitogen-activated protein kinase kinase kinase							90.0	89.0	89.0					14																	71209068		2203	4300	6503	SO:0001630	splice_region_variant	4293				activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity	g.chr14:71209068C>A	AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.1567+1G>T	14.37:g.71209068C>A						MAP3K9_uc010ttk.1_Missense_Mutation_p.D260Y|MAP3K9_uc001xmk.2_Missense_Mutation_p.D217Y|MAP3K9_uc001xml.2_Missense_Mutation_p.D523Y	p.D523Y	NM_033141	NP_149132	P80192	M3K9_HUMAN		all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)	6	1567	-			523	KLKDGNRISLPSDFQHKFTVQASPT -> AQPVLPFPHGHS RCPGGTGSSWGGQ (in Ref. 4).				A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	ENST00000554752.2	37	c.1567G>T		.	.	.	.	.	.	.	.	.	.	C	23.6	4.435350	0.83885	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	T;T;T;T	0.79653	-1.09;-1.06;-1.28;-1.29	5.97	5.97	0.96955	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.89687	0.6787	M	0.70595	2.14	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.99;0.996;0.996	D	0.87917	0.2701	9	.	.	.	.	20.4135	0.99023	0.0:1.0:0.0:0.0	.	260;523;523;217	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	Y	523;523;217;523;260;251	ENSP00000451612:D523Y;ENSP00000451038:D217Y;ENSP00000370649:D523Y;ENSP00000451921:D260Y	.	D	-	1	0	MAP3K9	70278821	1.000000	0.71417	0.970000	0.41538	0.536000	0.34869	7.760000	0.85248	2.835000	0.97688	0.591000	0.81541	GAT		0.607	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2		Missense_Mutation	8	115	1	0	1.12685e-05	0.004482	1.47015e-05	8	115				
LTBP2	4053	broad.mit.edu	37	14	74967652	74967652	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:74967652G>T	ENST00000261978.4	-	36	5787	c.5401C>A	c.(5401-5403)Cgc>Agc	p.R1801S	LTBP2_ENST00000556690.1_Missense_Mutation_p.R1757S	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1801	EGF-like 20; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R1801S(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CAGTGGCAGCGGTAGGAGCCC	0.567																																							uc001xqa.2		NA																	1	Substitution - Missense(1)		lung(1)	liver(1)|skin(1)	2						c.(5401-5403)CGC>AGC		latent transforming growth factor beta binding							44.0	40.0	41.0					14																	74967652		2203	4300	6503	SO:0001583	missense	4053				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding	g.chr14:74967652G>T		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.5401C>A	14.37:g.74967652G>T	ENSP00000261978:p.Arg1801Ser						p.R1801S	NM_000428	NP_000419	Q14767	LTBP2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)	36	5788	-			1801			EGF-like 20; calcium-binding (Potential).		Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	37	c.5401C>A	CCDS9831.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496126	0.85069	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	D;D	0.91792	-2.91;-2.91	5.4	4.49	0.54785	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.178806	0.27223	N	0.020351	D	0.88005	0.6321	N	0.11364	0.135	0.38560	D	0.949683	D	0.54207	0.965	P	0.58620	0.842	D	0.84551	0.0644	10	0.19590	T	0.45	.	10.2797	0.43532	0.0722:0.1342:0.7936:0.0	.	1801	Q14767	LTBP2_HUMAN	S	1801;1757	ENSP00000261978:R1801S;ENSP00000451477:R1757S	ENSP00000261978:R1801S	R	-	1	0	LTBP2	74037405	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.278000	0.43426	2.797000	0.96272	0.655000	0.94253	CGC		0.567	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428		9	39	1	0	7.48243e-07	0.006214	1.02883e-06	9	39				
YLPM1	56252	broad.mit.edu	37	14	75264581	75264581	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:75264581G>A	ENST00000325680.7	+	5	2705	c.2581G>A	c.(2581-2583)Gga>Aga	p.G861R	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Missense_Mutation_p.G666R	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	666	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.G861R(1)|p.G666R(1)		breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		ACCTCTTTCAGGAAACAAAGA	0.453																																							uc001xqj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(2581-2583)GGA>AGA		YLP motif containing 1							103.0	99.0	100.0					14																	75264581		1945	4138	6083	SO:0001583	missense	56252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck		g.chr14:75264581G>A	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.2581G>A	14.37:g.75264581G>A	ENSP00000324463:p.Gly861Arg					YLPM1_uc001xql.3_RNA	p.G861R	NM_019589	NP_062535	P49750	YLPM1_HUMAN	KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)	5	2705	+			666					P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000325680.7	37	c.2581G>A	CCDS45135.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.627382	0.46944	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.66	4.75	0.60458	.	0.176912	0.40385	N	0.001117	T	0.57888	0.2084	L	0.55481	1.735	0.37832	D	0.928751	B	0.19073	0.033	B	0.22601	0.04	T	0.57545	-0.7793	9	0.23891	T	0.37	-9.0334	15.1595	0.72771	0.0:0.1407:0.8593:0.0	.	861	P49750-4	.	R	861;666;574	.	ENSP00000238571:G666R	G	+	1	0	YLPM1	74334334	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.338000	0.72963	1.490000	0.48466	0.643000	0.83706	GGA		0.453	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404451.1	NM_019589		8	72	0	0	0	0.00308	0	8	72				
CEP128	145508	broad.mit.edu	37	14	81244254	81244254	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:81244254T>A	ENST00000555265.1	-	16	2723	c.2348A>T	c.(2347-2349)cAa>cTa	p.Q783L	CEP128_ENST00000281129.3_Missense_Mutation_p.Q783L			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	783						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)		p.Q783L(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						CTTCAAACATTGATATTTTAG	0.303																																							uc001xux.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2347-2349)CAA>CTA		hypothetical protein LOC145508							76.0	75.0	75.0					14																	81244254		2202	4300	6502	SO:0001583	missense	145508					centriole|spindle pole		g.chr14:81244254T>A	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.2348A>T	14.37:g.81244254T>A	ENSP00000451162:p.Gln783Leu					C14orf145_uc010asz.1_RNA	p.Q783L	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0586)	15	2519	-			783			Potential.		B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	ENST00000555265.1	37	c.2348A>T	CCDS32130.1	.	.	.	.	.	.	.	.	.	.	T	16.70	3.195038	0.58017	.	.	ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619	T;T	0.32988	1.43;1.43	4.89	4.89	0.63831	.	0.360222	0.25402	N	0.030940	T	0.30759	0.0775	L	0.56769	1.78	0.80722	D	1	P	0.41848	0.763	B	0.39027	0.288	T	0.07046	-1.0793	10	0.34782	T	0.22	.	12.7405	0.57251	0.0:0.0:0.0:1.0	.	783	Q6ZU80	CE128_HUMAN	L	783	ENSP00000281129:Q783L;ENSP00000451162:Q783L	ENSP00000281129:Q783L	Q	-	2	0	CEP128	80314007	1.000000	0.71417	0.960000	0.40013	0.988000	0.76386	6.021000	0.70832	1.821000	0.53095	0.528000	0.53228	CAA		0.303	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446		5	86	0	0	0	0.000602	0	5	86				
YY1	7528	broad.mit.edu	37	14	100743846	100743846	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:100743846G>T	ENST00000262238.4	+	5	1414	c.1154G>T	c.(1153-1155)tGc>tTc	p.C385F	AL157871.2_ENST00000553954.1_RNA	NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	385	Binding to DNA.|Involved in masking transactivation domain.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.C385F(1)		cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				CCCTATGTGTGCCCCTTCGAT	0.463																																							uc001ygy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1153-1155)TGC>TTC		YY1 transcription factor							115.0	103.0	107.0					14																	100743846		2203	4300	6503	SO:0001583	missense	7528				cell differentiation|cellular response to UV|double-strand break repair via homologous recombination|negative regulation of transcription from RNA polymerase II promoter|response to UV-C|spermatogenesis	Ino80 complex|nuclear matrix|plasma membrane	four-way junction DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr14:100743846G>T	BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.1154G>T	14.37:g.100743846G>T	ENSP00000262238:p.Cys385Phe					uc001ygz.1_5'Flank	p.C385F	NM_003403	NP_003394	P25490	TYY1_HUMAN			5	1634	+		Melanoma(154;0.152)	385			C2H2-type 4.|Involved in masking transactivation domain.	Zinc 4.	Q14935	Missense_Mutation	SNP	ENST00000262238.4	37	c.1154G>T	CCDS9957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.40|19.40	3.819772|3.819772	0.71028|0.71028	.|.	.|.	ENSG00000100811|ENSG00000100811	ENST00000554804|ENST00000262238	.|D	.|0.85088	.|-1.94	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.85682	.|U	.|0.000000	D|D	0.95001|0.95001	0.8382|0.8382	H|H	0.94423|0.94423	3.535|3.535	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.95618|0.95618	0.8678|0.8678	5|10	.|0.87932	.|D	.|0	.|.	20.0965|20.0965	0.97849|0.97849	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|385	.|P25490	.|TYY1_HUMAN	S|F	161|385	.|ENSP00000262238:C385F	.|ENSP00000262238:C385F	A|C	+|+	1|2	0|0	YY1|YY1	99813599|99813599	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.779000|9.779000	0.99018|0.99018	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	GCC|TGC		0.463	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318277.1	NM_003403		7	68	1	0	2.7689e-08	0.001984	3.98295e-08	7	68				
DYNC1H1	1778	broad.mit.edu	37	14	102496195	102496195	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:102496195G>T	ENST00000360184.4	+	50	9846	c.9682G>T	c.(9682-9684)Gag>Tag	p.E3228*		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3228	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.E3228*(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AAAGAGCCAAGAGCTGGAGGT	0.463																																							uc001yks.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(7)|central_nervous_system(2)|pancreas(1)	10						c.(9682-9684)GAG>TAG		cytoplasmic dynein 1 heavy chain 1							100.0	110.0	107.0					14																	102496195		2203	4300	6503	SO:0001587	stop_gained	1778				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding	g.chr14:102496195G>T	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.9682G>T	14.37:g.102496195G>T	ENSP00000348965:p.Glu3228*						p.E3228*	NM_001376	NP_001367	Q14204	DYHC1_HUMAN			50	9846	+			3228			Potential.|Stalk (By similarity).		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Nonsense_Mutation	SNP	ENST00000360184.4	37	c.9682G>T	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	52	18.743206	0.99910	.	.	ENSG00000197102	ENST00000360184	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	19.4734	0.94973	0.0:0.0:1.0:0.0	.	.	.	.	X	3228	.	ENSP00000348965:E3228X	E	+	1	0	DYNC1H1	101565948	1.000000	0.71417	0.963000	0.40424	0.943000	0.58893	9.748000	0.98867	2.606000	0.88127	0.585000	0.79938	GAG		0.463	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		12	80	1	0	0.00136819	0.001368	0.00156008	12	80				
TDRD9	122402	broad.mit.edu	37	14	104462107	104462107	+	Silent	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:104462107T>A	ENST00000409874.4	+	12	1389	c.1341T>A	c.(1339-1341)atT>atA	p.I447I	TDRD9_ENST00000339063.5_Silent_p.I447I	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	447	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.I447I(1)|p.I162I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				CCACCAATATTGCAGAGAGTT	0.353																																							uc001yom.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(1339-1341)ATT>ATA		tudor domain containing 9							185.0	157.0	167.0					14																	104462107		2203	4300	6503	SO:0001819	synonymous_variant	122402				cell differentiation|DNA methylation involved in gamete generation|fertilization|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	nucleus|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr14:104462107T>A	AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.1341T>A	14.37:g.104462107T>A						TDRD9_uc001yon.3_Silent_p.I185I	p.I447I	NM_153046	NP_694591	Q8NDG6	TDRD9_HUMAN			12	1371	+		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)	447			Helicase C-terminal.		A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Silent	SNP	ENST00000409874.4	37	c.1341T>A	CCDS9987.2	.	.	.	.	.	.	.	.	.	.	T	10.84	1.465096	0.26335	.	.	ENSG00000156414	ENST00000557332	.	.	.	5.06	-3.33	0.04958	.	.	.	.	.	T	0.47985	0.1475	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44236	-0.9341	4	.	.	.	.	5.5394	0.17030	0.1697:0.3681:0.0:0.4622	.	.	.	.	S	174	.	.	C	+	1	0	TDRD9	103531860	0.004000	0.15560	0.995000	0.50966	0.932000	0.56968	-1.897000	0.01603	-0.306000	0.08818	0.383000	0.25322	TGC		0.353	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046		5	27	0	0	0	0.001168	0	5	27				
AHNAK2	113146	broad.mit.edu	37	14	105411915	105411915	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr14:105411915C>A	ENST00000333244.5	-	7	9992	c.9873G>T	c.(9871-9873)gaG>gaT	p.E3291D	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3291						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.E3291D(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACAGGTCCCCCTCCAGCCGTG	0.612																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(9871-9873)GAG>GAT		AHNAK nucleoprotein 2							160.0	142.0	148.0					14																	105411915		1945	4126	6071	SO:0001583	missense	113146					nucleus		g.chr14:105411915C>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9873G>T	14.37:g.105411915C>A	ENSP00000353114:p.Glu3291Asp					AHNAK2_uc001ypx.2_Missense_Mutation_p.E3191D	p.E3291D	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	9993	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	3291					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.9873G>T	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	10.44	1.350913	0.24512	.	.	ENSG00000185567	ENST00000333244	T	0.01106	5.33	3.92	-0.401	0.12407	.	.	.	.	.	T	0.01661	0.0053	M	0.62088	1.915	0.09310	N	1	D	0.54047	0.964	B	0.43728	0.429	T	0.49818	-0.8899	9	0.18276	T	0.48	.	8.7071	0.34360	0.0:0.5224:0.0:0.4776	.	3291	Q8IVF2	AHNK2_HUMAN	D	3291	ENSP00000353114:E3291D	ENSP00000353114:E3291D	E	-	3	2	AHNAK2	104482960	.	.	0.033000	0.17914	0.023000	0.10783	.	.	0.026000	0.15269	0.485000	0.47835	GAG		0.612	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		8	208	1	0	3.09899e-07	0.004482	4.31397e-07	8	208				
GABRG3	2567	broad.mit.edu	37	15	27725868	27725868	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr15:27725868G>T	ENST00000333743.6	+	6	901	c.647G>T	c.(646-648)tGg>tTg	p.W216L	GABRG3_ENST00000555083.1_Missense_Mutation_p.W216L|RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	216					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.W216L(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CAGAAATCATGGCGGCTTTAT	0.418																																					NSCLC(114;800 1656 7410 37729 45293)	NSCLC(114;800 1656 7410 37729 45293)	uc001zbg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(646-648)TGG>TTG		gamma-aminobutyric acid (GABA) A receptor, gamma							46.0	50.0	49.0					15																	27725868		1888	4113	6001	SO:0001583	missense	2567				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27725868G>T		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.647G>T	15.37:g.27725868G>T	ENSP00000331912:p.Trp216Leu					GABRG3_uc001zbf.2_Missense_Mutation_p.W216L	p.W216L	NM_033223	NP_150092	Q99928	GBRG3_HUMAN		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	6	813	+		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)	216			Extracellular (Probable).		G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	c.647G>T	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	G	33	5.254181	0.95336	.	.	ENSG00000182256	ENST00000333743;ENST00000555083;ENST00000554696	T;T;T	0.77098	-1.07;-1.07;-1.07	5.55	5.55	0.83447	Neurotransmitter-gated ion-channel ligand-binding (3);	0.062735	0.64402	D	0.000002	T	0.73450	0.3588	N	0.05534	-0.03	0.58432	D	0.999999	P;D	0.65815	0.949;0.995	D;D	0.67103	0.949;0.941	T	0.67688	-0.5606	10	0.02654	T	1	.	18.5368	0.91013	0.0:0.0:1.0:0.0	.	216;216	Q99928;G3V594	GBRG3_HUMAN;.	L	216;216;158	ENSP00000331912:W216L;ENSP00000452244:W216L;ENSP00000451862:W158L	ENSP00000331912:W216L	W	+	2	0	GABRG3	25399463	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.380000	0.97202	2.621000	0.88768	0.558000	0.71614	TGG		0.418	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2			3	22	1	0	0.00909568	0.009096	0.00994674	3	22				
RYR3	6263	broad.mit.edu	37	15	33895447	33895447	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr15:33895447G>T	ENST00000389232.4	+	18	2116	c.2046G>T	c.(2044-2046)gtG>gtT	p.V682V	RYR3_ENST00000415757.3_Silent_p.V682V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	682	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.V682V(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ATCTGCGGGTGGGCTGGGCCT	0.577																																							uc001zhi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(2044-2046)GTG>GTT		ryanodine receptor 3							161.0	168.0	166.0					15																	33895447		2026	4176	6202	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33895447G>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2046G>T	15.37:g.33895447G>T						RYR3_uc010bar.2_Silent_p.V682V	p.V682V	NM_001036	NP_001027	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	18	2116	+		all_lung(180;7.18e-09)	682			Cytoplasmic (By similarity).|B30.2/SPRY 1.		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.2046G>T	CCDS45210.1																																																																																				0.577	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			16	181	1	0	5.01169e-05	0.00499	6.20654e-05	16	181				
RYR3	6263	broad.mit.edu	37	15	33962753	33962753	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr15:33962753C>T	ENST00000389232.4	+	38	5926	c.5856C>T	c.(5854-5856)tgC>tgT	p.C1952C	RYR3_ENST00000415757.3_Silent_p.C1952C	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1952	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.C1952C(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGGAGAGATGCCCCAGTAAGT	0.448																																							uc001zhi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(5854-5856)TGC>TGT		ryanodine receptor 3							75.0	89.0	84.0					15																	33962753		1962	4137	6099	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33962753C>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5856C>T	15.37:g.33962753C>T						RYR3_uc010bar.2_Silent_p.C1952C	p.C1952C	NM_001036	NP_001027	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	38	5926	+		all_lung(180;7.18e-09)	1952			4 X approximate repeats.|Cytoplasmic (By similarity).		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.5856C>T	CCDS45210.1																																																																																				0.448	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			11	57	0	0	0	0.008291	0	11	57				
UBR1	197131	broad.mit.edu	37	15	43281045	43281045	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr15:43281045G>A	ENST00000290650.4	-	35	4047	c.3969C>T	c.(3967-3969)agC>agT	p.S1323S	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1323					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S1323S(1)		NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		AAGCGCAGGTGCTCCAGGTCA	0.403																																							uc001zqq.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)	1						c.(3967-3969)AGC>AGT		ubiquitin protein ligase E3 component n-recognin							124.0	128.0	126.0					15																	43281045		2203	4299	6502	SO:0001819	synonymous_variant	197131				cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding	g.chr15:43281045G>A		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.3969C>T	15.37:g.43281045G>A							p.S1323S	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)	35	4035	-		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)	1323					O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Silent	SNP	ENST00000290650.4	37	c.3969C>T	CCDS10091.1																																																																																				0.403	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916		6	163	0	0	0	0.001168	0	6	163				
SLC28A2	9153	broad.mit.edu	37	15	45564558	45564558	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr15:45564558G>C	ENST00000347644.3	+	16	1779	c.1714G>C	c.(1714-1716)Gcc>Ccc	p.A572P	CTD-2651B20.3_ENST00000561404.1_RNA|SLC28A2_ENST00000560767.1_3'UTR|CTD-2651B20.3_ENST00000560344.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2	572					nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)	p.A572P(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	CTTCACAGGGGCCTGTGTATC	0.478																																					NSCLC(92;493 1501 26361 28917 47116)	NSCLC(92;493 1501 26361 28917 47116)	uc001zva.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(1714-1716)GCC>CCC		solute carrier family 28 (sodium-coupled							99.0	87.0	91.0					15																	45564558		2198	4298	6496	SO:0001583	missense	9153				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity	g.chr15:45564558G>C	U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.1714G>C	15.37:g.45564558G>C	ENSP00000315006:p.Ala572Pro						p.A572P	NM_004212	NP_004203	O43868	S28A2_HUMAN		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	16	1779	+		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)	572			Helical; (Potential).		A8K7F9|O43239|Q52LZ0	Missense_Mutation	SNP	ENST00000347644.3	37	c.1714G>C	CCDS10121.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957046	0.73902	.	.	ENSG00000137860	ENST00000347644	T	0.07327	3.2	5.99	-0.813	0.10850	Na dependent nucleoside transporter, C-terminal (1);	0.550430	0.21625	N	0.071576	T	0.22360	0.0539	M	0.88640	2.97	0.34312	D	0.685573	P	0.50272	0.933	P	0.60609	0.877	T	0.18272	-1.0342	10	0.72032	D	0.01	-1.2634	2.9519	0.05865	0.1326:0.1131:0.405:0.3494	.	572	O43868	S28A2_HUMAN	P	572	ENSP00000315006:A572P	ENSP00000315006:A572P	A	+	1	0	SLC28A2	43351850	0.934000	0.31675	0.972000	0.41901	0.988000	0.76386	0.786000	0.26844	-0.097000	0.12307	0.655000	0.94253	GCC		0.478	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254219.2	NM_004212		10	57	0	0	0	0.000978	0	10	57				
ADAM10	102	broad.mit.edu	37	15	58985220	58985220	+	Intron	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr15:58985220C>G	ENST00000260408.3	-	3	650				ADAM10_ENST00000396140.2_Intron|ADAM10_ENST00000558733.1_Intron|ADAM10_ENST00000561288.1_Intron|ADAM10_ENST00000402627.1_Intron	NM_001110.2	NP_001101.1	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10						cell death (GO:0008219)|cell-cell signaling (GO:0007267)|collagen catabolic process (GO:0030574)|constitutive protein ectodomain proteolysis (GO:0051089)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|negative regulation of cell adhesion (GO:0007162)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell chemotaxis (GO:0010820)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|tetraspanin-enriched microdomain (GO:0097197)	endopeptidase activity (GO:0004175)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(5)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)	27				GBM - Glioblastoma multiforme(80;0.202)		AAGGGTCTGTCAGGCTCTCAT	0.448																																							uc002afh.1		NA																	0					0						c.(103-105)CTG>CTC		RecName: Full=Putative heat shock protein HSP 90-beta 4;																																				SO:0001627	intron_variant	664618							g.chr15:58985220C>G	AF009615	CCDS10167.1	15q2	2006-09-25	2005-08-18		ENSG00000137845	ENSG00000137845		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	188	protein-coding gene	gene with protein product		602192	"""a disintegrin and metalloproteinase domain 10"""			9344679, 9441766	Standard	XM_005254117		Approved	kuz, MADM, HsT18717, CD156c	uc002afd.1	O14672	OTTHUMG00000132633	ENST00000260408.3:c.207-10707G>C	15.37:g.58985220C>G						ADAM10_uc002afd.1_Intron|ADAM10_uc010bgc.1_Intron|ADAM10_uc010ugz.1_Intron|ADAM10_uc002afe.1_Intron|ADAM10_uc002afg.2_Intron	p.L35L	NR_002927						1	105	-								B4DU28|Q10742|Q92650	Silent	SNP	ENST00000260408.3	37	c.105G>C	CCDS10167.1																																																																																				0.448	ADAM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255880.2	NM_001110		8	28	0	0	0	0.004482	0	8	28				
DIS3L	115752	broad.mit.edu	37	15	66610849	66610849	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr15:66610849G>C	ENST00000319212.4	+	8	1107	c.1057G>C	c.(1057-1059)Gaa>Caa	p.E353Q	RP11-352G18.2_ENST00000565993.1_RNA|DIS3L_ENST00000319194.5_Missense_Mutation_p.E270Q|DIS3L_ENST00000441424.2_Intron	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	353					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)	p.E353Q(1)|p.E270Q(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TCCGTCCAAAGAAGAGGTCCA	0.433																																							uc010ujm.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1057-1059)GAA>CAA		DIS3 mitotic control homolog (S.							126.0	124.0	124.0					15																	66610849		2201	4299	6500	SO:0001583	missense	115752				rRNA catabolic process	cytoplasm|exosome (RNase complex)	exonuclease activity|protein binding|ribonuclease activity|RNA binding	g.chr15:66610849G>C		CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.1057G>C	15.37:g.66610849G>C	ENSP00000321711:p.Glu353Gln					DIS3L_uc010ujl.1_Intron|DIS3L_uc002app.2_Missense_Mutation_p.E270Q|DIS3L_uc002apq.2_Missense_Mutation_p.E353Q|DIS3L_uc010bho.2_Missense_Mutation_p.E219Q	p.E353Q	NM_001143688	NP_001137160	Q8TF46	DI3L1_HUMAN			8	1072	+			353					Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	ENST00000319212.4	37	c.1057G>C	CCDS45286.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225513	0.39300	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	T;T	0.29397	1.57;1.57	4.28	3.33	0.38152	.	0.578800	0.18822	N	0.130215	T	0.23806	0.0576	L	0.38175	1.15	0.80722	D	1	B;B	0.32071	0.215;0.355	B;B	0.31751	0.07;0.135	T	0.03364	-1.1044	10	0.21014	T	0.42	-32.9815	12.7488	0.57296	0.0:0.0:0.8346:0.1654	.	353;353	Q8TF46;Q8TF46-3	DI3L1_HUMAN;.	Q	270;353	ENSP00000321583:E270Q;ENSP00000321711:E353Q	ENSP00000321583:E270Q	E	+	1	0	DIS3L	64397903	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	9.119000	0.94362	1.093000	0.41377	0.591000	0.81541	GAA		0.433	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375		10	87	0	0	0	0.008291	0	10	87				
LRRC49	54839	broad.mit.edu	37	15	71329524	71329524	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr15:71329524G>T	ENST00000260382.5	+	15	1970	c.1710G>T	c.(1708-1710)aaG>aaT	p.K570N	LRRC49_ENST00000560369.1_Missense_Mutation_p.K575N|LRRC49_ENST00000443425.2_Missense_Mutation_p.K526N|LRRC49_ENST00000560691.1_Missense_Mutation_p.K276N|LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000544974.2_Missense_Mutation_p.K560N|LRRC49_ENST00000560158.2_Missense_Mutation_p.K258N	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	570						cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.K570N(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						ACAGGAAAAAGCAATTTCGGT	0.318																																							uc002asw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1708-1710)AAG>AAT		leucine rich repeat containing 49							69.0	76.0	73.0					15																	71329524		2198	4293	6491	SO:0001583	missense	54839					cytoplasm|microtubule		g.chr15:71329524G>T		CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.1710G>T	15.37:g.71329524G>T	ENSP00000260382:p.Lys570Asn					LRRC49_uc002asu.2_Missense_Mutation_p.K560N|LRRC49_uc002asx.2_Missense_Mutation_p.K526N|LRRC49_uc010ukf.1_Missense_Mutation_p.K575N|LRRC49_uc002asy.2_Missense_Mutation_p.K276N|LRRC49_uc002asz.2_Missense_Mutation_p.K542N	p.K570N	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN			15	1957	+			570					B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Missense_Mutation	SNP	ENST00000260382.5	37	c.1710G>T	CCDS32282.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244998	0.59103	.	.	ENSG00000137821	ENST00000544974;ENST00000260382;ENST00000443425;ENST00000436542	T;T;T	0.37235	1.21;1.21;1.21	5.19	4.28	0.50868	.	0.059541	0.64402	D	0.000003	T	0.51686	0.1689	M	0.64997	1.995	0.41871	D	0.990272	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.71414	0.94;0.973;0.973;0.94;0.964	T	0.52457	-0.8573	10	0.56958	D	0.05	-17.7192	7.8816	0.29624	0.1855:0.0:0.8145:0.0	.	575;542;526;570;560	B7Z366;G5E9Q1;G5E9T5;Q8IUZ0;F5H1J4	.;.;.;LRC49_HUMAN;.	N	560;570;526;542	ENSP00000439600:K560N;ENSP00000260382:K570N;ENSP00000414065:K526N	ENSP00000260382:K570N	K	+	3	2	LRRC49	69116578	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.600000	0.36762	1.170000	0.42753	0.655000	0.94253	AAG		0.318	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417209.3	NM_017691		7	114	1	0	0.000157383	0.00308	0.000188658	7	114				
ACAN	176	broad.mit.edu	37	15	89382144	89382144	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr15:89382144C>T	ENST00000561243.1	+	2	321	c.321C>T	c.(319-321)ccC>ccT	p.P107P	ACAN_ENST00000352105.7_Silent_p.P107P|ACAN_ENST00000559004.1_Silent_p.P107P|ACAN_ENST00000439576.2_Silent_p.P107P|ACAN_ENST00000558207.1_Silent_p.P107P			P16112	PGCA_HUMAN	aggrecan	107	G1-A.|Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)	p.P107P(2)		NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TCTCACTGCCCAACTACCCGG	0.617																																							uc010upo.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(319-321)CCC>CCT		aggrecan isoform 2 precursor							152.0	173.0	166.0					15																	89382144		2152	4270	6422	SO:0001819	synonymous_variant	176				cell adhesion		hyaluronic acid binding|sugar binding	g.chr15:89382144C>T	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.321C>T	15.37:g.89382144C>T						ACAN_uc002bmx.2_Silent_p.P107P|ACAN_uc010upp.1_Silent_p.P107P|ACAN_uc002bna.2_RNA	p.P107P	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.146)		3	695	+	Lung NSC(78;0.0392)|all_lung(78;0.077)		107					Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	c.321C>T	CCDS53970.1																																																																																				0.617	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135		7	94	0	0	0	0.00308	0	7	94				
TTC23	64927	broad.mit.edu	37	15	99678233	99678233	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr15:99678233G>A	ENST00000394132.2	-	14	2143	c.1326C>T	c.(1324-1326)ccC>ccT	p.P442P	TTC23_ENST00000394136.1_Silent_p.P442P|TTC23_ENST00000558663.1_Silent_p.P442P|RP11-6O2.3_ENST00000564527.1_RNA|TTC23_ENST00000262074.4_Silent_p.P442P|TTC23_ENST00000558613.1_Silent_p.P442P|TTC23_ENST00000394135.3_Silent_p.P442P			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	442								p.P442P(1)		endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			CTGTTGTGCCGGGCCGGGCCT	0.587																																							uc002bur.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1324-1326)CCC>CCT		tetratricopeptide repeat domain 23							38.0	43.0	41.0					15																	99678233		1926	4119	6045	SO:0001819	synonymous_variant	64927						binding	g.chr15:99678233G>A		CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.1326C>T	15.37:g.99678233G>A						TTC23_uc002bus.2_Silent_p.P442P|TTC23_uc002but.2_Silent_p.P442P|TTC23_uc002buu.2_Silent_p.P442P|TTC23_uc002buv.2_Silent_p.P442P|TTC23_uc002bux.2_Silent_p.P442P|TTC23_uc002buw.2_Silent_p.P442P|TTC23_uc010boq.2_RNA|TTC23_uc002buy.2_Silent_p.P442P|TTC23_uc010bor.2_Silent_p.P442P	p.P442P	NM_022905	NP_075056	Q5W5X9	TTC23_HUMAN	all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)		13	1857	-	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		442					A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Silent	SNP	ENST00000394132.2	37	c.1326C>T	CCDS10379.2	.	.	.	.	.	.	.	.	.	.	G	8.833	0.940272	0.18281	.	.	ENSG00000103852	ENST00000434594	.	.	.	5.03	-0.456	0.12190	.	0.957954	0.08576	N	0.925257	T	0.19446	0.0467	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27839	-1.0062	5	.	.	.	-2.2383	0.7396	0.00971	0.2877:0.1653:0.3768:0.1701	.	.	.	.	L	253	.	.	P	-	2	0	TTC23	97495756	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	-0.071000	0.11505	0.224000	0.20940	0.563000	0.77884	CCG		0.587	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303953.2	NM_022905		3	41	0	0	0	0.000602	0	3	41				
BAIAP3	8938	broad.mit.edu	37	16	1391159	1391159	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:1391159C>T	ENST00000324385.5	+	7	761	c.603C>T	c.(601-603)gtC>gtT	p.V201V	BAIAP3_ENST00000426824.3_Silent_p.V166V|BAIAP3_ENST00000397489.1_Silent_p.V183V|BAIAP3_ENST00000421665.2_Silent_p.V166V|BAIAP3_ENST00000397488.2_Silent_p.V183V|BAIAP3_ENST00000568887.1_Silent_p.V138V|BAIAP3_ENST00000562208.1_Silent_p.V143V	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	201	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)	p.V201V(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				AAGTCTCTGTCATGCGTGCCA	0.672																																							uc002clk.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(601-603)GTC>GTT		BAI1-associated protein 3							64.0	60.0	62.0					16																	1391159		2199	4300	6499	SO:0001819	synonymous_variant	8938				G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding	g.chr16:1391159C>T	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.603C>T	16.37:g.1391159C>T						BAIAP3_uc002clj.2_Silent_p.V183V|BAIAP3_uc010uuz.1_Silent_p.V166V|BAIAP3_uc010uva.1_Silent_p.V138V|BAIAP3_uc010uvb.1_Silent_p.V218V|BAIAP3_uc010uvc.1_Silent_p.V166V	p.V201V	NM_003933	NP_003924	O94812	BAIP3_HUMAN			7	603	+		Hepatocellular(780;0.0893)	201			C2 1.		A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Silent	SNP	ENST00000324385.5	37	c.603C>T	CCDS10434.1																																																																																				0.672	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3			3	46	0	0	0	0.004672	0	3	46				
RBFOX1	54715	broad.mit.edu	37	16	7726787	7726787	+	Silent	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:7726787T>C	ENST00000550418.1	+	14	1930	c.942T>C	c.(940-942)gcT>gcC	p.A314A	RBFOX1_ENST00000355637.4_Silent_p.A335A|RBFOX1_ENST00000553186.1_Silent_p.A287A|RBFOX1_ENST00000436368.2_Silent_p.A335A|RBFOX1_ENST00000547372.1_Silent_p.A357A|RBFOX1_ENST00000340209.4_Silent_p.A319A|RBFOX1_ENST00000422070.4_Silent_p.A357A|RBFOX1_ENST00000535565.2_Silent_p.A271A|RBFOX1_ENST00000311745.5_Silent_p.A335A|RBFOX1_ENST00000547338.1_Silent_p.A314A|RBFOX1_ENST00000552089.1_Silent_p.A331A	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	314					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.A335A(2)|p.A314A(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						GTGGTTATGCTGCATACCGCT	0.517																																					Ovarian(157;934 2567 15163 39509)		uc002cys.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(940-942)GCT>GCC		ataxin 2-binding protein 1 isoform 4							216.0	145.0	169.0					16																	7726787		2197	4300	6497	SO:0001819	synonymous_variant	54715				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding	g.chr16:7726787T>C	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.942T>C	16.37:g.7726787T>C						A2BP1_uc002cyt.2_Silent_p.A287A|A2BP1_uc010uxz.1_Silent_p.A357A|A2BP1_uc010uya.1_Silent_p.A271A|A2BP1_uc010uyb.1_Silent_p.A314A|A2BP1_uc002cyw.2_Silent_p.A335A|A2BP1_uc002cyy.2_Silent_p.A335A|A2BP1_uc002cyx.2_Silent_p.A335A|A2BP1_uc010uyc.1_Silent_p.A308A	p.A314A	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)	14	1930	+		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)	314					Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Silent	SNP	ENST00000550418.1	37	c.942T>C	CCDS55983.1																																																																																				0.517	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891		4	75	0	0	0	0.000602	0	4	75				
C16orf62	57020	broad.mit.edu	37	16	19656206	19656206	+	Splice_Site	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:19656206A>T	ENST00000251143.5	+	23	1877		c.e23-1		C16orf62_ENST00000543152.1_Splice_Site|C16orf62_ENST00000448695.1_Splice_Site|C16orf62_ENST00000542263.1_Splice_Site|C16orf62_ENST00000438132.3_Splice_Site|C16orf62_ENST00000417362.2_Splice_Site			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62							integral component of membrane (GO:0016021)		p.?(2)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						TATTGATTTTAGTGCACTCAC	0.303																																							uc002dgn.1		NA																	2	Unknown(2)		lung(2)	ovary(1)	1						c.e23-2		hypothetical protein LOC57020							94.0	97.0	96.0					16																	19656206		2196	4299	6495	SO:0001630	splice_region_variant	57020					integral to membrane		g.chr16:19656206A>T		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.1866-1A>T	16.37:g.19656206A>T						C16orf62_uc002dgo.1_Splice_Site_p.N555_splice|C16orf62_uc002dgp.1_Splice_Site_p.N371_splice	p.N622_splice	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN			23	1878	+								A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Splice_Site	SNP	ENST00000251143.5	37	c.1866_splice		.	.	.	.	.	.	.	.	.	.	A	25.4	4.632802	0.87660	.	.	ENSG00000103544	ENST00000438132;ENST00000542263;ENST00000251143;ENST00000417362;ENST00000448695	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3143	0.74062	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C16orf62	19563707	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.017000	0.88712	2.264000	0.75181	0.533000	0.62120	.		0.303	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_020314	Intron	5	86	0	0	0	0.001168	0	5	86				
RBBP6	5930	broad.mit.edu	37	16	24580932	24580932	+	Nonsense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:24580932T>A	ENST00000319715.4	+	17	3353	c.2921T>A	c.(2920-2922)tTg>tAg	p.L974*	RBBP6_ENST00000348022.2_Nonsense_Mutation_p.L940*|RBBP6_ENST00000381039.3_Intron	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	974					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L974*(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		ACAGACTCATTGTTTGTTCTC	0.388																																							uc002dmh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(2920-2922)TTG>TAG		retinoblastoma-binding protein 6 isoform 1							68.0	72.0	71.0					16																	24580932		2190	4296	6486	SO:0001587	stop_gained	5930				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:24580932T>A		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.2921T>A	16.37:g.24580932T>A	ENSP00000317872:p.Leu974*					RBBP6_uc010vcb.1_Nonsense_Mutation_p.L841*|RBBP6_uc002dmi.2_Nonsense_Mutation_p.L940*|RBBP6_uc010bxr.2_Intron|RBBP6_uc002dmk.2_Nonsense_Mutation_p.L807*	p.L974*	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN		GBM - Glioblastoma multiforme(48;0.0518)	17	3961	+			974					Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Nonsense_Mutation	SNP	ENST00000319715.4	37	c.2921T>A	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	T	40	8.050120	0.98629	.	.	ENSG00000122257	ENST00000319715;ENST00000348022	.	.	.	5.62	5.62	0.85841	.	0.000000	0.47455	D	0.000234	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.6699	15.8114	0.78568	0.0:0.0:0.0:1.0	.	.	.	.	X	974;940	.	ENSP00000317872:L974X	L	+	2	0	RBBP6	24488433	1.000000	0.71417	0.751000	0.31187	0.228000	0.25075	5.409000	0.66374	2.145000	0.66743	0.533000	0.62120	TTG		0.388	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910		16	81	0	0	0	0.004007	0	16	81				
FAM57B	83723	broad.mit.edu	37	16	30038006	30038006	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:30038006C>T	ENST00000380495.4	-	3	1099	c.368G>A	c.(367-369)cGt>cAt	p.R123H	FAM57B_ENST00000564806.1_Missense_Mutation_p.R73H|FAM57B_ENST00000279389.4_Missense_Mutation_p.R73H	NM_031478.4	NP_113666.2	Q71RH2	FA57B_HUMAN	family with sequence similarity 57, member B	123	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|negative regulation of fat cell differentiation (GO:0045599)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sphingosine N-acyltransferase activity (GO:0050291)	p.R123H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						CAGGTAGCCACGCGCTATGGC	0.652																																							uc002dvt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(367-369)CGT>CAT		hypothetical protein LOC83723							68.0	59.0	62.0					16																	30038006		2197	4300	6497	SO:0001583	missense	83723					endoplasmic reticulum|integral to membrane		g.chr16:30038006C>T	AF370365	CCDS10667.2	16p11.2	2013-02-19			ENSG00000149926	ENSG00000149926			25295	protein-coding gene	gene with protein product		615175				11230166, 23275342	Standard	NM_031478		Approved	DKFZP434I2117	uc002dvt.3	Q71RH2	OTTHUMG00000132105	ENST00000380495.4:c.368G>A	16.37:g.30038006C>T	ENSP00000369863:p.Arg123His					uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|FAM57B_uc002dvu.2_Missense_Mutation_p.R73H	p.R123H	NM_031478	NP_113666	Q71RH2	FA57B_HUMAN			3	706	-			123			TLC.		Q9H0J1	Missense_Mutation	SNP	ENST00000380495.4	37	c.368G>A	CCDS10667.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.07|17.07	3.296334|3.296334	0.60086|0.60086	.|.	.|.	ENSG00000149926|ENSG00000149926	ENST00000380495|ENST00000279389	.|D	.|0.85955	.|-2.05	5.83|5.83	4.82|4.82	0.62117|0.62117	TRAM/LAG1/CLN8 homology domain (3);|.	0.488450|.	0.22221|.	N|.	0.062944|.	D|D	0.86322|0.86322	0.5905|0.5905	M|M	0.67397|0.67397	2.05|2.05	0.27663|0.27663	N|N	0.947028|0.947028	D;P|.	0.76494|.	0.999;0.91|.	D;P|.	0.65773|.	0.938;0.664|.	T|T	0.79591|0.79591	-0.1740|-0.1740	9|6	0.23891|.	T|.	0.37|.	-13.4025|-13.4025	8.2331|8.2331	0.31610|0.31610	0.1579:0.7628:0.0:0.0793|0.1579:0.7628:0.0:0.0793	.|.	123;123|.	F1T0F5;Q71RH2|.	.;FA57B_HUMAN|.	H|M	123|90	.|ENSP00000279389:V90M	ENSP00000369863:R123H|.	R|V	-|-	2|1	0|0	FAM57B|FAM57B	29945507|29945507	0.004000|0.004000	0.15560|0.15560	0.251000|0.251000	0.24312|0.24312	0.213000|0.213000	0.24496|0.24496	1.242000|1.242000	0.32755|0.32755	2.750000|2.750000	0.94351|0.94351	0.655000|0.655000	0.94253|0.94253	CGT|GTG		0.652	FAM57B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255142.2	NM_031478		5	26	0	0	0	0.001168	0	5	26				
ZNF768	79724	broad.mit.edu	37	16	30536017	30536017	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:30536017C>A	ENST00000380412.5	-	2	1619	c.1444G>T	c.(1444-1446)Gag>Tag	p.E482*	ZNF768_ENST00000562803.1_Nonsense_Mutation_p.E451*	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	482					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.E482*(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						TAGGGCCGCTCGCCCGTGTGG	0.677																																							uc002dyk.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1444-1446)GAG>TAG		zinc finger protein 768							34.0	31.0	32.0					16																	30536017		2197	4299	6496	SO:0001587	stop_gained	79724				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	DNA binding|zinc ion binding	g.chr16:30536017C>A	BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.1444G>T	16.37:g.30536017C>A	ENSP00000369777:p.Glu482*					ZNF768_uc010vex.1_Nonsense_Mutation_p.E451*|uc002dyl.1_5'Flank|ZNF768_uc010vew.1_Nonsense_Mutation_p.E451*	p.E482*	NM_024671	NP_078947	Q9H5H4	ZN768_HUMAN			2	1620	-			482					Q569L7|Q96CX4	Nonsense_Mutation	SNP	ENST00000380412.5	37	c.1444G>T	CCDS10681.2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.634098	0.87660	.	.	ENSG00000169957	ENST00000380412;ENST00000538507	.	.	.	4.6	4.6	0.57074	.	0.374719	0.19590	N	0.110652	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-3.5928	12.7635	0.57378	0.0:0.8333:0.1667:0.0	.	.	.	.	X	482;395	.	ENSP00000369777:E482X	E	-	1	0	ZNF768	30443518	0.998000	0.40836	1.000000	0.80357	0.694000	0.40290	3.814000	0.55643	2.405000	0.81733	0.436000	0.28706	GAG		0.677	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255522.2	NM_024671		5	26	1	0	0.000602214	0.000602	0.000699466	5	26				
HSD3B7	80270	broad.mit.edu	37	16	30998216	30998216	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:30998216G>T	ENST00000297679.5	+	6	680	c.587G>T	c.(586-588)gGt>gTt	p.G196V	HSD3B7_ENST00000262520.6_Intron|HSD3B7_ENST00000353250.5_Intron|AC135048.1_ENST00000602217.1_5'Flank	NM_025193.3	NP_079469.2	Q9H2F3	3BHS7_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7	196					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity (GO:0047016)	p.G196V(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						GGCATCTACGGTGAAGGCCAC	0.672																																							uc002eaf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(586-588)GGT>GTT		hydroxy-delta-5-steroid dehydrogenase, 3 beta-							62.0	60.0	60.0					16																	30998216		2197	4300	6497	SO:0001583	missense	80270				bile acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity	g.chr16:30998216G>T	AF277719	CCDS10698.1, CCDS45466.1	16p11.2	2011-09-14			ENSG00000099377	ENSG00000099377	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	18324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 3"""	607764				11067870, 19027726	Standard	NM_001142777		Approved	C(27)-3BETA-HSD, SDR11E3	uc002eaf.2	Q9H2F3	OTTHUMG00000132417	ENST00000297679.5:c.587G>T	16.37:g.30998216G>T	ENSP00000297679:p.Gly196Val					HSD3B7_uc010cac.2_Intron|HSD3B7_uc002eag.2_Intron|HSD3B7_uc002eah.2_Missense_Mutation_p.G196V	p.G196V	NM_025193	NP_079469	Q9H2F3	3BHS7_HUMAN			6	693	+			196					Q96M28|Q9BSN9	Missense_Mutation	SNP	ENST00000297679.5	37	c.587G>T	CCDS10698.1	.	.	.	.	.	.	.	.	.	.	G	35	5.433594	0.96150	.	.	ENSG00000099377	ENST00000297679	D	0.96685	-4.09	5.65	5.65	0.86999	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98833	0.9606	H	0.96080	3.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99552	1.0966	10	0.87932	D	0	-12.0105	18.4976	0.90870	0.0:0.0:1.0:0.0	.	196	Q9H2F3	3BHS7_HUMAN	V	196	ENSP00000297679:G196V	ENSP00000297679:G196V	G	+	2	0	HSD3B7	30905717	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.025000	0.76449	2.667000	0.90743	0.561000	0.74099	GGT		0.672	HSD3B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255554.2			16	70	1	0	1.67942e-08	0.006122	2.4345e-08	16	70				
NLRC5	84166	broad.mit.edu	37	16	57054740	57054740	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:57054740C>T	ENST00000262510.6	+	3	341	c.116C>T	c.(115-117)aCg>aTg	p.T39M	NLRC5_ENST00000308149.7_Missense_Mutation_p.T39M|NLRC5_ENST00000539144.1_Missense_Mutation_p.T39M|NLRC5_ENST00000436936.1_Missense_Mutation_p.T39M	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	39					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.T39M(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CTCCCCAACACGGACCTGGAT	0.547																																							uc002ekk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|breast(1)	7						c.(115-117)ACG>ATG		nucleotide-binding oligomerization domains 27							104.0	90.0	95.0					16																	57054740		2198	4300	6498	SO:0001583	missense	84166				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding	g.chr16:57054740C>T	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.116C>T	16.37:g.57054740C>T	ENSP00000262510:p.Thr39Met					NLRC5_uc010ccq.1_RNA	p.T39M	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN			3	341	+		all_neural(199;0.225)	39					B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	c.116C>T	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	C	0.518	-0.863482	0.02590	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000544641;ENST00000539144	T;T;T;T	0.73152	-0.52;-0.54;-0.72;-0.54	4.76	-0.358	0.12575	.	.	.	.	.	T	0.34542	0.0901	N	0.01109	-1.01	0.09310	N	1	B	0.16396	0.017	B	0.04013	0.001	T	0.20940	-1.0260	9	0.26408	T	0.33	.	4.938	0.13950	0.1368:0.3537:0.0:0.5095	.	39	Q86WI3	NLRC5_HUMAN	M	39	ENSP00000262510:T39M;ENSP00000308886:T39M;ENSP00000389739:T39M;ENSP00000441727:T39M	ENSP00000262510:T39M	T	+	2	0	NLRC5	55612241	0.001000	0.12720	0.048000	0.18961	0.154000	0.21943	0.137000	0.15995	-0.409000	0.07553	-0.391000	0.06502	ACG		0.547	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206		4	57	0	0	0	0.009096	0	4	57				
CLEC3A	10143	broad.mit.edu	37	16	78064459	78064459	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:78064459C>A	ENST00000575655.1	+	3	396	c.315C>A	c.(313-315)ccC>ccA	p.P105P	RP11-281J9.2_ENST00000563114.1_RNA|CLEC3A_ENST00000299642.4_Silent_p.P114P|CLEC3A_ENST00000565808.1_3'UTR	NM_005752.4	NP_005743.4	O75596	CLC3A_HUMAN	C-type lectin domain family 3, member A	105	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				skeletal system development (GO:0001501)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.P105P(1)		NS(1)|endometrium(2)|large_intestine(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	18						TGGTTATCCCCAGGAACTCCG	0.473																																							uc002ffh.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(313-315)CCC>CCA		C-type lectin domain family 3 member A							78.0	71.0	73.0					16																	78064459		2198	4300	6498	SO:0001819	synonymous_variant	10143				skeletal system development	extracellular region	sugar binding	g.chr16:78064459C>A	AF077345	CCDS10927.1, CCDS10927.2	16q23	2008-02-05	2005-02-09	2005-02-11	ENSG00000166509	ENSG00000166509		"""C-type lectin domain containing"""	2052	protein-coding gene	gene with protein product		613588	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 1 (cartilage-derived)"""	CLECSF1		10524194	Standard	NM_001244755		Approved		uc002ffh.5	O75596	OTTHUMG00000137620	ENST00000575655.1:c.315C>A	16.37:g.78064459C>A							p.P105P	NM_005752	NP_005743	O75596	CLC3A_HUMAN			3	396	+			105			C-type lectin.		B2R8C4|Q3SX91|Q6UXF5	Silent	SNP	ENST00000575655.1	37	c.315C>A																																																																																					0.473	CLEC3A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005752		6	63	1	0	2.7689e-08	0.001984	3.98295e-08	6	63				
CDH13	1012	broad.mit.edu	37	16	83378559	83378559	+	Silent	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:83378559G>C	ENST00000566620.1	+	6	1019	c.729G>C	c.(727-729)ccG>ccC	p.P243P	CDH13_ENST00000428848.3_Silent_p.P204P|CDH13_ENST00000569454.1_3'UTR|CDH13_ENST00000268613.10_Silent_p.P290P	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	243	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)	p.P243P(1)		large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		ACAACCGACCGATCTTTCGGG	0.507																																							uc002fgx.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(727-729)CCG>CCC		cadherin 13 preproprotein							104.0	104.0	104.0					16																	83378559		1921	4124	6045	SO:0001819	synonymous_variant	1012				adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding	g.chr16:83378559G>C	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.729G>C	16.37:g.83378559G>C						CDH13_uc010vns.1_Silent_p.P290P|CDH13_uc010vnt.1_5'UTR|CDH13_uc010vnu.1_Silent_p.P204P	p.P243P	NM_001257	NP_001248	P55290	CAD13_HUMAN		COAD - Colon adenocarcinoma(5;0.0268)	6	849	+		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)	243			Cadherin 1.		A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Silent	SNP	ENST00000566620.1	37	c.729G>C	CCDS58486.1																																																																																				0.507	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257		13	67	0	0	0	0.001855	0	13	67				
TAF1C	9013	broad.mit.edu	37	16	84212613	84212613	+	Silent	SNP	G	G	T	rs138100695		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:84212613G>T	ENST00000567759.1	-	14	2726	c.2544C>A	c.(2542-2544)tcC>tcA	p.S848S	TAF1C_ENST00000566732.1_Silent_p.S822S|TAF1C_ENST00000541676.1_Silent_p.S755S|TAF1C_ENST00000570117.1_Silent_p.S516S|TAF1C_ENST00000378541.4_Silent_p.S848S|TAF1C_ENST00000341690.6_Silent_p.S754S	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	848					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)	p.S848S(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						TGTGCTGCTGGGAGCGAGTGG	0.652																																							uc002fhn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2542-2544)TCC>TCA		TBP-associated factor 1C isoform 1							62.0	62.0	62.0					16																	84212613		2200	4300	6500	SO:0001819	synonymous_variant	9013				regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding	g.chr16:84212613G>T	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.2544C>A	16.37:g.84212613G>T						TAF1C_uc002fhm.2_Silent_p.S754S|TAF1C_uc010vnx.1_Silent_p.S822S|TAF1C_uc010vny.1_Silent_p.S439S|TAF1C_uc010vnz.1_Silent_p.S516S|TAF1C_uc002fho.2_Silent_p.S371S|TAF1C_uc010voa.1_Silent_p.S516S|TAF1C_uc002fhp.1_RNA	p.S848S	NM_005679	NP_005670	Q15572	TAF1C_HUMAN			14	2772	-			848					B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Silent	SNP	ENST00000567759.1	37	c.2544C>A	CCDS32496.1																																																																																				0.652	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353		11	71	1	0	1.49906e-05	0.00245	1.92884e-05	11	71				
USP10	9100	broad.mit.edu	37	16	84779061	84779061	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr16:84779061A>G	ENST00000219473.7	+	4	1087	c.974A>G	c.(973-975)gAc>gGc	p.D325G	USP10_ENST00000570191.1_Missense_Mutation_p.D329G	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	325					autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.D325G(1)		endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						CCTCCTGCTGACGGCACGGGC	0.612																																							uc002fii.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(973-975)GAC>GGC		ubiquitin specific protease 10							34.0	36.0	35.0					16																	84779061		1962	4149	6111	SO:0001583	missense	9100				DNA damage response, signal transduction by p53 class mediator|DNA repair|protein deubiquitination|ubiquitin-dependent protein catabolic process	early endosome|intermediate filament cytoskeleton|nucleus	cystic fibrosis transmembrane conductance regulator binding|p53 binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr16:84779061A>G	D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.974A>G	16.37:g.84779061A>G	ENSP00000219473:p.Asp325Gly					USP10_uc010voe.1_Missense_Mutation_p.D329G|USP10_uc010vof.1_Intron|USP10_uc002fij.2_5'UTR	p.D325G	NM_005153	NP_005144	Q14694	UBP10_HUMAN			4	1116	+			325					B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Missense_Mutation	SNP	ENST00000219473.7	37	c.974A>G	CCDS45537.1	.	.	.	.	.	.	.	.	.	.	A	9.944	1.218177	0.22373	.	.	ENSG00000103194	ENST00000219473	T	0.06933	3.24	5.47	4.38	0.52667	.	2.439510	0.01350	N	0.011875	T	0.08492	0.0211	L	0.36672	1.1	0.30094	N	0.808094	P;B	0.40834	0.73;0.224	B;B	0.29862	0.108;0.05	T	0.37820	-0.9689	10	0.31617	T	0.26	-17.1766	10.342	0.43884	0.9231:0.0:0.0769:0.0	.	329;325	Q14694-3;Q14694	.;UBP10_HUMAN	G	325	ENSP00000219473:D325G	ENSP00000219473:D325G	D	+	2	0	USP10	83336562	0.957000	0.32711	0.012000	0.15200	0.083000	0.17756	2.194000	0.42668	0.919000	0.36945	0.402000	0.26972	GAC		0.612	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1			3	19	0	0	0	0.004672	0	3	19				
WSCD1	23302	broad.mit.edu	37	17	6021461	6021461	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:6021461G>C	ENST00000574946.1	+	8	1718	c.1328G>C	c.(1327-1329)tGt>tCt	p.C443S	WSCD1_ENST00000317744.5_Missense_Mutation_p.C443S|WSCD1_ENST00000539421.1_Missense_Mutation_p.C443S|WSCD1_ENST00000574232.1_Missense_Mutation_p.C443S|WSCD1_ENST00000573634.1_Missense_Mutation_p.C327S			Q658N2	WSCD1_HUMAN	WSC domain containing 1	443						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.C443S(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						AACAGAAAATGTGCCGGGCAC	0.542																																							uc010cli.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1327-1329)TGT>TCT		WSC domain containing 1							49.0	50.0	50.0					17																	6021461		2203	4300	6503	SO:0001583	missense	23302					integral to membrane	sulfotransferase activity	g.chr17:6021461G>C		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1328G>C	17.37:g.6021461G>C	ENSP00000460825:p.Cys443Ser					WSCD1_uc002gcn.2_Missense_Mutation_p.C443S|WSCD1_uc002gco.2_Missense_Mutation_p.C443S|WSCD1_uc010clj.2_Missense_Mutation_p.C134S	p.C443S	NM_015253	NP_056068	Q658N2	WSCD1_HUMAN			8	1707	+			443					A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	ENST00000574946.1	37	c.1328G>C	CCDS32538.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.753101	0.49362	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	D;D	0.81499	-1.5;-1.5	5.47	5.47	0.80525	Sulfotransferase domain (1);	0.045565	0.85682	D	0.000000	T	0.82181	0.4981	L	0.28014	0.82	0.51012	D	0.999905	D	0.69078	0.997	D	0.66602	0.945	T	0.78971	-0.1993	10	0.22706	T	0.39	-19.7296	16.8089	0.85713	0.0:0.0:1.0:0.0	.	443	Q658N2	WSCD1_HUMAN	S	443	ENSP00000323087:C443S;ENSP00000446032:C443S	ENSP00000323087:C443S	C	+	2	0	WSCD1	5962185	1.000000	0.71417	0.834000	0.33040	0.717000	0.41224	4.918000	0.63376	2.583000	0.87209	0.655000	0.94253	TGT		0.542	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253		13	24	0	0	0	0.004007	0	13	24				
MYH8	4626	broad.mit.edu	37	17	10323440	10323440	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:10323440A>C	ENST00000403437.2	-	3	199	c.105T>G	c.(103-105)gaT>gaG	p.D35E	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	35					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.D35E(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						ATGTTTTAGCATCAAACGGCT	0.483									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(3)|breast(2)	11						c.(103-105)GAT>GAG		myosin, heavy chain 8, skeletal muscle,							243.0	232.0	236.0					17																	10323440		2203	4300	6503	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10323440A>C		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.105T>G	17.37:g.10323440A>C	ENSP00000384330:p.Asp35Glu					uc002gml.1_Intron	p.D35E	NM_002472	NP_002463	P13535	MYH8_HUMAN			3	200	-			35			Myosin head-like.		Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.105T>G	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	A	16.29	3.081331	0.55753	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.85411	-1.98	4.59	-0.263	0.12954	.	0.000000	0.42964	U	0.000630	D	0.82990	0.5157	M	0.69358	2.11	0.40537	D	0.980981	B	0.21753	0.06	B	0.34722	0.188	T	0.74754	-0.3558	10	0.52906	T	0.07	.	8.8961	0.35465	0.6987:0.0:0.3013:0.0	.	35	P13535	MYH8_HUMAN	E	35	ENSP00000384330:D35E	ENSP00000252173:D35E	D	-	3	2	MYH8	10264165	0.916000	0.31088	0.983000	0.44433	0.988000	0.76386	0.722000	0.25925	-0.253000	0.09514	0.383000	0.25322	GAT		0.483	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		61	200	0	0	0	0.00361	0	61	200				
ARHGAP44	9912	broad.mit.edu	37	17	12883520	12883520	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:12883520G>T	ENST00000379672.5	+	19	2209	c.1909G>T	c.(1909-1911)Gca>Tca	p.A637S	ARHGAP44_ENST00000578087.1_3'UTR|ARHGAP44_ENST00000340825.3_Missense_Mutation_p.A631S|ARHGAP44_ENST00000262444.9_Missense_Mutation_p.A637S	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	637					exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)	p.A637S(1)		NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						CCAGCCGCCTGCAGACCAGAG	0.652																																							uc002gnr.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1909-1911)GCA>TCA		Rho GTPase-activating protein RICH2							27.0	34.0	32.0					17																	12883520		1925	4147	6072	SO:0001583	missense	9912				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr17:12883520G>T		CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.1909G>T	17.37:g.12883520G>T	ENSP00000368994:p.Ala637Ser					RICH2_uc010vvk.1_Missense_Mutation_p.A637S|RICH2_uc010vvl.1_Missense_Mutation_p.A631S|RICH2_uc002gns.3_Missense_Mutation_p.A431S|RICH2_uc010vvm.1_Missense_Mutation_p.A631S|RICH2_uc010vvn.1_Intron	p.A637S	NM_014859	NP_055674	Q17R89	RHG44_HUMAN			19	2236	+			637					A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Missense_Mutation	SNP	ENST00000379672.5	37	c.1909G>T	CCDS45616.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845984	0.51164	.	.	ENSG00000006740	ENST00000379672;ENST00000544416;ENST00000340825;ENST00000262444	T;T;T	0.18174	2.24;3.08;2.23	4.87	0.32	0.15878	.	0.321261	0.32836	N	0.005585	T	0.10551	0.0258	L	0.43152	1.355	0.19575	N	0.999963	B;B;B;B	0.12630	0.0;0.006;0.0;0.001	B;B;B;B	0.11329	0.0;0.006;0.001;0.001	T	0.26916	-1.0089	10	0.19147	T	0.46	.	3.8362	0.08896	0.3869:0.1965:0.4166:0.0	.	631;95;293;637	A6NCP5;E7ERK8;F5H6L3;Q17R89	.;.;.;RHG44_HUMAN	S	637;293;631;95	ENSP00000368994:A637S;ENSP00000437542:A293S;ENSP00000342566:A631S	ENSP00000262444:A95S	A	+	1	0	ARHGAP44	12824245	0.279000	0.24239	0.027000	0.17364	0.870000	0.49936	1.222000	0.32515	0.256000	0.21614	0.555000	0.69702	GCA		0.652	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441566.1	NM_014859		5	25	1	0	8.12818e-05	0.001984	9.89135e-05	5	25				
NOS2	4843	broad.mit.edu	37	17	26110042	26110042	+	Silent	SNP	G	G	A	rs139747007	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:26110042G>A	ENST00000313735.6	-	6	791	c.558C>T	c.(556-558)ctC>ctT	p.L186L		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	186					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)	p.L186L(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	TGGCGAAGATGAGCTCATCTC	0.552																																							uc002gzu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)|breast(1)	4						c.(556-558)CTC>CTT		nitric oxide synthase 2A	Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	G		4,4402	8.1+/-20.4	0,4,2199	262.0	183.0	210.0		558	5.6	1.0	17	dbSNP_134	210	0,8600		0,0,4300	no	coding-synonymous	NOS2	NM_000625.4		0,4,6499	AA,AG,GG		0.0,0.0908,0.0308		186/1154	26110042	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	4843				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding	g.chr17:26110042G>A	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.558C>T	17.37:g.26110042G>A						NOS2_uc010crh.1_Silent_p.L186L|NOS2_uc010wab.1_Silent_p.L186L	p.L186L	NM_000625	NP_000616	P35228	NOS2_HUMAN			6	822	-			186					A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Silent	SNP	ENST00000313735.6	37	c.558C>T	CCDS11223.1																																																																																				0.552	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625		8	61	0	0	0	0.00308	0	8	61				
TMEM132E	124842	broad.mit.edu	37	17	32961968	32961968	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:32961968C>T	ENST00000321639.5	+	8	1897	c.1569C>T	c.(1567-1569)gtC>gtT	p.V523V		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	523						integral component of membrane (GO:0016021)		p.V523V(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		ACCAGGTGGTCACCATGTTAG	0.617																																							uc002hif.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1567-1569)GTC>GTT		transmembrane protein 132E precursor							109.0	84.0	92.0					17																	32961968		2203	4300	6503	SO:0001819	synonymous_variant	124842					integral to membrane		g.chr17:32961968C>T	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1569C>T	17.37:g.32961968C>T							p.V523V	NM_207313	NP_997196	Q6IEE7	T132E_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.231)	8	1897	+			523			Extracellular (Potential).		Q8WUF4|Q8WVA5	Silent	SNP	ENST00000321639.5	37	c.1569C>T	CCDS11283.1																																																																																				0.617	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313		3	51	0	0	0	0.009096	0	3	51				
TMEM132E	124842	broad.mit.edu	37	17	32961989	32961989	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:32961989G>A	ENST00000321639.5	+	8	1918	c.1590G>A	c.(1588-1590)tgG>tgA	p.W530*		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	530						integral component of membrane (GO:0016021)		p.W530*(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GCCCGGACTGGCTGGTGGAGG	0.627																																							uc002hif.2		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(1588-1590)TGG>TGA		transmembrane protein 132E precursor							98.0	76.0	83.0					17																	32961989		2203	4300	6503	SO:0001587	stop_gained	124842					integral to membrane		g.chr17:32961989G>A	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1590G>A	17.37:g.32961989G>A	ENSP00000316532:p.Trp530*						p.W530*	NM_207313	NP_997196	Q6IEE7	T132E_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.231)	8	1918	+			530			Extracellular (Potential).		Q8WUF4|Q8WVA5	Nonsense_Mutation	SNP	ENST00000321639.5	37	c.1590G>A	CCDS11283.1	.	.	.	.	.	.	.	.	.	.	G	43	9.838608	0.99276	.	.	ENSG00000181291	ENST00000321639	.	.	.	5.22	5.22	0.72569	.	0.112447	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.4348	17.9499	0.89050	0.0:0.0:1.0:0.0	.	.	.	.	X	530	.	ENSP00000316532:W530X	W	+	3	0	TMEM132E	29986102	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.640000	0.98453	2.725000	0.93324	0.498000	0.49722	TGG		0.627	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313		4	40	0	0	0	0.009096	0	4	40				
AP2B1	163	broad.mit.edu	37	17	33935316	33935316	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:33935316G>T	ENST00000262325.7	+	5	988	c.435G>T	c.(433-435)gtG>gtT	p.V145V	AP2B1_ENST00000537622.2_Silent_p.V145V|AP2B1_ENST00000538556.1_Silent_p.V88V|AP2B1_ENST00000592545.1_Silent_p.V107V|AP2B1_ENST00000589344.1_Silent_p.V145V|AP2B1_ENST00000312678.8_Silent_p.V145V	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	145					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)	p.V145V(1)		NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CAGTCTGCGTGGCAAAACTCC	0.458																																							uc002hjr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(433-435)GTG>GTT		adaptor-related protein complex 2, beta 1							100.0	102.0	101.0					17																	33935316		2203	4300	6503	SO:0001819	synonymous_variant	163				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|coated pit|cytosol|endocytic vesicle membrane|plasma membrane	clathrin binding|protein transporter activity	g.chr17:33935316G>T	M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.435G>T	17.37:g.33935316G>T						AP2B1_uc002hjq.2_Silent_p.V145V|AP2B1_uc010wci.1_Silent_p.V107V|AP2B1_uc002hjs.2_Silent_p.V88V|AP2B1_uc002hjt.2_Silent_p.V145V|AP2B1_uc010ctv.2_Silent_p.V145V	p.V145V	NM_001282	NP_001273	P63010	AP2B1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)	5	624	+		Ovarian(249;0.17)	145					A6NJP3|P21851|Q7Z451|Q96J19	Silent	SNP	ENST00000262325.7	37	c.435G>T	CCDS32622.1																																																																																				0.458	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1			31	103	1	0	1.30988e-24	0.002096	2.28212e-24	31	103				
ADAM11	4185	broad.mit.edu	37	17	42853507	42853507	+	Missense_Mutation	SNP	G	G	T	rs138490145		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:42853507G>T	ENST00000200557.6	+	18	1667	c.1498G>T	c.(1498-1500)Ggt>Tgt	p.G500C	ADAM11_ENST00000535346.1_Missense_Mutation_p.G300C	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	500	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G500C(2)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				CGAACCACGGGGTGTGTCCTG	0.687																																							uc002ihh.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1498-1500)GGT>TGT		ADAM metallopeptidase domain 11 preproprotein							85.0	92.0	90.0					17																	42853507		2203	4300	6503	SO:0001583	missense	4185				integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr17:42853507G>T	D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.1498G>T	17.37:g.42853507G>T	ENSP00000200557:p.Gly500Cys					ADAM11_uc010wjd.1_Missense_Mutation_p.G300C|ADAM11_uc002ihi.2_5'Flank	p.G500C	NM_002390	NP_002381	O75078	ADA11_HUMAN			18	1498	+		Prostate(33;0.0959)	500			Extracellular (Potential).|Disintegrin.		Q14808|Q14809|Q14810	Missense_Mutation	SNP	ENST00000200557.6	37	c.1498G>T	CCDS11486.1	.	.	.	.	.	.	.	.	.	.	G	32	5.121537	0.94385	.	.	ENSG00000073670	ENST00000200557;ENST00000535346;ENST00000355638	T;T	0.16457	2.34;2.34	4.48	4.48	0.54585	Disintegrin, conserved site (1);Blood coagulation inhibitor, Disintegrin (6);	0.000000	0.85682	D	0.000000	T	0.59945	0.2231	H	0.98646	4.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	T	0.77925	-0.2405	10	0.87932	D	0	.	16.1505	0.81618	0.0:0.0:1.0:0.0	.	300;500	B4DKD2;O75078	.;ADA11_HUMAN	C	500;300;400	ENSP00000200557:G500C;ENSP00000443773:G300C	ENSP00000200557:G500C	G	+	1	0	ADAM11	40209033	1.000000	0.71417	0.994000	0.49952	0.955000	0.61496	9.318000	0.96334	2.335000	0.79485	0.536000	0.68110	GGT		0.687	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390		8	103	1	0	2.52707e-12	0.006214	3.91626e-12	8	103				
SPAG9	9043	broad.mit.edu	37	17	49156969	49156969	+	Nonsense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:49156969T>A	ENST00000262013.7	-	2	608	c.400A>T	c.(400-402)Aaa>Taa	p.K134*	RP11-481C4.1_ENST00000509833.1_RNA|SPAG9_ENST00000505279.1_Nonsense_Mutation_p.K134*|SPAG9_ENST00000357122.4_Nonsense_Mutation_p.K134*	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	134					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.K134*(1)		NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			TTTTTCGCTTTCAGCTCAAGT	0.398																																							uc002itc.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(4)|breast(1)	5						c.(400-402)AAA>TAA		sperm associated antigen 9 isoform 1							206.0	196.0	199.0					17																	49156969		2203	4299	6502	SO:0001587	stop_gained	9043				positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm		g.chr17:49156969T>A	AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.400A>T	17.37:g.49156969T>A	ENSP00000262013:p.Lys134*					SPAG9_uc002itb.2_Nonsense_Mutation_p.K134*|SPAG9_uc002itd.2_Nonsense_Mutation_p.K134*|SPAG9_uc002itf.2_5'UTR	p.K134*	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	BRCA - Breast invasive adenocarcinoma(22;4.24e-07)		2	609	-			134			Potential.		A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Nonsense_Mutation	SNP	ENST00000262013.7	37	c.400A>T	CCDS45740.1	.	.	.	.	.	.	.	.	.	.	T	39	7.289962	0.98189	.	.	ENSG00000008294	ENST00000262013;ENST00000505279;ENST00000357122;ENST00000546269	.	.	.	5.1	5.1	0.69264	.	0.143577	0.51477	D	0.000095	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.3801	15.1929	0.73060	0.0:0.0:0.0:1.0	.	.	.	.	X	134	.	ENSP00000262013:K134X	K	-	1	0	SPAG9	46511968	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.785000	0.85724	2.057000	0.61298	0.528000	0.53228	AAA		0.398	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2	NM_003971		31	144	0	0	0	0.002445	0	31	144				
ANKFN1	162282	broad.mit.edu	37	17	54431318	54431318	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:54431318G>T	ENST00000318698.2	+	5	556	c.521G>T	c.(520-522)gGc>gTc	p.G174V	ANKFN1_ENST00000566473.2_Missense_Mutation_p.G174V	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	174								p.G174V(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						AACAGCGAGGGCTTGACACCC	0.502																																							uc002iun.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(520-522)GGC>GTC		ankyrin-repeat and fibronectin type III domain							198.0	139.0	159.0					17																	54431318		2203	4300	6503	SO:0001583	missense	162282							g.chr17:54431318G>T	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.521G>T	17.37:g.54431318G>T	ENSP00000321627:p.Gly174Val						p.G174V	NM_153228	NP_694960	Q8N957	ANKF1_HUMAN			5	556	+			174			ANK 2.			Missense_Mutation	SNP	ENST00000318698.2	37	c.521G>T	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685444	0.88639	.	.	ENSG00000153930	ENST00000318698	T	0.78126	-1.15	5.22	5.22	0.72569	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.89962	0.6867	M	0.87827	2.91	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.91649	0.5333	10	0.87932	D	0	-13.2516	18.7786	0.91922	0.0:0.0:1.0:0.0	.	174	Q8N957	ANKF1_HUMAN	V	174	ENSP00000321627:G174V	ENSP00000321627:G174V	G	+	2	0	ANKFN1	51786317	1.000000	0.71417	0.994000	0.49952	0.763000	0.43281	9.864000	0.99589	2.426000	0.82243	0.655000	0.94253	GGC		0.502	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228		13	48	1	0	7.05477e-17	0.00499	1.15723e-16	13	48				
COIL	8161	broad.mit.edu	37	17	55038196	55038196	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:55038196T>C	ENST00000240316.4	-	1	219	c.185A>G	c.(184-186)gAg>gGg	p.E62G		NM_004645.2	NP_004636.1	P38432	COIL_HUMAN	coilin	62						Cajal body (GO:0015030)|cytoplasm (GO:0005737)|female germ cell nucleus (GO:0001674)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	disulfide oxidoreductase activity (GO:0015036)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)	p.E62G(1)		NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	15	Breast(9;6.15e-08)					GAGCCCCCCCTCCAGGTAGAG	0.672																																							uc002iuu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(184-186)GAG>GGG		coilin							11.0	12.0	12.0					17																	55038196		2192	4284	6476	SO:0001583	missense	8161					Cajal body|nucleolus	protein C-terminus binding	g.chr17:55038196T>C	U06632	CCDS11592.1	17q22	2012-10-02			ENSG00000121058	ENSG00000121058			2184	protein-coding gene	gene with protein product		600272				7971277	Standard	NM_004645		Approved	CLN80, p80-coilin	uc002iuu.3	P38432	OTTHUMG00000178126	ENST00000240316.4:c.185A>G	17.37:g.55038196T>C	ENSP00000240316:p.Glu62Gly						p.E62G	NM_004645	NP_004636	P38432	COIL_HUMAN			1	216	-	Breast(9;6.15e-08)		62					B2R931	Missense_Mutation	SNP	ENST00000240316.4	37	c.185A>G	CCDS11592.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.675500	0.88445	.	.	ENSG00000121058	ENST00000240316	T	0.51574	0.7	4.32	3.2	0.36748	.	0.337951	0.34507	N	0.003919	T	0.45478	0.1344	L	0.55990	1.75	0.48135	D	0.999592	P	0.36909	0.573	B	0.40901	0.343	T	0.46176	-0.9210	10	0.87932	D	0	-6.0605	9.8597	0.41107	0.0:0.0:0.1721:0.8279	.	62	P38432	COIL_HUMAN	G	62	ENSP00000240316:E62G	ENSP00000240316:E62G	E	-	2	0	COIL	52393195	1.000000	0.71417	0.989000	0.46669	0.991000	0.79684	5.523000	0.67099	0.768000	0.33290	0.374000	0.22700	GAG		0.672	COIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440618.1			4	8	0	0	0	0.009096	0	4	8				
GH1	2688	broad.mit.edu	37	17	61994708	61994708	+	Missense_Mutation	SNP	G	G	C	rs148474991		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:61994708G>C	ENST00000323322.5	-	5	657	c.615C>G	c.(613-615)atC>atG	p.I205M	GH1_ENST00000458650.2_Missense_Mutation_p.I190M|CSHL1_ENST00000392824.4_Intron|GH1_ENST00000351388.4_Missense_Mutation_p.I165M|GH1_ENST00000342364.4_Missense_Mutation_p.I110M	NM_000515.3	NP_000506.2	P01241	SOMA_HUMAN	growth hormone 1	205			I -> M (in short stature; idiopathic autosomal). {ECO:0000269|PubMed:15001589}.		bone maturation (GO:0070977)|glucose transport (GO:0015758)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|growth hormone receptor binding (GO:0005131)|metal ion binding (GO:0046872)|prolactin receptor binding (GO:0005148)	p.I205M(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	19						GGCACTGCACGATGCGCAGGA	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		18658	0.0		0.0	False		,,,				2504	0.001						uc002jdj.2		NA																	1	Substitution - Missense(1)		lung(1)		0	GRCh37	CM040745	GH1	M	rs148474991	c.(613-615)ATC>ATG		growth hormone 1 isoform 1		G	MET/ILE,MET/ILE,MET/ILE,MET/ILE,	1,4405	2.1+/-5.4	0,1,2202	149.0	116.0	127.0		615,570,495,330,	-1.0	1.0	17	dbSNP_134	127	4,8590	3.7+/-12.6	0,4,4293	no	missense,missense,missense,missense,utr-3	GH1	NM_000515.3,NM_022559.2,NM_022560.2,NM_022561.2,NM_022562.2	10,10,10,10,	0,5,6495	CC,CG,GG		0.0465,0.0227,0.0385	benign,benign,benign,benign,	205/218,190/203,165/178,110/123,	61994708	5,12995	2203	4297	6500	SO:0001583	missense	2688				glucose transport|growth hormone receptor signaling pathway|JAK-STAT cascade|positive regulation of activation of JAK2 kinase activity|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of MAP kinase activity|positive regulation of multicellular organism growth|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|response to estradiol stimulus	extracellular space	growth factor activity|growth hormone receptor binding|hormone activity|metal ion binding|prolactin receptor binding	g.chr17:61994708G>C	M13438	CCDS11653.1, CCDS11654.1, CCDS45760.1	17q22-q24	2014-01-30				ENSG00000259384		"""Endogenous ligands"""	4261	protein-coding gene	gene with protein product	"""pituitary growth hormone"", ""somatotropin"""	139250				6306568	Standard	XM_005257218		Approved	GH-N, GHN, GH, hGH-N	uc002jdj.3	P01241		ENST00000323322.5:c.615C>G	17.37:g.61994708G>C	ENSP00000312673:p.Ile205Met					GH1_uc002jdi.2_Missense_Mutation_p.I190M|GH1_uc002jdk.2_Missense_Mutation_p.I165M|GH1_uc002jdl.2_Missense_Mutation_p.I110M|GH1_uc002jdm.2_3'UTR|GH1_uc002jdn.2_Missense_Mutation_p.S159W	p.I205M	NM_000515	NP_000506	P01241	SOMA_HUMAN			5	677	-			205		I -> M (in short stature; idiopathic autosomal).			A6NEF6|Q14405|Q16631|Q5EB53|Q9HBZ1|Q9UMJ7|Q9UNL5	Missense_Mutation	SNP	ENST00000323322.5	37	c.615C>G	CCDS11653.1	.	.	.	.	.	.	.	.	.	.	g	5.999	0.368220	0.11352	2.27E-4	4.65E-4	ENSG00000204414	ENST00000323322;ENST00000458650;ENST00000351388;ENST00000342364	D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62	2.62	-1.01	0.10169	Somatotropin hormone, conserved site (1);Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	17.051700	0.00166	N	0.000000	D	0.85809	0.5783	L	0.33753	1.03	0.21861	N	0.999508	B;B;B;B	0.13145	0.007;0.003;0.007;0.007	B;B;B;B	0.21708	0.023;0.026;0.036;0.013	T	0.70432	-0.4873	10	0.39692	T	0.17	.	7.4292	0.27118	0.1148:0.3032:0.582:0.0	.	110;165;205;190	B1A4G9;A6NEF6;P01241;B1A4G7	.;.;SOMA_HUMAN;.	M	205;190;165;110	ENSP00000312673:I205M;ENSP00000408486:I190M;ENSP00000343791:I165M;ENSP00000339278:I110M	ENSP00000312673:I205M	I	-	3	3	GH1	59348440	1.000000	0.71417	0.974000	0.42286	0.826000	0.46750	0.859000	0.27858	-0.324000	0.08589	-0.856000	0.03024	ATC		0.592	GH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417708.1	NM_000515		19	49	0	0	0	0.008871	0	19	49				
SDK2	54549	broad.mit.edu	37	17	71346482	71346482	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:71346482T>A	ENST00000392650.3	-	43	5932	c.5932A>T	c.(5932-5934)Agc>Tgc	p.S1978C	SDK2_ENST00000410094.1_5'UTR|SDK2_ENST00000388726.3_Missense_Mutation_p.S1959C	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1978					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.S1978C(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						ATCATCTCGCTGTGGCCTAGG	0.567																																							uc010dfm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(5932-5934)AGC>TGC		sidekick 2							95.0	76.0	82.0					17																	71346482		2203	4300	6503	SO:0001583	missense	54549				cell adhesion	integral to membrane		g.chr17:71346482T>A	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.5932A>T	17.37:g.71346482T>A	ENSP00000376421:p.Ser1978Cys					SDK2_uc002jjt.3_Missense_Mutation_p.S1118C	p.S1978C	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN			43	5932	-			1978			Cytoplasmic (Potential).		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	c.5932A>T	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.573798	0.86542	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893;ENST00000410094	T;T;T	0.60171	0.21;0.24;1.49	5.53	4.56	0.56223	.	0.060539	0.64402	D	0.000003	T	0.50837	0.1639	N	0.14661	0.345	0.35290	D	0.782119	P;P	0.45531	0.78;0.86	P;P	0.50440	0.541;0.641	T	0.65899	-0.6056	10	0.66056	D	0.02	.	13.2829	0.60226	0.0:0.9214:0.0:0.0786	.	1978;1959	Q58EX2;Q58EX2-3	SDK2_HUMAN;.	C	1602;1978;1959;1135;1978;319	ENSP00000376421:S1978C;ENSP00000373378:S1959C;ENSP00000407098:S1135C	ENSP00000324967:S1978C	S	-	1	0	SDK2	68858077	1.000000	0.71417	0.980000	0.43619	0.928000	0.56348	5.683000	0.68189	1.312000	0.45043	-0.248000	0.11899	AGC		0.567	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064		13	18	0	0	0	0.00245	0	13	18				
DNAI2	64446	broad.mit.edu	37	17	72301559	72301559	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:72301559G>T	ENST00000311014.6	+	9	1256	c.1189G>T	c.(1189-1191)Gaa>Taa	p.E397*	DNAI2_ENST00000446837.2_Nonsense_Mutation_p.E397*|DNAI2_ENST00000582036.1_Nonsense_Mutation_p.E397*|DNAI2_ENST00000307504.5_Nonsense_Mutation_p.E254*|DNAI2_ENST00000579490.1_Nonsense_Mutation_p.E454*|AC103809.1_ENST00000516976.1_RNA|RP11-647F2.2_ENST00000585167.1_RNA			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	397					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.E397*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AGACAGCCGGGAATCGTCCAT	0.612									Kartagener syndrome																														uc002jkf.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1189-1191)GAA>TAA		dynein, axonemal, intermediate polypeptide 2							47.0	48.0	48.0					17																	72301559		2203	4300	6503	SO:0001587	stop_gained	64446	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity	g.chr17:72301559G>T	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.1189G>T	17.37:g.72301559G>T	ENSP00000308312:p.Glu397*					DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA|uc002jkh.1_3'UTR|DNAI2_uc002jki.2_RNA	p.E397*	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN			9	1288	+			397			WD 4.		C9J0S6|Q8IUW4|Q9H179|Q9NT53	Nonsense_Mutation	SNP	ENST00000311014.6	37	c.1189G>T	CCDS11697.1	.	.	.	.	.	.	.	.	.	.	G	41	8.920356	0.99002	.	.	ENSG00000171595	ENST00000311014;ENST00000307504;ENST00000446837	.	.	.	4.96	4.96	0.65561	.	0.100864	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-32.556	18.2776	0.90088	0.0:0.0:1.0:0.0	.	.	.	.	X	397;254;397	.	ENSP00000302929:E254X	E	+	1	0	DNAI2	69813154	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.463000	0.97652	2.315000	0.78130	0.556000	0.70494	GAA		0.612	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036		4	28	1	0	0.000602214	0.000602	0.000699466	4	28				
TBC1D16	125058	broad.mit.edu	37	17	77926534	77926534	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:77926534C>A	ENST00000310924.2	-	4	978	c.863G>T	c.(862-864)cGg>cTg	p.R288L	TBC1D16_ENST00000576768.1_5'Flank|TBC1D16_ENST00000570373.1_5'Flank|TBC1D16_ENST00000572862.1_5'Flank|TBC1D16_ENST00000340848.7_5'Flank	NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	288							Rab GTPase activator activity (GO:0005097)	p.R288L(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			GGCGCACACCCGCTGCGGCTC	0.682																																					Ovarian(14;397 562 4850 31922 49378)	Ovarian(14;397 562 4850 31922 49378)	uc002jxj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(862-864)CGG>CTG		TBC1 domain family, member 16							24.0	29.0	27.0					17																	77926534		2202	4299	6501	SO:0001583	missense	125058					intracellular	Rab GTPase activator activity	g.chr17:77926534C>A	AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.863G>T	17.37:g.77926534C>A	ENSP00000309794:p.Arg288Leu					TBC1D16_uc002jxh.2_5'Flank|TBC1D16_uc002jxi.2_5'Flank|TBC1D16_uc002jxk.1_5'Flank	p.R288L	NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)		4	979	-	all_neural(118;0.167)		288					B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Missense_Mutation	SNP	ENST00000310924.2	37	c.863G>T	CCDS11766.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.238352	0.58886	.	.	ENSG00000167291	ENST00000310924	T	0.09911	2.93	5.06	3.99	0.46301	.	0.433622	0.25238	N	0.032117	T	0.07818	0.0196	L	0.36672	1.1	0.80722	D	1	B	0.16396	0.017	B	0.09377	0.004	T	0.22034	-1.0228	10	0.66056	D	0.02	-38.0701	3.4807	0.07601	0.0:0.6182:0.0:0.3818	.	288	Q8TBP0	TBC16_HUMAN	L	288	ENSP00000309794:R288L	ENSP00000309794:R288L	R	-	2	0	TBC1D16	75541129	1.000000	0.71417	0.040000	0.18447	0.906000	0.53458	4.776000	0.62354	2.355000	0.79922	0.655000	0.94253	CGG		0.682	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437145.1	NM_019020		6	37	1	0	8.12818e-05	0.001984	9.89135e-05	6	37				
FASN	2194	broad.mit.edu	37	17	80045689	80045689	+	Missense_Mutation	SNP	G	G	A	rs202024339		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:80045689G>A	ENST00000306749.2	-	19	3133	c.2915C>T	c.(2914-2916)cCg>cTg	p.P972L		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	972					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P972L(1)		central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GGGGCTTTCCGGGTGGTCGAA	0.652													.|||	1	0.000199681	0.0	0.0	5008	,	,		14499	0.0		0.001	False		,,,				2504	0.0				Colon(59;314 1043 11189 28578 32273)	Colon(59;314 1043 11189 28578 32273)	uc002kdu.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(2914-2916)CCG>CTG		fatty acid synthase	Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)						25.0	29.0	28.0					17																	80045689		2194	4292	6486	SO:0001583	missense	2194				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding	g.chr17:80045689G>A	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.2915C>T	17.37:g.80045689G>A	ENSP00000304592:p.Pro972Leu					FASN_uc002kdw.1_Missense_Mutation_p.P188L	p.P972L	NM_004104	NP_004095	P49327	FAS_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		19	3032	-	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		972					Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	c.2915C>T	CCDS11801.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	9.135	1.012465	0.19277	.	.	ENSG00000169710	ENST00000306749	T	0.27890	1.64	3.86	-7.55	0.01327	.	1.993410	0.02540	U	0.094552	T	0.12774	0.0310	N	0.16743	0.435	0.09310	N	0.999997	B	0.28419	0.211	B	0.21917	0.037	T	0.12400	-1.0549	10	0.14252	T	0.57	-4.1864	2.6345	0.04954	0.0943:0.1468:0.2435:0.5154	.	972	P49327	FAS_HUMAN	L	972	ENSP00000304592:P972L	ENSP00000304592:P972L	P	-	2	0	FASN	77638978	0.000000	0.05858	0.000000	0.03702	0.142000	0.21351	-2.205000	0.01232	-1.390000	0.02087	0.462000	0.41574	CCG		0.652	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104		9	31	0	0	0	0.008291	0	9	31				
EPB41L3	23136	broad.mit.edu	37	18	5415909	5415909	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr18:5415909G>A	ENST00000341928.2	-	13	2315	c.1975C>T	c.(1975-1977)Cct>Tct	p.P659S	EPB41L3_ENST00000427684.2_Intron|EPB41L3_ENST00000400111.3_Intron|EPB41L3_ENST00000542146.1_Intron|EPB41L3_ENST00000542652.2_Intron|EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000342933.3_Missense_Mutation_p.P659S|EPB41L3_ENST00000540638.2_Intron	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	659	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.P659S(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						AGAGCCAGAGGGAAGGAGAGA	0.572																																							uc002kmt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(1975-1977)CCT>TCT		erythrocyte membrane protein band 4.1-like 3							145.0	109.0	121.0					18																	5415909		2203	4300	6503	SO:0001583	missense	23136				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity	g.chr18:5415909G>A	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.1975C>T	18.37:g.5415909G>A	ENSP00000343158:p.Pro659Ser					EPB41L3_uc010wzh.1_Intron|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc002kms.1_Intron|EPB41L3_uc010wze.1_Intron|EPB41L3_uc010wzf.1_Intron|EPB41L3_uc010wzg.1_Intron|EPB41L3_uc010dkr.2_Intron	p.P659S	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN			13	2061	-			659			Spectrin--actin-binding (Potential).		B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	c.1975C>T	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.109238	0.77096	.	.	ENSG00000082397	ENST00000341928;ENST00000342933	D;D	0.81996	-1.56;-1.56	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000001	D	0.86719	0.6000	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.66716	0.946	D	0.88186	0.2874	10	0.87932	D	0	.	19.4559	0.94889	0.0:0.0:1.0:0.0	.	659	Q9Y2J2	E41L3_HUMAN	S	659	ENSP00000343158:P659S;ENSP00000341138:P659S	ENSP00000343158:P659S	P	-	1	0	EPB41L3	5405909	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.025000	0.88777	2.586000	0.87340	0.563000	0.77884	CCT		0.572	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307		19	51	0	0	0	0.006122	0	19	51				
ANKRD30B	374860	broad.mit.edu	37	18	14851954	14851954	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr18:14851954T>G	ENST00000358984.4	+	36	3834	c.3654T>G	c.(3652-3654)gaT>gaG	p.D1218E		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1218								p.D1218E(1)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TGAATGTTGATGTGAGTAATA	0.368																																							uc010dlo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(3652-3654)GAT>GAG		ankyrin repeat domain 30B							30.0	23.0	25.0					18																	14851954		692	1590	2282	SO:0001583	missense	374860							g.chr18:14851954T>G	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3654T>G	18.37:g.14851954T>G	ENSP00000351875:p.Asp1218Glu					ANKRD30B_uc010xal.1_Missense_Mutation_p.D360E	p.D1218E	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN			36	3834	+			1303					B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	c.3654T>G	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	T	4.488	0.090536	0.08632	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.12984	2.63	1.39	-0.00248	0.14030	.	.	.	.	.	T	0.07683	0.0193	L	0.48260	1.515	0.09310	N	0.999997	B;P	0.35456	0.03;0.502	B;B	0.21546	0.005;0.035	T	0.32640	-0.9899	9	0.20046	T	0.44	.	2.2572	0.04058	0.2862:0.0:0.2895:0.4243	.	1303;1218	Q9BXX2;F8WAG3	AN30B_HUMAN;.	E	1218;612;638	ENSP00000351875:D1218E	ENSP00000277669:D638E	D	+	3	2	ANKRD30B	14841954	0.078000	0.21339	0.015000	0.15790	0.053000	0.15095	0.035000	0.13797	-0.002000	0.14469	0.145000	0.16022	GAT		0.368	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		5	18	0	0	0	0.001984	0	5	18				
ZNF521	25925	broad.mit.edu	37	18	22805060	22805060	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr18:22805060G>T	ENST00000361524.3	-	4	2970	c.2822C>A	c.(2821-2823)tCc>tAc	p.S941Y	ZNF521_ENST00000584787.1_Missense_Mutation_p.S721Y|ZNF521_ENST00000538137.2_Missense_Mutation_p.S941Y|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	941					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.S941Y(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GCCATTTTCGGAGAAGAAGGT	0.488			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(2)|lung(1)	7						c.(2821-2823)TCC>TAC		zinc finger protein 521							131.0	123.0	126.0					18																	22805060		2203	4300	6503	SO:0001583	missense	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22805060G>T	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2822C>A	18.37:g.22805060G>T	ENSP00000354794:p.Ser941Tyr					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.S941Y|ZNF521_uc002kvl.2_Missense_Mutation_p.S721Y	p.S941Y	NM_015461	NP_056276	Q96K83	ZN521_HUMAN			4	3069	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		941			C2H2-type 22.		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	c.2822C>A	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897368	0.33535	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.29397	1.57;1.57	5.97	5.97	0.96955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.48926	0.1527	L	0.48986	1.54	0.54753	D	0.999983	D	0.76494	0.999	D	0.81914	0.995	T	0.17592	-1.0364	10	0.07990	T	0.79	-19.631	20.4238	0.99064	0.0:0.0:1.0:0.0	.	941	Q96K83	ZN521_HUMAN	Y	941;975;941	ENSP00000354794:S941Y;ENSP00000382352:S941Y	ENSP00000354794:S941Y	S	-	2	0	ZNF521	21059058	1.000000	0.71417	0.973000	0.42090	0.990000	0.78478	9.476000	0.97823	2.828000	0.97474	0.655000	0.94253	TCC		0.488	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		23	67	1	0	2.41591e-17	0.004656	3.97456e-17	23	67				
CDH2	1000	broad.mit.edu	37	18	25565006	25565006	+	Missense_Mutation	SNP	C	C	A	rs151110746		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr18:25565006C>A	ENST00000269141.3	-	13	2590	c.2167G>T	c.(2167-2169)Ggt>Tgt	p.G723C	CDH2_ENST00000399380.3_Missense_Mutation_p.G692C	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	723					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.G723C(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						ATGATGGCACCGGTGCCAAGC	0.483																																							uc002kwg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)	4						c.(2167-2169)GGT>TGT		cadherin 2, type 1 preproprotein							99.0	89.0	92.0					18																	25565006		2203	4300	6503	SO:0001583	missense	1000				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding	g.chr18:25565006C>A	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.2167G>T	18.37:g.25565006C>A	ENSP00000269141:p.Gly723Cys					CDH2_uc010xbn.1_Missense_Mutation_p.G692C	p.G723C	NM_001792	NP_001783	P19022	CADH2_HUMAN			13	2626	-			723			Extracellular (Potential).		A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	c.2167G>T	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757035	0.69648	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.61274	0.16;0.12	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.82403	0.5029	M	0.91140	3.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.991	D	0.83779	0.0224	10	0.54805	T	0.06	.	20.6525	0.99598	0.0:1.0:0.0:0.0	.	692;723	A8MWK3;P19022	.;CADH2_HUMAN	C	723;692	ENSP00000269141:G723C;ENSP00000382312:G692C	ENSP00000269141:G723C	G	-	1	0	CDH2	23819004	1.000000	0.71417	0.247000	0.24249	0.776000	0.43924	7.440000	0.80464	2.890000	0.99128	0.585000	0.79938	GGT		0.483	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792		10	28	1	0	0.00621372	0.006214	0.006862	10	28				
TRAPPC8	22878	broad.mit.edu	37	18	29437775	29437775	+	Silent	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr18:29437775G>C	ENST00000283351.4	-	20	3251	c.2916C>G	c.(2914-2916)ccC>ccG	p.P972P	TRAPPC8_ENST00000582539.1_Silent_p.P918P	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	972					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.P972P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CAGAAGCTGAGGGACTTAGTG	0.423																																							uc002kxc.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2914-2916)CCC>CCG		hypothetical protein LOC22878							191.0	180.0	184.0					18																	29437775		2203	4300	6503	SO:0001819	synonymous_variant	22878				ER to Golgi vesicle-mediated transport	cis-Golgi network		g.chr18:29437775G>C	AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.2916C>G	18.37:g.29437775G>C						KIAA1012_uc002kxb.3_Silent_p.P918P|KIAA1012_uc002kxd.3_Intron	p.P972P	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN			20	3280	-			972					A0JP15|B3KME5|Q9H0L2	Silent	SNP	ENST00000283351.4	37	c.2916C>G	CCDS11901.1																																																																																				0.423	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939		58	171	0	0	0	0.00361	0	58	171				
ZNF532	55205	broad.mit.edu	37	18	56620993	56620993	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr18:56620993G>C	ENST00000336078.4	+	8	3888	c.3112G>C	c.(3112-3114)Gat>Cat	p.D1038H	ZNF532_ENST00000591083.1_Missense_Mutation_p.D1038H|ZNF532_ENST00000589288.1_Missense_Mutation_p.D1038H|ZNF532_ENST00000591230.1_Missense_Mutation_p.D1038H|ZNF532_ENST00000591808.1_Missense_Mutation_p.D1038H	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	1038					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D1038H(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						CATGCAGAGAGATGTGTACAT	0.498																																							uc002lho.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|skin(1)	2						c.(3112-3114)GAT>CAT		zinc finger protein 532							95.0	93.0	94.0					18																	56620993		2203	4300	6503	SO:0001583	missense	55205				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:56620993G>C	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.3112G>C	18.37:g.56620993G>C	ENSP00000338217:p.Asp1038His					ZNF532_uc002lhp.2_Missense_Mutation_p.D1036H|ZNF532_uc010xeg.1_Missense_Mutation_p.D1036H|ZNF532_uc002lhr.2_Missense_Mutation_p.D1036H|ZNF532_uc002lhs.2_Missense_Mutation_p.D1036H|ZNF532_uc010xeh.1_Missense_Mutation_p.D130H	p.D1038H	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN			8	3659	+			1038			C2H2-type 8.		Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	37	c.3112G>C	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843392	0.91197	.	.	ENSG00000074657	ENST00000336078	T	0.15017	2.46	5.23	5.23	0.72850	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.048332	0.85682	D	0.000000	T	0.36358	0.0964	M	0.61703	1.905	0.58432	D	0.999994	P;D	0.71674	0.567;0.998	B;P	0.57371	0.224;0.819	T	0.07578	-1.0765	10	0.66056	D	0.02	-1.5631	18.7617	0.91855	0.0:0.0:1.0:0.0	.	1038;1038	B3KXW2;Q9HCE3	.;ZN532_HUMAN	H	1038	ENSP00000338217:D1038H	ENSP00000338217:D1038H	D	+	1	0	ZNF532	54771973	1.000000	0.71417	0.981000	0.43875	0.996000	0.88848	9.710000	0.98732	2.599000	0.87857	0.637000	0.83480	GAT		0.498	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181		7	128	0	0	0	0.00308	0	7	128				
ZNF560	147741	broad.mit.edu	37	19	9577253	9577253	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:9577253G>T	ENST00000301480.4	-	10	2583	c.2370C>A	c.(2368-2370)caC>caA	p.H790Q		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	790					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H790Q(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						CTTCTCTCTAGTGTGTTTTCA	0.398																																							uc002mlp.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						c.(2368-2370)CAC>CAA		zinc finger protein 560							86.0	84.0	85.0					19																	9577253		2203	4300	6503	SO:0001583	missense	147741				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9577253G>T	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.2370C>A	19.37:g.9577253G>T	ENSP00000301480:p.His790Gln					ZNF560_uc010dwr.1_Missense_Mutation_p.H684Q	p.H790Q	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN			10	2580	-			790			C2H2-type 15.		Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	c.2370C>A	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	G	9.640	1.138665	0.21123	.	.	ENSG00000198028	ENST00000301480	T	0.17054	2.3	2.02	0.838	0.18902	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41166	0.1147	H	0.96142	3.775	0.23076	N	0.998338	D	0.65815	0.995	P	0.56278	0.795	T	0.33343	-0.9872	9	0.87932	D	0	.	2.3553	0.04294	0.2923:0.315:0.3926:0.0	.	790	Q96MR9	ZN560_HUMAN	Q	790	ENSP00000301480:H790Q	ENSP00000301480:H790Q	H	-	3	2	ZNF560	9438253	0.948000	0.32251	0.043000	0.18650	0.036000	0.12997	1.393000	0.34497	0.270000	0.21984	0.462000	0.41574	CAC		0.398	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476		16	60	1	0	1.33834e-09	0.007413	1.99683e-09	16	60				
CC2D1A	54862	broad.mit.edu	37	19	14040397	14040397	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:14040397G>C	ENST00000318003.7	+	26	2875	c.2634G>C	c.(2632-2634)caG>caC	p.Q878H	CC2D1A_ENST00000589606.1_Missense_Mutation_p.Q877H	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	878					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)	p.Q878H(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			AAGTGGCCCAGCAGTACCAGG	0.657																																							uc002mxo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2632-2634)CAG>CAC		coiled-coil and C2 domain containing 1A							12.0	16.0	14.0					19																	14040397		2018	4175	6193	SO:0001583	missense	54862				positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity	g.chr19:14040397G>C	AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.2634G>C	19.37:g.14040397G>C	ENSP00000313601:p.Gln878His					CC2D1A_uc002mxp.2_Missense_Mutation_p.Q877H|CC2D1A_uc010dzh.2_Missense_Mutation_p.Q447H	p.Q878H	NM_017721	NP_060191	Q6P1N0	C2D1A_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)		26	2933	+			878					Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Missense_Mutation	SNP	ENST00000318003.7	37	c.2634G>C	CCDS42512.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537818	0.65085	.	.	ENSG00000132024	ENST00000318003;ENST00000254346	T	0.34072	1.38	4.89	3.85	0.44370	.	0.376292	0.25109	N	0.033061	T	0.46308	0.1386	L	0.47716	1.5	0.33047	D	0.532267	B;D;B	0.65815	0.076;0.995;0.081	B;P;B	0.58172	0.014;0.834;0.019	T	0.60439	-0.7263	10	0.59425	D	0.04	-26.8122	12.2327	0.54497	0.0859:0.0:0.9141:0.0	.	499;877;878	Q9NX28;Q6P1N0-2;Q6P1N0	.;.;C2D1A_HUMAN	H	878;500	ENSP00000313601:Q878H	ENSP00000254346:Q500H	Q	+	3	2	CC2D1A	13901397	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.565000	0.45939	1.047000	0.40274	0.491000	0.48974	CAG		0.657	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457954.1	NM_017721		4	11	0	0	0	0.000602	0	4	11				
OR7C2	26658	broad.mit.edu	37	19	15052637	15052637	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:15052637T>A	ENST00000248072.3	+	1	337	c.337T>A	c.(337-339)Ttg>Atg	p.L113M		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L113M(1)		large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					CCTGGACAATTTGCTCCTGAC	0.483																																							uc010xoc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(337-339)TTG>ATG		olfactory receptor, family 7, subfamily C,							79.0	74.0	76.0					19																	15052637		2203	4300	6503	SO:0001583	missense	26658				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:15052637T>A	U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.337T>A	19.37:g.15052637T>A	ENSP00000248072:p.Leu113Met						p.L113M	NM_012377	NP_036509	O60412	OR7C2_HUMAN			1	337	+	Ovarian(108;0.203)		113			Helical; Name=3; (Potential).		O43881|Q6IFP9	Missense_Mutation	SNP	ENST00000248072.3	37	c.337T>A	CCDS12320.1	.	.	.	.	.	.	.	.	.	.	t	8.426	0.847435	0.17034	.	.	ENSG00000127529	ENST00000248072	T	0.03801	3.8	4.19	0.909	0.19332	GPCR, rhodopsin-like superfamily (1);	0.211078	0.23263	U	0.050113	T	0.05410	0.0143	L	0.41079	1.255	0.09310	N	1	P	0.50943	0.94	P	0.45856	0.495	T	0.31447	-0.9943	10	0.54805	T	0.06	.	7.1132	0.25403	0.0:0.2932:0.0:0.7068	.	113	O60412	OR7C2_HUMAN	M	113	ENSP00000248072:L113M	ENSP00000248072:L113M	L	+	1	2	OR7C2	14913637	0.000000	0.05858	0.004000	0.12327	0.011000	0.07611	-0.469000	0.06648	-0.005000	0.14395	0.421000	0.28195	TTG		0.483	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466281.1			13	47	0	0	0	0.001855	0	13	47				
OR10H2	26538	broad.mit.edu	37	19	15838973	15838973	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:15838973G>T	ENST00000305899.3	+	1	140	c.120G>T	c.(118-120)ctG>ctT	p.L40L		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	40			L -> Q (in dbSNP:rs4569397).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L40L(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					TCACGCTGCTGGGCAACCTGC	0.582																																							uc002nbm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(118-120)CTG>CTT		olfactory receptor, family 10, subfamily H,							227.0	188.0	201.0					19																	15838973		2203	4298	6501	SO:0001819	synonymous_variant	26538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:15838973G>T	AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.120G>T	19.37:g.15838973G>T							p.L40L	NM_013939	NP_039227	O60403	O10H2_HUMAN			1	140	+	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)		40			Helical; Name=1; (Potential).		Q6IFQ1|Q96R58	Silent	SNP	ENST00000305899.3	37	c.120G>T	CCDS12333.1																																																																																				0.582	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1			6	120	1	0	0.00198382	0.001984	0.00223928	6	120				
OR10H2	26538	broad.mit.edu	37	19	15839525	15839525	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:15839525C>T	ENST00000305899.3	+	1	692	c.672C>T	c.(670-672)gcC>gcT	p.A224A		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A224A(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					TCATCGTGGCCGACATCTTGA	0.532																																							uc002nbm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(670-672)GCC>GCT		olfactory receptor, family 10, subfamily H,							242.0	177.0	199.0					19																	15839525		2203	4300	6503	SO:0001819	synonymous_variant	26538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:15839525C>T	AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.672C>T	19.37:g.15839525C>T							p.A224A	NM_013939	NP_039227	O60403	O10H2_HUMAN			1	692	+	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)		224			Cytoplasmic (Potential).		Q6IFQ1|Q96R58	Silent	SNP	ENST00000305899.3	37	c.672C>T	CCDS12333.1																																																																																				0.532	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1			5	90	0	0	0	0.000602	0	5	90				
ZNF208	7757	broad.mit.edu	37	19	22155045	22155045	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:22155045C>G	ENST00000397126.4	-	4	2939	c.2791G>C	c.(2791-2793)Gtc>Ctc	p.V931L	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	931					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.V831L(2)|p.V931L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTACTAAAGACTGACAACCAG	0.373																																							uc002nqp.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(5)|skin(2)	7						c.(2491-2493)GTC>CTC		zinc finger protein 208							50.0	53.0	52.0					19																	22155045		2049	4205	6254	SO:0001583	missense	7757							g.chr19:22155045C>G	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2791G>C	19.37:g.22155045C>G	ENSP00000380315:p.Val931Leu					ZNF208_uc002nqo.1_Intron	p.V831L	NM_007153	NP_009084					5	2640	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Missense_Mutation	SNP	ENST00000397126.4	37	c.2491G>C	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	0.111	-1.138954	0.01742	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.07216	3.21	3.07	-6.14	0.02111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03390	0.0098	.	.	.	0.09310	N	1	B	0.31705	0.336	B	0.30251	0.113	T	0.24941	-1.0146	8	0.18276	T	0.48	.	1.2416	0.01964	0.1905:0.3321:0.1246:0.3529	.	831	O43345	ZN208_HUMAN	L	931;831	ENSP00000380315:V931L	ENSP00000380315:V931L	V	-	1	0	ZNF208	21946885	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.832000	0.00355	-3.262000	0.00201	-1.660000	0.00751	GTC		0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		4	30	0	0	0	0.009096	0	4	30				
ZNF257	113835	broad.mit.edu	37	19	22271585	22271585	+	Nonsense_Mutation	SNP	C	C	T	rs555293490		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:22271585C>T	ENST00000594947.1	+	4	1177	c.1033C>T	c.(1033-1035)Caa>Taa	p.Q345*		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.Q345E(1)|p.Q345*(1)		haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				GAAACCCTTCCAATGTGAAGA	0.418													A|||	1	0.000199681	0.0	0.0	5008	,	,		20330	0.0		0.0	False		,,,				2504	0.001						uc010ecx.2		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(2)		0						c.(1033-1035)CAA>TAA		zinc finger protein 257							43.0	47.0	46.0					19																	22271585		2168	4277	6445	SO:0001587	stop_gained	113835				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22271585C>T	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.1033C>T	19.37:g.22271585C>T	ENSP00000470209:p.Gln345*					ZNF257_uc010ecy.2_Nonsense_Mutation_p.Q313*	p.Q345*	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN			4	1202	+		all_lung(12;0.0961)|Lung NSC(12;0.103)	345			C2H2-type 7.		B3KPS4|E9PG34|Q8NE34	Nonsense_Mutation	SNP	ENST00000594947.1	37	c.1033C>T	CCDS46030.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.611753	0.87258	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	1.11	1.11	0.20524	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4235	0.21756	0.5125:0.4875:0.0:0.0	.	.	.	.	X	345;317	.	ENSP00000380312:Q317X	Q	+	1	0	ZNF257	22063425	0.000000	0.05858	0.156000	0.22583	0.072000	0.16883	-5.272000	0.00135	-0.436000	0.07254	-0.824000	0.03097	CAA		0.418	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1			8	32	0	0	0	0.004482	0	8	32				
UQCRFS1	7386	broad.mit.edu	37	19	29698810	29698810	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:29698810G>C	ENST00000304863.4	-	2	892	c.470C>G	c.(469-471)tCc>tGc	p.S157C		NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	157					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)	p.S157C(1)		endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			TGGAATATCGGATAACTTGAT	0.488																																							uc002nsd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(469-471)TCC>TGC		ubiquinol-cytochrome c reductase, Rieske							46.0	47.0	47.0					19																	29698810		2201	4296	6497	SO:0001583	missense	7386				respiratory electron transport chain	integral to membrane|mitochondrial respiratory chain complex III	2 iron, 2 sulfur cluster binding|metal ion binding|ubiquinol-cytochrome-c reductase activity	g.chr19:29698810G>C	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.470C>G	19.37:g.29698810G>C	ENSP00000306397:p.Ser157Cys						p.S157C	NM_006003	NP_005994	P47985	UCRI_HUMAN	Lung(7;0.092)		2	581	-	Breast(6;0.0545)|Esophageal squamous(110;0.239)		157					A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	c.470C>G	CCDS12415.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025217	0.35701	.	.	ENSG00000169021	ENST00000304863	T	0.54866	0.55	5.42	5.42	0.78866	Ubiquinol-cytochrome c reductase, iron-sulphur subunit (1);Rieske [2Fe-2S] iron-sulphur domain (2);	0.202387	0.52532	D	0.000076	T	0.76198	0.3954	H	0.97214	3.96	0.42638	D	0.993402	P	0.46512	0.879	P	0.48368	0.575	D	0.85718	0.1323	10	0.87932	D	0	.	18.2067	0.89857	0.0:0.0:1.0:0.0	.	157	P47985	UCRI_HUMAN	C	157	ENSP00000306397:S157C	ENSP00000306397:S157C	S	-	2	0	UQCRFS1	34390650	0.960000	0.32886	0.558000	0.28319	0.099000	0.18886	4.020000	0.57189	2.540000	0.85666	0.462000	0.41574	TCC		0.488	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003		5	92	0	0	0	0.001168	0	5	92				
ZNF536	9745	broad.mit.edu	37	19	30935025	30935025	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:30935025G>T	ENST00000355537.3	+	2	703	c.556G>T	c.(556-558)Ggc>Tgc	p.G186C		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	186					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.G186C(2)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGGCAACCTGGGCAAGGGGCG	0.667																																							uc002nsu.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|large_intestine(2)|skin(2)	11						c.(556-558)GGC>TGC		zinc finger protein 536							23.0	19.0	20.0					19																	30935025		2202	4298	6500	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:30935025G>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.556G>T	19.37:g.30935025G>T	ENSP00000347730:p.Gly186Cys					ZNF536_uc010edd.1_Missense_Mutation_p.G186C	p.G186C	NM_014717	NP_055532	O15090	ZN536_HUMAN			2	694	+	Esophageal squamous(110;0.0834)		186					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.556G>T	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.342663	0.61073	.	.	ENSG00000198597	ENST00000355537	T	0.10382	2.88	5.94	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.24470	0.0593	L	0.36672	1.1	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.83275	0.988;0.996	T	0.01330	-1.1383	10	0.72032	D	0.01	-31.1036	15.1232	0.72460	0.0676:0.0:0.9324:0.0	.	186;186	A7E228;O15090	.;ZN536_HUMAN	C	186	ENSP00000347730:G186C	ENSP00000347730:G186C	G	+	1	0	ZNF536	35626865	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.440000	0.97547	1.533000	0.49186	0.561000	0.74099	GGC		0.667	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		4	21	1	0	0.00024832	0.009096	0.000296399	4	21				
TSHZ3	57616	broad.mit.edu	37	19	31769436	31769436	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:31769436C>G	ENST00000240587.4	-	2	1590	c.1263G>C	c.(1261-1263)aaG>aaC	p.K421N		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	421					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K238N(1)|p.K421N(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TGGGCTTCCCCTTTTTCATAG	0.582																																							uc002nsy.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(1261-1263)AAG>AAC		zinc finger protein 537							124.0	116.0	118.0					19																	31769436		2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31769436C>G	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1263G>C	19.37:g.31769436C>G	ENSP00000240587:p.Lys421Asn						p.K421N	NM_020856	NP_065907	Q63HK5	TSH3_HUMAN			2	1328	-	Esophageal squamous(110;0.226)		421					Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.1263G>C	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929386	0.52759	.	.	ENSG00000121297	ENST00000240587	T	0.19806	2.12	5.46	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.27241	0.0668	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.02736	-1.1117	10	0.87932	D	0	-36.1793	6.3206	0.21215	0.0:0.7332:0.0:0.2668	.	421	Q63HK5	TSH3_HUMAN	N	421	ENSP00000240587:K421N	ENSP00000240587:K421N	K	-	3	2	TSHZ3	36461276	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.578000	0.46051	2.548000	0.85928	0.655000	0.94253	AAG		0.582	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		13	101	0	0	0	0.001368	0	13	101				
ZNF585B	92285	broad.mit.edu	37	19	37678134	37678135	+	Missense_Mutation	DNP	CA	CA	GT			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:37678134_37678135CA>GT	ENST00000532828.2	-	5	555_556	c.304_305TG>AC	c.(304-306)TGg>ACg	p.W102T	CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000527838.1_Missense_Mutation_p.W102T|ZNF585B_ENST00000531805.1_Missense_Mutation_p.W47T|ZNF585B_ENST00000312908.5_5'Flank	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W102T(1)		NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATTATGGTCCCATAATTTCTCT	0.332																																					Melanoma(93;882 1454 18863 28917 48427)	Melanoma(93;882 1454 18863 28917 48427)	uc002ofq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(304-306)TGG>ACG		zinc finger protein 585B																																				SO:0001583	missense	92285				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr19:37678134_37678135CA>GT	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.304_305delinsGT	19.37:g.37678134_37678135delinsGT	ENSP00000433773:p.Trp102Thr					ZNF585B_uc002ofr.1_5'UTR	p.W102T	NM_152279	NP_689492	Q52M93	Z585B_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		5	558_559	-			102					Q8IZD3|Q96JW6	Missense_Mutation	DNP	ENST00000532828.2	37	c.304_305TG>AC	CCDS12500.1																																																																																				0.332	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279		13	72	0	0	0	0.004672	0	13	72				
HKR1	284459	broad.mit.edu	37	19	37854259	37854259	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:37854259G>T	ENST00000324411.4	+	6	1831	c.1562G>T	c.(1561-1563)gGg>gTg	p.G521V	HKR1_ENST00000591134.1_Intron|HKR1_ENST00000591471.1_Missense_Mutation_p.G248V|HKR1_ENST00000544914.1_Missense_Mutation_p.G248V|HKR1_ENST00000541583.2_Missense_Mutation_p.G460V|HKR1_ENST00000589392.1_Missense_Mutation_p.G503V|HKR1_ENST00000392153.3_Missense_Mutation_p.G502V	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	521					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G521V(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ACACACTCAGGGGAGAAGCCA	0.517																																							uc002ogb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1561-1563)GGG>GTG		GLI-Kruppel family member HKR1							69.0	66.0	67.0					19																	37854259		2203	4300	6503	SO:0001583	missense	284459				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37854259G>T	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1562G>T	19.37:g.37854259G>T	ENSP00000315505:p.Gly521Val					HKR1_uc002ofx.2_Missense_Mutation_p.G237V|HKR1_uc002ofy.2_Missense_Mutation_p.G237V|HKR1_uc002oga.2_Missense_Mutation_p.G503V|HKR1_uc010xto.1_Missense_Mutation_p.G503V|HKR1_uc002ogc.2_Missense_Mutation_p.G502V|HKR1_uc010xtp.1_Missense_Mutation_p.G460V|HKR1_uc002ogd.2_Missense_Mutation_p.G460V	p.G521V	NM_181786	NP_861451	P10072	HKR1_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1831	+			521					A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	c.1562G>T	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.668484	0.47677	.	.	ENSG00000181666	ENST00000544914;ENST00000414402;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	2.58	0.395	0.16304	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47060	0.1425	M	0.80616	2.505	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.993	D;D;D;P	0.91635	0.999;0.999;0.982;0.903	T	0.44467	-0.9326	9	0.87932	D	0	.	7.8062	0.29204	0.2315:0.0:0.7685:0.0	.	460;502;521;503	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	V	248;300;502;557;521;460	ENSP00000437774:G248V;ENSP00000375994:G502V;ENSP00000315505:G521V;ENSP00000438261:G460V	ENSP00000315505:G521V	G	+	2	0	HKR1	42546099	0.064000	0.20934	0.975000	0.42487	0.958000	0.62258	0.200000	0.17257	0.182000	0.20032	-0.145000	0.13849	GGG		0.517	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786		3	35	1	0	0.004672	0.004672	0.00517983	3	35				
RYR1	6261	broad.mit.edu	37	19	39008033	39008033	+	Silent	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:39008033T>C	ENST00000359596.3	+	66	9720	c.9720T>C	c.(9718-9720)tgT>tgC	p.C3240C	RYR1_ENST00000355481.4_Silent_p.C3240C|RYR1_ENST00000360985.3_Silent_p.C3240C			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3240					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.C3240C(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGGAGATGTGTCCCGACATCC	0.647																																							uc002oit.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(9718-9720)TGT>TGC		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						42.0	43.0	43.0					19																	39008033		2203	4300	6503	SO:0001819	synonymous_variant	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:39008033T>C	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.9720T>C	19.37:g.39008033T>C						RYR1_uc002oiu.2_Silent_p.C3240C|RYR1_uc002oiv.1_Silent_p.C160C|RYR1_uc010xuf.1_Silent_p.C160C	p.C3240C	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		66	9850	+	all_cancers(60;7.91e-06)		3240					Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	c.9720T>C	CCDS33011.1																																																																																				0.647	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			3	40	0	0	0	0.009096	0	3	40				
PSG8	440533	broad.mit.edu	37	19	43268239	43268239	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:43268239G>T	ENST00000306511.4	-	2	356	c.259C>A	c.(259-261)Caa>Aaa	p.Q87K	PSG8_ENST00000404209.4_Missense_Mutation_p.Q87K|PSG8_ENST00000406636.3_Intron|PSG8_ENST00000401467.2_Missense_Mutation_p.Q87K	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	87	Ig-like V-type.					extracellular region (GO:0005576)		p.Q87K(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				ATAATTATTTGACCGTCTACT	0.433																																							uc002ouo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(259-261)CAA>AAA		pregnancy specific beta-1-glycoprotein 8 isoform							253.0	270.0	264.0					19																	43268239		2203	4299	6502	SO:0001583	missense	440533					extracellular region		g.chr19:43268239G>T	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.259C>A	19.37:g.43268239G>T	ENSP00000305005:p.Gln87Lys					PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc002oui.2_Intron|PSG8_uc002ouh.2_Missense_Mutation_p.Q87K|PSG8_uc010ein.2_Intron|PSG8_uc002ouj.3_5'UTR|PSG8_uc002ouk.3_Intron|PSG8_uc002oul.3_Missense_Mutation_p.Q87K|PSG8_uc002oum.3_Missense_Mutation_p.Q87K|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Missense_Mutation_p.Q87K	p.Q87K	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN			2	357	-		Prostate(69;0.00899)	87			Ig-like V-type.		A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	37	c.259C>A	CCDS33037.1	.	.	.	.	.	.	.	.	.	.	g	0.025	-1.376640	0.01214	.	.	ENSG00000124467	ENST00000404209;ENST00000401467;ENST00000407488;ENST00000306511	T;T;T	0.01495	4.83;4.83;4.83	1.35	-2.7	0.06004	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.01454	0.0047	L	0.31526	0.94	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0	B;B;B;B;B	0.19391	0.025;0.003;0.002;0.001;0.002	T	0.45145	-0.9281	9	0.38643	T	0.18	.	3.7292	0.08487	0.0:0.2109:0.3286:0.4605	.	87;87;87;87;87	B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;PSG8_HUMAN;.;.;.	K	87	ENSP00000385869:Q87K;ENSP00000386090:Q87K;ENSP00000305005:Q87K	ENSP00000305005:Q87K	Q	-	1	0	PSG8	47960079	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.656000	0.05342	-1.410000	0.02035	-1.271000	0.01417	CAA		0.433	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1			70	282	1	0	2.60599e-31	0.00361	4.59736e-31	70	282				
GPR4	2828	broad.mit.edu	37	19	46094546	46094546	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:46094546C>A	ENST00000323040.4	-	2	1523	c.579G>T	c.(577-579)ccG>ccT	p.P193P	OPA3_ENST00000544371.1_Intron|GPR4_ENST00000591614.1_5'Flank	NM_005282.2	NP_005273.1	P46093	GPR4_HUMAN	G protein-coupled receptor 4	193					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P193P(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		TGAGCGCCCACGGGAAGAGGA	0.642																																					Esophageal Squamous(117;181 1612 1673 14956 42937)	Esophageal Squamous(117;181 1612 1673 14956 42937)	uc002pcm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(577-579)CCG>CCT		G protein-coupled receptor 4							55.0	48.0	50.0					19																	46094546		2203	4300	6503	SO:0001819	synonymous_variant	2828					integral to plasma membrane	G-protein coupled receptor activity	g.chr19:46094546C>A	BC067536	CCDS12669.1	19q13.3	2012-08-21				ENSG00000177464		"""GPCR / Class A : Orphans"""	4497	protein-coding gene	gene with protein product		600551				8595909	Standard	NM_005282		Approved		uc002pcm.3	P46093		ENST00000323040.4:c.579G>T	19.37:g.46094546C>A						OPA3_uc010xxk.1_Intron	p.P193P	NM_005282	NP_005273	P46093	GPR4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)	2	1524	-			193			Helical; Name=5; (Potential).		A8K3T3|B0M0K1|Q6NWM4	Silent	SNP	ENST00000323040.4	37	c.579G>T	CCDS12669.1																																																																																				0.642	GPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459603.1	NM_005282		3	43	1	0	0.004672	0.004672	0.00517983	3	43				
SPACA4	171169	broad.mit.edu	37	19	49110448	49110448	+	Nonsense_Mutation	SNP	C	C	A	rs371143349		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:49110448C>A	ENST00000321762.1	+	1	449	c.213C>A	c.(211-213)tgC>tgA	p.C71*	FAM83E_ENST00000263266.3_Intron	NM_133498.2	NP_598005.1	Q8TDM5	SACA4_HUMAN	sperm acrosome associated 4	71	UPAR/Ly6 1.				cell adhesion (GO:0007155)	anchored component of membrane (GO:0031225)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)		p.C71C(1)|p.C71*(1)		central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	5		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		CCACCAGCTGCGGCCTTGAGG	0.652																																							uc002pjo.2		NA																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)		lung(1)|central_nervous_system(1)	central_nervous_system(1)	1						c.(211-213)TGC>TGA		sperm acrosomal membrane protein 14 precursor							35.0	32.0	33.0					19																	49110448		2203	4300	6503	SO:0001587	stop_gained	171169				cell adhesion	acrosomal vesicle|anchored to membrane|plasma membrane		g.chr19:49110448C>A		CCDS12725.1	19q13.33	2013-10-24			ENSG00000177202	ENSG00000177202			16441	protein-coding gene	gene with protein product		609932					Standard	NM_133498		Approved	SAMP14	uc002pjo.3	Q8TDM5	OTTHUMG00000183316	ENST00000321762.1:c.213C>A	19.37:g.49110448C>A	ENSP00000312774:p.Cys71*					FAM83E_uc002pjn.2_Intron	p.C71*	NM_133498	NP_598005	Q8TDM5	SACA4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)	1	449	+		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	71			UPAR/Ly6 1.			Nonsense_Mutation	SNP	ENST00000321762.1	37	c.213C>A	CCDS12725.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.740634	0.49045	.	.	ENSG00000177202	ENST00000321762	.	.	.	5.19	-3.83	0.04269	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.1174	10.7229	0.46050	0.0:0.4449:0.0:0.5551	.	.	.	.	X	71	.	ENSP00000312774:C71X	C	+	3	2	SPACA4	53802260	0.005000	0.15991	0.660000	0.29694	0.006000	0.05464	-1.793000	0.01755	-0.414000	0.07495	-0.899000	0.02877	TGC		0.652	SPACA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466149.1	NM_133498		3	28	1	0	6.4e-05	0.004672	7.85819e-05	3	28				
RASIP1	54922	broad.mit.edu	37	19	49225186	49225186	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:49225186A>C	ENST00000222145.4	-	11	2821	c.2617T>G	c.(2617-2619)Tat>Gat	p.Y873D	MAMSTR_ENST00000377367.3_5'Flank|MAMSTR_ENST00000318083.6_5'Flank|MAMSTR_ENST00000419611.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	873	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)		p.Y873D(2)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CCCAGCTGATAGTGGCTGAGC	0.652																																							uc002pki.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(2617-2619)TAT>GAT		Ras-interacting protein 1							35.0	41.0	39.0					19																	49225186		2202	4297	6499	SO:0001583	missense	54922				signal transduction	Golgi stack|perinuclear region of cytoplasm		g.chr19:49225186A>C	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.2617T>G	19.37:g.49225186A>C	ENSP00000222145:p.Tyr873Asp					MAMSTR_uc002pkg.2_5'Flank|RASIP1_uc002pkh.2_Missense_Mutation_p.Y134D	p.Y873D	NM_017805	NP_060275	Q5U651	RAIN_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)	11	2814	-		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	873			Dilute.		Q6U676	Missense_Mutation	SNP	ENST00000222145.4	37	c.2617T>G	CCDS12731.1	.	.	.	.	.	.	.	.	.	.	A	17.59	3.426805	0.62733	.	.	ENSG00000105538	ENST00000222145	T	0.40225	1.04	4.51	4.51	0.55191	Dilute (1);Dil domain (1);	0.076782	0.53938	D	0.000055	T	0.59891	0.2227	M	0.64170	1.965	0.53005	D	0.999964	D	0.76494	0.999	D	0.87578	0.998	T	0.63620	-0.6596	10	0.87932	D	0	-9.1696	12.0974	0.53763	1.0:0.0:0.0:0.0	.	873	Q5U651	RAIN_HUMAN	D	873	ENSP00000222145:Y873D	ENSP00000222145:Y873D	Y	-	1	0	RASIP1	53916998	1.000000	0.71417	1.000000	0.80357	0.358000	0.29455	6.071000	0.71229	2.034000	0.60081	0.397000	0.26171	TAT		0.652	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805		8	45	0	0	0	0.004482	0	8	45				
KLK8	11202	broad.mit.edu	37	19	51499377	51499377	+	Missense_Mutation	SNP	C	C	T	rs56296296	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:51499377C>T	ENST00000600767.1	-	7	1210	c.721G>A	c.(721-723)Gtc>Atc	p.V241I	KLK8_ENST00000291726.7_Missense_Mutation_p.V241I|KLK8_ENST00000320838.5_3'UTR|KLK8_ENST00000593490.1_3'UTR|KLK8_ENST00000391806.2_Missense_Mutation_p.V286I|CTB-147C22.9_ENST00000594512.1_RNA|KLK8_ENST00000347619.4_Missense_Mutation_p.V100I|KLK8_ENST00000598195.1_5'UTR			O60259	KLK8_HUMAN	kallikrein-related peptidase 8	241	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell death (GO:0008219)|keratinocyte proliferation (GO:0043616)|memory (GO:0007613)|negative regulation of axon regeneration (GO:0048681)|negative regulation of myelination (GO:0031642)|neuron projection morphogenesis (GO:0048812)|regulation of synapse organization (GO:0050807)|response to wounding (GO:0009611)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)	p.V286I(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|prostate(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		TTGGTATAGACGCCAGGTTTG	0.542																																							uc002pur.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(721-723)GTC>ATC		kallikrein 8 isoform 1 preproprotein		C	ILE/VAL,ILE/VAL,ILE/VAL,	1,4405	2.1+/-5.4	0,1,2202	174.0	161.0	165.0		721,856,298,	3.6	0.9	19	dbSNP_129	165	0,8600		0,0,4300	no	missense,missense,missense,utr-3	KLK8	NM_007196.2,NM_144505.1,NM_144506.1,NM_144507.1	29,29,29,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,	241/261,286/306,100/120,	51499377	1,13005	2203	4300	6503	SO:0001583	missense	11202				cell death|keratinocyte proliferation|memory|negative regulation of axon regeneration|negative regulation of myelination|neuron projection morphogenesis|proteolysis|regulation of synapse organization|response to wounding	cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity	g.chr19:51499377C>T	AB008390	CCDS12813.1, CCDS12814.1, CCDS12815.1, CCDS42600.1, CCDS74433.1	19q13	2011-09-07	2006-10-27			ENSG00000129455		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6369	protein-coding gene	gene with protein product		605644	"""kallikrein 8 (neuropsin/ovasin)"""	PRSS19		10102990, 9714609, 16800724, 16800723	Standard	NM_144505		Approved	HNP, TADG14, neuropsin, ovasin	uc002pur.1	O60259		ENST00000600767.1:c.721G>A	19.37:g.51499377C>T	ENSP00000472016:p.Val241Ile					KLK8_uc002puq.1_Missense_Mutation_p.V286I|KLK8_uc002pus.1_Missense_Mutation_p.V100I|KLK8_uc002put.1_3'UTR|KLK8_uc002puu.1_Missense_Mutation_p.V241I|KLK9_uc002puv.1_RNA	p.V241I	NM_007196	NP_009127	O60259	KLK8_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)	6	900	-		all_neural(266;0.026)	241			Peptidase S1.		Q5V9X1|Q5V9X2|Q8IW69|Q9HCB3|Q9NR68|Q9NR69|Q9UIL9|Q9UQ47	Missense_Mutation	SNP	ENST00000600767.1	37	c.721G>A	CCDS12813.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.602044	0.46423	2.27E-4	0.0	ENSG00000129455	ENST00000391806;ENST00000291726;ENST00000347619	D;D;D	0.90732	-2.72;-2.72;-2.72	4.66	3.62	0.41486	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.39834	N	0.001253	D	0.92331	0.7567	L	0.52905	1.665	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.995;0.968;0.997	D	0.90875	0.4749	10	0.48119	T	0.1	.	7.4155	0.27042	0.0:0.8058:0.0:0.1942	rs56296296	100;241;286	O60259-3;O60259;O60259-2	.;KLK8_HUMAN;.	I	286;241;100	ENSP00000375682:V286I;ENSP00000291726:V241I;ENSP00000341555:V100I	ENSP00000291726:V241I	V	-	1	0	KLK8	56191189	0.998000	0.40836	0.855000	0.33649	0.063000	0.16089	3.907000	0.56348	1.308000	0.44962	0.563000	0.77884	GTC		0.542	KLK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465032.2	NM_007196		15	178	0	0	0	0.00499	0	15	178				
ZNF665	79788	broad.mit.edu	37	19	53667774	53667774	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr19:53667774T>A	ENST00000600412.1	-	2	1889	c.1774A>T	c.(1774-1776)Aac>Tac	p.N592Y	CTD-2245F17.2_ENST00000600257.1_RNA|ZNF665_ENST00000396424.3_Missense_Mutation_p.N657Y			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	592					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N592Y(1)|p.N657Y(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		CCACATTGGTTACATTTGTAA	0.428																																							uc010eqm.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1969-1971)AAC>TAC		zinc finger protein 665							61.0	65.0	64.0					19																	53667774		2200	4298	6498	SO:0001583	missense	79788				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53667774T>A		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1774A>T	19.37:g.53667774T>A	ENSP00000469154:p.Asn592Tyr						p.N657Y	NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN		GBM - Glioblastoma multiforme(134;0.0196)	4	2069	-			592			C2H2-type 18.		A8K5T8	Missense_Mutation	SNP	ENST00000600412.1	37	c.1969A>T		.	.	.	.	.	.	.	.	.	.	T	12.23	1.874565	0.33069	.	.	ENSG00000197497	ENST00000396424	T	0.07688	3.17	2.52	0.172	0.15031	.	.	.	.	.	T	0.18087	0.0434	M	0.66939	2.045	0.09310	N	1	D	0.56287	0.975	P	0.61800	0.894	T	0.12016	-1.0564	9	0.87932	D	0	.	3.5332	0.07785	0.0:0.2507:0.2025:0.5467	.	657	Q9H7R5-2	.	Y	657	ENSP00000379702:N657Y	ENSP00000379702:N657Y	N	-	1	0	ZNF665	58359586	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.667000	0.00846	-0.157000	0.11059	-0.410000	0.06199	AAC		0.428	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733		12	42	0	0	0	0.000978	0	12	42				
TPO	7173	broad.mit.edu	37	2	1520666	1520666	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:1520666C>A	ENST00000345913.4	+	15	2621	c.2530C>A	c.(2530-2532)Ctc>Atc	p.L844I	TPO_ENST00000337415.3_Missense_Mutation_p.L844I|TPO_ENST00000346956.3_Missense_Mutation_p.L800I|TPO_ENST00000382198.1_Missense_Mutation_p.L671I|TPO_ENST00000349624.3_Missense_Mutation_p.L671I|TPO_ENST00000382201.3_Missense_Mutation_p.L787I|TPO_ENST00000329066.4_Missense_Mutation_p.L844I|TPO_ENST00000497517.2_3'UTR	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	844					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.L844I(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CTCCGGGAGGCTCCCTCGGGT	0.602																																							uc002qww.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20						c.(2530-2532)CTC>ATC		thyroid peroxidase isoform a	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)						66.0	69.0	68.0					2																	1520666		2203	4300	6503	SO:0001583	missense	7173				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity	g.chr2:1520666C>A		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2530C>A	2.37:g.1520666C>A	ENSP00000318820:p.Leu844Ile					TPO_uc010ewj.2_RNA|TPO_uc002qwu.2_Missense_Mutation_p.L787I|TPO_uc002qwr.2_Missense_Mutation_p.L844I|TPO_uc002qwx.2_Missense_Mutation_p.L787I|TPO_uc010yio.1_Missense_Mutation_p.L671I|TPO_uc010yip.1_Missense_Mutation_p.L800I|TPO_uc002qwy.1_Missense_Mutation_p.L140I|TPO_uc002qwz.2_RNA	p.L844I	NM_000547	NP_000538	P07202	PERT_HUMAN		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	15	2621	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	844			Extracellular (Potential).		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	c.2530C>A	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.493013	0.44352	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607;ENST00000425083	D;D;T;D;D;D;D;T;T;D	0.95656	-3.77;-3.77;-0.33;-3.77;-3.77;-3.77;-3.77;-0.39;0.4;-3.77	5.52	4.64	0.57946	.	1.621250	0.03527	N	0.221896	D	0.97467	0.9171	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.71674	0.998;0.996;0.978;0.963	D;P;P;P	0.83275	0.996;0.857;0.738;0.574	D	0.91888	0.5521	10	0.45353	T	0.12	-46.8089	9.3392	0.38069	0.0:0.9055:0.0:0.0945	.	800;671;787;844	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	I	844;844;800;671;844;787;671;729;274;65	ENSP00000337263:L844I;ENSP00000318820:L844I;ENSP00000263886:L800I;ENSP00000332044:L671I;ENSP00000329869:L844I;ENSP00000371636:L787I;ENSP00000371633:L671I;ENSP00000405788:L729I;ENSP00000419461:L274I;ENSP00000389659:L65I	ENSP00000329869:L844I	L	+	1	0	TPO	1499673	1.000000	0.71417	1.000000	0.80357	0.021000	0.10359	1.781000	0.38644	2.612000	0.88384	0.650000	0.86243	CTC		0.602	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547		11	52	1	0	3.86212e-05	0.008291	4.79347e-05	11	52				
GEN1	348654	broad.mit.edu	37	2	17953925	17953925	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:17953925A>G	ENST00000381254.2	+	8	1041	c.827A>G	c.(826-828)aAt>aGt	p.N276S	SMC6_ENST00000402989.1_Intron|GEN1_ENST00000317402.7_Missense_Mutation_p.N276S	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	276					DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R275fs*37(2)|p.N276S(1)		breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CATGAACGTAATGGATGCAGA	0.353								Homologous recombination																															uc002rct.2		NA																	3	Deletion - Frameshift(2)|Substitution - Missense(1)	p.R275fs*37(2)	breast(2)|lung(1)	breast(5)|kidney(1)|central_nervous_system(1)|skin(1)	8						c.(826-828)AAT>AGT	Homologous_recombination	Gen homolog 1, endonuclease							90.0	81.0	84.0					2																	17953925		2203	4300	6503	SO:0001583	missense	348654				DNA repair	nucleus	DNA binding|endonuclease activity|metal ion binding	g.chr2:17953925A>G	AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.827A>G	2.37:g.17953925A>G	ENSP00000370653:p.Asn276Ser					SMC6_uc010exo.2_Intron|GEN1_uc010yjs.1_Missense_Mutation_p.N276S|GEN1_uc002rcu.2_Missense_Mutation_p.N276S	p.N276S	NM_182625	NP_872431	Q17RS7	GEN_HUMAN			8	900	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)		276					Q17RS9|Q6ZN37	Missense_Mutation	SNP	ENST00000381254.2	37	c.827A>G	CCDS1691.1	.	.	.	.	.	.	.	.	.	.	A	6.661	0.490517	0.12702	.	.	ENSG00000178295	ENST00000317402;ENST00000381254;ENST00000528873	T;T;T	0.37752	1.18;1.18;1.18	5.63	3.17	0.36434	-3&apos (1); exonuclease, C-terminal domain (1);5&apos (1);	0.305836	0.30989	N	0.008474	T	0.23330	0.0564	L	0.37750	1.13	0.22996	N	0.998456	B	0.15473	0.013	B	0.08055	0.003	T	0.15809	-1.0424	10	0.19147	T	0.46	-13.1462	6.7874	0.23682	0.6858:0.1179:0.1963:0.0	.	276	Q17RS7	GEN_HUMAN	S	276;276;47	ENSP00000318977:N276S;ENSP00000370653:N276S;ENSP00000431542:N47S	ENSP00000318977:N276S	N	+	2	0	GEN1	17817406	0.006000	0.16342	1.000000	0.80357	0.987000	0.75469	0.345000	0.19979	0.932000	0.37266	0.533000	0.62120	AAT		0.353	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241661.2	NM_182625		5	81	0	0	0	0.000602	0	5	81				
APOB	338	broad.mit.edu	37	2	21233331	21233331	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:21233331G>C	ENST00000233242.1	-	26	6536	c.6409C>G	c.(6409-6411)Cat>Gat	p.H2137D		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2137	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.H2137D(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCTTGGCATGTGAAACTTGT	0.338																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(6409-6411)CAT>GAT		apolipoprotein B precursor	Atorvastatin(DB01076)						68.0	67.0	67.0					2																	21233331		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21233331G>C	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.6409C>G	2.37:g.21233331G>C	ENSP00000233242:p.His2137Asp						p.H2137D	NM_000384	NP_000375	P04114	APOB_HUMAN			26	6537	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		2137			Heparin-binding.		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.6409C>G	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	0.220	-1.029786	0.02045	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00666	5.91	5.65	-1.43	0.08884	.	1.420810	0.04042	N	0.303187	T	0.00637	0.0021	N	0.22421	0.69	0.09310	N	0.999998	B	0.11235	0.004	B	0.04013	0.001	T	0.47873	-0.9083	10	0.13853	T	0.58	.	2.6299	0.04941	0.1172:0.1374:0.3891:0.3564	.	2137	P04114	APOB_HUMAN	D	2137	ENSP00000233242:H2137D	ENSP00000233242:H2137D	H	-	1	0	APOB	21086836	0.000000	0.05858	0.000000	0.03702	0.661000	0.39034	0.201000	0.17276	-0.492000	0.06687	-0.397000	0.06425	CAT		0.338	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			5	38	0	0	0	0.000602	0	5	38				
DPYSL5	56896	broad.mit.edu	37	2	27121559	27121559	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:27121559C>G	ENST00000288699.6	+	2	350	c.192C>G	c.(190-192)gaC>gaG	p.D64E	DPYSL5_ENST00000401478.1_Missense_Mutation_p.D64E	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	64					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.D64E(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGGCATCGACACCAGCACCC	0.572																																							uc002rhu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(190-192)GAC>GAG		dihydropyrimidinase-like 5							95.0	85.0	88.0					2																	27121559		2203	4300	6503	SO:0001583	missense	56896				axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides	g.chr2:27121559C>G	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.192C>G	2.37:g.27121559C>G	ENSP00000288699:p.Asp64Glu					DPYSL5_uc002rhv.3_Missense_Mutation_p.D64E	p.D64E	NM_020134	NP_064519	Q9BPU6	DPYL5_HUMAN			2	350	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		64					Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	ENST00000288699.6	37	c.192C>G	CCDS1730.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.512646	0.64522	.	.	ENSG00000157851	ENST00000450961;ENST00000288699;ENST00000401478;ENST00000431402;ENST00000434719	D;D;D;D;D	0.98531	-2.74;-4.98;-4.98;-2.94;-2.81	4.99	4.09	0.47781	Amidohydrolase 1 (1);	0.000000	0.85682	D	0.000000	D	0.98855	0.9613	M	0.89287	3.02	0.43453	D	0.99564	D	0.57571	0.98	D	0.66497	0.944	D	0.98905	1.0778	10	0.87932	D	0	-33.5328	13.2465	0.60026	0.0:0.916:0.0:0.084	.	64	Q9BPU6	DPYL5_HUMAN	E	64	ENSP00000407174:D64E;ENSP00000288699:D64E;ENSP00000385549:D64E;ENSP00000399581:D64E;ENSP00000413075:D64E	ENSP00000288699:D64E	D	+	3	2	DPYSL5	26975063	1.000000	0.71417	1.000000	0.80357	0.313000	0.28021	3.718000	0.54919	2.473000	0.83533	0.655000	0.94253	GAC		0.572	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134		9	41	0	0	0	0.004482	0	9	41				
SLC8A1	6546	broad.mit.edu	37	2	40342547	40342547	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:40342547C>A	ENST00000403092.1	-	11	2801	c.2768G>T	c.(2767-2769)gGg>gTg	p.G923V	SLC8A1_ENST00000405901.3_Missense_Mutation_p.G918V|SLC8A1_ENST00000332839.4_Missense_Mutation_p.G923V|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1_ENST00000542756.1_Missense_Mutation_p.G918V|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1_ENST00000402441.1_Missense_Mutation_p.G887V|SLC8A1_ENST00000542024.1_Missense_Mutation_p.G887V|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1_ENST00000405269.1_Missense_Mutation_p.G887V|SLC8A1_ENST00000406391.2_Missense_Mutation_p.G887V|SLC8A1_ENST00000406785.2_Missense_Mutation_p.G887V|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1_ENST00000408028.2_Missense_Mutation_p.G915V|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1-AS1_ENST00000597385.1_RNA			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	923					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.G923V(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CAGCAGCACCCCCACATTGAT	0.562																																							uc002rrx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2767-2769)GGG>GTG		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						87.0	78.0	81.0					2																	40342547		2203	4300	6503	SO:0001583	missense	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40342547C>A		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.2768G>T	2.37:g.40342547C>A	ENSP00000384763:p.Gly923Val					uc002rrw.2_Intron|SLC8A1_uc002rry.2_Missense_Mutation_p.G918V|SLC8A1_uc002rrz.2_Missense_Mutation_p.G910V|SLC8A1_uc002rsa.2_Missense_Mutation_p.G887V|SLC8A1_uc002rsd.3_Missense_Mutation_p.G887V	p.G923V	NM_021097	NP_066920	P32418	NAC1_HUMAN			10	2792	-			923			Helical; (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	c.2768G>T	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.784136	0.31593	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23;0.23;0.23;0.23;0.23;0.23	5.94	5.94	0.96194	Sodium/calcium exchanger membrane region (1);	0.052398	0.85682	D	0.000000	T	0.64360	0.2591	N	0.21545	0.675	0.80722	D	1	D;B;B;B	0.76494	0.999;0.022;0.03;0.016	D;B;B;B	0.83275	0.996;0.007;0.03;0.012	T	0.59236	-0.7492	10	0.25751	T	0.34	.	17.8596	0.88777	0.0:1.0:0.0:0.0	.	887;910;918;923	P32418-2;P32418-3;F6VPY9;P32418	.;.;.;NAC1_HUMAN	V	887;923;918;923;918;887;887;923;915;910;887;887	ENSP00000383886:G887V;ENSP00000440727:G918V;ENSP00000384763:G923V;ENSP00000385678:G918V;ENSP00000385188:G887V;ENSP00000385535:G887V;ENSP00000332931:G923V;ENSP00000384908:G915V;ENSP00000385811:G887V;ENSP00000443515:G887V	ENSP00000332931:G923V	G	-	2	0	SLC8A1	40196051	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.272000	0.72575	2.820000	0.97059	0.650000	0.86243	GGG		0.562	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		12	51	1	0	9.31168e-06	0.001855	1.22626e-05	12	51				
ABCG8	64241	broad.mit.edu	37	2	44079912	44079912	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:44079912C>A	ENST00000272286.2	+	6	959	c.869C>A	c.(868-870)aCc>aAc	p.T290N		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	290	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)	p.T290N(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	ACGTCTGGCACCCCCATCTAC	0.582																																							uc002rtq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(868-870)ACC>AAC		ATP-binding cassette sub-family G member 8							89.0	83.0	85.0					2																	44079912		2203	4300	6503	SO:0001583	missense	64241				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity	g.chr2:44079912C>A	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.869C>A	2.37:g.44079912C>A	ENSP00000272286:p.Thr290Asn					ABCG8_uc010yoa.1_Missense_Mutation_p.T290N	p.T290N	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN			6	959	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	290			ABC transporter.|Cytoplasmic (Potential).		Q53QN8	Missense_Mutation	SNP	ENST00000272286.2	37	c.869C>A	CCDS1815.1	.	.	.	.	.	.	.	.	.	.	C	5.316	0.243595	0.10077	.	.	ENSG00000143921	ENST00000272286	T	0.35048	1.33	5.57	3.72	0.42706	ABC transporter-like (1);	0.423938	0.28618	N	0.014713	T	0.22781	0.0550	N	0.26042	0.785	0.34850	D	0.741584	B;B	0.29646	0.253;0.164	B;B	0.33690	0.168;0.081	T	0.22836	-1.0205	10	0.16420	T	0.52	.	6.2591	0.20889	0.0:0.6491:0.1516:0.1993	.	290;290	Q9H221-2;Q9H221	.;ABCG8_HUMAN	N	290	ENSP00000272286:T290N	ENSP00000272286:T290N	T	+	2	0	ABCG8	43933416	0.910000	0.30920	0.990000	0.47175	0.177000	0.22998	2.334000	0.43920	0.659000	0.30945	0.655000	0.94253	ACC		0.582	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437		7	57	1	0	2.0095e-06	0.001984	2.70342e-06	7	57				
PREPL	9581	broad.mit.edu	37	2	44566424	44566424	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:44566424C>A	ENST00000409936.1	-	7	1268	c.831G>T	c.(829-831)gtG>gtT	p.V277V	PREPL_ENST00000378520.3_Silent_p.V277V|PREPL_ENST00000541738.1_Silent_p.V188V|PREPL_ENST00000410081.1_Silent_p.V277V|PREPL_ENST00000260648.6_Silent_p.V277V|PREPL_ENST00000378511.3_Silent_p.V277V|PREPL_ENST00000409411.1_Silent_p.V188V|PREPL_ENST00000409272.1_Silent_p.V277V|PREPL_ENST00000409957.1_Silent_p.V188V	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	277						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.V277V(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTATCAACCACACTTCAGAAG	0.403																																							uc002ruf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(829-831)GTG>GTT		prolyl endopeptidase-like isoform C							108.0	100.0	103.0					2																	44566424		2203	4300	6503	SO:0001819	synonymous_variant	9581				proteolysis	cytosol	serine-type endopeptidase activity	g.chr2:44566424C>A	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.831G>T	2.37:g.44566424C>A						PREPL_uc002rug.2_Silent_p.V277V|PREPL_uc002ruh.2_Silent_p.V277V|PREPL_uc010fax.2_Silent_p.V277V|PREPL_uc002rui.3_Silent_p.V188V|PREPL_uc002ruj.1_Silent_p.V188V|PREPL_uc002ruk.1_Silent_p.V277V	p.V277V	NM_006036	NP_006027	Q4J6C6	PPCEL_HUMAN			6	866	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	277					A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Silent	SNP	ENST00000409936.1	37	c.831G>T	CCDS33190.1																																																																																				0.403	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	NM_006036		8	72	1	0	0.000157383	0.00308	0.000188658	8	72				
FSHR	2492	broad.mit.edu	37	2	49195971	49195971	+	Silent	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:49195971A>G	ENST00000406846.2	-	9	839	c.720T>C	c.(718-720)aaT>aaC	p.N240N	FSHR_ENST00000304421.4_Silent_p.N214N|FSHR_ENST00000469138.1_5'UTR|FSHR_ENST00000541117.1_5'UTR|FSHR_ENST00000346173.3_Intron	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	240					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.N240N(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	GCTTCTTAAGATTTTCTAAGC	0.428									Gonadal Dysgenesis, 46 XX																														uc002rww.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8						c.(718-720)AAT>AAC		follicle stimulating hormone receptor isoform 1	Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)						76.0	74.0	75.0					2																	49195971		2203	4300	6503	SO:0001819	synonymous_variant	2492	Gonadal_Dysgenesis_46_XX	Familial Cancer Database		female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding	g.chr2:49195971A>G		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.720T>C	2.37:g.49195971A>G						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Silent_p.N214N	p.N240N	NM_000145	NP_000136	P23945	FSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		9	794	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	240			Extracellular (Potential).|LRR 8.		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Silent	SNP	ENST00000406846.2	37	c.720T>C	CCDS1843.1																																																																																				0.428	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2			3	52	0	0	0	0.009096	0	3	52				
PAPOLG	64895	broad.mit.edu	37	2	60998766	60998766	+	Splice_Site	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:60998766G>T	ENST00000238714.3	+	7	853		c.e7+1			NM_022894.3	NP_075045.2	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma						mRNA polyadenylation (GO:0006378)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)	p.?(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	35	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			AGCTTAAATGGTAAGCTTCTA	0.353																																					GBM(183;1497 2932 21839 46797)	GBM(183;1497 2932 21839 46797)	uc002sai.2		NA																	1	Unknown(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.e7+1		poly(A) polymerase gamma							68.0	71.0	70.0					2																	60998766		2203	4300	6503	SO:0001630	splice_region_variant	64895				mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding	g.chr2:60998766G>T	AC012498	CCDS1863.1	2p16.1	2008-02-08			ENSG00000115421	ENSG00000115421	2.7.7.19		14982	protein-coding gene	gene with protein product							Standard	NM_022894		Approved	FLJ12972	uc002sai.3	Q9BWT3	OTTHUMG00000129419	ENST00000238714.3:c.604+1G>T	2.37:g.60998766G>T						PAPOLG_uc002saj.2_Splice_Site|PAPOLG_uc002sak.2_Intron	p.G202_splice	NM_022894	NP_075045	Q9BWT3	PAPOG_HUMAN	LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)		7	835	+	all_hematologic(2;0.0797)							B2RBH4|Q59G05|Q969N1|Q9H8L2|Q9HAD0	Splice_Site	SNP	ENST00000238714.3	37	c.604_splice	CCDS1863.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712088	0.89112	.	.	ENSG00000115421	ENST00000238714	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1692	0.93570	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PAPOLG	60852270	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.474000	0.97718	2.698000	0.92095	0.591000	0.81541	.		0.353	PAPOLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251577.3	NM_022894	Intron	19	70	1	0	6.33239e-15	0.010504	1.01499e-14	19	70				
REL	5966	broad.mit.edu	37	2	61149634	61149634	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:61149634G>C	ENST00000295025.8	+	11	2144	c.1824G>C	c.(1822-1824)ttG>ttC	p.L608F	REL_ENST00000394479.3_Missense_Mutation_p.L576F	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog	608					cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L608F(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			ATGAGCAATTGAGTGACTCCT	0.333			A		Hodgkin Lymphoma																																		uc002sam.1		NA		Dom	yes		2	2p13-p12	5966	A	v-rel reticuloendotheliosis viral oncogene homolog (avian)			L			Hodgkin Lymphoma		1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(1822-1824)TTG>TTC		v-rel reticuloendotheliosis viral oncogene							46.0	44.0	45.0					2																	61149634		2203	4300	6503	SO:0001583	missense	5966				positive regulation of I-kappaB kinase/NF-kappaB cascade	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr2:61149634G>C	M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.1824G>C	2.37:g.61149634G>C	ENSP00000295025:p.Leu608Phe					REL_uc002san.1_Missense_Mutation_p.L576F	p.L608F	NM_002908	NP_002899	Q04864	REL_HUMAN	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)		11	2048	+	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	608					Q17RU2|Q2PNZ7|Q6LDY0	Missense_Mutation	SNP	ENST00000295025.8	37	c.1824G>C	CCDS1864.1	.	.	.	.	.	.	.	.	.	.	G	9.986	1.229506	0.22542	.	.	ENSG00000162924	ENST00000295025;ENST00000394479	T;T	0.50548	0.74;0.86	5.74	2.69	0.31865	.	0.437004	0.19136	N	0.121804	T	0.31482	0.0798	L	0.29908	0.895	0.09310	N	1	P;P	0.50272	0.883;0.933	B;P	0.44860	0.368;0.462	T	0.13229	-1.0517	10	0.38643	T	0.18	-25.9441	1.5183	0.02510	0.1825:0.1371:0.4721:0.2083	.	576;608	Q17RU2;Q04864	.;REL_HUMAN	F	608;576	ENSP00000295025:L608F;ENSP00000377989:L576F	ENSP00000295025:L608F	L	+	3	2	REL	61003138	0.011000	0.17503	0.011000	0.14972	0.330000	0.28571	0.517000	0.22832	0.780000	0.33566	0.650000	0.86243	TTG		0.333	REL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251576.3	NM_002908		10	65	0	0	0	0.008291	0	10	65				
ALMS1	7840	broad.mit.edu	37	2	73717864	73717864	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:73717864A>T	ENST00000264448.6	+	10	8886	c.8775A>T	c.(8773-8775)caA>caT	p.Q2925H	ALMS1_ENST00000409009.1_Missense_Mutation_p.Q2883H|AC096546.1_ENST00000408160.1_RNA	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2925					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.Q2925H(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TTCTTGAACAACGAGAACTCT	0.453																																							uc002sje.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						c.(8779-8781)CAA>CAT		Alstrom syndrome 1							210.0	194.0	199.0					2																	73717864		1898	4123	6021	SO:0001583	missense	7840				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		g.chr2:73717864A>T	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.8775A>T	2.37:g.73717864A>T	ENSP00000264448:p.Gln2925His					ALMS1_uc002sjf.1_Missense_Mutation_p.Q2883H|ALMS1_uc002sjg.2_Missense_Mutation_p.Q2313H|ALMS1_uc002sjh.1_Missense_Mutation_p.Q2313H	p.Q2927H	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN			12	8892	+			2925					Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	c.8781A>T	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	a	15.55	2.867581	0.51588	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.07216	3.21;3.21	4.55	-1.75	0.08031	.	0.263775	0.27424	N	0.019423	T	0.11623	0.0283	L	0.42245	1.32	0.44201	D	0.99702	D;D;D	0.65815	0.983;0.995;0.995	P;P;P	0.58873	0.847;0.824;0.824	T	0.12167	-1.0558	10	0.46703	T	0.11	.	4.8516	0.13540	0.4807:0.1661:0.3532:0.0	.	2925;2883;2925	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	H	2883;2925	ENSP00000386627:Q2883H;ENSP00000264448:Q2925H	ENSP00000264448:Q2925H	Q	+	3	2	ALMS1	73571372	0.256000	0.24012	0.215000	0.23724	0.960000	0.62799	0.036000	0.13819	-0.290000	0.09025	0.528000	0.53228	CAA		0.453	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		23	251	0	0	0	0.002299	0	23	251				
SLC9A4	389015	broad.mit.edu	37	2	103148979	103148979	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:103148979G>T	ENST00000295269.4	+	12	2686	c.2229G>T	c.(2227-2229)gtG>gtT	p.V743V		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	743					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.V743V(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TAAGGAGGGTGGCCTTAAGAC	0.502																																							uc002tbz.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(2227-2229)GTG>GTT		solute carrier family 9 (sodium/hydrogen							103.0	74.0	84.0					2																	103148979		2203	4300	6503	SO:0001819	synonymous_variant	389015				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity	g.chr2:103148979G>T		CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.2229G>T	2.37:g.103148979G>T							p.V743V	NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN			12	2686	+			743			Cytoplasmic (Potential).		Q69YK0	Silent	SNP	ENST00000295269.4	37	c.2229G>T	CCDS33264.1																																																																																				0.502	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329498.1	NM_001011552.3		11	27	1	0	3.86212e-05	0.008291	4.79347e-05	11	27				
RANBP2	5903	broad.mit.edu	37	2	109380702	109380702	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:109380702G>T	ENST00000283195.6	+	20	3833	c.3707G>T	c.(3706-3708)cGa>cTa	p.R1236L		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1236	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R1236L(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CTAATGAGACGAGAGCAAGTA	0.383																																							uc002tem.3		NA																RANBP2/ALK(16)	2	Substitution - Missense(2)		lung(2)	soft_tissue(16)|lung(1)|pancreas(1)	18						c.(3706-3708)CGA>CTA		RAN binding protein 2							77.0	77.0	77.0					2																	109380702		2203	4300	6503	SO:0001583	missense	5903				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding	g.chr2:109380702G>T	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3707G>T	2.37:g.109380702G>T	ENSP00000283195:p.Arg1236Leu						p.R1236L	NM_006267	NP_006258	P49792	RBP2_HUMAN			20	3833	+			1236			RanBD1 1.		Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	c.3707G>T	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410570	0.83340	.	.	ENSG00000153201	ENST00000283195	T	0.52983	0.64	5.45	5.45	0.79879	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.77552	0.4147	M	0.92691	3.335	0.49483	D	0.999796	D	0.89917	1.0	D	0.97110	1.0	T	0.83277	-0.0040	9	0.87932	D	0	-10.9993	19.3035	0.94153	0.0:0.0:1.0:0.0	.	1236	P49792	RBP2_HUMAN	L	1236	ENSP00000283195:R1236L	ENSP00000283195:R1236L	R	+	2	0	RANBP2	108747134	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.864000	0.99589	2.535000	0.85469	0.650000	0.86243	CGA		0.383	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267		7	92	1	0	2.0095e-06	0.001984	2.70342e-06	7	92				
RANBP2	5903	broad.mit.edu	37	2	109382540	109382540	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:109382540G>A	ENST00000283195.6	+	20	5671	c.5545G>A	c.(5545-5547)Gct>Act	p.A1849T		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1849					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.A1849T(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CTCAGAAAAAGCTTCTAAGTT	0.383																																							uc002tem.3		NA																RANBP2/ALK(16)	2	Substitution - Missense(2)		lung(2)	soft_tissue(16)|lung(1)|pancreas(1)	18						c.(5545-5547)GCT>ACT		RAN binding protein 2							84.0	96.0	92.0					2																	109382540		2203	4299	6502	SO:0001583	missense	5903				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding	g.chr2:109382540G>A	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.5545G>A	2.37:g.109382540G>A	ENSP00000283195:p.Ala1849Thr						p.A1849T	NM_006267	NP_006258	P49792	RBP2_HUMAN			20	5671	+			1849					Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	c.5545G>A	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	10.16	1.274733	0.23307	.	.	ENSG00000153201	ENST00000283195	T	0.27402	1.67	5.67	-0.169	0.13339	.	.	.	.	.	T	0.17916	0.0430	L	0.38531	1.155	0.20563	N	0.999884	B	0.02656	0.0	B	0.04013	0.001	T	0.35126	-0.9801	9	0.12430	T	0.62	-0.0649	4.292	0.10883	0.2996:0.0:0.4195:0.2809	.	1849	P49792	RBP2_HUMAN	T	1849	ENSP00000283195:A1849T	ENSP00000283195:A1849T	A	+	1	0	RANBP2	108748972	0.001000	0.12720	0.969000	0.41365	0.439000	0.31926	0.545000	0.23268	-0.389000	0.07786	-0.158000	0.13435	GCT		0.383	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267		13	215	0	0	0	0.001368	0	13	215				
UGGT1	56886	broad.mit.edu	37	2	128941255	128941255	+	Silent	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:128941255A>G	ENST00000259253.6	+	38	4298	c.4251A>G	c.(4249-4251)ctA>ctG	p.L1417L	UGGT1_ENST00000375990.3_Silent_p.L1393L	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	1417	Glucosyltransferase. {ECO:0000250}.				'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)	p.L1417L(1)		NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TCAGTGCACTATATGTTGTGG	0.433																																							uc002tps.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(4249-4251)CTA>CTG		UDP-glucose ceramide glucosyltransferase-like 1							102.0	96.0	98.0					2																	128941255		2203	4300	6503	SO:0001819	synonymous_variant	56886				'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding	g.chr2:128941255A>G	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.4251A>G	2.37:g.128941255A>G						UGGT1_uc002tpr.2_Silent_p.L1393L	p.L1417L	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN			38	4429	+			1417			Glucosyltransferase (By similarity).		Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Silent	SNP	ENST00000259253.6	37	c.4251A>G	CCDS2154.1																																																																																				0.433	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120		11	59	0	0	0	0.001368	0	11	59				
PLEKHB2	55041	broad.mit.edu	37	2	131904333	131904333	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:131904333T>C	ENST00000403716.1	+	8	1216	c.656T>C	c.(655-657)tTt>tCt	p.F219S	PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000538982.1_Missense_Mutation_p.F171S|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000409612.1_Missense_Mutation_p.F219S|PLEKHB2_ENST00000438882.2_3'UTR|PLEKHB2_ENST00000409279.1_Missense_Mutation_p.F219S|PLEKHB2_ENST00000439822.2_3'UTR|PLEKHB2_ENST00000234115.6_Missense_Mutation_p.F218S|PLEKHB2_ENST00000409158.1_Missense_Mutation_p.F227S	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	219						endosome (GO:0005768)|membrane (GO:0016020)		p.F218S(1)		large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		GGGTCTCTATTTTGGGTCTTC	0.502																																							uc002tsg.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(655-657)TTT>TCT		pleckstrin homology domain containing, family B							127.0	131.0	130.0					2																	131904333		2203	4300	6503	SO:0001583	missense	55041					membrane	protein binding	g.chr2:131904333T>C		CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.656T>C	2.37:g.131904333T>C	ENSP00000385892:p.Phe219Ser					PLEKHB2_uc002tsh.2_Intron|PLEKHB2_uc002tsj.3_Missense_Mutation_p.F218S|PLEKHB2_uc002tsf.3_Missense_Mutation_p.F227S|PLEKHB2_uc010zao.1_Missense_Mutation_p.F169S|PLEKHB2_uc010zap.1_3'UTR|PLEKHB2_uc010zaq.1_3'UTR|PLEKHB2_uc002tsi.3_Missense_Mutation_p.F260S	p.F219S	NM_001100623	NP_001094093	Q96CS7	PKHB2_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0828)	8	1216	+			219					B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Missense_Mutation	SNP	ENST00000403716.1	37	c.656T>C	CCDS46413.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.637161	0.87760	.	.	ENSG00000115762	ENST00000409158;ENST00000403716;ENST00000234115;ENST00000538982;ENST00000409612;ENST00000409279	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	T	0.77698	0.4169	M	0.71581	2.175	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.85130	0.994;0.997;0.994;0.994	T	0.80353	-0.1418	8	0.87932	D	0	.	13.7769	0.63059	0.0:0.0:0.0:1.0	.	218;218;219;227	Q53FF1;Q96CS7-3;Q96CS7;B8ZZN1	.;.;PKHB2_HUMAN;.	S	227;219;218;171;219;219	.	ENSP00000234115:F218S	F	+	2	0	PLEKHB2	131620803	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.279000	0.72620	2.144000	0.66660	0.524000	0.50904	TTT		0.502	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331304.2	NM_017958		33	219	0	0	0	0.002445	0	33	219				
LOC150776	150776	broad.mit.edu	37	2	132277131	132277131	+	RNA	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:132277131G>T	ENST00000438378.2	+	0	2200					NR_026922.1																						AGCTTAGGCAGTTCACACTCG	0.587																																							uc002tsz.3		NA																	0					0						c.(139-141)CAG>CAT		Homo sapiens cDNA FLJ41352 fis, clone BRAWH2014645.																																						150776							g.chr2:132277131G>T																													2.37:g.132277131G>T						LOC150776_uc002tsy.3_RNA	p.Q47H							2	588	+									Missense_Mutation	SNP	ENST00000438378.2	37	c.141G>T																																																																																					0.587	AC093838.4-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000331819.7			8	33	1	0	1.12685e-05	0.004482	1.47015e-05	8	33				
THSD7B	80731	broad.mit.edu	37	2	137814464	137814464	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:137814464C>T	ENST00000409968.1	+	3	792	c.614C>T	c.(613-615)gCg>gTg	p.A205V	THSD7B_ENST00000543459.1_Missense_Mutation_p.A64V|THSD7B_ENST00000413152.2_Missense_Mutation_p.A174V|THSD7B_ENST00000272643.3_Missense_Mutation_p.A205V			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	205	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.A174V(1)|p.A205V(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		AGAACTCGCGCGGTCATAGCT	0.502																																							uc002tva.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(520-522)GCG>GTG		thrombospondin, type I, domain containing 7B							187.0	183.0	184.0					2																	137814464		1955	4149	6104	SO:0001583	missense	80731							g.chr2:137814464C>T			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.614C>T	2.37:g.137814464C>T	ENSP00000387145:p.Ala205Val					THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_Missense_Mutation_p.A64V	p.A174V	NM_001080427	NP_001073896				BRCA - Breast invasive adenocarcinoma(221;0.19)	2	521	+									Missense_Mutation	SNP	ENST00000409968.1	37	c.521C>T		.	.	.	.	.	.	.	.	.	.	C	1.777	-0.482911	0.04383	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152;ENST00000543459	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.77	0.881	0.19166	.	0.652035	0.17137	N	0.185585	T	0.21347	0.0514	N	0.10809	0.05	0.09310	N	1	B;B	0.12630	0.006;0.003	B;B	0.15484	0.013;0.003	T	0.18999	-1.0319	10	0.14656	T	0.56	.	4.7171	0.12899	0.1355:0.4749:0.0:0.3896	.	205;174	Q9C0I4;C9JKN6	THS7B_HUMAN;.	V	205;205;174;64	ENSP00000387145:A205V;ENSP00000272643:A205V;ENSP00000413841:A174V;ENSP00000443370:A64V	ENSP00000272643:A205V	A	+	2	0	THSD7B	137530934	0.000000	0.05858	0.000000	0.03702	0.149000	0.21700	0.236000	0.17967	-0.058000	0.13177	0.585000	0.79938	GCG		0.502	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		50	205	0	0	0	0.00361	0	50	205				
LRP1B	53353	broad.mit.edu	37	2	141747165	141747165	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:141747165T>A	ENST00000389484.3	-	17	3677	c.2706A>T	c.(2704-2706)agA>agT	p.R902S	Y_RNA_ENST00000365022.1_RNA	NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	902	LDL-receptor class A 4. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.R902S(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CACAAAGCCATCTCTTGGGGA	0.413										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(2704-2706)AGA>AGT		low density lipoprotein-related protein 1B							136.0	127.0	130.0					2																	141747165		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141747165T>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2706A>T	2.37:g.141747165T>A	ENSP00000374135:p.Arg902Ser	TSP Lung(27;0.18)				LRP1B_uc010fnl.1_Intron	p.R902S	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	17	3678	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	902			Extracellular (Potential).|LDL-receptor class A 4.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.2706A>T	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.158036	0.78114	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.94828	-3.53	5.69	2.02	0.26589	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	U	0.000000	D	0.85256	0.5655	N	0.01751	-0.74	0.48452	D	0.999651	B	0.28128	0.201	B	0.40444	0.329	T	0.73154	-0.4072	10	0.13853	T	0.58	.	10.193	0.43039	0.0:0.3211:0.0:0.6789	.	902	Q9NZR2	LRP1B_HUMAN	S	902;840	ENSP00000374135:R902S	ENSP00000374135:R902S	R	-	3	2	LRP1B	141463635	0.951000	0.32395	1.000000	0.80357	0.960000	0.62799	0.003000	0.13083	0.171000	0.19730	0.533000	0.62120	AGA		0.413	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		22	108	0	0	0	0.002299	0	22	108				
NEB	4703	broad.mit.edu	37	2	152472566	152472566	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:152472566C>G	ENST00000172853.10	-	72	10657	c.10510G>C	c.(10510-10512)Gat>Cat	p.D3504H	NEB_ENST00000427231.2_Missense_Mutation_p.D3747H|NEB_ENST00000604864.1_Missense_Mutation_p.D3747H|NEB_ENST00000603639.1_Missense_Mutation_p.D3747H|NEB_ENST00000409198.1_Missense_Mutation_p.D3504H|NEB_ENST00000397345.3_Missense_Mutation_p.D3747H			P20929	NEBU_HUMAN	nebulin	3504					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.D3747H(1)|p.D3504H(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GGAATGGCATCCAGACGCAAG	0.378																																							uc010fnx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(10510-10512)GAT>CAT		nebulin isoform 3							72.0	73.0	72.0					2																	152472566		1855	4095	5950	SO:0001583	missense	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152472566C>G	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.10510G>C	2.37:g.152472566C>G	ENSP00000172853:p.Asp3504His						p.D3504H	NM_004543	NP_004534	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	72	10701	-			3504			Nebulin 96.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37	c.10510G>C		.	.	.	.	.	.	.	.	.	.	C	27.8	4.866558	0.91511	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.86322	0.5905	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89500	0.3763	10	0.87932	D	0	.	17.9894	0.89164	0.0:1.0:0.0:0.0	.	3504	P20929	NEBU_HUMAN	H	3504;3747;3747;3504	ENSP00000386259:D3504H;ENSP00000380505:D3747H;ENSP00000416578:D3747H;ENSP00000172853:D3504H	ENSP00000172853:D3504H	D	-	1	0	NEB	152180812	1.000000	0.71417	0.990000	0.47175	0.867000	0.49689	7.521000	0.81832	2.602000	0.87976	0.650000	0.86243	GAT		0.378	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		3	42	0	0	0	0.004672	0	3	42				
LY75	4065	broad.mit.edu	37	2	160755507	160755507	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:160755507C>A	ENST00000263636.4	-	2	185	c.158G>T	c.(157-159)tGg>tTg	p.W53L	LY75_ENST00000554112.1_Missense_Mutation_p.W53L|LY75_ENST00000553424.1_Missense_Mutation_p.W53L|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.W53L|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.W53L	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	53	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.W53L(1)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TGCTACTATCCAGCCATACAC	0.488																																							uc002ubc.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(157-159)TGG>TTG		lymphocyte antigen 75 precursor							159.0	142.0	148.0					2																	160755507		2203	4300	6503	SO:0001583	missense	4065				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding	g.chr2:160755507C>A	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.158G>T	2.37:g.160755507C>A	ENSP00000263636:p.Trp53Leu					LY75_uc002ubb.3_Missense_Mutation_p.W53L|LY75_uc010fos.2_Missense_Mutation_p.W53L|LY75_uc010fot.1_Missense_Mutation_p.W53L	p.W53L	NM_002349	NP_002340	O60449	LY75_HUMAN		COAD - Colon adenocarcinoma(177;0.132)	2	227	-			53			Extracellular (Potential).|Ricin B-type lectin.		O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	37	c.158G>T	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	C	4.965	0.179169	0.09443	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	6.02	5.12	0.69794	Ricin B-related lectin (1);Ricin B lectin (2);	0.000000	0.33180	N	0.005198	T	0.57184	0.2036	M	0.75447	2.3	0.33612	D	0.603692	B;B;D	0.89917	0.41;0.086;1.0	B;B;D	0.85130	0.07;0.048;0.997	T	0.58901	-0.7554	10	0.08837	T	0.75	-8.2306	10.007	0.41964	0.2439:0.6907:0.0:0.0653	.	53;53;53	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	L	53	ENSP00000451511:W53L;ENSP00000451446:W53L;ENSP00000263636:W53L;ENSP00000423463:W53L;ENSP00000421035:W53L	ENSP00000423463:W53L	W	-	2	0	LY75;LY75-CD302	160463753	0.996000	0.38824	1.000000	0.80357	0.105000	0.19272	1.085000	0.30840	2.865000	0.98341	0.655000	0.94253	TGG		0.488	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1			32	109	1	0	8.16721e-17	0.002096	1.3358e-16	32	109				
ITGB6	3694	broad.mit.edu	37	2	160958301	160958301	+	Silent	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:160958301A>G	ENST00000283249.2	-	15	2550	c.2313T>C	c.(2311-2313)aaT>aaC	p.N771N	ITGB6_ENST00000409872.1_Silent_p.N771N|ITGB6_ENST00000428609.2_Silent_p.N729N|ITGB6_ENST00000409967.2_Silent_p.N664N	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	771					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)	p.N771N(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						TATAAGTTACATTTTTAAAAG	0.308																																							uc002ubh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(2311-2313)AAT>AAC		integrin, beta 6 precursor							161.0	157.0	158.0					2																	160958301		2202	4299	6501	SO:0001819	synonymous_variant	3694				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity	g.chr2:160958301A>G		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.2313T>C	2.37:g.160958301A>G						ITGB6_uc002ubg.2_5'Flank|ITGB6_uc010fou.2_Silent_p.N771N|ITGB6_uc010zcq.1_Silent_p.N729N|ITGB6_uc010fov.1_Silent_p.N771N	p.N771N	NM_000888	NP_000879	P18564	ITB6_HUMAN			15	2329	-			771			Cytoplasmic (Potential).		B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Silent	SNP	ENST00000283249.2	37	c.2313T>C	CCDS2212.1																																																																																				0.308	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888		16	80	0	0	0	0.008871	0	16	80				
SCN3A	6328	broad.mit.edu	37	2	165946747	165946747	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:165946747A>C	ENST00000360093.3	-	28	6407	c.5916T>G	c.(5914-5916)agT>agG	p.S1972R	SCN3A_ENST00000283254.7_Missense_Mutation_p.S1972R|AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000409101.3_Missense_Mutation_p.S1923R|SCN3A_ENST00000465043.1_5'Flank|SCN3A_ENST00000540861.1_Missense_Mutation_p.S455R	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1972					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.S1923R(1)|p.S1972R(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTTTTGTTACACTATCATAGG	0.358																																							uc002ucx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(5914-5916)AGT>AGG		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						93.0	90.0	91.0					2																	165946747		2203	4300	6503	SO:0001583	missense	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:165946747A>C	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5916T>G	2.37:g.165946747A>C	ENSP00000353206:p.Ser1972Arg					SCN3A_uc010zcy.1_Missense_Mutation_p.S455R|SCN3A_uc002ucy.2_Missense_Mutation_p.S1923R|SCN3A_uc002ucz.2_Missense_Mutation_p.S1923R	p.S1972R	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN			28	6408	-			1972					Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37	c.5916T>G		.	.	.	.	.	.	.	.	.	.	A	14.66	2.602449	0.46423	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.97455	-4.13;-4.13;-4.09;-4.39	6.03	2.44	0.29823	.	0.000000	0.64402	D	0.000001	D	0.95468	0.8528	N	0.14661	0.345	0.49582	D	0.999809	D;D;D	0.76494	0.999;0.999;0.997	D;D;D	0.80764	0.994;0.994;0.975	D	0.93212	0.6601	10	0.40728	T	0.16	.	9.4197	0.38544	0.8004:0.0:0.1996:0.0	.	1923;1923;1972	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	R	1972;1972;1923;455	ENSP00000353206:S1972R;ENSP00000283254:S1972R;ENSP00000386726:S1923R;ENSP00000439920:S455R	ENSP00000283254:S1972R	S	-	3	2	SCN3A	165654993	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	2.261000	0.43276	0.523000	0.28482	0.533000	0.62120	AGT		0.358	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		5	35	0	0	0	0.001168	0	5	35				
XIRP2	129446	broad.mit.edu	37	2	168102059	168102059	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:168102059C>G	ENST00000409195.1	+	9	4246	c.4157C>G	c.(4156-4158)tCt>tGt	p.S1386C	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.S1164C|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.S1386C	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1211					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.S1386C(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GATGTTAGTTCTGTCAGATAC	0.343																																							uc002udx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(4156-4158)TCT>TGT		xin actin-binding repeat containing 2 isoform 1							71.0	66.0	67.0					2																	168102059		1846	4093	5939	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168102059C>G	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.4157C>G	2.37:g.168102059C>G	ENSP00000386840:p.Ser1386Cys					XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.S1211C|XIRP2_uc010fpq.2_Missense_Mutation_p.S1164C|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	p.S1386C	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			8	4175	+			1211			Xin 24.		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.4157C>G	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.151550	0.57151	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.04758	3.56;3.56;3.56	5.67	4.77	0.60923	.	0.242758	0.42420	N	0.000703	T	0.23806	0.0576	M	0.82056	2.57	0.52501	D	0.999956	D;D;B	0.89917	1.0;1.0;0.33	D;D;B	0.91635	0.997;0.999;0.091	T	0.02339	-1.1174	10	0.87932	D	0	-3.6088	16.1465	0.81575	0.0:0.866:0.134:0.0	.	1211;1211;1164	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	C	1386;1386;1164	ENSP00000386840:S1386C;ENSP00000295237:S1386C;ENSP00000387255:S1164C	ENSP00000295237:S1386C	S	+	2	0	XIRP2	167810305	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.755000	0.68750	1.348000	0.45733	0.563000	0.77884	TCT		0.343	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		28	82	0	0	0	0.008361	0	28	82				
TTN	7273	broad.mit.edu	37	2	179614245	179614245	+	Intron	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:179614245A>G	ENST00000591111.1	-	45	10585				TTN_ENST00000360870.5_Silent_p.F4294F|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCAGGGAGTAAAGGGACCAG	0.393																																							uc002unb.2		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(12880-12882)TTT>TTC		titin isoform novex-3							59.0	60.0	60.0					2																	179614245		2203	4299	6502	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179614245A>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3605T>C	2.37:g.179614245A>G						TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.F4294F	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	13106	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.12882T>C																																																																																					0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		9	110	0	0	0	0.004482	0	9	110				
TTN	7273	broad.mit.edu	37	2	179632810	179632810	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:179632810C>A	ENST00000591111.1	-	39	9460	c.9236G>T	c.(9235-9237)tGt>tTt	p.C3079F	TTN_ENST00000360870.5_Missense_Mutation_p.C3079F|TTN_ENST00000342992.6_Missense_Mutation_p.C3079F|TTN_ENST00000589042.1_Missense_Mutation_p.C3079F|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.C3033F|TTN_ENST00000460472.2_Missense_Mutation_p.C3033F|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.C3033F			Q8WZ42	TITIN_HUMAN	titin	13411	Ig-like 18.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.C3033F(3)|p.C3079F(3)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAAACTTCACATTCAAACAT	0.393																																							uc010zfg.1		NA																	6	Substitution - Missense(6)		lung(6)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(9235-9237)TGT>TTT		titin isoform N2-A							151.0	138.0	143.0					2																	179632810		2203	4300	6503	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179632810C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.9236G>T	2.37:g.179632810C>A	ENSP00000465570:p.Cys3079Phe					TTN_uc010zfh.1_Missense_Mutation_p.C3033F|TTN_uc010zfi.1_Missense_Mutation_p.C3033F|TTN_uc010zfj.1_Missense_Mutation_p.C3033F|TTN_uc002unb.2_Missense_Mutation_p.C3079F	p.C3079F	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		39	9460	-			3079					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.9236G>T		.	.	.	.	.	.	.	.	.	.	C	15.48	2.847468	0.51164	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22	5.73	5.73	0.89815	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50205	0.1602	M	0.90759	3.145	0.47153	D	0.999336	D;D;D;D;D	0.76494	0.99;0.983;0.99;0.983;0.999	P;P;P;P;P	0.62184	0.899;0.899;0.899;0.899;0.873	T	0.58244	-0.7670	9	0.87932	D	0	.	20.27	0.98469	0.0:1.0:0.0:0.0	.	3033;3033;3033;3079;3079	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	F	3079;3033;3033;3033;3033;3079	ENSP00000343764:C3079F;ENSP00000434586:C3033F;ENSP00000340554:C3033F;ENSP00000352154:C3033F;ENSP00000354117:C3079F	ENSP00000340554:C3033F	C	-	2	0	TTN	179341055	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.445000	0.80570	2.854000	0.98071	0.655000	0.94253	TGT		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		12	92	1	0	1.02788e-11	0.00499	1.57984e-11	12	92				
CCDC141	285025	broad.mit.edu	37	2	179736949	179736949	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:179736949T>C	ENST00000420890.2	-	13	2107	c.1990A>G	c.(1990-1992)Agc>Ggc	p.S664G	CCDC141_ENST00000295723.5_Missense_Mutation_p.S89G	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	664								p.S89G(1)|p.S664G(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CGAAGGAGGCTAAGTTCTTCC	0.453																																							uc002unf.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|pancreas(2)|skin(1)	10						c.(265-267)AGC>GGC		coiled-coil domain containing 141							158.0	134.0	142.0					2																	179736949		2203	4300	6503	SO:0001583	missense	285025						protein binding	g.chr2:179736949T>C	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.1990A>G	2.37:g.179736949T>C	ENSP00000395995:p.Ser664Gly						p.S89G	NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)		3	322	-			89			Potential.		H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37	c.265A>G		.	.	.	.	.	.	.	.	.	.	T	11.30	1.596887	0.28445	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758;ENST00000446116	T;T;T;T	0.47869	0.83;1.4;1.39;1.44	5.51	3.09	0.35607	.	0.492688	0.18534	N	0.138412	T	0.26810	0.0656	N	0.17082	0.46	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.15122	-1.0448	10	0.30854	T	0.27	-2.2714	4.5719	0.12214	0.1897:0.0931:0.0:0.7172	.	89	Q6ZP82	CC141_HUMAN	G	664;108;89;664;599	ENSP00000395995:S664G;ENSP00000344627:S108G;ENSP00000295723:S89G;ENSP00000390190:S664G	ENSP00000295723:S89G	S	-	1	0	CCDC141	179445194	0.002000	0.14202	0.066000	0.19879	0.673000	0.39480	0.469000	0.22067	0.359000	0.24239	0.456000	0.33151	AGC		0.453	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648		8	85	0	0	0	0.004482	0	8	85				
COL3A1	1281	broad.mit.edu	37	2	189870935	189870935	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:189870935A>T	ENST00000304636.3	+	42	3213	c.3043A>T	c.(3043-3045)Aac>Tac	p.N1015Y	COL3A1_ENST00000317840.5_Intron	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1015	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.N1015Y(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TAATCAGGGAAACCCTGGATC	0.388																																							uc002uqj.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(4)|large_intestine(2)	13						c.(3043-3045)AAC>TAC		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						74.0	77.0	76.0					2																	189870935		2203	4300	6503	SO:0001583	missense	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189870935A>T	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.3043A>T	2.37:g.189870935A>T	ENSP00000304408:p.Asn1015Tyr						p.N1015Y	NM_000090	NP_000081	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		42	3160	+			1015			Triple-helical region.		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.3043A>T	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.853871	0.71719	.	.	ENSG00000168542	ENST00000304636	D	0.94280	-3.39	5.69	5.69	0.88448	.	0.000000	0.56097	D	0.000032	D	0.94138	0.8120	L	0.28649	0.875	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93636	0.6960	10	0.34782	T	0.22	.	15.9353	0.79698	1.0:0.0:0.0:0.0	.	1015	P02461	CO3A1_HUMAN	Y	1015	ENSP00000304408:N1015Y	ENSP00000304408:N1015Y	N	+	1	0	COL3A1	189579180	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	5.049000	0.64244	2.160000	0.67779	0.482000	0.46254	AAC		0.388	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		12	60	0	0	0	0.000978	0	12	60				
C2orf66	401027	broad.mit.edu	37	2	197674047	197674047	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:197674047G>T	ENST00000342506.2	-	1	953	c.65C>A	c.(64-66)cCt>cAt	p.P22H		NM_213608.2	NP_998773.1	Q6UXQ4	CB066_HUMAN	chromosome 2 open reading frame 66	22						extracellular region (GO:0005576)		p.P22H(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9						TAGCAGGAGAGGTGCTCTGGT	0.507																																							uc002utv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(64-66)CCT>CAT		hypothetical protein LOC401027 precursor							196.0	178.0	184.0					2																	197674047		2203	4300	6503	SO:0001583	missense	401027					extracellular region		g.chr2:197674047G>T		CCDS2317.1	2q33.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000187944	ENSG00000187944			33809	protein-coding gene	gene with protein product							Standard	NM_213608		Approved	UNQ6411	uc002utv.3	Q6UXQ4	OTTHUMG00000132742	ENST00000342506.2:c.65C>A	2.37:g.197674047G>T	ENSP00000339384:p.Pro22His						p.P22H	NM_213608	NP_998773	Q6UXQ4	CB066_HUMAN			1	954	-			22					B2RNW3	Missense_Mutation	SNP	ENST00000342506.2	37	c.65C>A	CCDS2317.1	.	.	.	.	.	.	.	.	.	.	G	7.488	0.650030	0.14516	.	.	ENSG00000187944	ENST00000342506	.	.	.	3.09	-1.96	0.07525	.	1.656350	0.04365	U	0.358174	T	0.14614	0.0353	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10683	-1.0619	9	0.15499	T	0.54	-0.4175	0.0611	0.00015	0.3403:0.1874:0.1778:0.2946	.	22	Q6UXQ4	CB066_HUMAN	H	22	.	ENSP00000339384:P22H	P	-	2	0	C2orf66	197382292	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	0.132000	0.15891	-0.383000	0.07858	0.655000	0.94253	CCT		0.507	C2orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256102.1	NM_213608		15	187	1	0	2.62699e-14	0.003163	4.19869e-14	15	187				
KANSL1L	151050	broad.mit.edu	37	2	210887823	210887823	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:210887823A>T	ENST00000281772.9	-	15	3077	c.2814T>A	c.(2812-2814)gaT>gaA	p.D938E	KANSL1L_ENST00000418791.1_Missense_Mutation_p.D896E	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	938						histone acetyltransferase complex (GO:0000123)		p.D938E(1)									TTTCAACCTGATCCTTTTTTT	0.448																																							uc002vds.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2812-2814)GAT>GAA		hypothetical protein LOC151050							121.0	116.0	117.0					2																	210887823		2203	4300	6503	SO:0001583	missense	151050							g.chr2:210887823A>T	AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.2814T>A	2.37:g.210887823A>T	ENSP00000281772:p.Asp938Glu					C2orf67_uc002vdt.2_Missense_Mutation_p.D896E	p.D938E	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)	15	3022	-		Renal(323;0.202)	938					B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Missense_Mutation	SNP	ENST00000281772.9	37	c.2814T>A	CCDS33370.1	.	.	.	.	.	.	.	.	.	.	A	4.629	0.116878	0.08881	.	.	ENSG00000144445	ENST00000281772;ENST00000418791	.	.	.	5.6	1.67	0.24075	.	0.665589	0.13870	N	0.357046	T	0.27205	0.0667	L	0.47716	1.5	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.11329	0.006;0.006	T	0.34453	-0.9828	9	0.05436	T	0.98	.	5.2329	0.15432	0.5615:0.2864:0.1521:0.0	.	896;938	A0AUZ9-2;A0AUZ9	.;CB067_HUMAN	E	938;896	.	ENSP00000281772:D938E	D	-	3	2	C2orf67	210596068	0.621000	0.27077	0.003000	0.11579	0.032000	0.12392	0.887000	0.28254	0.398000	0.25338	0.482000	0.46254	GAT		0.448	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336633.3	NM_152519		10	69	0	0	0	0.006214	0	10	69				
TRIP12	9320	broad.mit.edu	37	2	230724103	230724103	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:230724103G>A	ENST00000283943.5	-	3	464	c.286C>T	c.(286-288)Cag>Tag	p.Q96*	TRIP12_ENST00000543084.1_Nonsense_Mutation_p.Q138*|TRIP12_ENST00000389045.3_Intron|TRIP12_ENST00000389044.4_Nonsense_Mutation_p.Q138*|TRIP12_ENST00000409677.1_Nonsense_Mutation_p.Q138*	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	96					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.Q96*(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TCAGTATGCTGAAGTGCTTTT	0.433																																							uc002vpw.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9						c.(286-288)CAG>TAG		thyroid hormone receptor interactor 12							179.0	175.0	177.0					2																	230724103		2203	4300	6503	SO:0001587	stop_gained	9320				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity	g.chr2:230724103G>A	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.286C>T	2.37:g.230724103G>A	ENSP00000283943:p.Gln96*					TRIP12_uc002vpx.1_Nonsense_Mutation_p.Q138*|TRIP12_uc002vpy.1_Intron|TRIP12_uc010zlz.1_RNA|TRIP12_uc010fxh.1_Nonsense_Mutation_p.Q96*	p.Q96*	NM_004238	NP_004229	Q14669	TRIPC_HUMAN		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)	3	395	-		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)	96					D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Nonsense_Mutation	SNP	ENST00000283943.5	37	c.286C>T	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.816434	0.90790	.	.	ENSG00000153827	ENST00000283943;ENST00000389044;ENST00000543084;ENST00000409677;ENST00000435716;ENST00000428959;ENST00000430954;ENST00000343290	.	.	.	5.85	4.96	0.65561	.	0.309632	0.36932	N	0.002334	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	16.9589	0.86267	0.0:0.1277:0.8723:0.0	.	.	.	.	X	96;138;138;138;96;96;138;96	.	ENSP00000283943:Q96X	Q	-	1	0	TRIP12	230432347	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.353000	0.79414	1.459000	0.47892	0.655000	0.94253	CAG		0.433	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238		7	224	0	0	0	0.001984	0	7	224				
COL6A3	1293	broad.mit.edu	37	2	238249699	238249699	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:238249699C>A	ENST00000295550.4	-	38	8312	c.7860G>T	c.(7858-7860)atG>atT	p.M2620I	COL6A3_ENST00000353578.4_Missense_Mutation_p.M2414I|COL6A3_ENST00000472056.1_Missense_Mutation_p.M2013I|COL6A3_ENST00000346358.4_Missense_Mutation_p.M2420I|COL6A3_ENST00000347401.3_Missense_Mutation_p.M2419I|COL6A3_ENST00000409809.1_Missense_Mutation_p.M2414I	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2620	Nonhelical region.|VWFA 12. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.M2620I(2)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AGATGAAAGCCATGTCGATGT	0.527																																							uc002vwl.2		NA																	2	Substitution - Missense(2)		lung(1)|kidney(1)	ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.(7858-7860)ATG>ATT		alpha 3 type VI collagen isoform 1 precursor							190.0	184.0	186.0					2																	238249699		2203	4300	6503	SO:0001583	missense	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238249699C>A	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7860G>T	2.37:g.238249699C>A	ENSP00000295550:p.Met2620Ile					COL6A3_uc002vwo.2_Missense_Mutation_p.M2414I|COL6A3_uc010znj.1_Missense_Mutation_p.M2013I|COL6A3_uc002vwj.2_Missense_Mutation_p.M1I	p.M2620I	NM_004369	NP_004360	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	38	8145	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	2620			VWFA 12.|Nonhelical region.		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	c.7860G>T	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.983038	0.34942	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	5.05	5.05	0.67936	von Willebrand factor, type A (3);	0.443090	0.21076	N	0.080571	T	0.62841	0.2461	N	0.17474	0.49	0.40261	D	0.978171	B;B;B	0.25390	0.001;0.001;0.125	B;B;B	0.37267	0.002;0.001;0.245	T	0.55891	-0.8069	10	0.02654	T	1	.	10.1126	0.42572	0.0:0.8746:0.0:0.1254	.	2013;2414;2620	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	I	2620;2419;2414;2013;2414;2420	ENSP00000295550:M2620I;ENSP00000315609:M2419I;ENSP00000315873:M2414I;ENSP00000418285:M2013I;ENSP00000386844:M2414I;ENSP00000295546:M2420I	ENSP00000295550:M2620I	M	-	3	0	COL6A3	237914438	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	1.181000	0.32017	2.478000	0.83669	0.655000	0.94253	ATG		0.527	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		48	169	1	0	1.56793e-16	0.00361	2.54958e-16	48	169				
OR6B2	389090	broad.mit.edu	37	2	240969109	240969109	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:240969109G>T	ENST00000402971.2	-	1	797	c.738C>A	c.(736-738)acC>acA	p.T246T		NM_001005853.1	NP_001005853.1	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B, member 2	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T246T(1)		endometrium(1)|large_intestine(4)|lung(9)|prostate(1)	15		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		CGGTGACCACGGTGAGGTGAG	0.572																																							uc002vyr.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(736-738)ACC>ACA		olfactory receptor, family 6, subfamily B,							62.0	66.0	65.0					2																	240969109		2069	4212	6281	SO:0001819	synonymous_variant	389090				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr2:240969109G>T		CCDS46559.1	2q37.3	2012-08-09	2004-10-07	2004-10-07	ENSG00000182083	ENSG00000182083		"""GPCR / Class A : Olfactory receptors"""	15041	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 2 pseudogene"""	OR6B2P			Standard	XM_005247004		Approved		uc010zoc.2	Q6IFH4	OTTHUMG00000152400	ENST00000402971.2:c.738C>A	2.37:g.240969109G>T						OR6B2_uc010zoc.1_Silent_p.T246T	p.T246T	NM_001005853	NP_001005853	Q6IFH4	OR6B2_HUMAN		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)	2	784	-		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)	246			Helical; Name=6; (Potential).		B2RPR3|Q8NGW0	Silent	SNP	ENST00000402971.2	37	c.738C>A	CCDS46559.1																																																																																				0.572	OR6B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326079.1	NM_001005853		4	52	1	0	0.00909568	0.009096	0.00994674	4	52				
CAPN10	11132	broad.mit.edu	37	2	241535790	241535790	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:241535790G>A	ENST00000391984.2	+	8	1529	c.1333G>A	c.(1333-1335)Ggc>Agc	p.G445S	CAPN10_ENST00000404753.3_Missense_Mutation_p.G445S|CAPN10_ENST00000352879.4_Intron|CAPN10_ENST00000270364.7_Intron|CAPN10_ENST00000354082.4_Intron	NM_023083.3	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10	445	Domain III 1.				actin cytoskeleton reorganization (GO:0031532)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to insulin stimulus (GO:0032869)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin secretion (GO:0032024)|positive regulation of intracellular transport (GO:0032388)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteolysis (GO:0006508)|type B pancreatic cell apoptotic process (GO:0097050)	cell (GO:0005623)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cytoskeletal protein binding (GO:0008092)|SNARE binding (GO:0000149)	p.G445S(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|urinary_tract(1)	27		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		CCCCGTGGCTGGCACCGCGTG	0.667																																							uc002vzk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|lung(1)	6						c.(1333-1335)GGC>AGC		calpain 10 isoform a							55.0	60.0	59.0					2																	241535790		1989	4147	6136	SO:0001583	missense	11132				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding	g.chr2:241535790G>A	AF089088	CCDS33420.1, CCDS42838.1	2q37.3	2008-05-22			ENSG00000142330	ENSG00000142330			1477	protein-coding gene	gene with protein product		605286				11017071, 11018080	Standard	NM_023083		Approved		uc002vzk.2	Q9HC96	OTTHUMG00000133358	ENST00000391984.2:c.1333G>A	2.37:g.241535790G>A	ENSP00000375844:p.Gly445Ser					CAPN10_uc002vzl.1_Intron|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Missense_Mutation_p.G317S|CAPN10_uc002vzo.1_RNA|CAPN10_uc010fzg.1_RNA|CAPN10_uc002vzp.1_RNA|CAPN10_uc002vzq.1_Intron	p.G445S	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)	8	1517	+		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	445			Domain III 1.		A8MVS7|Q4ZFV1|Q8NCD4|Q96IG4|Q96JI2|Q9HC89|Q9HC90|Q9HC91|Q9HC92|Q9HC93|Q9HC94|Q9HC95	Missense_Mutation	SNP	ENST00000391984.2	37	c.1333G>A	CCDS42838.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.241000	0.22711	.	.	ENSG00000142330	ENST00000391984;ENST00000404753	D;D	0.86694	-2.16;-2.16	4.14	4.14	0.48551	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.139523	0.49916	D	0.000139	D	0.82444	0.5038	N	0.12443	0.215	0.80722	D	1	P;P	0.50617	0.937;0.891	P;P	0.51415	0.605;0.669	D	0.85387	0.1123	10	0.56958	D	0.05	.	14.251	0.66019	0.0:0.0:1.0:0.0	.	445;445	B7WPF5;Q9HC96	.;CAN10_HUMAN	S	445	ENSP00000375844:G445S;ENSP00000384422:G445S	ENSP00000349556:G445S	G	+	1	0	CAPN10	241184463	1.000000	0.71417	0.788000	0.31933	0.265000	0.26407	4.098000	0.57748	2.014000	0.59158	0.563000	0.77884	GGC		0.667	CAPN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257191.3	NM_023083		6	69	0	0	0	0.001168	0	6	69				
GAL3ST2	64090	broad.mit.edu	37	2	242741367	242741367	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:242741367C>A	ENST00000192314.6	+	3	422	c.291C>A	c.(289-291)ctC>ctA	p.L97L	AC114730.5_ENST00000437438.1_RNA	NM_022134.2	NP_071417.2	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	97					biosynthetic process (GO:0009058)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)	p.L97L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|skin(1)	14		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		ACCCCTGGCTCTTCCTGGCGC	0.662																																							uc002wcj.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(289-291)CTC>CTA		galactose-3-O-sulfotransferase 2							49.0	47.0	48.0					2																	242741367		2202	4300	6502	SO:0001819	synonymous_variant	64090				biosynthetic process	Golgi cisterna membrane|integral to membrane	galactosylceramide sulfotransferase activity	g.chr2:242741367C>A	AB040610	CCDS33427.1	2q37.2	2014-05-19			ENSG00000154252	ENSG00000154252		"""Sulfotransferases, membrane-bound"""	24869	protein-coding gene	gene with protein product		608237				11029462	Standard	NM_022134		Approved	GP3ST	uc002wcj.1	Q9H3Q3	OTTHUMG00000151473	ENST00000192314.6:c.291C>A	2.37:g.242741367C>A							p.L97L	NM_022134	NP_071417	Q9H3Q3	G3ST2_HUMAN		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)	3	422	+		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)	97			Lumenal (Potential).		Q17RK0|Q57Z52	Silent	SNP	ENST00000192314.6	37	c.291C>A	CCDS33427.1																																																																																				0.662	GAL3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322792.1	NM_022134		11	47	1	0	0.000673444	0.008291	0.000778973	11	47				
SLC52A3	113278	broad.mit.edu	37	20	744476	744476	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:744476A>T	ENST00000217254.7	-	3	980	c.739T>A	c.(739-741)Tgc>Agc	p.C247S	SLC52A3_ENST00000381944.3_Missense_Mutation_p.C247S|SLC52A3_ENST00000473664.1_Intron	NM_033409.3	NP_212134.3	Q9NQ40	S52A3_HUMAN	solute carrier family 52 (riboflavin transporter), member 3	247					cellular response to heat (GO:0034605)|riboflavin metabolic process (GO:0006771)|riboflavin transport (GO:0032218)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	riboflavin transporter activity (GO:0032217)	p.C247S(1)									GCCTCCCAGCACCTGGGTTGA	0.617																																							uc002wed.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(739-741)TGC>AGC		hypothetical protein LOC113278 precursor							74.0	69.0	71.0					20																	744476		2203	4300	6503	SO:0001583	missense	113278				sensory perception of sound	integral to plasma membrane	riboflavin transporter activity	g.chr20:744476A>T	AL118502	CCDS13007.1	20p13	2013-07-17	2013-07-17	2012-02-29	ENSG00000101276	ENSG00000101276		"""Solute carriers"""	16187	protein-coding gene	gene with protein product	"""hypothetical protein LOC113278"""	613350	"""chromosome 20 open reading frame 54"""	C20orf54		11780052, 19122205	Standard	NM_033409		Approved	bA371L19.1, hRFT2, RFVT3	uc002wed.4	Q9NQ40	OTTHUMG00000031647	ENST00000217254.7:c.739T>A	20.37:g.744476A>T	ENSP00000217254:p.Cys247Ser					C20orf54_uc002wee.2_Missense_Mutation_p.C247S	p.C247S	NM_033409	NP_212134	Q9NQ40	RFT2_HUMAN			3	1078	-			247					A8K6P1|Q5W1A0|Q5W1A1|Q8NCL7|Q96GD5	Missense_Mutation	SNP	ENST00000217254.7	37	c.739T>A	CCDS13007.1	.	.	.	.	.	.	.	.	.	.	A	3.939	-0.014551	0.07681	.	.	ENSG00000101276	ENST00000217254;ENST00000381944	T;T	0.71341	-0.56;-0.56	4.95	-7.56	0.01322	.	2.229260	0.02193	N	0.061516	T	0.40767	0.1130	N	0.08118	0	0.09310	N	1	B;B	0.20052	0.041;0.013	B;B	0.13407	0.005;0.009	T	0.37009	-0.9724	10	0.09843	T	0.71	0.1058	3.9338	0.09298	0.1761:0.4368:0.2899:0.0973	.	247;247	Q9NQ40-2;Q9NQ40	.;RFT2_HUMAN	S	247	ENSP00000217254:C247S;ENSP00000371370:C247S	ENSP00000217254:C247S	C	-	1	0	C20orf54	692476	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	0.351000	0.20096	-1.182000	0.02727	-0.379000	0.06801	TGC		0.617	SLC52A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077482.2	NM_033409		10	52	0	0	0	0.008291	0	10	52				
TGM6	343641	broad.mit.edu	37	20	2384386	2384386	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:2384386A>G	ENST00000202625.2	+	9	1314	c.1253A>G	c.(1252-1254)aAg>aGg	p.K418R	TGM6_ENST00000381423.1_Missense_Mutation_p.K418R	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	418					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.K418R(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	TCAAACACGAAGAAGATTGGG	0.582																																							uc002wfy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1252-1254)AAG>AGG		transglutaminase 6	L-Glutamine(DB00130)						135.0	124.0	128.0					20																	2384386		2203	4300	6503	SO:0001583	missense	343641				cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr20:2384386A>G	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1253A>G	20.37:g.2384386A>G	ENSP00000202625:p.Lys418Arg					TGM6_uc010gal.1_Missense_Mutation_p.K418R	p.K418R	NM_198994	NP_945345	O95932	TGM3L_HUMAN			9	1314	+			418					Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	c.1253A>G	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	A	7.558	0.664034	0.14710	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	T;T	0.73363	-0.74;-0.74	4.84	4.84	0.62591	.	0.282464	0.38663	N	0.001605	T	0.62853	0.2462	L	0.38531	1.155	0.30087	N	0.808632	B;B	0.21147	0.052;0.004	B;B	0.19148	0.024;0.004	T	0.56038	-0.8045	10	0.18276	T	0.48	-35.87	12.7255	0.57168	1.0:0.0:0.0:0.0	.	418;418	O95932-2;O95932	.;TGM3L_HUMAN	R	418	ENSP00000202625:K418R;ENSP00000370831:K418R	ENSP00000202625:K418R	K	+	2	0	TGM6	2332386	0.000000	0.05858	0.993000	0.49108	0.619000	0.37552	0.463000	0.21972	2.180000	0.69256	0.449000	0.29647	AAG		0.582	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994		17	80	0	0	0	0.00499	0	17	80				
LAMP5	24141	broad.mit.edu	37	20	9496977	9496977	+	Silent	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:9496977G>C	ENST00000246070.2	+	4	936	c.444G>C	c.(442-444)tcG>tcC	p.S148S	LAMP5_ENST00000427562.2_Silent_p.S104S|RP5-1119D9.4_ENST00000443469.1_RNA	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	148						cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)		p.S148S(1)									ACGACTCCTCGGAGAAAACCC	0.572																																							uc002wni.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						c.(442-444)TCG>TCC		chromosome 20 open reading frame 103 precursor							83.0	75.0	78.0					20																	9496977		2203	4300	6503	SO:0001819	synonymous_variant	24141					integral to membrane		g.chr20:9496977G>C	AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.444G>C	20.37:g.9496977G>C						C20orf103_uc010zrc.1_Silent_p.S104S	p.S148S	NM_012261	NP_036393	Q9UJQ1	CT103_HUMAN	COAD - Colon adenocarcinoma(9;0.194)		4	673	+			148			Extracellular (Potential).		B4DHZ7|B7Z9Z9	Silent	SNP	ENST00000246070.2	37	c.444G>C	CCDS13106.1																																																																																				0.572	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077946.2	NM_012261		6	71	0	0	0	0.001984	0	6	71				
BTBD3	22903	broad.mit.edu	37	20	11898955	11898955	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:11898955G>T	ENST00000405977.1	+	2	657	c.32G>T	c.(31-33)tGt>tTt	p.C11F	BTBD3_ENST00000399006.2_Intron|BTBD3_ENST00000254977.3_Intron|BTBD3_ENST00000378226.2_Missense_Mutation_p.C11F|RP4-742J24.2_ENST00000439529.1_RNA	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	11					cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.C11F(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						AACATGAAATGTCTCACCTTC	0.408																																							uc002wnz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(31-33)TGT>TTT		BTB/POZ domain containing protein 3 isoform a							197.0	204.0	202.0					20																	11898955		2203	4300	6503	SO:0001583	missense	22903							g.chr20:11898955G>T	AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.32G>T	20.37:g.11898955G>T	ENSP00000384545:p.Cys11Phe					BTBD3_uc002wny.2_Intron|BTBD3_uc002woa.2_Intron|BTBD3_uc010zrf.1_Intron|BTBD3_uc010zrg.1_5'Flank|BTBD3_uc010zrh.1_5'Flank	p.C11F	NM_014962	NP_055777	Q9Y2F9	BTBD3_HUMAN			1	391	+			11					D3DW19|Q5JY73	Missense_Mutation	SNP	ENST00000405977.1	37	c.32G>T	CCDS13113.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341421	0.60963	.	.	ENSG00000132640	ENST00000405977;ENST00000378226	D;D	0.86865	-2.18;-2.18	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.91868	0.7426	L	0.46157	1.445	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	D	0.91553	0.5258	10	0.72032	D	0.01	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	11	Q9Y2F9	BTBD3_HUMAN	F	11	ENSP00000384545:C11F;ENSP00000367471:C11F	ENSP00000367471:C11F	C	+	2	0	BTBD3	11846955	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.872000	0.87187	2.941000	0.99782	0.655000	0.94253	TGT		0.408	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078021.3			56	246	1	0	6.75472e-32	0.00361	1.19539e-31	56	246				
SYNDIG1	79953	broad.mit.edu	37	20	24565510	24565510	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:24565510A>G	ENST00000376862.3	+	3	1132	c.499A>G	c.(499-501)Aca>Gca	p.T167A		NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	167					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)	p.T167A(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						CTCAAGCGACACAGAGAGTGA	0.562																																							uc002wtw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(499-501)ACA>GCA		transmembrane protein 90B							140.0	132.0	135.0					20																	24565510		2203	4300	6503	SO:0001583	missense	79953				response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane		g.chr20:24565510A>G	AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.499A>G	20.37:g.24565510A>G	ENSP00000366058:p.Thr167Ala						p.T167A	NM_024893	NP_079169	Q9H7V2	SYNG1_HUMAN			3	1132	+			167			Cytoplasmic (Potential).		Q6IA30|Q9H514	Missense_Mutation	SNP	ENST00000376862.3	37	c.499A>G	CCDS13164.1	.	.	.	.	.	.	.	.	.	.	A	13.58	2.278997	0.40294	.	.	ENSG00000101463	ENST00000376862	D	0.90620	-2.7	5.1	5.1	0.69264	.	0.078921	0.52532	D	0.000063	D	0.88746	0.6520	L	0.47716	1.5	0.41539	D	0.988501	P	0.47762	0.9	P	0.45538	0.484	D	0.89491	0.3757	10	0.56958	D	0.05	-16.4836	12.8475	0.57837	1.0:0.0:0.0:0.0	.	167	Q9H7V2	SYNG1_HUMAN	A	167	ENSP00000366058:T167A	ENSP00000366058:T167A	T	+	1	0	SYNDIG1	24513510	0.992000	0.36948	0.997000	0.53966	0.670000	0.39368	3.706000	0.54830	1.930000	0.55929	0.459000	0.35465	ACA		0.562	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078376.1	NM_024893		19	123	0	0	0	0.010504	0	19	123				
HCK	3055	broad.mit.edu	37	20	30662469	30662469	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:30662469G>T	ENST00000520553.1	+	5	556	c.310G>T	c.(310-312)Gag>Tag	p.E104*	HCK_ENST00000534862.1_Nonsense_Mutation_p.E105*|HCK_ENST00000375862.2_Nonsense_Mutation_p.E124*|HCK_ENST00000375852.2_Nonsense_Mutation_p.E125*|HCK_ENST00000538448.1_Nonsense_Mutation_p.E104*|HCK_ENST00000518730.1_Nonsense_Mutation_p.E103*	NM_001172129.1|NM_001172130.1|NM_001172131.1|NM_002110.3	NP_001165600.1|NP_001165601.1|NP_001165602.1|NP_002101.2	P08631	HCK_HUMAN	HCK proto-oncogene, Src family tyrosine kinase	125	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|innate immune response-activating signal transduction (GO:0002758)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte degranulation (GO:0043299)|leukocyte migration involved in immune response (GO:0002522)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|regulation of inflammatory response (GO:0050727)|regulation of phagocytosis (GO:0050764)|regulation of podosome assembly (GO:0071801)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|respiratory burst after phagocytosis (GO:0045728)|viral process (GO:0016032)	caveola (GO:0005901)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.E125*(1)|p.E104*(1)		NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(4)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		Bosutinib(DB06616)	CACCCGGAAGGAGGGCTACAT	0.542																																							uc002wxh.2		NA																	2	Substitution - Nonsense(2)		lung(2)	lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9						c.(373-375)GAG>TAG		hemopoietic cell kinase isoform p61HCK							126.0	122.0	123.0					20																	30662469		2203	4300	6503	SO:0001587	stop_gained	3055				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr20:30662469G>T	AK026432	CCDS33460.1, CCDS54453.1, CCDS54455.1, CCDS54456.1	20q11-q12	2014-06-25	2014-06-25		ENSG00000101336	ENSG00000101336		"""SH2 domain containing"""	4840	protein-coding gene	gene with protein product		142370	"""hemopoietic cell kinase"""			3496523	Standard	NM_002110		Approved	JTK9	uc002wxh.3	P08631	OTTHUMG00000032204	ENST00000520553.1:c.310G>T	20.37:g.30662469G>T	ENSP00000429848:p.Glu104*					HCK_uc010gdy.2_Nonsense_Mutation_p.E104*|HCK_uc002wxi.2_Nonsense_Mutation_p.E103*	p.E125*	NM_002110	NP_002101	P08631	HCK_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		5	544	+			125			SH3.		A8K1I1|B4DQB6|E1P5M2|Q29RX1|Q2VPE2|Q504R5|Q5T7K1|Q5T7K2|Q96CC0|Q9H5Y5|Q9NUA4|Q9UMJ5	Nonsense_Mutation	SNP	ENST00000520553.1	37	c.373G>T	CCDS54455.1	.	.	.	.	.	.	.	.	.	.	G	38	6.792713	0.97841	.	.	ENSG00000101336	ENST00000534862;ENST00000538448;ENST00000375862;ENST00000520553;ENST00000518730;ENST00000375852	.	.	.	4.98	4.98	0.66077	.	0.062020	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	12.8704	0.57962	0.0811:0.0:0.9189:0.0	.	.	.	.	X	105;104;124;104;103;125	.	ENSP00000365012:E125X	E	+	1	0	HCK	30126130	1.000000	0.71417	0.991000	0.47740	0.943000	0.58893	7.803000	0.85983	2.584000	0.87258	0.563000	0.77884	GAG		0.542	HCK-006	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000375751.1			14	102	1	0	0.000422831	0.004007	0.000498337	14	102				
BPIFB6	128859	broad.mit.edu	37	20	31622623	31622623	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:31622623C>G	ENST00000349552.1	+	4	357	c.357C>G	c.(355-357)aaC>aaG	p.N119K		NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6	119						extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.N119K(1)									CAGCCACCAACCGGCTTCTGC	0.577																																							uc010zuc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(355-357)AAC>AAG		bactericidal/permeability-increasing							95.0	74.0	81.0					20																	31622623		2203	4300	6503	SO:0001583	missense	128859					extracellular region	lipid binding	g.chr20:31622623C>G	AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.357C>G	20.37:g.31622623C>G	ENSP00000344929:p.Asn119Lys					BPIL3_uc010zud.1_Missense_Mutation_p.N58K	p.N119K	NM_174897	NP_777557	Q8NFQ5	BPIL3_HUMAN			4	357	+			119						Missense_Mutation	SNP	ENST00000349552.1	37	c.357C>G	CCDS13211.1	.	.	.	.	.	.	.	.	.	.	C	9.908	1.208677	0.22205	.	.	ENSG00000167104	ENST00000349552	T	0.05447	3.44	4.21	2.14	0.27477	.	0.322040	0.26190	N	0.025808	T	0.05273	0.0140	L	0.51422	1.61	0.25871	N	0.983705	P	0.38677	0.642	B	0.37780	0.258	T	0.19160	-1.0314	10	0.06099	T	0.92	.	7.5613	0.27853	0.0:0.7747:0.0:0.2253	.	119	Q8NFQ5	BPIB6_HUMAN	K	119	ENSP00000344929:N119K	ENSP00000344929:N119K	N	+	3	2	BPIFB6	31086284	0.997000	0.39634	1.000000	0.80357	0.647000	0.38526	0.778000	0.26732	0.846000	0.35142	0.511000	0.50034	AAC		0.577	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078658.2	NM_174897		26	69	0	0	0	0.00632	0	26	69				
GDF5	8200	broad.mit.edu	37	20	34022074	34022074	+	Missense_Mutation	SNP	C	C	T	rs397514668		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:34022074C>T	ENST00000374372.1	-	4	1642	c.1139G>A	c.(1138-1140)cGg>cAg	p.R380Q	GDF5OS_ENST00000374375.1_Missense_Mutation_p.R40C|GDF5_ENST00000374369.3_Missense_Mutation_p.R380Q			P43026	GDF5_HUMAN	growth differentiation factor 5	380			R -> Q (in BDA2; reduces activity; impairs processing). {ECO:0000269|PubMed:18203755}.		cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)	p.R40C(2)|p.R380Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			TGGGGCCCGCCGTTTTCGCCG	0.582																																							uc002xck.1		NA																	3	Substitution - Missense(3)		lung(3)		0	GRCh37	CM081281	GDF5	M		c.(1138-1140)CGG>CAG		growth differentiation factor 5 preproprotein							87.0	92.0	91.0					20																	34022074		2202	4294	6496	SO:0001583	missense	8200				cartilage development|cell-cell signaling|growth|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity	g.chr20:34022074C>T	X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.1139G>A	20.37:g.34022074C>T	ENSP00000363492:p.Arg380Gln					GDF5_uc010gfc.1_Missense_Mutation_p.R380Q|uc002xcj.2_Missense_Mutation_p.P162L|GDF5_uc010zvc.1_Missense_Mutation_p.R380Q	p.R380Q	NM_000557	NP_000548	P43026	GDF5_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00663)		2	1458	-	Lung NSC(9;0.00642)|all_lung(11;0.0094)		380		R -> Q (in BDA2; reduces activity; impairs processing).			E1P5Q2|Q96SB1	Missense_Mutation	SNP	ENST00000374372.1	37	c.1139G>A	CCDS13254.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.6|24.6	4.549374|4.549374	0.86127|0.86127	.|.	.|.	ENSG00000204183|ENSG00000125965	ENST00000374375|ENST00000374369;ENST00000374372	.|D;D	.|0.81659	.|-1.52;-1.52	4.27|4.27	4.27|4.27	0.50696|0.50696	.|Transforming growth factor-beta, C-terminal (1);	0.000000|0.000000	0.64402|0.64402	D|D	0.000001|0.000001	D|D	0.84338|0.84338	0.5450|0.5450	L|L	0.32530|0.32530	0.975|0.975	0.52501|0.52501	D|D	0.999951|0.999951	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.71414	.|0.973;0.964	D|D	0.86732|0.86732	0.1949|0.1949	7|10	0.87932|0.72032	D|D	0|0.01	.|.	16.8865|16.8865	0.86077|0.86077	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|380;380	.|F1T0J1;P43026	.|.;GDF5_HUMAN	C|Q	40|380	.|ENSP00000363489:R380Q;ENSP00000363492:R380Q	ENSP00000363495:R40C|ENSP00000363489:R380Q	R|R	+|-	1|2	0|0	GDF5OS|GDF5	33485488|33485488	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.918000|0.918000	0.54935|0.54935	5.932000|5.932000	0.70121|0.70121	2.201000|2.201000	0.70794|0.70794	0.313000|0.313000	0.20887|0.20887	CGT|CGG		0.582	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2			52	123	0	0	0	0.00361	0	52	123				
ZSWIM3	140831	broad.mit.edu	37	20	44505598	44505598	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:44505598C>T	ENST00000255152.2	+	2	610	c.401C>T	c.(400-402)aCc>aTc	p.T134I	ZSWIM3_ENST00000454862.2_Missense_Mutation_p.T128I	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	134							zinc ion binding (GO:0008270)	p.T134I(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				CAGCCCACAACCAAAAAAGAC	0.502																																							uc002xqd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(400-402)ACC>ATC		zinc finger, SWIM domain containing 3							69.0	66.0	67.0					20																	44505598		2203	4300	6503	SO:0001583	missense	140831						zinc ion binding	g.chr20:44505598C>T	AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.401C>T	20.37:g.44505598C>T	ENSP00000255152:p.Thr134Ile					ZSWIM3_uc010zxg.1_Missense_Mutation_p.T128I	p.T134I	NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN			2	604	+		Myeloproliferative disorder(115;0.0122)	134					Q9BR13	Missense_Mutation	SNP	ENST00000255152.2	37	c.401C>T	CCDS13381.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.792169	0.00077	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.22336	1.96;1.96	4.95	-7.99	0.01131	.	2.246270	0.01322	N	0.010969	T	0.09468	0.0233	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20739	-1.0266	10	0.33940	T	0.23	0.9048	11.305	0.49329	0.0:0.4717:0.268:0.2603	.	128;134	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	I	134;128	ENSP00000255152:T134I;ENSP00000406313:T128I	ENSP00000255152:T134I	T	+	2	0	ZSWIM3	43939005	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.158000	0.03153	-2.263000	0.00689	-2.504000	0.00190	ACC		0.502	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752		8	40	0	0	0	0.00308	0	8	40				
ZMYND8	23613	broad.mit.edu	37	20	45905216	45905216	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:45905216C>A	ENST00000311275.7	-	11	1515	c.1262G>T	c.(1261-1263)gGc>gTc	p.G421V	ZMYND8_ENST00000471951.2_Missense_Mutation_p.G441V|ZMYND8_ENST00000352431.2_Missense_Mutation_p.G441V|ZMYND8_ENST00000355972.4_Missense_Mutation_p.G421V|ZMYND8_ENST00000360911.3_Missense_Mutation_p.G416V|ZMYND8_ENST00000536340.1_Missense_Mutation_p.G448V|ZMYND8_ENST00000461685.1_Missense_Mutation_p.G441V|ZMYND8_ENST00000540497.1_Missense_Mutation_p.G416V|ZMYND8_ENST00000458360.2_Missense_Mutation_p.G416V|ZMYND8_ENST00000396281.4_Missense_Mutation_p.G421V|ZMYND8_ENST00000446994.2_Missense_Mutation_p.G358V|ZMYND8_ENST00000262975.4_Missense_Mutation_p.G421V|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000372023.3_Missense_Mutation_p.G416V	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	421					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)	p.G441V(1)		NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			AATCCGGCGGCCTGTGCCCCC	0.577																																							uc002xta.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5						c.(1261-1263)GGC>GTC		zinc finger, MYND-type containing 8 isoform b							90.0	78.0	82.0					20																	45905216		2203	4300	6503	SO:0001583	missense	23613						protein binding|zinc ion binding	g.chr20:45905216C>A	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.1262G>T	20.37:g.45905216C>A	ENSP00000312237:p.Gly421Val					ZMYND8_uc010ghq.1_Missense_Mutation_p.G98V|ZMYND8_uc010ghr.1_Missense_Mutation_p.G396V|ZMYND8_uc002xst.1_Missense_Mutation_p.G396V|ZMYND8_uc002xsu.1_Missense_Mutation_p.G421V|ZMYND8_uc002xsv.1_Missense_Mutation_p.G396V|ZMYND8_uc002xsw.1_Missense_Mutation_p.G173V|ZMYND8_uc002xsx.1_Missense_Mutation_p.G173V|ZMYND8_uc002xsy.1_Missense_Mutation_p.G396V|ZMYND8_uc002xsz.1_Missense_Mutation_p.G358V|ZMYND8_uc010zxy.1_Missense_Mutation_p.G448V|ZMYND8_uc002xtb.1_Missense_Mutation_p.G441V|ZMYND8_uc002xss.2_Missense_Mutation_p.G421V|ZMYND8_uc010zxz.1_Missense_Mutation_p.G416V|ZMYND8_uc002xtc.1_Missense_Mutation_p.G441V|ZMYND8_uc002xtd.1_Missense_Mutation_p.G416V|ZMYND8_uc002xte.1_Missense_Mutation_p.G421V|ZMYND8_uc010zya.1_Missense_Mutation_p.G421V|ZMYND8_uc002xtf.1_Missense_Mutation_p.G441V|ZMYND8_uc002xtg.2_Missense_Mutation_p.G415V|ZMYND8_uc010ghs.1_Missense_Mutation_p.G415V	p.G421V	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)		11	1516	-			421					B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	ENST00000311275.7	37	c.1262G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.10|17.10	3.303124|3.303124	0.60195|0.60195	.|.	.|.	ENSG00000101040|ENSG00000101040	ENST00000360911;ENST00000311275;ENST00000458360;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497|ENST00000467200	D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.92348|.	-2.12;-1.98;-2.1;-2.03;-2.0;-2.01;-2.1;-2.0;-1.99;-3.02;-2.04;-2.13;-1.84|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.050641|.	0.85682|.	D|.	0.000000|.	T|T	0.73048|0.73048	0.3537|0.3537	L|L	0.58101|0.58101	1.795|1.795	0.80722|0.80722	D|D	1|1	P;P;D;D;D;D;B;P;D;B;P;D;D;D;P;D;D;P|.	0.76494|.	0.786;0.951;0.958;0.999;0.999;0.999;0.317;0.948;0.984;0.199;0.948;0.958;0.999;0.999;0.928;0.992;0.998;0.928|.	P;P;P;D;D;D;B;P;P;B;P;P;D;D;P;P;D;P|.	0.76071|.	0.696;0.743;0.904;0.987;0.973;0.987;0.196;0.844;0.763;0.196;0.844;0.904;0.987;0.987;0.862;0.9;0.96;0.862|.	T|T	0.69756|0.69756	-0.5059|-0.5059	10|5	0.72032|.	D|.	0.01|.	-17.1093|-17.1093	19.451|19.451	0.94867|0.94867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	416;448;416;416;396;415;441;421;416;441;441;421;358;416;416;441;416;421|.	B7ZM62;F5H0X3;Q2HXV7;Q2HXV3;Q5TH11;Q5JV90;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q9ULU4-8;Q2HXV4;B7Z2A8|.	.;.;.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.;.|.	V|S	416;421;416;421;441;441;421;448;421;358;441;416;416|347	ENSP00000354166:G416V;ENSP00000312237:G421V;ENSP00000392964:G416V;ENSP00000262975:G421V;ENSP00000420095:G441V;ENSP00000335537:G441V;ENSP00000379577:G421V;ENSP00000439800:G448V;ENSP00000348246:G421V;ENSP00000396725:G358V;ENSP00000418210:G441V;ENSP00000361093:G416V;ENSP00000443086:G416V|.	ENSP00000262975:G421V|.	G|R	-|-	2|3	0|2	ZMYND8|ZMYND8	45338623|45338623	1.000000|1.000000	0.71417|0.71417	0.920000|0.920000	0.36463|0.36463	0.052000|0.052000	0.14988|0.14988	3.955000|3.955000	0.56715|0.56715	2.593000|2.593000	0.87608|0.87608	0.655000|0.655000	0.94253|0.94253	GGC|AGG		0.577	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	NM_183047		9	87	1	0	0.000978159	0.000978	0.00112448	9	87				
ZMYND8	23613	broad.mit.edu	37	20	45918993	45918993	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:45918993C>A	ENST00000311275.7	-	7	879	c.626G>T	c.(625-627)tGc>tTc	p.C209F	ZMYND8_ENST00000471951.2_Missense_Mutation_p.C229F|ZMYND8_ENST00000352431.2_Missense_Mutation_p.C229F|ZMYND8_ENST00000355972.4_Missense_Mutation_p.C209F|ZMYND8_ENST00000360911.3_Missense_Mutation_p.C204F|ZMYND8_ENST00000536340.1_Missense_Mutation_p.C236F|ZMYND8_ENST00000461685.1_Missense_Mutation_p.C229F|ZMYND8_ENST00000540497.1_Missense_Mutation_p.C204F|ZMYND8_ENST00000458360.2_Missense_Mutation_p.C204F|ZMYND8_ENST00000396281.4_Missense_Mutation_p.C209F|ZMYND8_ENST00000446994.2_Missense_Mutation_p.C146F|ZMYND8_ENST00000262975.4_Missense_Mutation_p.C209F|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000372023.3_Missense_Mutation_p.C204F	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	209	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)	p.C229F(1)		NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			GGCTTCTGTGCAGCCATACAT	0.453																																							uc002xta.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5						c.(625-627)TGC>TTC		zinc finger, MYND-type containing 8 isoform b							114.0	95.0	101.0					20																	45918993		2203	4300	6503	SO:0001583	missense	23613						protein binding|zinc ion binding	g.chr20:45918993C>A	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.626G>T	20.37:g.45918993C>A	ENSP00000312237:p.Cys209Phe					ZMYND8_uc010ghr.1_Missense_Mutation_p.C184F|ZMYND8_uc002xst.1_Missense_Mutation_p.C184F|ZMYND8_uc002xsu.1_Missense_Mutation_p.C209F|ZMYND8_uc002xsv.1_Missense_Mutation_p.C184F|ZMYND8_uc002xsw.1_5'UTR|ZMYND8_uc002xsx.1_5'UTR|ZMYND8_uc002xsy.1_Missense_Mutation_p.C184F|ZMYND8_uc002xsz.1_Missense_Mutation_p.C146F|ZMYND8_uc010zxy.1_Missense_Mutation_p.C236F|ZMYND8_uc002xtb.1_Missense_Mutation_p.C229F|ZMYND8_uc002xss.2_Missense_Mutation_p.C209F|ZMYND8_uc010zxz.1_Missense_Mutation_p.C204F|ZMYND8_uc002xtc.1_Missense_Mutation_p.C229F|ZMYND8_uc002xtd.1_Missense_Mutation_p.C204F|ZMYND8_uc002xte.1_Missense_Mutation_p.C209F|ZMYND8_uc010zya.1_Missense_Mutation_p.C209F|ZMYND8_uc002xtf.1_Missense_Mutation_p.C229F|ZMYND8_uc002xtg.2_Missense_Mutation_p.C203F|ZMYND8_uc010ghs.1_Missense_Mutation_p.C203F	p.C209F	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)		7	880	-			209			Bromo.		B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	ENST00000311275.7	37	c.626G>T		.	.	.	.	.	.	.	.	.	.	C	16.94	3.261105	0.59431	.	.	ENSG00000101040	ENST00000360911;ENST00000311275;ENST00000458360;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497	T;T;T;T;T;T;T;T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22	6.16	6.16	0.99307	Bromodomain (5);	0.090927	0.85682	D	0.000000	T	0.32133	0.0819	L	0.31065	0.9	0.53688	D	0.999977	P;B;P;B;P;B;B;B;B;B;B;B;B;B;P;B;B	0.49447	0.599;0.082;0.924;0.399;0.553;0.106;0.167;0.082;0.055;0.167;0.201;0.399;0.118;0.107;0.731;0.1;0.1	P;B;P;P;P;B;B;B;B;B;B;P;B;B;B;B;B	0.61070	0.472;0.096;0.883;0.466;0.466;0.061;0.098;0.061;0.061;0.138;0.217;0.466;0.158;0.155;0.444;0.102;0.155	T	0.00708	-1.1600	10	0.87932	D	0	-15.32	20.8598	0.99761	0.0:1.0:0.0:0.0	.	204;236;204;204;203;229;209;204;229;229;209;146;204;204;229;204;209	B7ZM62;F5H0X3;Q2HXV7;Q2HXV3;Q5JV90;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q9ULU4-8;Q2HXV4;B7Z2A8	.;.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.;.	F	204;209;204;209;229;229;209;236;209;146;229;204;204	ENSP00000354166:C204F;ENSP00000312237:C209F;ENSP00000392964:C204F;ENSP00000262975:C209F;ENSP00000420095:C229F;ENSP00000335537:C229F;ENSP00000379577:C209F;ENSP00000439800:C236F;ENSP00000348246:C209F;ENSP00000396725:C146F;ENSP00000418210:C229F;ENSP00000361093:C204F;ENSP00000443086:C204F	ENSP00000262975:C209F	C	-	2	0	ZMYND8	45352400	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.698000	0.68302	2.937000	0.99478	0.650000	0.86243	TGC		0.453	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	NM_183047		12	83	1	0	0.00010058	0.001368	0.000121606	12	83				
PREX1	57580	broad.mit.edu	37	20	47268039	47268039	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:47268039G>T	ENST00000371941.3	-	22	2572	c.2550C>A	c.(2548-2550)caC>caA	p.H850Q	PREX1_ENST00000396220.1_Missense_Mutation_p.H850Q	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	850					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H850Q(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CGTGTTCCAGGTGCACGTTGT	0.632																																							uc002xtw.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|ovary(2)|pancreas(1)	6						c.(2548-2550)CAC>CAA		phosphatidylinositol-3,4,							83.0	69.0	74.0					20																	47268039		2203	4300	6503	SO:0001583	missense	57580				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr20:47268039G>T	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2550C>A	20.37:g.47268039G>T	ENSP00000361009:p.His850Gln					PREX1_uc002xtv.1_Missense_Mutation_p.H147Q	p.H850Q	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)		22	2573	-			850					E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	c.2550C>A	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.936415	0.34189	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.40225	1.04;1.04	4.71	1.67	0.24075	.	0.209202	0.32548	U	0.005953	T	0.29028	0.0721	L	0.41236	1.265	0.39329	D	0.965385	B;B	0.21452	0.056;0.038	B;B	0.25291	0.019;0.059	T	0.09596	-1.0667	10	0.54805	T	0.06	.	3.3048	0.06996	0.1501:0.1357:0.5739:0.1403	.	850;147	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	Q	850	ENSP00000361009:H850Q;ENSP00000379522:H850Q	ENSP00000361009:H850Q	H	-	3	2	PREX1	46701446	0.999000	0.42202	0.695000	0.30226	0.987000	0.75469	0.529000	0.23019	0.081000	0.16988	-0.244000	0.11960	CAC		0.632	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		22	47	1	0	9.86323e-18	0.003954	1.64192e-17	22	47				
ARFGEF2	10564	broad.mit.edu	37	20	47592674	47592674	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:47592674T>A	ENST00000371917.4	+	14	1896	c.1896T>A	c.(1894-1896)gaT>gaA	p.D632E		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	632					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)	p.D632E(1)		breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			CTGTTCAGGATGACCCTGAGC	0.512																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)	Esophageal Squamous(176;1738 1974 26285 33069 35354)	uc002xtx.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|upper_aerodigestive_tract(1)	4						c.(1894-1896)GAT>GAA		ADP-ribosylation factor guanine							107.0	79.0	88.0					20																	47592674		2203	4300	6503	SO:0001583	missense	10564				exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity	g.chr20:47592674T>A	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.1896T>A	20.37:g.47592674T>A	ENSP00000360985:p.Asp632Glu						p.D632E	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)		14	2048	+			632					Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	37	c.1896T>A	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	T	19.37	3.813968	0.70912	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.26810	1.71	5.79	1.13	0.20643	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.35595	0.0937	M	0.81341	2.54	0.58432	D	0.999999	P	0.50066	0.931	P	0.48089	0.566	T	0.28170	-1.0052	10	0.87932	D	0	.	9.4115	0.38494	0.0:0.2659:0.0:0.7341	.	632	Q9Y6D5	BIG2_HUMAN	E	632	ENSP00000360985:D632E	ENSP00000360985:D632E	D	+	3	2	ARFGEF2	47026081	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	1.324000	0.33712	0.130000	0.18549	-0.274000	0.10170	GAT		0.512	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420		5	31	0	0	0	0.000602	0	5	31				
ZNF831	128611	broad.mit.edu	37	20	57829409	57829409	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:57829409T>A	ENST00000371030.2	+	5	4645	c.4645T>A	c.(4645-4647)Tct>Act	p.S1549T		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1549							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.S1549T(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GAGACCTTCATCTGGACAAAG	0.498																																							uc002yan.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(13)|ovary(1)	14						c.(4645-4647)TCT>ACT		zinc finger protein 831							40.0	43.0	42.0					20																	57829409		1977	4173	6150	SO:0001583	missense	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57829409T>A	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4645T>A	20.37:g.57829409T>A	ENSP00000360069:p.Ser1549Thr						p.S1549T	NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN			5	4645	+	all_lung(29;0.0085)		1549					Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	c.4645T>A	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	T	7.872	0.728284	0.15507	.	.	ENSG00000124203	ENST00000371030	T	0.06528	3.29	5.66	-0.92	0.10475	.	0.472817	0.19983	N	0.101731	T	0.08447	0.0210	L	0.56769	1.78	0.09310	N	1	P	0.52463	0.953	P	0.50109	0.631	T	0.24693	-1.0153	10	0.25751	T	0.34	-0.4819	4.6082	0.12389	0.0:0.2852:0.3105:0.4042	.	1549	Q5JPB2	ZN831_HUMAN	T	1549	ENSP00000360069:S1549T	ENSP00000360069:S1549T	S	+	1	0	ZNF831	57262804	0.000000	0.05858	0.004000	0.12327	0.142000	0.21351	-0.184000	0.09698	-0.437000	0.07243	-0.323000	0.08544	TCT		0.498	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		11	44	0	0	0	0.008291	0	11	44				
EDN3	1908	broad.mit.edu	37	20	57896227	57896227	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:57896227C>A	ENST00000337938.2	+	3	907	c.521C>A	c.(520-522)aCc>aAc	p.T174N	EDN3_ENST00000395654.3_Missense_Mutation_p.T174N|EDN3_ENST00000371028.2_Missense_Mutation_p.T174N|EDN3_ENST00000311585.7_Missense_Mutation_p.T174N|EDN3_ENST00000371025.3_Missense_Mutation_p.T174N	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	174					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)	p.T174N(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					CACTTTTGCACCCAAACTCTG	0.567																																							uc002yap.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(520-522)ACC>AAC		endothelin 3 isoform 1 preproprotein							127.0	118.0	121.0					20																	57896227		2203	4300	6503	SO:0001583	missense	1908				cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity	g.chr20:57896227C>A	X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.521C>A	20.37:g.57896227C>A	ENSP00000337128:p.Thr174Asn					EDN3_uc002yao.1_Missense_Mutation_p.T174N|EDN3_uc002yaq.2_Missense_Mutation_p.T174N|EDN3_uc002yar.2_Missense_Mutation_p.T174N|EDN3_uc002yas.2_Missense_Mutation_p.T174N	p.T174N	NM_000114	NP_000105	P14138	EDN3_HUMAN			3	890	+	all_lung(29;0.0115)		174					E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Missense_Mutation	SNP	ENST00000337938.2	37	c.521C>A	CCDS13477.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.382665	0.25031	.	.	ENSG00000124205	ENST00000337938;ENST00000311585;ENST00000371028;ENST00000371025;ENST00000395654	D;D;D;D;D	0.95238	-2.19;-2.19;-2.19;-3.65;-2.15	4.75	2.76	0.32466	Endothelin-like toxin (1);	0.851172	0.10028	N	0.725173	D	0.94241	0.8151	L	0.50333	1.59	0.09310	N	1	D;P;P;P	0.53462	0.96;0.937;0.93;0.872	P;B;P;B	0.53954	0.738;0.405;0.451;0.424	D	0.85443	0.1156	10	0.23302	T	0.38	-10.4375	11.6588	0.51334	0.0:0.6553:0.3447:0.0	.	174;174;174;174	P14138-2;Q7Z6D2;P14138;Q4FAT2	.;.;EDN3_HUMAN;.	N	174	ENSP00000337128:T174N;ENSP00000311854:T174N;ENSP00000360067:T174N;ENSP00000360064:T174N;ENSP00000379015:T174N	ENSP00000311854:T174N	T	+	2	0	EDN3	57329622	0.004000	0.15560	0.006000	0.13384	0.385000	0.30292	1.324000	0.33712	0.508000	0.28173	-0.314000	0.08810	ACC		0.567	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079919.2	NM_000114		7	121	1	0	1.12685e-05	0.004482	1.47015e-05	7	121				
C20orf195	79025	broad.mit.edu	37	20	62187726	62187726	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr20:62187726C>A	ENST00000370098.3	+	2	802	c.710C>A	c.(709-711)tCg>tAg	p.S237*	C20orf195_ENST00000370097.1_Nonsense_Mutation_p.S237*	NM_024059.2	NP_076964.1	Q9BVV2	CT195_HUMAN	chromosome 20 open reading frame 195	237	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular vesicular exosome (GO:0070062)		p.S237*(1)		large_intestine(3)|lung(4)	7	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			CCAGCCACATCGGAGCAGTAT	0.652																																							uc002yfj.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(709-711)TCG>TAG		hypothetical protein LOC79025							92.0	93.0	93.0					20																	62187726		2203	4299	6502	SO:0001587	stop_gained	79025							g.chr20:62187726C>A		CCDS13526.1	20q13.33	2014-02-12			ENSG00000125531	ENSG00000125531			28764	protein-coding gene	gene with protein product						12477932	Standard	NM_024059		Approved	MGC5356	uc002yfj.3	Q9BVV2	OTTHUMG00000032980	ENST00000370098.3:c.710C>A	20.37:g.62187726C>A	ENSP00000359116:p.Ser237*					C20orf195_uc002yfk.2_Nonsense_Mutation_p.S237*	p.S237*	NM_024059	NP_076964	Q9BVV2	CT195_HUMAN	Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)		2	802	+	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		237						Nonsense_Mutation	SNP	ENST00000370098.3	37	c.710C>A	CCDS13526.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.034281	0.35893	.	.	ENSG00000125531	ENST00000370098;ENST00000370097	.	.	.	5.31	4.37	0.52481	.	0.277845	0.26400	N	0.024595	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-26.8409	5.5426	0.17045	0.1759:0.6582:0.0:0.1659	.	.	.	.	X	237	.	ENSP00000359115:S237X	S	+	2	0	C20orf195	61658170	0.000000	0.05858	0.011000	0.14972	0.002000	0.02628	0.195000	0.17155	2.496000	0.84212	0.655000	0.94253	TCG		0.652	C20orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080155.1	NM_024059		43	136	1	0	8.20599e-20	0.002852	1.39926e-19	43	136				
TPTE	7179	broad.mit.edu	37	21	10934071	10934071	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr21:10934071G>T	ENST00000361285.4	-	16	1235	c.906C>A	c.(904-906)atC>atA	p.I302I	TPTE_ENST00000342420.5_Silent_p.I264I|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Silent_p.I284I	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	302	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.I284I(1)|p.I302I(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CATCAATCATGATTCTAACGA	0.313																																							uc002yip.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(904-906)ATC>ATA		transmembrane phosphatase with tensin homology							188.0	191.0	190.0					21																	10934071		2203	4300	6503	SO:0001819	synonymous_variant	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10934071G>T	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.906C>A	21.37:g.10934071G>T						TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Silent_p.I284I|TPTE_uc002yir.1_Silent_p.I264I|TPTE_uc010gkv.1_Silent_p.I164I	p.I302I	NM_199261	NP_954870	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	16	1274	-			302			Phosphatase tensin-type.		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Silent	SNP	ENST00000361285.4	37	c.906C>A	CCDS13560.2																																																																																				0.313	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			16	291	1	0	7.07596e-05	0.006122	8.66728e-05	16	291				
KRTAP6-2	337967	broad.mit.edu	37	21	31971137	31971137	+	Silent	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr21:31971137T>A	ENST00000334897.3	-	1	82	c.57A>T	c.(55-57)ggA>ggT	p.G19G	KRTAP22-1_ENST00000334680.2_5'Flank	NM_181604.1	NP_853635.1	Q3LI66	KRA62_HUMAN	keratin associated protein 6-2	19						intermediate filament (GO:0005882)		p.G19G(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(4)	11						GGCCTTCGTATCCACAGCACC	0.567																																							uc011adc.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(55-57)GGA>GGT		keratin associated protein 6-2							197.0	160.0	173.0					21																	31971137		2203	4300	6503	SO:0001819	synonymous_variant	337967					intermediate filament		g.chr21:31971137T>A	AP001708	CCDS13600.1	21q22.1	2011-02-10			ENSG00000186930	ENSG00000186930		"""Keratin associated proteins"""	18932	protein-coding gene	gene with protein product						12359730	Standard	NM_181604		Approved	KAP6.2	uc011adc.2	Q3LI66	OTTHUMG00000057794	ENST00000334897.3:c.57A>T	21.37:g.31971137T>A						KRTAP22-1_uc011add.1_5'Flank	p.G19G	NM_181604	NP_853635	Q3LI66	KRA62_HUMAN			1	57	-			19						Silent	SNP	ENST00000334897.3	37	c.57A>T	CCDS13600.1																																																																																				0.567	KRTAP6-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128246.3			9	70	0	0	0	0.008291	0	9	70				
ITSN1	6453	broad.mit.edu	37	21	35229038	35229038	+	Splice_Site	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr21:35229038A>T	ENST00000381318.3	+	30	3949		c.e30-1		ITSN1_ENST00000437442.2_Splice_Site|ITSN1_ENST00000381285.4_Splice_Site|ITSN1_ENST00000399367.3_Splice_Site|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000399326.3_Splice_Site	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)						apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.?(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						TGTGTTTTCCAGGGTGTTCAG	0.502																																							uc002yta.1		NA																	1	Unknown(1)		lung(1)	ovary(3)|skin(1)	4						c.e30-2		intersectin 1 isoform ITSN-l							126.0	105.0	112.0					21																	35229038		2203	4300	6503	SO:0001630	splice_region_variant	6453				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity	g.chr21:35229038A>T	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.3662-1A>T	21.37:g.35229038A>T						DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Splice_Site_p.W1216_splice|ITSN1_uc002ytj.2_Splice_Site_p.W1216_splice|ITSN1_uc010gmm.1_Splice_Site|ITSN1_uc002yti.1_Splice_Site	p.W1221_splice	NM_003024	NP_003015	Q15811	ITSN1_HUMAN			30	3930	+								A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Splice_Site	SNP	ENST00000381318.3	37	c.3662_splice	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.481899	0.84747	.	.	ENSG00000205726	ENST00000381318;ENST00000381285;ENST00000381288;ENST00000399367;ENST00000437442	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3868	0.74708	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITSN1	34150908	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.917000	0.92751	2.065000	0.61736	0.528000	0.53228	.		0.502	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	Intron	18	62	0	0	0	0.006122	0	18	62				
TTC3	7267	broad.mit.edu	37	21	38537963	38537963	+	Silent	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr21:38537963A>T	ENST00000399017.2	+	33	6194	c.3447A>T	c.(3445-3447)gcA>gcT	p.A1149A	TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000355666.1_Silent_p.A1149A|TTC3_ENST00000354749.2_Silent_p.A1149A	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1149					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A1149A(1)		breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TAGAAAAAGCAGGAGGTTTAA	0.408																																					Ovarian(38;194 1649 35661)	Ovarian(38;194 1649 35661)	uc002yvz.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|lung(2)|breast(2)	9						c.(3445-3447)GCA>GCT		tetratricopeptide repeat domain 3							150.0	164.0	159.0					21																	38537963		2203	4300	6503	SO:0001819	synonymous_variant	7267				protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr21:38537963A>T	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.3447A>T	21.37:g.38537963A>T						TTC3_uc011aee.1_Silent_p.A839A|TTC3_uc002ywa.2_Silent_p.A1149A|TTC3_uc002ywb.2_Silent_p.A1149A|TTC3_uc010gnf.2_Silent_p.A914A|TTC3_uc002ywc.2_Silent_p.A839A|TTC3_uc002ywd.1_Silent_p.A213A	p.A1149A	NM_001001894	NP_001001894	P53804	TTC3_HUMAN			33	3552	+		Myeloproliferative disorder(46;0.0412)	1149					A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Silent	SNP	ENST00000399017.2	37	c.3447A>T	CCDS13651.1																																																																																				0.408	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1			54	305	0	0	0	0.00361	0	54	305				
U2AF1	7307	broad.mit.edu	37	21	44524456	44524456	+	Missense_Mutation	SNP	G	G	A	rs371769427		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr21:44524456G>A	ENST00000291552.4	-	2	193	c.101C>T	c.(100-102)tCt>tTt	p.S34F	U2AF1_ENST00000398137.1_5'UTR|U2AF1_ENST00000459639.1_5'UTR|U2AF1_ENST00000380276.2_Missense_Mutation_p.S34F|U2AF1_ENST00000486519.1_5'UTR	NM_006758.2	NP_006749.1	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxiliary factor 1	34					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S34F(45)|p.S34Y(12)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(111)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	126						GTGCAACCGAGAGCACCTGTC	0.358			Mis		"""CLL, MDS"""																																		uc002zda.1		NA		Dom	yes		21	21q22.3	7307		U2 small nuclear RNA auxiliary factor 1			L					57	Substitution - Missense(57)		haematopoietic_and_lymphoid_tissue(43)|lung(12)|endometrium(2)		0						c.(100-102)TCT>TTT		U2 small nuclear RNA auxillary factor 1 isoform		G	PHE/SER,PHE/SER,	1,4405		0,1,2202	67.0	64.0	65.0		101,101,	5.5	1.0	21		65	0,8600		0,0,4300	no	missense,missense,utr-5	U2AF1	NM_001025203.1,NM_006758.2,NM_001025204.1	155,155,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,	34/241,34/241,	44524456	1,13005	2203	4300	6503	SO:0001583	missense	7307				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	Cajal body|catalytic step 2 spliceosome|nuclear speck	nucleotide binding|RNA binding|zinc ion binding	g.chr21:44524456G>A	BC001177	CCDS13694.1, CCDS33574.1, CCDS42948.1	21q22.3	2014-09-17	2006-04-11		ENSG00000160201	ENSG00000160201		"""RNA binding motif (RRM) containing"""	12453	protein-coding gene	gene with protein product		191317	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein"", ""U2(RNU2) small nuclear RNA auxiliary factor 1"""	U2AFBP		8660980, 7956352	Standard	NM_006758		Approved	U2AF35, RNU2AF1, RN	uc002zdb.1	Q01081	OTTHUMG00000086836	ENST00000291552.4:c.101C>T	21.37:g.44524456G>A	ENSP00000291552:p.Ser34Phe					U2AF1_uc002zcy.1_5'UTR|U2AF1_uc002zcz.1_5'UTR|U2AF1_uc002zdb.1_Missense_Mutation_p.S34F|U2AF1_uc010gpi.1_Missense_Mutation_p.S34F|U2AF1_uc002zdc.1_Missense_Mutation_p.S34F	p.S34F	NM_001025203	NP_001020374	Q01081	U2AF1_HUMAN			2	185	-			34			C3H1-type 1.		Q701P4|Q71RF1	Missense_Mutation	SNP	ENST00000291552.4	37	c.101C>T	CCDS13694.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025187	0.93518	2.27E-4	0.0	ENSG00000160201	ENST00000380276;ENST00000291552	T;T	0.46063	0.88;0.88	5.47	5.47	0.80525	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.77239	0.4101	H	0.96430	3.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.997	D	0.84864	0.0821	10	0.87932	D	0	-15.7954	19.3169	0.94218	0.0:0.0:1.0:0.0	.	34;34;34	Q69YM7;Q01081;Q701P4	.;U2AF1_HUMAN;.	F	34	ENSP00000369629:S34F;ENSP00000291552:S34F	ENSP00000291552:S34F	S	-	2	0	U2AF1	43397525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.864000	0.92294	2.560000	0.86352	0.563000	0.77884	TCT		0.358	U2AF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195541.1	NM_006758		13	37	0	0	0	0.00245	0	13	37				
RRP1	8568	broad.mit.edu	37	21	45220427	45220427	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr21:45220427G>T	ENST00000497547.1	+	10	1038	c.921G>T	c.(919-921)ctG>ctT	p.L307L	RRP1_ENST00000471909.1_3'UTR	NM_003683.5	NP_003674.1	P05386	RLA1_HUMAN	ribosomal RNA processing 1	0					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.L307L(1)		central_nervous_system(1)|kidney(1)|lung(4)|stomach(2)	8				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		CTAACAGACTGTTTGAAATGG	0.557																																							uc002zds.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(919-921)CTG>CTT		ribosomal RNA processing 1 homolog							60.0	63.0	62.0					21																	45220427		2040	4194	6234	SO:0001819	synonymous_variant	8568				rRNA processing	nucleolus|preribosome, small subunit precursor		g.chr21:45220427G>T	U79775	CCDS42951.1	21q22.3	2013-07-02	2013-07-02		ENSG00000160214	ENSG00000160214			18785	protein-coding gene	gene with protein product	"""DNA segment on chromosome 21 (unique) 2056 expressed sequence"", ""Nnp1 homolog, nucleolar protein (Drosophila)"""	610653	"""ribosomal RNA processing 1 homolog (S. cerevisiae)"""			10830953, 10341208	Standard	NM_003683		Approved	NNP-1, Nop52, NOP52, RRP1A, D21S2056E	uc002zds.2	P56182	OTTHUMG00000086884	ENST00000497547.1:c.921G>T	21.37:g.45220427G>T						RRP1_uc011aez.1_Silent_p.L307L|RRP1_uc010gpk.1_Silent_p.L157L|RRP1_uc010gpl.1_Silent_p.L205L|RRP1_uc010gpm.1_Silent_p.L174L	p.L307L	NM_003683	NP_003674	P56182	RRP1_HUMAN		COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)	10	1014	+			307					A6NIB2	Silent	SNP	ENST00000497547.1	37	c.921G>T	CCDS42951.1																																																																																				0.557	RRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195680.1	NM_003683		7	44	1	0	2.0095e-06	0.001984	2.70342e-06	7	44				
PCNT	5116	broad.mit.edu	37	21	47801665	47801665	+	Silent	SNP	G	G	T	rs539565988		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr21:47801665G>T	ENST00000359568.5	+	16	3329	c.3222G>T	c.(3220-3222)cgG>cgT	p.R1074R	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1074					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.R1074R(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGACACTTCGGCTTCAGAGTG	0.413																																							uc002zji.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|breast(2)|pancreas(2)	8						c.(3220-3222)CGG>CGT		pericentrin							168.0	178.0	175.0					21																	47801665		2203	4300	6503	SO:0001819	synonymous_variant	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47801665G>T	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.3222G>T	21.37:g.47801665G>T						PCNT_uc002zjj.2_Silent_p.R956R	p.R1074R	NM_006031	NP_006022	O95613	PCNT_HUMAN			16	3329	+	Breast(49;0.112)		1074			Potential.		O43152|Q7Z7C9	Silent	SNP	ENST00000359568.5	37	c.3222G>T	CCDS33592.1																																																																																				0.413	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		9	242	1	0	1.58986e-06	0.008291	2.16484e-06	9	242				
PRAME	23532	broad.mit.edu	37	22	22892596	22892596	+	Missense_Mutation	SNP	C	C	T	rs530261022		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr22:22892596C>T	ENST00000398741.1	-	5	811	c.505G>A	c.(505-507)Gag>Aag	p.E169K	PRAME_ENST00000424204.2_Missense_Mutation_p.E153K|PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000398743.2_Missense_Mutation_p.E169K|PRAME_ENST00000543184.1_Missense_Mutation_p.E169K|PRAME_ENST00000405655.3_Missense_Mutation_p.E169K|PRAME_ENST00000402697.1_Missense_Mutation_p.E169K|PRAME_ENST00000539862.1_Missense_Mutation_p.E153K	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	169					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)	p.E169K(1)		autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		AAGGGCTGCTCTGCCTCTGTG	0.493																																					Melanoma(73;1707 1838 15168 27201)	Melanoma(73;1707 1838 15168 27201)	uc002zwf.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(505-507)GAG>AAG		preferentially expressed antigen in melanoma							127.0	109.0	115.0					22																	22892596		2203	4300	6503	SO:0001583	missense	23532				apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding	g.chr22:22892596C>T	U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.505G>A	22.37:g.22892596C>T	ENSP00000381726:p.Glu169Lys					LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Missense_Mutation_p.E153K|PRAME_uc010gtr.2_Missense_Mutation_p.E169K|PRAME_uc002zwg.2_Missense_Mutation_p.E169K|PRAME_uc002zwh.2_Missense_Mutation_p.E169K|PRAME_uc002zwi.2_Missense_Mutation_p.E169K|PRAME_uc002zwj.2_Missense_Mutation_p.E169K|PRAME_uc002zwk.2_Missense_Mutation_p.E169K	p.E169K	NM_206956	NP_996839	P78395	PRAME_HUMAN		READ - Rectum adenocarcinoma(21;0.0649)	4	661	-	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)	169					B2R6Y7|O43481|Q8IXN8	Missense_Mutation	SNP	ENST00000398741.1	37	c.505G>A	CCDS13801.1	.	.	.	.	.	.	.	.	.	.	.	9.419	1.082522	0.20309	.	.	ENSG00000185686	ENST00000398743;ENST00000543184;ENST00000398741;ENST00000405655;ENST00000539862;ENST00000402697;ENST00000424204;ENST00000439106	T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;2.54	3.16	-0.504	0.11997	.	1.833880	0.03026	N	0.151394	T	0.18635	0.0447	N	0.02842	-0.48	0.09310	N	1	B	0.13145	0.007	B	0.15484	0.013	T	0.25117	-1.0141	10	0.02654	T	1	.	2.8221	0.05474	0.0:0.2704:0.2524:0.4771	.	169	P78395	PRAME_HUMAN	K	169;169;169;169;153;169;153;169	ENSP00000381728:E169K;ENSP00000445675:E169K;ENSP00000381726:E169K;ENSP00000384343:E169K;ENSP00000445097:E153K;ENSP00000385198:E169K;ENSP00000407342:E153K;ENSP00000407320:E169K	ENSP00000381726:E169K	E	-	1	0	PRAME	21222596	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.037000	0.12164	-0.083000	0.12618	0.655000	0.94253	GAG		0.493	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321644.1	NM_206953		8	89	0	0	0	0.00308	0	8	89				
SMTN	6525	broad.mit.edu	37	22	31487707	31487707	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr22:31487707T>A	ENST00000347557.2	+	11	1724	c.1506T>A	c.(1504-1506)agT>agA	p.S502R	SMTN_ENST00000358743.1_Missense_Mutation_p.S502R|SMTN_ENST00000333137.7_Missense_Mutation_p.S502R|SMTN_ENST00000404574.1_5'Flank	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	502					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)	p.S502R(2)|p.S494R(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						TCAGCACCAGTAGTGGGGGCA	0.647																																							uc003ajl.1		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(2)|pancreas(1)	3						c.(1504-1506)AGT>AGA		smoothelin isoform c							61.0	41.0	48.0					22																	31487707		2203	4300	6503	SO:0001583	missense	6525				muscle organ development|smooth muscle contraction	actin cytoskeleton|cytoplasm	actin binding|structural constituent of muscle	g.chr22:31487707T>A	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.1506T>A	22.37:g.31487707T>A	ENSP00000328635:p.Ser502Arg					SMTN_uc003ajk.1_Missense_Mutation_p.S502R|SMTN_uc003ajm.1_Missense_Mutation_p.S502R|SMTN_uc011ale.1_Missense_Mutation_p.S556R|SMTN_uc011alf.1_Missense_Mutation_p.S558R|SMTN_uc003ajn.1_Missense_Mutation_p.S494R|SMTN_uc011alg.1_Intron|SMTN_uc003ajo.1_5'Flank|SMTN_uc011alh.1_5'Flank|SMTN_uc010gwe.1_5'Flank	p.S502R	NM_006932	NP_008863	P53814	SMTN_HUMAN			11	1724	+			502					O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	ENST00000347557.2	37	c.1506T>A	CCDS13886.1	.	.	.	.	.	.	.	.	.	.	T	19.55	3.848538	0.71603	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496	T;T;T	0.70164	-0.02;-0.46;-0.46	4.21	2.09	0.27110	.	0.000000	0.39834	N	0.001259	T	0.74245	0.3691	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.999;0.996;0.999;0.991;0.999	D;D;P;D;P;D	0.69824	0.926;0.939;0.794;0.926;0.593;0.966	T	0.72616	-0.4239	10	0.72032	D	0.01	-12.3196	7.0802	0.25227	0.0:0.7777:0.0:0.2223	.	558;556;494;502;502;502	E7ETT8;B4E229;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;SMTN_HUMAN;.	R	502;502;502;500;494	ENSP00000351593:S502R;ENSP00000328635:S502R;ENSP00000329532:S502R	ENSP00000329393:S500R	S	+	3	2	SMTN	29817707	1.000000	0.71417	0.999000	0.59377	0.917000	0.54804	1.641000	0.37197	0.503000	0.28060	-0.464000	0.05259	AGT		0.647	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270		3	21	0	0	0	0.009096	0	3	21				
FBLN1	2192	broad.mit.edu	37	22	45929753	45929753	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr22:45929753G>T	ENST00000327858.6	+	7	854	c.759G>T	c.(757-759)gaG>gaT	p.E253D	FBLN1_ENST00000262722.7_Missense_Mutation_p.E253D|FBLN1_ENST00000402984.3_Missense_Mutation_p.E291D|FBLN1_ENST00000340923.5_Missense_Mutation_p.E253D|FBLN1_ENST00000442170.2_Missense_Mutation_p.E253D|FBLN1_ENST00000348697.2_Missense_Mutation_p.E253D	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	253	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)	p.E253D(3)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CTGGCTATGAGCTCACAGAGG	0.612																																							uc003bgj.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)|central_nervous_system(1)	2						c.(757-759)GAG>GAT		fibulin 1 isoform D							119.0	121.0	120.0					22																	45929753		2203	4300	6503	SO:0001583	missense	2192				interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding	g.chr22:45929753G>T		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.759G>T	22.37:g.45929753G>T	ENSP00000331544:p.Glu253Asp					FBLN1_uc003bgg.1_Missense_Mutation_p.E253D|FBLN1_uc003bgh.2_Missense_Mutation_p.E253D|FBLN1_uc010gzz.2_Missense_Mutation_p.E291D|FBLN1_uc003bgi.1_Missense_Mutation_p.E253D	p.E253D	NM_006486	NP_006477	P23142	FBLN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)	7	906	+		Ovarian(80;0.00965)|all_neural(38;0.0416)	253			EGF-like 2; calcium-binding (Potential).		B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	c.759G>T	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614628	0.66672	.	.	ENSG00000077942	ENST00000348697;ENST00000402984;ENST00000262722;ENST00000327858;ENST00000442170;ENST00000340923;ENST00000451475	D;D;D;D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11;-3.11;-3.11;-3.11	5.19	4.17	0.49024	EGF-like calcium-binding (2);	0.000000	0.85682	D	0.000000	D	0.93019	0.7778	L	0.49699	1.58	0.45979	D	0.998796	D;D;D;D	0.76494	0.999;0.999;0.998;0.998	D;D;D;D	0.83275	0.954;0.996;0.969;0.961	D	0.90059	0.4155	10	0.22706	T	0.39	.	8.3935	0.32542	0.236:0.0:0.764:0.0	.	291;253;253;253	B1AHL2;P23142;B1AHL4;P23142-4	.;FBLN1_HUMAN;.;.	D	253;291;253;253;253;253;173	ENSP00000262723:E253D;ENSP00000385521:E291D;ENSP00000262722:E253D;ENSP00000331544:E253D;ENSP00000393812:E253D;ENSP00000342212:E253D;ENSP00000415160:E173D	ENSP00000262722:E253D	E	+	3	2	FBLN1	44308417	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	0.910000	0.28571	1.185000	0.42971	0.305000	0.20034	GAG		0.612	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486		11	141	1	0	2.80697e-09	0.000978	4.14398e-09	11	141				
BRD1	23774	broad.mit.edu	37	22	50167916	50167916	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr22:50167916C>A	ENST00000216267.8	-	12	3628	c.3142G>T	c.(3142-3144)Ggg>Tgg	p.G1048W	BRD1_ENST00000457780.2_3'UTR|BRD1_ENST00000404034.1_Missense_Mutation_p.G1048W|BRD1_ENST00000342989.5_Missense_Mutation_p.G774W|BRD1_ENST00000404760.1_Missense_Mutation_p.G1179W|BRD1_ENST00000542442.1_Missense_Mutation_p.G736W	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	1048					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)	p.G774W(1)|p.G1048W(1)		endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GTCGGCTCCCCGTGGACGCGG	0.552																																							uc003biv.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(3142-3144)GGG>TGG		bromodomain containing protein 1							118.0	124.0	122.0					22																	50167916		2203	4300	6503	SO:0001583	missense	23774				histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding	g.chr22:50167916C>A	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.3142G>T	22.37:g.50167916C>A	ENSP00000216267:p.Gly1048Trp					BRD1_uc011arf.1_Missense_Mutation_p.G774W|BRD1_uc011arg.1_Missense_Mutation_p.G1097W|BRD1_uc011arh.1_Missense_Mutation_p.G1048W|BRD1_uc003biu.3_Missense_Mutation_p.G1179W	p.G1048W	NM_014577	NP_055392	O95696	BRD1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)	12	3629	-		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)	1048					A6ZJA4	Missense_Mutation	SNP	ENST00000216267.8	37	c.3142G>T	CCDS14080.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.171770	0.57584	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000542442;ENST00000342989;ENST00000419212	T;T;T;T;T	0.39787	2.07;2.07;1.99;1.06;1.32	4.89	3.85	0.44370	.	0.053554	0.85682	D	0.000000	T	0.59998	0.2235	L	0.60455	1.87	0.80722	D	1	D;D;B;D	0.89917	1.0;1.0;0.392;1.0	D;D;B;D	0.79108	0.945;0.992;0.052;0.975	T	0.64575	-0.6375	10	0.87932	D	0	.	14.6564	0.68835	0.147:0.853:0.0:0.0	.	1179;774;1048;1179	Q86X06;B7Z926;O95696;O95696-2	.;.;BRD1_HUMAN;.	W	1048;1048;1179;736;774;639	ENSP00000216267:G1048W;ENSP00000384076:G1048W;ENSP00000385858:G1179W;ENSP00000437514:G736W;ENSP00000345886:G774W	ENSP00000216267:G1048W	G	-	1	0	BRD1	48553920	1.000000	0.71417	0.997000	0.53966	0.945000	0.59286	7.504000	0.81646	1.161000	0.42604	0.655000	0.94253	GGG		0.552	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317402.1	NM_014577		27	168	1	0	2.79863e-10	0.004656	4.23189e-10	27	168				
BTD	686	broad.mit.edu	37	3	15677046	15677046	+	Nonsense_Mutation	SNP	G	G	T	rs397514338		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:15677046G>T	ENST00000303498.5	+	2	269	c.160G>T	c.(160-162)Gag>Tag	p.E54*	BTD_ENST00000437172.1_Nonsense_Mutation_p.E56*|BTD_ENST00000383778.4_Nonsense_Mutation_p.E34*|BTD_ENST00000449107.1_Nonsense_Mutation_p.E56*|BTD_ENST00000482824.1_3'UTR	NM_000060.2|NM_001281723.1	NP_000051.1|NP_001268652.1	P43251	BTD_HUMAN	biotinidase	54					biotin metabolic process (GO:0006768)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	biotin carboxylase activity (GO:0004075)|biotinidase activity (GO:0047708)	p.E54*(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	18						TGACCATCACGAGGCTGAATA	0.562																																							uc003cah.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0	GRCh37	CM051397	BTD	M		c.(160-162)GAG>TAG		biotinidase precursor							134.0	123.0	127.0					3																	15677046		2203	4300	6503	SO:0001587	stop_gained	686				central nervous system development|epidermis development|nitrogen compound metabolic process	extracellular space	biotin carboxylase activity|biotinidase activity	g.chr3:15677046G>T	AF018631	CCDS2628.1, CCDS63563.1, CCDS63564.1, CCDS63565.1	3p25	2007-03-26			ENSG00000169814	ENSG00000169814	3.5.1.12		1122	protein-coding gene	gene with protein product		609019				8001986	Standard	NM_001281723		Approved		uc003cah.3	P43251	OTTHUMG00000129861	ENST00000303498.5:c.160G>T	3.37:g.15677046G>T	ENSP00000306477:p.Glu54*					BTD_uc011avv.1_Nonsense_Mutation_p.E56*|BTD_uc011avw.1_Nonsense_Mutation_p.E56*|BTD_uc011avx.1_Nonsense_Mutation_p.E34*	p.E54*	NM_000060	NP_000051	P43251	BTD_HUMAN			2	263	+			54					A6NHF2|B2R865|B4DFX1|B4DLJ9|B7Z7C9|F8W1Q3|Q96EM9	Nonsense_Mutation	SNP	ENST00000303498.5	37	c.160G>T	CCDS2628.1	.	.	.	.	.	.	.	.	.	.	G	11.30	1.598895	0.28445	.	.	ENSG00000169814	ENST00000427382;ENST00000449107;ENST00000303498;ENST00000437172;ENST00000436193;ENST00000383778	.	.	.	3.24	-1.75	0.08031	.	0.973243	0.08477	N	0.940113	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-6.354	4.189	0.10413	0.4598:0.1932:0.347:0.0	.	.	.	.	X	34;56;54;56;34;34	.	ENSP00000306477:E54X	E	+	1	0	BTD	15652050	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	0.229000	0.17833	-0.431000	0.07307	0.555000	0.69702	GAG		0.562	BTD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252103.2	NM_000060		14	91	1	0	3.27435e-08	0.00245	4.67408e-08	14	91				
CRTAP	10491	broad.mit.edu	37	3	33174052	33174052	+	Missense_Mutation	SNP	G	G	C	rs111525897	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:33174052G>C	ENST00000320954.6	+	5	1027	c.928G>C	c.(928-930)Gac>Cac	p.D310H	CRTAP_ENST00000485310.1_3'UTR|CRTAP_ENST00000449224.1_Missense_Mutation_p.D267H	NM_006371.4	NP_006362.1	O75718	CRTAP_HUMAN	cartilage associated protein	310					chaperone-mediated protein folding (GO:0061077)|extracellular matrix organization (GO:0030198)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation to 3-hydroxy-L-proline (GO:0018400)|protein stabilization (GO:0050821)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|macromolecular complex (GO:0032991)|proteinaceous extracellular matrix (GO:0005578)	protein complex binding (GO:0032403)	p.D310H(1)		breast(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9						CCTAGTGAACGACCTGAAGAA	0.453																																							uc003cfl.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(928-930)GAC>CAC		cartilage associated protein precursor							169.0	168.0	168.0					3																	33174052		2203	4300	6503	SO:0001583	missense	10491					proteinaceous extracellular matrix	binding	g.chr3:33174052G>C	AJ006470	CCDS2657.1	3p22	2014-09-17			ENSG00000170275	ENSG00000170275			2379	protein-coding gene	gene with protein product	"""leprecan-like 3"""	605497				9217321, 10429950	Standard	NM_006371		Approved	CASP, LEPREL3	uc003cfl.4	O75718	OTTHUMG00000130746	ENST00000320954.6:c.928G>C	3.37:g.33174052G>C	ENSP00000323696:p.Asp310His					CRTAP_uc010hfz.2_Missense_Mutation_p.D267H|CRTAP_uc003cfm.2_Missense_Mutation_p.D131H|CRTAP_uc003cfn.2_Missense_Mutation_p.D131H	p.D310H	NM_006371	NP_006362	O75718	CRTAP_HUMAN			5	1048	+			310					B2RBL6	Missense_Mutation	SNP	ENST00000320954.6	37	c.928G>C	CCDS2657.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402571	0.62288	.	.	ENSG00000170275	ENST00000320954;ENST00000539684;ENST00000449224	T;T	0.63744	-0.06;-0.06	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.81226	0.4778	M	0.82056	2.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.83549	0.0100	10	0.72032	D	0.01	-0.753	19.0154	0.92892	0.0:0.0:1.0:0.0	.	267;310	C9JP16;O75718	.;CRTAP_HUMAN	H	310;297;267	ENSP00000323696:D310H;ENSP00000409997:D267H	ENSP00000323696:D310H	D	+	1	0	CRTAP	33149056	1.000000	0.71417	0.948000	0.38648	0.381000	0.30169	6.668000	0.74457	2.498000	0.84270	0.561000	0.74099	GAC		0.453	CRTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253246.3			13	134	0	0	0	0.001855	0	13	134				
SCN10A	6336	broad.mit.edu	37	3	38739040	38739040	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:38739040C>T	ENST00000449082.2	-	27	5670	c.5671G>A	c.(5671-5673)Gat>Aat	p.D1891N		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1891					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.D1891N(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	AAACCTTCATCTGGGAGTGAT	0.498																																							uc003ciq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10						c.(5671-5673)GAT>AAT		sodium channel, voltage-gated, type X, alpha	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)						146.0	134.0	138.0					3																	38739040		2203	4300	6503	SO:0001583	missense	6336				sensory perception	voltage-gated sodium channel complex		g.chr3:38739040C>T	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.5671G>A	3.37:g.38739040C>T	ENSP00000390600:p.Asp1891Asn						p.D1891N	NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	27	5671	-			1891					A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	c.5671G>A	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	C	1.755	-0.488177	0.04352	.	.	ENSG00000185313	ENST00000449082	D	0.95588	-3.75	5.38	3.57	0.40892	.	10.633600	0.00166	N	0.000000	D	0.89203	0.6648	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.79831	-0.1637	10	0.38643	T	0.18	.	4.125	0.10123	0.0:0.5504:0.1776:0.2721	.	1891	Q9Y5Y9	SCNAA_HUMAN	N	1891	ENSP00000390600:D1891N	ENSP00000390600:D1891N	D	-	1	0	SCN10A	38714044	0.013000	0.17824	0.007000	0.13788	0.348000	0.29142	1.531000	0.36018	0.805000	0.34159	0.655000	0.94253	GAT		0.498	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		12	67	0	0	0	0.000978	0	12	67				
SCN11A	11280	broad.mit.edu	37	3	38888217	38888217	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:38888217C>T	ENST00000302328.3	-	26	5542	c.5344G>A	c.(5344-5346)Ggg>Agg	p.G1782R	SCN11A_ENST00000456224.3_Missense_Mutation_p.G1744R|SCN11A_ENST00000450244.1_Missense_Mutation_p.G1782R	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1782					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.G1782R(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTGGCCACCCCAAAGCTAGAC	0.552																																							uc011ays.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9						c.(5344-5346)GGG>AGG		sodium channel, voltage-gated, type XI, alpha	Cocaine(DB00907)						152.0	134.0	140.0					3																	38888217		2203	4300	6503	SO:0001583	missense	11280				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr3:38888217C>T	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.5344G>A	3.37:g.38888217C>T	ENSP00000307599:p.Gly1782Arg						p.G1782R	NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN		Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	26	5543	-			1782					A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	c.5344G>A	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	9.825	1.186931	0.21870	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224	D;D;D	0.95980	-3.87;-3.87;-3.83	5.02	4.16	0.48862	.	1.722310	0.03832	N	0.269269	D	0.94928	0.8360	M	0.72479	2.2	0.09310	N	1	B	0.18461	0.028	B	0.15870	0.014	D	0.84126	0.0409	10	0.72032	D	0.01	.	9.2114	0.37320	0.0:0.9029:0.0:0.0971	.	1782	Q9UI33	SCNBA_HUMAN	R	1782;1782;1744	ENSP00000307599:G1782R;ENSP00000400945:G1782R;ENSP00000416757:G1744R	ENSP00000307599:G1782R	G	-	1	0	SCN11A	38863221	0.006000	0.16342	0.060000	0.19600	0.117000	0.20001	2.057000	0.41365	1.347000	0.45714	-0.142000	0.14014	GGG		0.552	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		8	63	0	0	0	0.00308	0	8	63				
EIF1B	10289	broad.mit.edu	37	3	40352529	40352529	+	Silent	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:40352529T>A	ENST00000232905.3	+	2	435	c.177T>A	c.(175-177)ctT>ctA	p.L59L	ENTPD3-AS1_ENST00000439293.1_RNA	NM_005875.2	NP_005866.1	O60739	EIF1B_HUMAN	eukaryotic translation initiation factor 1B	59					regulation of translational initiation (GO:0006446)		poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.L59L(1)		central_nervous_system(1)|lung(3)	4				KIRC - Kidney renal clear cell carcinoma(284;0.0509)|Kidney(284;0.064)		AAAAGAAACTTGTGAAAGCTT	0.398																																							uc003ckc.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(175-177)CTT>CTA		translation factor sui1 homolog							66.0	66.0	66.0					3																	40352529		2203	4300	6503	SO:0001819	synonymous_variant	10289				regulation of translational initiation		protein binding|translation initiation factor activity	g.chr3:40352529T>A	BC006996	CCDS2690.1	3p22.1	2006-02-03			ENSG00000114784	ENSG00000114784			30792	protein-coding gene	gene with protein product						7904817	Standard	NM_005875		Approved	GC20	uc003ckc.3	O60739	OTTHUMG00000131388	ENST00000232905.3:c.177T>A	3.37:g.40352529T>A						uc003ckb.2_5'Flank	p.L59L	NM_005875	NP_005866	O60739	EIF1B_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0509)|Kidney(284;0.064)	2	437	+			59					Q9UQF8	Silent	SNP	ENST00000232905.3	37	c.177T>A	CCDS2690.1																																																																																				0.398	EIF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254177.1	NM_005875		7	58	0	0	0	0.006214	0	7	58				
MAP4	4134	broad.mit.edu	37	3	47956349	47956349	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:47956349G>C	ENST00000360240.6	-	8	2475	c.1957C>G	c.(1957-1959)Cca>Gca	p.P653A	MAP4_ENST00000395734.3_Missense_Mutation_p.P653A|MAP4_ENST00000426837.2_Missense_Mutation_p.P670A|MAP4_ENST00000383737.4_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	653					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.P653A(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	CTGTTGCATGGTTTCCTTTCC	0.433																																							uc003csb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(1957-1959)CCA>GCA		microtubule-associated protein 4 isoform 1							183.0	187.0	186.0					3																	47956349		2203	4300	6503	SO:0001583	missense	4134				negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr3:47956349G>C		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1957C>G	3.37:g.47956349G>C	ENSP00000353375:p.Pro653Ala					MAP4_uc003csc.3_Missense_Mutation_p.P653A|MAP4_uc011bbf.1_Missense_Mutation_p.P630A|MAP4_uc003csf.3_Missense_Mutation_p.P670A	p.P653A	NM_002375	NP_002366	P27816	MAP4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	8	2483	-			653					Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	ENST00000360240.6	37	c.1957C>G	CCDS33750.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121464	0.37436	.	.	ENSG00000047849	ENST00000395734;ENST00000426837;ENST00000360240	T;T;T	0.09538	3.18;2.97;3.19	4.29	3.37	0.38596	.	.	.	.	.	T	0.18215	0.0437	M	0.68317	2.08	0.53688	D	0.999973	D;D;B	0.56968	0.969;0.978;0.301	B;P;B	0.51415	0.374;0.669;0.038	T	0.02275	-1.1184	9	0.30854	T	0.27	-0.569	9.6492	0.39886	0.0:0.0:0.7816:0.2183	.	630;653;653	C9JFC3;P27816-6;P27816	.;.;MAP4_HUMAN	A	653;670;653	ENSP00000379083:P653A;ENSP00000407602:P670A;ENSP00000353375:P653A	ENSP00000353375:P653A	P	-	1	0	MAP4	47931353	0.989000	0.36119	0.515000	0.27774	0.876000	0.50452	2.527000	0.45615	1.029000	0.39812	0.557000	0.71058	CCA		0.433	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375		22	172	0	0	0	0.010504	0	22	172				
FLNB	2317	broad.mit.edu	37	3	58120479	58120479	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:58120479C>A	ENST00000295956.4	+	27	4816	c.4651C>A	c.(4651-4653)Ctg>Atg	p.L1551M	FLNB_ENST00000429972.2_Missense_Mutation_p.L1551M|FLNB_ENST00000419752.2_Missense_Mutation_p.L1382M|FLNB_ENST00000493452.1_Missense_Mutation_p.L1382M|FLNB_ENST00000348383.5_Missense_Mutation_p.L1551M|FLNB_ENST00000490882.1_Missense_Mutation_p.L1582M|FLNB_ENST00000358537.3_Missense_Mutation_p.L1551M|FLNB_ENST00000357272.4_Missense_Mutation_p.L1551M	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1551					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.L1551M(1)|p.L1582M(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CGGGGAAGGCCTGCTTGCTGT	0.483																																							uc003djj.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19						c.(4651-4653)CTG>ATG		filamin B isoform 2							151.0	150.0	151.0					3																	58120479		2203	4300	6503	SO:0001583	missense	2317				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding	g.chr3:58120479C>A	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.4651C>A	3.37:g.58120479C>A	ENSP00000295956:p.Leu1551Met					FLNB_uc010hne.2_Missense_Mutation_p.L1582M|FLNB_uc003djk.2_Missense_Mutation_p.L1551M|FLNB_uc010hnf.2_Missense_Mutation_p.L1551M|FLNB_uc003djl.2_Missense_Mutation_p.L1382M|FLNB_uc003djm.2_Missense_Mutation_p.L1382M	p.L1551M	NM_001457	NP_001448	O75369	FLNB_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)	27	4816	+			1551			Filamin 14.		B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	c.4651C>A	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555566	0.86231	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98;-1.98;-1.98;-1.98	5.68	4.81	0.61882	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.199032	0.46145	D	0.000316	D	0.87370	0.6160	L	0.31578	0.945	0.44323	D	0.997205	P;D;B;B;P;P	0.67145	0.855;0.996;0.247;0.078;0.949;0.949	P;D;P;B;P;P	0.74348	0.69;0.983;0.753;0.441;0.853;0.853	D	0.87681	0.2547	10	0.48119	T	0.1	.	14.4931	0.67665	0.0:0.9296:0.0:0.0704	.	1551;1582;1382;1382;1551;1551	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	M	1551;1582;1551;1551;1551;1551;1382;1382	ENSP00000295956:L1551M;ENSP00000420213:L1582M;ENSP00000351339:L1551M;ENSP00000415599:L1551M;ENSP00000232447:L1551M;ENSP00000349819:L1551M;ENSP00000418510:L1382M;ENSP00000414532:L1382M	ENSP00000295956:L1551M	L	+	1	2	FLNB	58095519	0.899000	0.30636	1.000000	0.80357	0.996000	0.88848	4.634000	0.61325	1.394000	0.46624	0.563000	0.77884	CTG		0.483	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457		10	129	1	0	1.41608e-15	0.001855	2.29601e-15	10	129				
MAGI1	9223	broad.mit.edu	37	3	65342407	65342407	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:65342407C>G	ENST00000402939.2	-	23	4034	c.4035G>C	c.(4033-4035)aaG>aaC	p.K1345N	MAGI1_ENST00000330909.8_3'UTR|RP11-88H12.2_ENST00000602316.1_RNA	NM_001033057.1	NP_001028229.1	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	1374					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)	p.K1345N(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CGTCTCGTCTCTTCTCGTGCT	0.692																																							uc003dmn.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6						c.(4033-4035)AAG>AAC		membrane associated guanylate kinase, WW and PDZ							47.0	49.0	49.0					3																	65342407		2203	4300	6503	SO:0001583	missense	9223				cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding	g.chr3:65342407C>G	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000402939.2:c.4035G>C	3.37:g.65342407C>G	ENSP00000385450:p.Lys1345Asn					MAGI1_uc003dmm.2_3'UTR	p.K1345N	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)	23	4561	-		Lung NSC(201;0.0016)	1374					A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	ENST00000402939.2	37	c.4035G>C	CCDS33780.1	.	.	.	.	.	.	.	.	.	.	C	5.849	0.340844	0.11069	.	.	ENSG00000151276	ENST00000402939	T	0.12361	2.69	5.11	2.06	0.26882	.	0.218288	0.37669	N	0.001988	T	0.07863	0.0197	N	0.19112	0.55	0.09310	N	0.999999	B	0.15473	0.013	B	0.16289	0.015	T	0.23976	-1.0173	10	0.62326	D	0.03	-6.7174	5.972	0.19357	0.0:0.6341:0.1377:0.2282	.	1345	Q96QZ7-2	.	N	1345	ENSP00000385450:K1345N	ENSP00000385450:K1345N	K	-	3	2	MAGI1	65317447	0.000000	0.05858	0.142000	0.22268	0.435000	0.31806	0.017000	0.13399	1.133000	0.42147	0.591000	0.81541	AAG		0.692	MAGI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349126.1	NM_004742		12	56	0	0	0	0.00245	0	12	56				
PDZRN3	23024	broad.mit.edu	37	3	73433087	73433087	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:73433087G>T	ENST00000263666.4	-	10	2744	c.2630C>A	c.(2629-2631)gCc>gAc	p.A877D	PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Missense_Mutation_p.A599D|PDZRN3_ENST00000479530.1_Missense_Mutation_p.A594D|PDZRN3_ENST00000462146.2_Missense_Mutation_p.A534D|PDZRN3_ENST00000466780.1_Missense_Mutation_p.A534D	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	877					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A877D(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GTAGTGCTGGGCGTGCGCCGG	0.647																																							uc003dpl.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7						c.(2629-2631)GCC>GAC		PDZ domain containing ring finger 3							70.0	66.0	67.0					3																	73433087		2203	4300	6503	SO:0001583	missense	23024						ubiquitin-protein ligase activity|zinc ion binding	g.chr3:73433087G>T	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.2630C>A	3.37:g.73433087G>T	ENSP00000263666:p.Ala877Asp					PDZRN3_uc011bgh.1_Missense_Mutation_p.A534D|PDZRN3_uc010hoe.1_Missense_Mutation_p.A575D|PDZRN3_uc011bgf.1_Missense_Mutation_p.A594D|PDZRN3_uc011bgg.1_Missense_Mutation_p.A597D	p.A877D	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)	10	2726	-		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)	877					A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	c.2630C>A	CCDS33789.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.389634	0.82902	.	.	ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530	T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94	5.4	5.4	0.78164	.	0.539636	0.20925	N	0.083216	D	0.87684	0.6239	M	0.84433	2.695	0.80722	D	1	D;D;D;D	0.89917	0.995;1.0;1.0;1.0	D;D;D;D	0.97110	0.965;0.999;1.0;0.998	D	0.86162	0.1594	10	0.31617	T	0.26	.	18.7949	0.91990	0.0:0.0:1.0:0.0	.	599;594;594;877	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.;.;.;PZRN3_HUMAN	D	877;599;534;534;594	ENSP00000263666:A877D;ENSP00000442026:A599D;ENSP00000418168:A534D;ENSP00000418484:A534D;ENSP00000418624:A594D	ENSP00000263666:A877D	A	-	2	0	PDZRN3	73515777	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.398000	0.97281	2.522000	0.85027	0.655000	0.94253	GCC		0.647	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363		8	69	1	0	5.18039e-06	0.00308	6.90309e-06	8	69				
VGLL3	389136	broad.mit.edu	37	3	87017813	87017813	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:87017813G>A	ENST00000398399.2	-	3	1227	c.864C>T	c.(862-864)acC>acT	p.T288T	VGLL3_ENST00000383698.3_Silent_p.T288T	NM_016206.2	NP_057290.2			vestigial-like family member 3									p.T288T(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(11)	19	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		AGGTAGCAGAGGTGACTGTAG	0.522																																							uc003dqn.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(862-864)ACC>ACT		colon carcinoma related protein							83.0	85.0	84.0					3																	87017813		2091	4213	6304	SO:0001819	synonymous_variant	389136				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr3:87017813G>A	AF099505	CCDS43110.1	3p12.1	2014-03-03	2014-03-03		ENSG00000206538	ENSG00000206538			24327	protein-coding gene	gene with protein product		609980	"""vestigial like 3 (Drosophila)"""			12376544	Standard	NM_016206		Approved	VGL-3	uc003dqn.3	A8MV65	OTTHUMG00000158984	ENST00000398399.2:c.864C>T	3.37:g.87017813G>A							p.T288T	NM_016206	NP_057290	A8MV65	VGLL3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)	3	1228	-	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)	288						Silent	SNP	ENST00000398399.2	37	c.864C>T	CCDS43110.1																																																																																				0.522	VGLL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352805.1	NM_016206		8	43	0	0	0	0.006214	0	8	43				
OR5H6	79295	broad.mit.edu	37	3	97983997	97983997	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:97983997A>T	ENST00000383696.2	+	1	910	c.869A>T	c.(868-870)gAg>gTg	p.E290V	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E290V(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						GATATGATGGAGTCTCTATTT	0.403																																							uc003dsi.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|large_intestine(1)	3						c.(868-870)GAG>GTG		olfactory receptor, family 5, subfamily H,							67.0	64.0	65.0					3																	97983997		2203	4299	6502	SO:0001583	missense	79295				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97983997A>T	BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.869A>T	3.37:g.97983997A>T	ENSP00000373196:p.Glu290Val						p.E290V	NM_001005479	NP_001005479	Q8NGV6	OR5H6_HUMAN			1	869	+			290			Helical; Name=7; (Potential).		Q6IF88	Missense_Mutation	SNP	ENST00000383696.2	37	c.869A>T	CCDS33800.1	.	.	.	.	.	.	.	.	.	.	-	0.021	-1.430407	0.01117	.	.	ENSG00000230301	ENST00000383696	T	0.31769	1.48	2.19	-1.22	0.09494	GPCR, rhodopsin-like superfamily (1);	1.611960	0.03900	N	0.280234	T	0.06371	0.0164	N	0.00265	-1.74	0.09310	N	1	B	0.14012	0.009	B	0.18263	0.021	T	0.22695	-1.0209	10	0.12766	T	0.61	.	0.1555	0.00097	0.3532:0.2421:0.1667:0.2379	.	290	Q8NGV6	OR5H6_HUMAN	V	290	ENSP00000373196:E290V	ENSP00000373196:E290V	E	+	2	0	OR5H6	99466687	0.000000	0.05858	0.367000	0.25926	0.500000	0.33767	-1.150000	0.03178	0.073000	0.16731	0.163000	0.16589	GAG		0.403	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2			5	66	0	0	0	0.001168	0	5	66				
ZBTB20	26137	broad.mit.edu	37	3	114069321	114069321	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:114069321T>A	ENST00000474710.1	-	4	1782	c.1604A>T	c.(1603-1605)cAg>cTg	p.Q535L	ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20_ENST00000481632.1_Missense_Mutation_p.Q462L|ZBTB20_ENST00000462705.1_Missense_Mutation_p.Q462L|ZBTB20_ENST00000464560.1_Missense_Mutation_p.Q462L|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20_ENST00000357258.3_Missense_Mutation_p.Q462L|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20_ENST00000471418.1_Missense_Mutation_p.Q462L|ZBTB20_ENST00000393785.2_Missense_Mutation_p.Q462L	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	535						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.Q462L(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CTGGGTCTGCTGGCCTGCCAG	0.652																																					NSCLC(69;748 1344 9802 11203 30933)	NSCLC(69;748 1344 9802 11203 30933)	uc003ebi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(1603-1605)CAG>CTG		zinc finger and BTB domain containing 20 isoform							51.0	57.0	55.0					3																	114069321		2203	4300	6503	SO:0001583	missense	26137				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:114069321T>A	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.1604A>T	3.37:g.114069321T>A	ENSP00000419153:p.Gln535Leu					ZBTB20_uc003ebj.2_Missense_Mutation_p.Q462L|ZBTB20_uc010hqp.2_Missense_Mutation_p.Q462L|ZBTB20_uc003ebk.2_Missense_Mutation_p.Q462L|ZBTB20_uc003ebl.2_Missense_Mutation_p.Q462L|ZBTB20_uc003ebm.2_Missense_Mutation_p.Q462L|ZBTB20_uc003ebn.2_Missense_Mutation_p.Q462L|uc003ebo.1_5'Flank	p.Q535L	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN		LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)	4	1784	-			535					Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	c.1604A>T	CCDS54626.1	.	.	.	.	.	.	.	.	.	.	T	14.34	2.506715	0.44558	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.11604	2.78;2.78;2.78;2.78;2.76;2.78;2.78	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.13884	0.0336	N	0.24115	0.695	0.80722	D	1	D	0.53885	0.963	P	0.49853	0.624	T	0.01557	-1.1325	10	0.59425	D	0.04	.	16.2454	0.82441	0.0:0.0:0.0:1.0	.	535	Q9HC78	ZBT20_HUMAN	L	462;462;462;462;535;462;462	ENSP00000420324:Q462L;ENSP00000377375:Q462L;ENSP00000418092:Q462L;ENSP00000419902:Q462L;ENSP00000419153:Q535L;ENSP00000349803:Q462L;ENSP00000417307:Q462L	ENSP00000349803:Q462L	Q	-	2	0	ZBTB20	115552011	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.689000	0.84165	2.230000	0.72887	0.455000	0.32223	CAG		0.652	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642		16	69	0	0	0	0.004007	0	16	69				
LRRC58	116064	broad.mit.edu	37	3	120053875	120053875	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:120053875C>T	ENST00000295628.3	-	3	836	c.741G>A	c.(739-741)ttG>ttA	p.L247L		NM_001099678.1	NP_001093148.1	Q96CX6	LRC58_HUMAN	leucine rich repeat containing 58	247								p.L247L(1)		large_intestine(2)|lung(5)	7				GBM - Glioblastoma multiforme(114;0.147)		AACGAACAACCAATGGATTTC	0.403																																							uc003edr.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(739-741)TTG>TTA		leucine rich repeat containing 58							110.0	99.0	102.0					3																	120053875		1861	4104	5965	SO:0001819	synonymous_variant	116064							g.chr3:120053875C>T	BC013757	CCDS46892.1	3q13.33	2006-01-06			ENSG00000163428	ENSG00000163428			26968	protein-coding gene	gene with protein product							Standard	NM_001099678		Approved		uc003edr.2	Q96CX6	OTTHUMG00000159407	ENST00000295628.3:c.741G>A	3.37:g.120053875C>T							p.L247L	NM_001099678	NP_001093148	Q96CX6	LRC58_HUMAN		GBM - Glioblastoma multiforme(114;0.147)	3	837	-			247			LRR 9.			Silent	SNP	ENST00000295628.3	37	c.741G>A	CCDS46892.1																																																																																				0.403	LRRC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355142.1	XM_057296		5	45	0	0	0	0.001168	0	5	45				
STXBP5L	9515	broad.mit.edu	37	3	121137243	121137243	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:121137243G>C	ENST00000273666.6	+	27	3629	c.3358G>C	c.(3358-3360)Ggt>Cgt	p.G1120R	STXBP5L_ENST00000471454.1_Missense_Mutation_p.G1096R	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	1120					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G1120R(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		TCCTGGACCAGGTAGTATAGA	0.502																																							uc003eec.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|skin(2)	9						c.(3358-3360)GGT>CGT		syntaxin binding protein 5-like							49.0	55.0	53.0					3																	121137243		1999	4177	6176	SO:0001583	missense	9515				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane		g.chr3:121137243G>C	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.3358G>C	3.37:g.121137243G>C	ENSP00000273666:p.Gly1120Arg					STXBP5L_uc011bji.1_Missense_Mutation_p.G1096R	p.G1120R	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN		GBM - Glioblastoma multiforme(114;0.0694)	27	3498	+			1120					Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	37	c.3358G>C	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611530	0.66558	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000471262	T;T;T	0.26957	1.7;1.7;1.76	5.35	5.35	0.76521	.	0.120533	0.56097	D	0.000038	T	0.49966	0.1588	M	0.76002	2.32	0.80722	D	1	D;D	0.63880	0.993;0.993	P;P	0.60949	0.881;0.844	T	0.47182	-0.9137	10	0.44086	T	0.13	-15.5896	19.0738	0.93151	0.0:0.0:1.0:0.0	.	1096;1120	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	R	1120;1096;1063	ENSP00000273666:G1120R;ENSP00000420019:G1096R;ENSP00000420167:G1063R	ENSP00000273666:G1120R	G	+	1	0	STXBP5L	122619933	1.000000	0.71417	0.996000	0.52242	0.638000	0.38207	9.807000	0.99171	2.512000	0.84698	0.655000	0.94253	GGT		0.502	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3			3	33	0	0	0	0.000602	0	3	33				
POLQ	10721	broad.mit.edu	37	3	121217437	121217437	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:121217437C>T	ENST00000264233.5	-	13	2168	c.2040G>A	c.(2038-2040)atG>atA	p.M680I		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	680					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.M815I(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		CCACCCTTTTCATTGAAGTTG	0.423								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	Pancreas(152;907 1925 26081 31236 36904)	uc003eee.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(2038-2040)ATG>ATA	DNA_polymerases_(catalytic_subunits)	DNA polymerase theta							123.0	114.0	118.0					3																	121217437		2203	4300	6503	SO:0001583	missense	10721				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity	g.chr3:121217437C>T	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.2040G>A	3.37:g.121217437C>T	ENSP00000264233:p.Met680Ile						p.M680I	NM_199420	NP_955452	O75417	DPOLQ_HUMAN		GBM - Glioblastoma multiforme(114;0.0915)	13	2169	-			680					O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	c.2040G>A	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.211887	0.79240	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.48836	0.8	5.68	5.68	0.88126	.	0.155391	0.64402	D	0.000001	T	0.54431	0.1858	M	0.80422	2.495	0.80722	D	1	P	0.35908	0.527	B	0.33042	0.157	T	0.60801	-0.7191	10	0.59425	D	0.04	.	19.7724	0.96370	0.0:1.0:0.0:0.0	.	680	O75417	DPOLQ_HUMAN	I	303;680;816	ENSP00000264233:M680I	ENSP00000264233:M680I	M	-	3	0	POLQ	122700127	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.379000	0.79691	2.664000	0.90586	0.655000	0.94253	ATG		0.423	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420		9	85	0	0	0	0.004482	0	9	85				
XRN1	54464	broad.mit.edu	37	3	142123810	142123810	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:142123810C>T	ENST00000264951.4	-	16	1939	c.1822G>A	c.(1822-1824)Gag>Aag	p.E608K	XRN1_ENST00000392981.2_Missense_Mutation_p.E608K|RNU6-1294P_ENST00000515995.1_RNA	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	608					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.E608K(1)		NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TAGATAAACTCTGTGTCTCTA	0.413																																							uc003eus.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1822-1824)GAG>AAG		5'-3' exoribonuclease 1 isoform a							158.0	140.0	146.0					3																	142123810		2203	4300	6503	SO:0001583	missense	54464				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding	g.chr3:142123810C>T	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1822G>A	3.37:g.142123810C>T	ENSP00000264951:p.Glu608Lys					XRN1_uc010huu.2_Missense_Mutation_p.E74K|XRN1_uc003eut.2_Missense_Mutation_p.E608K|XRN1_uc003euu.2_Missense_Mutation_p.E608K|XRN1_uc003euv.1_Missense_Mutation_p.E469K	p.E608K	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN			16	1889	-			608					Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	c.1822G>A	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.713325	0.48517	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.26518	1.73;1.73	5.53	3.74	0.42951	.	0.451748	0.25045	N	0.033567	T	0.21921	0.0528	L	0.52573	1.65	0.80722	D	1	B;B;B	0.28998	0.0;0.23;0.006	B;B;B	0.31614	0.001;0.133;0.011	T	0.02232	-1.1191	10	0.07813	T	0.8	-4.2349	11.7724	0.51967	0.0:0.8572:0.0:0.1428	.	469;608;608	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	K	608	ENSP00000264951:E608K;ENSP00000376707:E608K	ENSP00000264951:E608K	E	-	1	0	XRN1	143606500	1.000000	0.71417	0.918000	0.36340	0.808000	0.45660	4.222000	0.58580	0.693000	0.31634	0.650000	0.86243	GAG		0.413	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001		7	85	0	0	0	0.00308	0	7	85				
EHHADH	1962	broad.mit.edu	37	3	184910894	184910894	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:184910894G>C	ENST00000231887.3	-	7	1367	c.1292C>G	c.(1291-1293)aCc>aGc	p.T431S	EHHADH_ENST00000456310.1_Missense_Mutation_p.T335S|EHHADH-AS1_ENST00000417720.1_RNA	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	431	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)	p.T431S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			AAAGAAGTGGGTGCCAATGAC	0.448																																							uc003fpf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1291-1293)ACC>AGC		enoyl-Coenzyme A, hydratase/3-hydroxyacyl	NADH(DB00157)						121.0	117.0	119.0					3																	184910894		2203	4300	6503	SO:0001583	missense	1962					peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity	g.chr3:184910894G>C	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1292C>G	3.37:g.184910894G>C	ENSP00000231887:p.Thr431Ser					EHHADH_uc011brs.1_Missense_Mutation_p.T335S	p.T431S	NM_001966	NP_001957	Q08426	ECHP_HUMAN	Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		7	1319	-	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		431			3-hydroxyacyl-CoA dehydrogenase.		A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	c.1292C>G	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007044	0.54361	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.77229	-1.08;-1.08	6.08	6.08	0.98989	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.099662	0.64402	D	0.000002	T	0.80149	0.4570	M	0.75777	2.31	0.80722	D	1	B	0.31227	0.314	B	0.36092	0.217	T	0.79897	-0.1609	10	0.87932	D	0	-15.3293	14.7773	0.69740	0.0684:0.0:0.9316:0.0	.	431	Q08426	ECHP_HUMAN	S	431;431;335	ENSP00000231887:T431S;ENSP00000387746:T335S	ENSP00000231887:T431S	T	-	2	0	EHHADH	186393588	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.885000	0.69736	2.894000	0.99253	0.591000	0.81541	ACC		0.448	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1			8	76	0	0	0	0.00308	0	8	76				
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	G	C	rs369326402	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:195505836G>C	ENST00000463781.3	-	2	13074	c.12615C>G	c.(12613-12615)caC>caG	p.H4205Q	MUC4_ENST00000475231.1_Missense_Mutation_p.H4205Q|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H4205Q(10)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597																																							uc011bto.1		NA																	10	Substitution - Missense(10)		kidney(4)|prostate(3)|urinary_tract(2)|endometrium(1)		0						c.(12229-12231)CAC>CAG		mucin 4 isoform a							15.0	14.0	14.0					3																	195505836		687	1573	2260	SO:0001583	missense	4585				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity	g.chr3:195505836G>C	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12615C>G	3.37:g.195505836G>C	ENSP00000417498:p.His4205Gln					MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	p.H4077Q	NM_018406	NP_060876	Q99102	MUC4_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)	3	12691	-	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	c.12231C>G	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	0.099	-1.155501	0.01686	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.55;1.53	.	.	.	.	.	.	.	.	T	0.17619	0.0423	N	0.19112	0.55	0.21950	N	0.999454	P	0.35208	0.49	B	0.40038	0.317	T	0.24368	-1.0162	6	.	.	.	.	.	.	.	.	4077	E7ESK3	.	Q	4205	ENSP00000417498:H4205Q;ENSP00000420243:H4205Q	.	H	-	3	2	MUC4	196990615	.	.	0.016000	0.15963	0.046000	0.14306	.	.	-0.849000	0.04158	0.074000	0.15403	CAC		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406		2	5	0	0	0	0.004672	0	2	5				
PPARGC1A	10891	broad.mit.edu	37	4	23833297	23833297	+	Missense_Mutation	SNP	G	G	T	rs376151789		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:23833297G>T	ENST00000264867.2	-	3	431	c.312C>A	c.(310-312)gaC>gaA	p.D104E	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	104					androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.D104E(1)		central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				AGGGCAATCCGTCTTCATCCA	0.512																																					Esophageal Squamous(29;694 744 13796 34866 44181)	Esophageal Squamous(29;694 744 13796 34866 44181)	uc003gqs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)|kidney(2)|skin(2)	8						c.(310-312)GAC>GAA		peroxisome proliferator-activated receptor							416.0	334.0	362.0					4																	23833297		2203	4300	6503	SO:0001583	missense	10891				androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding	g.chr4:23833297G>T	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.312C>A	4.37:g.23833297G>T	ENSP00000264867:p.Asp104Glu					PPARGC1A_uc003gqt.2_RNA|PPARGC1A_uc011bxp.1_RNA|PPARGC1A_uc010ier.1_RNA	p.D104E	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN			3	432	-		Breast(46;0.0503)	104					B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	ENST00000264867.2	37	c.312C>A	CCDS3429.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357700	0.82243	.	.	ENSG00000109819	ENST00000264867	T	0.22743	1.94	6.03	4.08	0.47627	.	0.000000	0.85682	D	0.000000	T	0.40040	0.1101	M	0.79475	2.455	0.80722	D	1	D	0.69078	0.997	D	0.76575	0.988	T	0.29488	-1.0010	10	0.45353	T	0.12	-9.6448	4.264	0.10754	0.4329:0.0:0.5671:0.0	.	104	Q9UBK2	PRGC1_HUMAN	E	104	ENSP00000264867:D104E	ENSP00000264867:D104E	D	-	3	2	PPARGC1A	23442395	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.194000	0.65125	1.561000	0.49584	0.655000	0.94253	GAC		0.512	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261		62	278	1	0	6.00099e-30	0.00361	1.05535e-29	62	278				
TMEM156	80008	broad.mit.edu	37	4	39000506	39000506	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:39000506G>C	ENST00000381938.3	-	2	219	c.112C>G	c.(112-114)Ctg>Gtg	p.L38V	TMEM156_ENST00000372489.2_5'UTR	NM_024943.1	NP_079219.1	Q8N614	TM156_HUMAN	transmembrane protein 156	38						integral component of membrane (GO:0016021)		p.L38V(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						CACACTTCCAGACATGATAGC	0.323																																							uc003gto.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(112-114)CTG>GTG		transmembrane protein 156							39.0	41.0	41.0					4																	39000506		2202	4298	6500	SO:0001583	missense	80008					integral to membrane		g.chr4:39000506G>C	AK026888	CCDS3448.1	4p14	2008-02-05			ENSG00000121895	ENSG00000121895			26260	protein-coding gene	gene with protein product						12477932	Standard	NM_024943		Approved	FLJ23235	uc003gto.3	Q8N614	OTTHUMG00000128582	ENST00000381938.3:c.112C>G	4.37:g.39000506G>C	ENSP00000371364:p.Leu38Val					TMEM156_uc010ifj.2_Missense_Mutation_p.L38V	p.L38V	NM_024943	NP_079219	Q8N614	TM156_HUMAN			2	220	-			38			Extracellular (Potential).		Q9H5N9	Missense_Mutation	SNP	ENST00000381938.3	37	c.112C>G	CCDS3448.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879680	0.51801	.	.	ENSG00000121895	ENST00000381938;ENST00000344606	T;T	0.51574	1.7;0.7	4.89	3.16	0.36331	.	0.410909	0.20636	N	0.088496	T	0.57577	0.2063	L	0.58101	1.795	0.27872	N	0.939984	D	0.76494	0.999	D	0.67103	0.949	T	0.48007	-0.9072	10	0.52906	T	0.07	-7.8694	6.9036	0.24297	0.2016:0.0:0.7984:0.0	.	38	Q8N614	TM156_HUMAN	V	38	ENSP00000371364:L38V;ENSP00000343758:L38V	ENSP00000343758:L38V	L	-	1	2	TMEM156	38676901	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	1.077000	0.30741	1.433000	0.47394	0.655000	0.94253	CTG		0.323	TMEM156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250435.3	NM_024943		13	40	0	0	0	0.00245	0	13	40				
CORIN	10699	broad.mit.edu	37	4	47765481	47765481	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:47765481G>T	ENST00000273857.4	-	4	531	c.532C>A	c.(532-534)Ctc>Atc	p.L178I	CORIN_ENST00000502252.1_Missense_Mutation_p.L111I|CORIN_ENST00000504584.1_Missense_Mutation_p.L178I|CORIN_ENST00000505909.1_Missense_Mutation_p.L178I|CORIN_ENST00000508498.1_Missense_Mutation_p.L39I	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	178	FZ 1. {ECO:0000255|PROSITE- ProRule:PRU00090}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.L178I(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						AGGCGATGGAGATATGTGAAA	0.493																																							uc003gxm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(532-534)CTC>ATC		corin							135.0	118.0	124.0					4																	47765481		2203	4300	6503	SO:0001583	missense	10699				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity	g.chr4:47765481G>T	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.532C>A	4.37:g.47765481G>T	ENSP00000273857:p.Leu178Ile					CORIN_uc011bzf.1_Missense_Mutation_p.L39I|CORIN_uc011bzg.1_Missense_Mutation_p.L111I|CORIN_uc011bzh.1_Missense_Mutation_p.L178I|CORIN_uc011bzi.1_Missense_Mutation_p.L178I|CORIN_uc003gxn.3_Missense_Mutation_p.L178I	p.L178I	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN			4	625	-			178			Extracellular (Potential).|FZ 1.		B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	ENST00000273857.4	37	c.532C>A	CCDS3477.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645631	0.87958	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	T;T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65;-0.65	5.09	5.09	0.68999	Frizzled domain (5);	0.000000	0.64402	D	0.000001	D	0.88966	0.6581	H	0.94847	3.59	0.45108	D	0.998129	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.998;0.996;0.999;0.999	D	0.91869	0.5506	10	0.72032	D	0.01	.	18.8587	0.92264	0.0:0.0:1.0:0.0	.	178;178;111;39;178	B7Z4R1;B4E2W9;B4E1Y7;B4DZA3;Q9Y5Q5	.;.;.;.;CORIN_HUMAN	I	178;39;111;178;178	ENSP00000273857:L178I;ENSP00000425597:L39I;ENSP00000424212:L111I;ENSP00000425401:L178I;ENSP00000423216:L178I	ENSP00000273857:L178I	L	-	1	0	CORIN	47460238	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	8.132000	0.89603	2.528000	0.85240	0.655000	0.94253	CTC		0.493	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2			6	44	1	0	3.59834e-05	0.001168	4.51603e-05	6	44				
NFXL1	152518	broad.mit.edu	37	4	47900034	47900034	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:47900034C>A	ENST00000507489.1	-	9	1330	c.1154G>T	c.(1153-1155)tGt>tTt	p.C385F	NFXL1_ENST00000381538.3_Missense_Mutation_p.C385F|NFXL1_ENST00000329043.3_Missense_Mutation_p.C385F	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	385						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.C385F(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						ACATTCTCCACAAGCACCAAC	0.358																																							uc010igh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(1153-1155)TGT>TTT		nuclear transcription factor, X-box binding-like							105.0	99.0	101.0					4																	47900034		2203	4300	6503	SO:0001583	missense	152518					integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr4:47900034C>A	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.1154G>T	4.37:g.47900034C>A	ENSP00000422037:p.Cys385Phe					NFXL1_uc003gxp.2_Missense_Mutation_p.C385F|NFXL1_uc003gxq.3_RNA|NFXL1_uc010igi.2_Missense_Mutation_p.C385F	p.C385F	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN			9	1331	-			385			NF-X1-type 3.		B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	37	c.1154G>T	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677441	0.88445	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	D;D;D	0.82255	-1.59;-1.59;-1.59	5.92	5.92	0.95590	Zinc finger, NF-X1-type (2);	0.000000	0.85682	D	0.000000	D	0.95162	0.8432	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96259	0.9189	10	0.87932	D	0	-10.6092	20.3206	0.98668	0.0:1.0:0.0:0.0	.	385	Q6ZNB6	NFXL1_HUMAN	F	385	ENSP00000370949:C385F;ENSP00000422037:C385F;ENSP00000333113:C385F	ENSP00000333113:C385F	C	-	2	0	NFXL1	47594791	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.508000	0.81686	2.809000	0.96659	0.655000	0.94253	TGT		0.358	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995		5	48	1	0	5.9392e-07	0.001168	8.20663e-07	5	48				
SPATA18	132671	broad.mit.edu	37	4	52926965	52926965	+	Missense_Mutation	SNP	G	G	T	rs183444588		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:52926965G>T	ENST00000295213.4	+	3	585	c.211G>T	c.(211-213)Gtg>Ttg	p.V71L	SPATA18_ENST00000506829.1_Intron|SPATA18_ENST00000419395.2_Missense_Mutation_p.V71L	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	71					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)		p.V71L(2)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TAATGATGGTGTGGAAACAAT	0.468																																							uc003gzl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)	4						c.(211-213)GTG>TTG		spermatogenesis associated 18 homolog		G	LEU/VAL	0,4406		0,0,2203	155.0	131.0	139.0		211	1.8	0.8	4		139	1,8599	1.2+/-3.3	0,1,4299	no	missense	SPATA18	NM_145263.2	32	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign	71/539	52926965	1,13005	2203	4300	6503	SO:0001583	missense	132671				mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding	g.chr4:52926965G>T	BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.211G>T	4.37:g.52926965G>T	ENSP00000295213:p.Val71Leu					SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Missense_Mutation_p.V71L|SPATA18_uc003gzk.1_Missense_Mutation_p.V71L	p.V71L	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)		3	489	+			71					B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Missense_Mutation	SNP	ENST00000295213.4	37	c.211G>T	CCDS3489.1	.	.	.	.	.	.	.	.	.	.	G	9.328	1.059762	0.19987	0.0	1.16E-4	ENSG00000163071	ENST00000295213;ENST00000419395	T;T	0.35973	1.28;1.33	4.81	1.75	0.24633	.	0.319150	0.32901	N	0.005519	T	0.30978	0.0782	M	0.62723	1.935	0.41892	D	0.990371	B;B;P	0.52316	0.253;0.253;0.952	B;B;B	0.41571	0.178;0.178;0.36	T	0.06661	-1.0814	10	0.51188	T	0.08	-8.473	6.232	0.20740	0.3717:0.0:0.6283:0.0	.	71;71;71	Q8TC71-2;Q8TC71;Q96M13	.;MIEAP_HUMAN;.	L	71	ENSP00000295213:V71L;ENSP00000415309:V71L	ENSP00000295213:V71L	V	+	1	0	SPATA18	52621722	0.840000	0.29493	0.845000	0.33349	0.082000	0.17680	1.032000	0.30178	0.198000	0.20407	0.462000	0.41574	GTG		0.468	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263		18	71	1	0	1.67942e-08	0.006122	2.4345e-08	18	71				
UBA6	55236	broad.mit.edu	37	4	68504691	68504691	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:68504691T>C	ENST00000322244.5	-	19	1765	c.1706A>G	c.(1705-1707)gAt>gGt	p.D569G		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	569					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)	p.D569G(1)		central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TTCCACATTATCTAATGCTGT	0.343																																							uc003hdg.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1705-1707)GAT>GGT		ubiquitin-activating enzyme E1-like 2							170.0	157.0	162.0					4																	68504691		2203	4299	6502	SO:0001583	missense	55236				protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding	g.chr4:68504691T>C	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.1706A>G	4.37:g.68504691T>C	ENSP00000313454:p.Asp569Gly					UBA6_uc003hdh.1_Missense_Mutation_p.D95G	p.D569G	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN			19	1758	-			569					A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	ENST00000322244.5	37	c.1706A>G	CCDS3516.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.5|23.5	4.418653|4.418653	0.83559|0.83559	.|.	.|.	ENSG00000033178|ENSG00000033178	ENST00000322244|ENST00000505673	T|.	0.77620|.	-1.11|.	5.63|5.63	5.63|5.63	0.86233|0.86233	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88362|0.88362	0.6416|0.6416	H|H	0.97240|0.97240	3.965|3.965	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.92458|0.92458	0.5975|0.5975	10|5	0.87932|.	D|.	0|.	-0.1177|-0.1177	15.8337|15.8337	0.78782|0.78782	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	569|.	A0AVT1|.	UBA6_HUMAN|.	G|V	569|103	ENSP00000313454:D569G|.	ENSP00000313454:D569G|.	D|I	-|-	2|1	0|0	UBA6|UBA6	68187286|68187286	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.841000|0.841000	0.47740|0.47740	7.477000|7.477000	0.81069|0.81069	2.153000|2.153000	0.67306|0.67306	0.482000|0.482000	0.46254|0.46254	GAT|ATA		0.343	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227		6	97	0	0	0	0.001168	0	6	97				
TMPRSS11F	389208	broad.mit.edu	37	4	68938203	68938203	+	Splice_Site	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:68938203G>T	ENST00000356291.2	-	5	411	c.352C>A	c.(352-354)Cca>Aca	p.P118T	UBA6-AS1_ENST00000500538.2_RNA|UBA6-AS1_ENST00000499180.2_RNA|UBA6-AS1_ENST00000511571.1_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	118	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.P118T(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						TGTTCATCTGGACTGAAGAAC	0.294																																							uc003hdt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(352-354)CCA>ACA		transmembrane protease, serine 11F							75.0	75.0	75.0					4																	68938203		2203	4300	6503	SO:0001630	splice_region_variant	389208				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity	g.chr4:68938203G>T	AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.351-1C>A	4.37:g.68938203G>T						LOC550112_uc003hdl.3_Intron|uc011cak.1_Intron	p.P118T	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN			5	401	-			118			SEA.|Extracellular (Potential).		A8MXX2	Missense_Mutation	SNP	ENST00000356291.2	37	c.352C>A	CCDS3520.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721844	0.68959	.	.	ENSG00000198092	ENST00000356291	T	0.44083	0.93	6.07	6.07	0.98685	SEA (3);	0.000000	0.53938	D	0.000045	T	0.65595	0.2706	M	0.77313	2.365	0.39348	D	0.965704	D	0.89917	1.0	D	0.91635	0.999	T	0.63800	-0.6555	10	0.35671	T	0.21	.	16.1594	0.81686	0.0:0.0:1.0:0.0	.	118	Q6ZWK6	TM11F_HUMAN	T	118	ENSP00000348639:P118T	ENSP00000348639:P118T	P	-	1	0	TMPRSS11F	68620798	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	4.922000	0.63404	2.885000	0.99019	0.655000	0.94253	CCA		0.294	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407	Missense_Mutation	11	67	1	0	5.50884e-06	0.001368	7.28881e-06	11	67				
GRID2	2895	broad.mit.edu	37	4	94690466	94690466	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:94690466A>T	ENST00000282020.4	+	15	2724	c.2466A>T	c.(2464-2466)aaA>aaT	p.K822N	GRID2_ENST00000510992.1_Missense_Mutation_p.K727N	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	822					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.K822N(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		CAAAGCAGAAAGGAGGCGCCC	0.522																																							uc011cdt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|large_intestine(1)	6						c.(2464-2466)AAA>AAT		glutamate receptor, ionotropic, delta 2	L-Glutamic Acid(DB00142)						120.0	124.0	123.0					4																	94690466		2203	4300	6503	SO:0001583	missense	2895				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr4:94690466A>T	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.2466A>T	4.37:g.94690466A>T	ENSP00000282020:p.Lys822Asn					GRID2_uc011cdu.1_Missense_Mutation_p.K727N	p.K822N	NM_001510	NP_001501	O43424	GRID2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	15	2724	+		Hepatocellular(203;0.114)|all_hematologic(202;0.177)	822			Extracellular (Potential).		E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	c.2466A>T	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	A	13.90	2.374259	0.42105	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.54675	0.56;0.56	5.17	3.77	0.43336	Ionotropic glutamate receptor (1);	0.205916	0.50627	D	0.000109	T	0.31702	0.0805	N	0.11870	0.19	0.47905	D	0.999543	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.08743	-1.0707	10	0.66056	D	0.02	.	7.141	0.25556	0.7851:0.0:0.2149:0.0	.	727;822	E9PH24;O43424	.;GRID2_HUMAN	N	822;727	ENSP00000282020:K822N;ENSP00000421257:K727N	ENSP00000282020:K822N	K	+	3	2	GRID2	94909489	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.836000	0.27545	0.622000	0.30249	0.528000	0.53228	AAA		0.522	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2			6	81	0	0	0	0.00308	0	6	81				
UNC5C	8633	broad.mit.edu	37	4	96124011	96124011	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:96124011C>A	ENST00000453304.1	-	12	2355	c.2007G>T	c.(2005-2007)ctG>ctT	p.L669L		NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	669					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.L669L(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		AATGTCCTACCAGGGCGTAGG	0.597																																							uc003htp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(2005-2007)CTG>CTT		unc5C precursor							130.0	125.0	127.0					4																	96124011		2203	4300	6503	SO:0001819	synonymous_variant	8633				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity	g.chr4:96124011C>A	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.2007G>T	4.37:g.96124011C>A						UNC5C_uc010ilc.1_Silent_p.L688L	p.L669L	NM_003728	NP_003719	O95185	UNC5C_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)	12	2161	-		Hepatocellular(203;0.114)	669			Cytoplasmic (Potential).		Q8IUT0	Silent	SNP	ENST00000453304.1	37	c.2007G>T	CCDS3643.1																																																																																				0.597	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728		16	90	1	0	3.32936e-07	0.006122	4.62319e-07	16	90				
NDST4	64579	broad.mit.edu	37	4	115997569	115997569	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:115997569G>T	ENST00000264363.2	-	2	1302	c.624C>A	c.(622-624)ccC>ccA	p.P208P		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	208	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.P208P(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TCTCAACCTTGGGGGCTTTGG	0.398																																							uc003ibu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(1)	4						c.(622-624)CCC>CCA		heparan sulfate N-deacetylase/N-sulfotransferase							71.0	71.0	71.0					4																	115997569		2203	4300	6503	SO:0001819	synonymous_variant	64579					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:115997569G>T	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.624C>A	4.37:g.115997569G>T						NDST4_uc010imw.2_Intron	p.P208P	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000562)	2	1303	-		Ovarian(17;0.156)	208			Lumenal (Potential).|Heparan sulfate N-deacetylase 4.		Q2KHM8	Silent	SNP	ENST00000264363.2	37	c.624C>A	CCDS3706.1																																																																																				0.398	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569		21	111	1	0	7.41877e-09	0.001882	1.08102e-08	21	111				
INTU	27152	broad.mit.edu	37	4	128564978	128564978	+	Missense_Mutation	SNP	C	C	T	rs147508682		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:128564978C>T	ENST00000335251.6	+	2	552	c.449C>T	c.(448-450)aCa>aTa	p.T150I	INTU_ENST00000296461.5_Missense_Mutation_p.T150I	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	150					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)		p.T150I(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						AATCAGAAGACAGGAGTCATT	0.378																																							uc003ifk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(448-450)ACA>ATA		PDZ domain containing 6							89.0	88.0	88.0					4																	128564978		2203	4300	6503	SO:0001583	missense	27152							g.chr4:128564978C>T	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.449C>T	4.37:g.128564978C>T	ENSP00000334003:p.Thr150Ile					INTU_uc011cgq.1_RNA	p.T150I	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN			2	519	+			150					A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	37	c.449C>T	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	C	10.94	1.493601	0.26774	.	.	ENSG00000164066	ENST00000504491;ENST00000335251;ENST00000296461	T	0.48201	0.82	5.1	3.23	0.37069	.	0.574176	0.19370	N	0.115925	T	0.35098	0.0920	L	0.44542	1.39	0.27713	N	0.945387	B	0.26002	0.139	B	0.20767	0.031	T	0.20571	-1.0271	10	0.40728	T	0.16	-1.4492	6.8497	0.24008	0.0:0.7124:0.0:0.2876	.	150	Q9ULD6	PDZD6_HUMAN	I	131;150;150	ENSP00000296461:T150I	ENSP00000296461:T150I	T	+	2	0	INTU	128784428	0.962000	0.33011	0.983000	0.44433	0.789000	0.44602	0.795000	0.26972	1.389000	0.46526	0.655000	0.94253	ACA		0.378	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707		16	101	0	0	0	0.00499	0	16	101				
FGB	2244	broad.mit.edu	37	4	155489541	155489541	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr4:155489541G>A	ENST00000302068.4	+	5	790	c.727G>A	c.(727-729)Gaa>Aaa	p.E243K	FGB_ENST00000502545.1_3'UTR|FGB_ENST00000509493.1_Missense_Mutation_p.E24K	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	243	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)	p.E243K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	AGAATGTGAGGAAATTATCAG	0.318																																					NSCLC(106;1133 1613 21870 46110 52656)	NSCLC(106;1133 1613 21870 46110 52656)	uc003ioa.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(727-729)GAA>AAA		fibrinogen, beta chain preproprotein	Sucralfate(DB00364)						116.0	115.0	116.0					4																	155489541		2203	4300	6503	SO:0001583	missense	2244				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding	g.chr4:155489541G>A		CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.727G>A	4.37:g.155489541G>A	ENSP00000306099:p.Glu243Lys					FGB_uc003iob.3_Missense_Mutation_p.E240K|FGB_uc010ipv.2_Missense_Mutation_p.E181K|FGB_uc010ipw.2_Missense_Mutation_p.E240K|FGB_uc003ioc.3_Missense_Mutation_p.E24K	p.E243K	NM_005141	NP_005132	P02675	FIBB_HUMAN			5	766	+	all_hematologic(180;0.215)	Renal(120;0.0458)	243			Fibrinogen C-terminal.		A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	ENST00000302068.4	37	c.727G>A	CCDS3786.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.827448	0.90955	.	.	ENSG00000171564	ENST00000302068;ENST00000537843;ENST00000509493	D;D	0.84442	-1.85;-1.85	5.8	5.8	0.92144	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.179649	0.64402	D	0.000014	D	0.84338	0.5450	L	0.49640	1.575	0.58432	D	0.999999	B;B	0.30114	0.269;0.138	B;B	0.31946	0.117;0.138	T	0.82392	-0.0480	10	0.62326	D	0.03	.	20.0591	0.97667	0.0:0.0:1.0:0.0	.	226;243	B4E1D3;P02675	.;FIBB_HUMAN	K	243;226;24	ENSP00000306099:E243K;ENSP00000426757:E24K	ENSP00000306099:E243K	E	+	1	0	FGB	155708991	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.813000	0.99286	2.739000	0.93911	0.491000	0.48974	GAA		0.318	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317595.1	NM_005141		4	79	0	0	0	0.000602	0	4	79				
DNAH5	1767	broad.mit.edu	37	5	13923425	13923425	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:13923425G>A	ENST00000265104.4	-	4	506	c.402C>T	c.(400-402)gaC>gaT	p.D134D		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	134	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.D134D(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTTTGGAAGGGTCAGTCCTGA	0.433									Kartagener syndrome																														uc003jfd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(400-402)GAC>GAT		dynein, axonemal, heavy chain 5							270.0	262.0	265.0					5																	13923425		2203	4300	6503	SO:0001819	synonymous_variant	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13923425G>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.402C>T	5.37:g.13923425G>A						DNAH5_uc003jfe.1_RNA	p.D134D	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN			4	444	-	Lung NSC(4;0.00476)		134			Stem (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	c.402C>T	CCDS3882.1																																																																																				0.433	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		59	331	0	0	0	0.00361	0	59	331				
CDH9	1007	broad.mit.edu	37	5	26881273	26881273	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:26881273T>A	ENST00000231021.4	-	12	2514	c.2342A>T	c.(2341-2343)tAt>tTt	p.Y781F		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	781					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y781F(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ATCACCCCCATACATATCGGC	0.413																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(2341-2343)TAT>TTT		cadherin 9, type 2 preproprotein							143.0	138.0	140.0					5																	26881273		2203	4299	6502	SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26881273T>A	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2342A>T	5.37:g.26881273T>A	ENSP00000231021:p.Tyr781Phe					CDH9_uc011cnv.1_Missense_Mutation_p.Y374F	p.Y781F	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN			12	2511	-			781			Cytoplasmic (Potential).		Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.2342A>T	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	T	18.12	3.552642	0.65425	.	.	ENSG00000113100	ENST00000231021	T	0.80994	-1.44	5.26	5.26	0.73747	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	T	0.79118	0.4392	L	0.43757	1.38	0.50171	D	0.999858	B;B	0.32409	0.37;0.225	B;B	0.42422	0.387;0.364	T	0.75822	-0.3182	9	.	.	.	.	14.0088	0.64483	0.0:0.0:0.0:1.0	.	374;781	B4DFP0;Q9ULB4	.;CADH9_HUMAN	F	781	ENSP00000231021:Y781F	.	Y	-	2	0	CDH9	26917030	1.000000	0.71417	0.999000	0.59377	0.925000	0.55904	8.013000	0.88655	1.988000	0.58038	0.455000	0.32223	TAT		0.413	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		41	181	0	0	0	0.00361	0	41	181				
SPEF2	79925	broad.mit.edu	37	5	35776410	35776410	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:35776410T>A	ENST00000356031.3	+	29	4284	c.4130T>A	c.(4129-4131)cTt>cAt	p.L1377H	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Missense_Mutation_p.L1372H|SPEF2_ENST00000303129.4_5'Flank	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1377					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.L1377H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCATTGGCTCTTCTTGAAGAT	0.348																																							uc003jjo.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(4129-4131)CTT>CAT		KPL2 protein isoform 1							151.0	144.0	146.0					5																	35776410		1830	4091	5921	SO:0001583	missense	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35776410T>A	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4130T>A	5.37:g.35776410T>A	ENSP00000348314:p.Leu1377His					SPEF2_uc003jjp.1_Missense_Mutation_p.L863H|SPEF2_uc003jjr.2_5'UTR	p.L1377H	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		29	4241	+	all_lung(31;7.56e-05)		1377					Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	c.4130T>A	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	T	1.807	-0.475576	0.04414	.	.	ENSG00000152582	ENST00000356031;ENST00000440995	T;T	0.05717	3.4;3.4	5.66	-3.04	0.05412	.	0.836562	0.10932	N	0.618315	T	0.02455	0.0075	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47302	-0.9128	10	0.15952	T	0.53	.	0.4901	0.00562	0.236:0.1508:0.2214:0.3918	.	1372;1377	Q9C093-2;Q9C093	.;SPEF2_HUMAN	H	1377;1372	ENSP00000348314:L1377H;ENSP00000412125:L1372H	ENSP00000348314:L1377H	L	+	2	0	SPEF2	35812167	0.002000	0.14202	0.017000	0.16124	0.558000	0.35554	0.174000	0.16743	-0.132000	0.11557	-0.666000	0.03841	CTT		0.348	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		5	138	0	0	0	0.001168	0	5	138				
C6	729	broad.mit.edu	37	5	41186174	41186174	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:41186174C>G	ENST00000263413.3	-	6	988	c.724G>C	c.(724-726)Gag>Cag	p.E242Q	C6_ENST00000337836.5_Missense_Mutation_p.E242Q|C6_ENST00000475349.1_Intron	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	242	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.E242Q(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TGTCATACCTCAAAGCCGACA	0.408																																							uc003jmk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(2)	7						c.(724-726)GAG>CAG		complement component 6 precursor							126.0	113.0	117.0					5																	41186174		2203	4300	6503	SO:0001583	missense	729				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding	g.chr5:41186174C>G	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.724G>C	5.37:g.41186174C>G	ENSP00000263413:p.Glu242Gln					C6_uc003jml.1_Missense_Mutation_p.E242Q	p.E242Q	NM_000065	NP_000056	P13671	CO6_HUMAN			6	934	-		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)	242			MACPF.			Missense_Mutation	SNP	ENST00000263413.3	37	c.724G>C	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	C	7.676	0.688053	0.14973	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.60171	0.21;0.21	5.99	3.07	0.35406	Membrane attack complex component/perforin (MACPF) domain (1);	0.250304	0.47093	N	0.000250	T	0.34250	0.0891	N	0.20766	0.605	0.34647	D	0.721204	B	0.29481	0.245	B	0.20955	0.032	T	0.35895	-0.9770	10	0.19590	T	0.45	-18.7605	7.5386	0.27725	0.0:0.4447:0.4009:0.1544	.	242	P13671	CO6_HUMAN	Q	242	ENSP00000338861:E242Q;ENSP00000263413:E242Q	ENSP00000263413:E242Q	E	-	1	0	C6	41221931	1.000000	0.71417	0.999000	0.59377	0.534000	0.34807	1.344000	0.33941	0.837000	0.34925	0.655000	0.94253	GAG		0.408	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1			8	62	0	0	0	0.006214	0	8	62				
OXCT1	5019	broad.mit.edu	37	5	41870398	41870398	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:41870398C>T	ENST00000196371.5	-	1	223	c.63G>A	c.(61-63)ggG>ggA	p.G21G	OXCT1-AS1_ENST00000508458.1_RNA	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	21					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)	p.G21G(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	ACCAGGTTGCCCCAGATCCGC	0.642																																							uc003jmn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(61-63)GGG>GGA		3-oxoacid CoA transferase 1 precursor	Succinic acid(DB00139)						73.0	64.0	67.0					5																	41870398		2203	4300	6503	SO:0001819	synonymous_variant	5019				cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity	g.chr5:41870398C>T	U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.63G>A	5.37:g.41870398C>T							p.G21G	NM_000436	NP_000427	P55809	SCOT1_HUMAN			1	394	-			21					B2R5V2|B7Z528	Silent	SNP	ENST00000196371.5	37	c.63G>A	CCDS3937.1																																																																																				0.642	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436		3	23	0	0	0	0.000602	0	3	23				
ADAMTS6	11174	broad.mit.edu	37	5	64468799	64468799	+	5'UTR	SNP	T	T	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:64468799T>G	ENST00000314351.5	-	0	606							Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6							proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.I154L(1)|p.I983L(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CACAGAACAATCCGATGCTTG	0.443																																							uc003jtp.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2947-2949)ATT>CTT		ADAM metallopeptidase with thrombospondin type 1							167.0	147.0	154.0					5																	64468799		2203	4300	6503	SO:0001623	5_prime_UTR_variant	11174				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:64468799T>G	AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000314351.5:c.-716A>C	5.37:g.64468799T>G						ADAMTS6_uc003jto.2_RNA|ADAMTS6_uc003jtq.2_RNA	p.I983L	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN		Lung(70;0.00942)	23	3761	-		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)	983			TSP type-1 4.		Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	ENST00000314351.5	37	c.2947A>C		.	.	.	.	.	.	.	.	.	.	T	17.56	3.420844	0.62622	.	.	ENSG00000049192	ENST00000381055	T	0.60040	0.22	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.50326	0.1609	N	0.20328	0.56	0.80722	D	1	B	0.30526	0.283	B	0.40256	0.324	T	0.49113	-0.8973	10	0.30854	T	0.27	.	15.711	0.77626	0.0:0.0:0.0:1.0	.	983	Q9UKP5	ATS6_HUMAN	L	983	ENSP00000370443:I983L	ENSP00000370443:I983L	I	-	1	0	ADAMTS6	64504555	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.956000	0.70315	2.105000	0.64084	0.528000	0.53228	ATT		0.443	ADAMTS6-006	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000157334.2	NM_197941		5	111	0	0	0	0.000602	0	5	111				
BDP1	55814	broad.mit.edu	37	5	70806102	70806102	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:70806102G>T	ENST00000358731.4	+	17	3446	c.3183G>T	c.(3181-3183)gaG>gaT	p.E1061D	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	1061	9 X 55 AA repeats of G-R-R-X-I-S-P-X-E-N- G-X-E-E-V-K-P-X-X-E-M-E-T-D-L-K-X-T-G-R- E-X-X-X-R-E-K-T-X-E-X-X-D-A-X-E-E-I-D-X- D-L-E-E-T.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E1061D(1)		NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		GTGAAATGGAGACGGATTTGA	0.433																																							uc003kbp.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(3181-3183)GAG>GAT		transcription factor-like nuclear regulator							77.0	78.0	78.0					5																	70806102		1852	4101	5953	SO:0001583	missense	55814				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding	g.chr5:70806102G>T	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.3183G>T	5.37:g.70806102G>T	ENSP00000351575:p.Glu1061Asp					BDP1_uc003kbn.1_Missense_Mutation_p.E1061D|BDP1_uc003kbo.2_Missense_Mutation_p.E1061D	p.E1061D	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)	17	3446	+		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)	1061			5.|9 X 55 AA repeats of G-R-R-X-I-S-P-X-E-N- G-X-E-E-V-K-P-X-X-E-M-E-T-D-L-K-X-T-G-R- E-X-X-X-R-E-K-T-X-E-X-X-D-A-X-E-E-I-D-X- D-L-E-E-T.		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	c.3183G>T	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	g	8.725	0.915390	0.17907	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.18960	2.18	2.93	-1.14	0.09741	.	.	.	.	.	T	0.12305	0.0299	L	0.32530	0.975	0.09310	N	0.999999	B;B;B	0.21225	0.004;0.011;0.053	B;B;B	0.18263	0.006;0.01;0.021	T	0.30966	-0.9960	9	0.33940	T	0.23	.	2.7374	0.05244	0.3773:0.0:0.4145:0.2082	.	1061;1061;1061	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	D	1061;641	ENSP00000351575:E1061D	ENSP00000351575:E1061D	E	+	3	2	BDP1	70841858	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.139000	0.10358	-0.298000	0.08921	0.205000	0.17691	GAG		0.433	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429		7	73	1	0	0.00198382	0.001984	0.00223928	7	73				
PRR16	51334	broad.mit.edu	37	5	120021828	120021828	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:120021828C>T	ENST00000407149.2	+	2	548	c.339C>T	c.(337-339)atC>atT	p.I113I	PRR16_ENST00000379551.2_Silent_p.I90I|PRR16_ENST00000505123.1_Silent_p.I43I|PRR16_ENST00000446965.1_Silent_p.I43I			Q569H4	LARGN_HUMAN	proline rich 16	113	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)			p.I90I(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CGTCTGCTATCCTCACGGTCC	0.527																																							uc003ksq.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(337-339)ATC>ATT		proline rich 16							144.0	127.0	133.0					5																	120021828		2203	4300	6503	SO:0001819	synonymous_variant	51334							g.chr5:120021828C>T	AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.339C>T	5.37:g.120021828C>T						PRR16_uc003ksp.2_Silent_p.I90I|PRR16_uc003ksr.2_Silent_p.I43I	p.I113I	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)	2	502	+		all_cancers(142;0.0464)|Prostate(80;0.00446)	113			Pro-rich.		D3DSZ0|Q8IXY1|Q9NYI5	Silent	SNP	ENST00000407149.2	37	c.339C>T																																																																																					0.527	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644		6	81	0	0	0	0.001984	0	6	81				
FBN2	2201	broad.mit.edu	37	5	127686665	127686666	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:127686665_127686666GG>TT	ENST00000508053.1	-	27	3680_3681	c.2706_2707CC>AA	c.(2704-2709)atCCag>atAAag	p.Q903K	FBN2_ENST00000262464.4_Missense_Mutation_p.Q903K|FBN2_ENST00000508989.1_Missense_Mutation_p.Q870K			P35556	FBN2_HUMAN	fibrillin 2	903	TB 4.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.Q903K(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CGGCTGTCCTGGATGTTGAGCC	0.53																																							uc003kuu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(2704-2709)ATCCAG>ATAAAG		fibrillin 2 precursor																																				SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127686665_127686666GG>TT	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2706_2707delinsTT	5.37:g.127686665_127686666delinsTT	ENSP00000424571:p.Gln903Lys					FBN2_uc003kuv.2_Missense_Mutation_p.Q870K	p.Q903K	NM_001999	NP_001990	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	21	3145_3146	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	903			TB 4.		B4DU01|Q59ES6	Missense_Mutation	DNP	ENST00000508053.1	37	c.2706_2707CC>AA	CCDS34222.1																																																																																				0.530	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		11	64	0	0	0	0.004672	0	11	64				
ADAMTS19	171019	broad.mit.edu	37	5	128862031	128862031	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:128862031A>T	ENST00000274487.4	+	4	1095	c.950A>T	c.(949-951)tAt>tTt	p.Y317F	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	317						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Y317F(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GGGAAACGATATTCATACAAA	0.393																																							uc003kvb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(2)|lung(1)|skin(1)	9						c.(949-951)TAT>TTT		ADAM metallopeptidase with thrombospondin type 1							93.0	86.0	89.0					5																	128862031		2203	4300	6503	SO:0001583	missense	171019				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:128862031A>T	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.950A>T	5.37:g.128862031A>T	ENSP00000274487:p.Tyr317Phe					ADAMTS19_uc003kvc.1_RNA	p.Y317F	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)	4	950	+		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	317						Missense_Mutation	SNP	ENST00000274487.4	37	c.950A>T	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.432737	0.43224	.	.	ENSG00000145808	ENST00000274487	T	0.64085	-0.08	4.45	3.3	0.37823	.	0.182769	0.36932	N	0.002324	T	0.49287	0.1548	N	0.14661	0.345	0.41219	D	0.986499	D	0.60575	0.988	P	0.49953	0.627	T	0.42899	-0.9424	9	.	.	.	.	10.4919	0.44756	0.922:0.0:0.078:0.0	.	317	Q8TE59	ATS19_HUMAN	F	317	ENSP00000274487:Y317F	.	Y	+	2	0	ADAMTS19	128889930	1.000000	0.71417	0.992000	0.48379	0.936000	0.57629	3.910000	0.56371	1.044000	0.40200	0.455000	0.32223	TAT		0.393	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638		5	77	0	0	0	0.001168	0	5	77				
TRPC7	57113	broad.mit.edu	37	5	135549258	135549258	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:135549258G>T	ENST00000513104.1	-	12	2736	c.2454C>A	c.(2452-2454)agC>agA	p.S818R	TRPC7-AS1_ENST00000514459.1_RNA|TRPC7_ENST00000426057.2_Missense_Mutation_p.S702R|TRPC7_ENST00000355180.3_Missense_Mutation_p.S757R	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	818					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.S818R(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CATAGCGCAGGCTGGAGATAT	0.483																																							uc003lbn.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2449-2451)AGC>AGA		transient receptor potential cation channel,							91.0	87.0	88.0					5																	135549258		2003	4185	6188	SO:0001583	missense	57113				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding	g.chr5:135549258G>T	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.2454C>A	5.37:g.135549258G>T	ENSP00000426070:p.Ser818Arg					TRPC7_uc010jef.1_Missense_Mutation_p.S754R|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.S748R|TRPC7_uc010jei.1_Missense_Mutation_p.S693R|TRPC7_uc010jej.1_Missense_Mutation_p.S369R	p.S817R	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		11	2454	-			818			Cytoplasmic (Potential).		A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	37	c.2451C>A	CCDS47267.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.30|17.30	3.353648|3.353648	0.61293|0.61293	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753|ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	.|D;D;D	.|0.87179	.|-2.22;-2.22;-2.22	4.89|4.89	3.08|3.08	0.35506|0.35506	.|.	.|0.082676	.|0.85682	.|D	.|0.000000	D|D	0.92525|0.92525	0.7626|0.7626	M|M	0.85859|0.85859	2.78|2.78	0.40289|0.40289	D|D	0.97848|0.97848	.|D;D;D;D	.|0.89917	.|0.999;1.0;1.0;0.999	.|D;D;D;D	.|0.97110	.|0.991;0.997;1.0;0.996	D|D	0.92427|0.92427	0.5950|0.5950	5|10	.|0.87932	.|D	.|0	-21.1984|-21.1984	8.2216|8.2216	0.31545|0.31545	0.2882:0.0:0.7118:0.0|0.2882:0.0:0.7118:0.0	.|.	.|702;757;763;818	.|Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.|.;.;.;TRPC7_HUMAN	T|R	702;757;763|757;702;818;818	.|ENSP00000347312:S757R;ENSP00000441628:S702R;ENSP00000426070:S818R	.|ENSP00000265193:S818R	P|S	-|-	1|3	0|2	TRPC7|TRPC7	135577157|135577157	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.689000|0.689000	0.40095|0.40095	2.100000|2.100000	0.41777|0.41777	1.281000|1.281000	0.44480|0.44480	0.561000|0.561000	0.74099|0.74099	CCT|AGC		0.483	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389		13	42	1	0	5.50884e-06	0.001368	7.28881e-06	13	42				
PCDHA4	56144	broad.mit.edu	37	5	140186910	140186910	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:140186910C>A	ENST00000530339.1	+	1	138	c.138C>A	c.(136-138)ggC>ggA	p.G46G	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Silent_p.G46G|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Silent_p.G46G	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	46	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G46G(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTCGTGGGCCGCATCGCGC	0.662																																							uc003lhi.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|skin(2)	6						c.(136-138)GGC>GGA		protocadherin alpha 4 isoform 1 precursor							54.0	61.0	59.0					5																	140186910		2203	4300	6503	SO:0001819	synonymous_variant	56144				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140186910C>A	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.138C>A	5.37:g.140186910C>A						PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Silent_p.G46G|PCDHA4_uc011daa.1_Silent_p.G46G	p.G46G	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	239	+			46			Cadherin 1.|Extracellular (Potential).		O75285|Q2M253	Silent	SNP	ENST00000530339.1	37	c.138C>A	CCDS54916.1																																																																																				0.662	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907		16	61	1	0	6.72482e-11	0.003163	1.02239e-10	16	61				
PCDHA4	56144	broad.mit.edu	37	5	140189058	140189058	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:140189058G>T	ENST00000530339.1	+	1	2286	c.2286G>T	c.(2284-2286)gaG>gaT	p.E762D	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.E762D|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.E762D	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	762	6 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E762D(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCTGGTGAGGGCCCACCCA	0.622																																							uc003lhi.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(2284-2286)GAG>GAT		protocadherin alpha 4 isoform 1 precursor							106.0	110.0	108.0					5																	140189058		2203	4300	6503	SO:0001583	missense	56144				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140189058G>T	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.2286G>T	5.37:g.140189058G>T	ENSP00000435300:p.Glu762Asp					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Missense_Mutation_p.E762D|PCDHA4_uc011daa.1_Missense_Mutation_p.E762D	p.E762D	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2387	+			762			Cytoplasmic (Potential).|6 X 4 AA repeats of P-X-X-P.		O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	c.2286G>T	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	g	8.176	0.792676	0.16258	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.15372	2.43;2.43;2.43	3.83	0.705	0.18127	.	0.172378	0.27172	U	0.020594	T	0.17577	0.0422	M	0.81341	2.54	0.09310	N	1	B;B;B	0.30406	0.278;0.053;0.019	B;B;B	0.33196	0.159;0.028;0.033	T	0.18808	-1.0325	10	0.41790	T	0.15	.	1.2716	0.02022	0.2662:0.1478:0.4346:0.1513	.	762;762;762	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	D	762	ENSP00000423470:E762D;ENSP00000349344:E762D;ENSP00000435300:E762D	ENSP00000349344:E762D	E	+	3	2	PCDHA4	140169242	0.929000	0.31497	0.757000	0.31301	0.468000	0.32798	-0.001000	0.12947	0.245000	0.21373	-0.439000	0.05793	GAG		0.622	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907		21	69	1	0	2.4624e-09	0.008871	3.64487e-09	21	69				
PCDHA11	56138	broad.mit.edu	37	5	140250586	140250586	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:140250586C>A	ENST00000398640.2	+	1	1898	c.1898C>A	c.(1897-1899)aCg>aAg	p.T633K	PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000506939.2_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	633	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T633K(1)		breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATAAGCACAACGCGTGCCCTG	0.662																																							uc003lia.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1897-1899)ACG>AAG		protocadherin alpha 11 isoform 1 precursor							48.0	56.0	53.0					5																	140250586		2203	4298	6501	SO:0001583	missense	56138				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140250586C>A	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1898C>A	5.37:g.140250586C>A	ENSP00000381636:p.Thr633Lys					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.T633K	p.T633K	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2756	+			633			Extracellular (Potential).|Cadherin 6.		B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	37	c.1898C>A	CCDS47284.1	.	.	.	.	.	.	.	.	.	.	C	8.469	0.857007	0.17106	.	.	ENSG00000249158	ENST00000398640	T	0.53640	0.61	4.78	3.91	0.45181	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.48624	0.1510	L	0.43923	1.385	0.27019	N	0.964508	D;P	0.55385	0.971;0.768	P;P	0.51055	0.633;0.657	T	0.36311	-0.9753	9	0.52906	T	0.07	.	9.7376	0.40397	0.0:0.7776:0.1429:0.0795	.	633;633	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	K	633	ENSP00000381636:T633K	ENSP00000381636:T633K	T	+	2	0	PCDHA11	140230770	0.016000	0.18221	0.941000	0.38009	0.034000	0.12701	1.739000	0.38217	1.000000	0.39049	0.556000	0.70494	ACG		0.662	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902		10	44	1	0	5.50884e-06	0.001368	7.28881e-06	10	44				
PCDHB10	56126	broad.mit.edu	37	5	140573083	140573083	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:140573083C>G	ENST00000239446.4	+	1	1142	c.958C>G	c.(958-960)Cag>Gag	p.Q320E		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	320	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q320E(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AATAAATATACAGGCAATGGA	0.368																																							uc003lix.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(958-960)CAG>GAG		protocadherin beta 10 precursor							69.0	73.0	71.0					5																	140573083		2203	4300	6503	SO:0001583	missense	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140573083C>G	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.958C>G	5.37:g.140573083C>G	ENSP00000239446:p.Gln320Glu						p.Q320E	NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1132	+			320			Extracellular (Potential).|Cadherin 3.		Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	c.958C>G	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.678161	0.00751	.	.	ENSG00000120324	ENST00000239446	T	0.01685	4.69	3.41	1.34	0.21922	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.02533	0.0077	N	0.20986	0.625	0.18873	N	0.999981	D	0.55605	0.972	P	0.58210	0.835	T	0.36383	-0.9750	9	0.07482	T	0.82	.	9.082	0.36558	0.1456:0.5681:0.2862:0.0	.	320	Q9UN67	PCDBA_HUMAN	E	320	ENSP00000239446:Q320E	ENSP00000239446:Q320E	Q	+	1	0	PCDHB10	140553267	0.000000	0.05858	0.988000	0.46212	0.732000	0.41865	-0.716000	0.04991	0.760000	0.33108	0.556000	0.70494	CAG		0.368	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		4	97	0	0	0	0.009096	0	4	97				
PCDHB12	56124	broad.mit.edu	37	5	140589623	140589623	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:140589623G>T	ENST00000239450.2	+	1	1333	c.1144G>T	c.(1144-1146)Gtt>Ttt	p.V382F	PCDHB12_ENST00000541609.1_Missense_Mutation_p.V45F	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	382	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V382F(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGAAAGATGGTTTGTTCTAT	0.458																																							uc003liz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1144-1146)GTT>TTT		protocadherin beta 12 precursor							71.0	68.0	69.0					5																	140589623		2203	4300	6503	SO:0001583	missense	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140589623G>T	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1144G>T	5.37:g.140589623G>T	ENSP00000239450:p.Val382Phe					PCDHB12_uc011dak.1_Missense_Mutation_p.V45F	p.V382F	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1333	+			382			Extracellular (Potential).|Cadherin 4.		B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	c.1144G>T	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	G	4.779	0.144836	0.09134	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.51071	0.72;0.72	4.06	0.519	0.17035	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.62392	0.2424	M	0.85373	2.75	0.09310	N	1	P	0.42248	0.774	P	0.55871	0.786	T	0.54289	-0.8316	9	0.87932	D	0	.	4.8475	0.13521	0.2507:0.0:0.5906:0.1587	.	382	Q9Y5F1	PCDBC_HUMAN	F	45;382;2	ENSP00000440199:V45F;ENSP00000239450:V382F	ENSP00000239450:V382F	V	+	1	0	PCDHB12	140569807	0.000000	0.05858	0.012000	0.15200	0.050000	0.14768	-3.629000	0.00409	0.190000	0.20209	0.491000	0.48974	GTT		0.458	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		10	38	1	0	1.08611e-07	0.000978	1.52708e-07	10	38				
PCDHGA8	9708	broad.mit.edu	37	5	140774087	140774087	+	Silent	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:140774087A>G	ENST00000398604.2	+	1	1707	c.1707A>G	c.(1705-1707)acA>acG	p.T569T	PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	569					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T569T(1)		endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCTCCCCACAGACGGTTCCA	0.667																																							uc003lkd.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1705-1707)ACA>ACG		protocadherin gamma subfamily A, 8 isoform 1							89.0	104.0	99.0					5																	140774087		2202	4298	6500	SO:0001819	synonymous_variant	9708				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140774087A>G	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1707A>G	5.37:g.140774087A>G						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Silent_p.T569T	p.T569T	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2605	+			569			Extracellular (Potential).		A7MCZ4|O15039	Silent	SNP	ENST00000398604.2	37	c.1707A>G	CCDS47291.1																																																																																				0.667	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088		6	117	0	0	0	0.004482	0	6	117				
PPARGC1B	133522	broad.mit.edu	37	5	149215939	149215939	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:149215939G>T	ENST00000309241.5	+	8	1953	c.1921G>T	c.(1921-1923)Ggc>Tgc	p.G641C	PPARGC1B_ENST00000394320.3_Missense_Mutation_p.G641C|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.G602C|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.G577C	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	641					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.G641C(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CTCCCCTGAGGGCCTCTCACT	0.592																																							uc003lrc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1921-1923)GGC>TGC		peroxisome proliferator-activated receptor							78.0	81.0	80.0					5																	149215939		2203	4300	6503	SO:0001583	missense	133522				estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity	g.chr5:149215939G>T	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.1921G>T	5.37:g.149215939G>T	ENSP00000312649:p.Gly641Cys					PPARGC1B_uc003lrb.1_Missense_Mutation_p.G641C|PPARGC1B_uc003lrd.2_Missense_Mutation_p.G602C|PPARGC1B_uc003lrf.2_Missense_Mutation_p.G620C|PPARGC1B_uc003lre.1_Missense_Mutation_p.G620C	p.G641C	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		8	1963	+			641					A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	37	c.1921G>T	CCDS4298.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.85|11.85	1.762722|1.762722	0.31228|0.31228	.|.	.|.	ENSG00000155846|ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750|ENST00000434684	T;T;T;T|.	0.09073|.	3.03;3.02;3.02;3.03|.	4.3|4.3	3.41|3.41	0.39046|0.39046	.|.	0.738542|0.738542	0.12432|0.12432	N|N	0.469440|0.469440	T|T	0.45577|0.45577	0.1349|0.1349	L|L	0.56769|0.56769	1.78|1.78	0.27679|0.27679	N|N	0.946511|0.946511	P;P;P;P;P|.	0.52842|.	0.932;0.956;0.932;0.888;0.929|.	P;P;P;P;P|.	0.55577|.	0.779;0.694;0.779;0.606;0.599|.	T|T	0.34279|0.34279	-0.9835|-0.9835	10|6	0.62326|.	D|.	0.03|.	-5.1484|-5.1484	8.8747|8.8747	0.35339|0.35339	0.1089:0.0:0.891:0.0|0.1089:0.0:0.891:0.0	.|.	620;620;602;641;641|.	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3|.	.;.;.;PRGC2_HUMAN;.|.	C|V	602;641;641;577|327	ENSP00000353638:G602C;ENSP00000377855:G641C;ENSP00000312649:G641C;ENSP00000384403:G577C|.	ENSP00000312649:G641C|.	G|G	+|+	1|2	0|0	PPARGC1B|PPARGC1B	149196132|149196132	0.684000|0.684000	0.27642|0.27642	0.755000|0.755000	0.31263|0.31263	0.156000|0.156000	0.22039|0.22039	0.670000|0.670000	0.25157|0.25157	0.912000|0.912000	0.36772|0.36772	0.456000|0.456000	0.33151|0.33151	GGC|GGG		0.592	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263		6	90	1	0	3.59834e-05	0.001168	4.51603e-05	6	90				
HAVCR1	26762	broad.mit.edu	37	5	156469677	156469677	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:156469677C>A	ENST00000339252.3	-	5	1330	c.798G>T	c.(796-798)gtG>gtT	p.V266V	HAVCR1_ENST00000425854.1_Silent_p.V266V|HAVCR1_ENST00000544197.1_Silent_p.V266V|HAVCR1_ENST00000517644.1_5'UTR|HAVCR1_ENST00000523175.1_Silent_p.V266V|HAVCR1_ENST00000522693.1_Silent_p.V266V	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	261					viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)	p.V266V(1)		endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAGACTCTGTCACGGTGTCAT	0.348																																							uc010jij.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(796-798)GTG>GTT		hepatitis A virus cellular receptor 1							135.0	131.0	132.0					5																	156469677		1846	4085	5931	SO:0001819	synonymous_variant	26762				interspecies interaction between organisms	integral to membrane	receptor activity	g.chr5:156469677C>A	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.798G>T	5.37:g.156469677C>A						HAVCR1_uc011ddl.1_Silent_p.V97V|HAVCR1_uc003lwi.2_Silent_p.V266V	p.V266V	NM_001099414	NP_001092884	Q96D42	HAVR1_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		6	983	-	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	261			Extracellular (Potential).		O43656	Silent	SNP	ENST00000339252.3	37	c.798G>T	CCDS43392.1																																																																																				0.348	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1			12	125	1	0	1.52009e-12	0.003163	2.36881e-12	12	125				
FAM71B	153745	broad.mit.edu	37	5	156589905	156589905	+	Silent	SNP	C	C	A	rs369862230		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:156589905C>A	ENST00000302938.4	-	2	1466	c.1371G>T	c.(1369-1371)gcG>gcT	p.A457A		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	457						nucleus (GO:0005634)		p.A457A(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCTTGTCCCCCGCTCTCCTGC	0.483																																							uc003lwn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(1)|skin(1)	6						c.(1369-1371)GCG>GCT		family with sequence similarity 71, member B							185.0	174.0	178.0					5																	156589905		2203	4300	6503	SO:0001819	synonymous_variant	153745					nucleus		g.chr5:156589905C>A		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1371G>T	5.37:g.156589905C>A							p.A457A	NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		2	1471	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	457			Bipartite nuclear localization signal (Potential).		Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	ENST00000302938.4	37	c.1371G>T	CCDS4335.1																																																																																				0.483	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		30	148	1	0	2.08457e-15	0.002096	3.36047e-15	30	148				
CYFIP2	26999	broad.mit.edu	37	5	156819862	156819862	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:156819862C>T	ENST00000521420.1	+	30	3629	c.3538C>T	c.(3538-3540)Cgg>Tgg	p.R1180W	CYFIP2_ENST00000442283.2_3'UTR|CYFIP2_ENST00000435847.2_Missense_Mutation_p.R905W|CYFIP2_ENST00000377576.3_Missense_Mutation_p.R1206W|CYFIP2_ENST00000522463.1_Missense_Mutation_p.R1010W|CYFIP2_ENST00000541131.1_Missense_Mutation_p.R1131W|CYFIP2_ENST00000318218.6_Missense_Mutation_p.R1231W|CYFIP2_ENST00000347377.6_Missense_Mutation_p.R1206W					cytoplasmic FMR1 interacting protein 2									p.R1231W(2)|p.R1206W(1)		breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GATGGCCGACCGGATCAGGAA	0.498																																							uc003lwq.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(3616-3618)CGG>TGG		cytoplasmic FMR1 interacting protein 2							120.0	123.0	122.0					5																	156819862		2033	4195	6228	SO:0001583	missense	26999				apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding	g.chr5:156819862C>T	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.3538C>T	5.37:g.156819862C>T	ENSP00000430904:p.Arg1180Trp					CYFIP2_uc011ddn.1_Missense_Mutation_p.R1180W|CYFIP2_uc011ddo.1_Missense_Mutation_p.R1010W|CYFIP2_uc003lwr.2_Missense_Mutation_p.R1206W|CYFIP2_uc003lws.2_Missense_Mutation_p.R1206W|CYFIP2_uc003lwt.2_Missense_Mutation_p.R1109W|CYFIP2_uc011ddp.1_Missense_Mutation_p.R940W|CYFIP2_uc003lwv.2_Missense_Mutation_p.R161W	p.R1206W	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		33	3754	+	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	1231						Missense_Mutation	SNP	ENST00000521420.1	37	c.3616C>T		.	.	.	.	.	.	.	.	.	.	C	20.1	3.938333	0.73557	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81;1.81;1.81	5.38	2.22	0.28083	.	0.049036	0.85682	D	0.000000	T	0.53334	0.1790	M	0.85373	2.75	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.91635	0.996;0.996;0.999;0.98;0.997;0.978	T	0.61936	-0.6960	10	0.59425	D	0.04	-28.0425	14.3257	0.66518	0.6448:0.3552:0.0:0.0	.	1070;1010;1180;1206;1206;1231	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	W	1231;1010;1180;1206;1206;1131;905	ENSP00000325817:R1231W;ENSP00000428009:R1010W;ENSP00000430904:R1180W;ENSP00000313567:R1206W;ENSP00000366799:R1206W;ENSP00000444645:R1131W;ENSP00000403793:R905W	ENSP00000325817:R1231W	R	+	1	2	CYFIP2	156752440	0.996000	0.38824	0.998000	0.56505	0.993000	0.82548	0.676000	0.25247	0.630000	0.30394	0.655000	0.94253	CGG		0.498	CYFIP2-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000373710.1	NM_001037332		5	95	0	0	0	0.001168	0	5	95				
GABRG2	2566	broad.mit.edu	37	5	161580234	161580234	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:161580234G>T	ENST00000361925.4	+	9	1484	c.1264G>T	c.(1264-1266)Gaa>Taa	p.E422*	GABRG2_ENST00000356592.3_Nonsense_Mutation_p.E430*|GABRG2_ENST00000393933.4_Nonsense_Mutation_p.E327*|GABRG2_ENST00000414552.2_Nonsense_Mutation_p.E470*			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	422					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.E430*(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTGCTGTTTTGAAGATTGTCG	0.468																																							uc003lyz.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|skin(1)	5						c.(1264-1266)GAA>TAA		gamma-aminobutyric acid A receptor, gamma 2							216.0	207.0	210.0					5																	161580234		2203	4300	6503	SO:0001587	stop_gained	2566				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chr5:161580234G>T		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1264G>T	5.37:g.161580234G>T	ENSP00000354651:p.Glu422*					GABRG2_uc010jjc.2_Nonsense_Mutation_p.E470*|GABRG2_uc003lyy.3_Nonsense_Mutation_p.E430*|GABRG2_uc011dej.1_Nonsense_Mutation_p.E327*	p.E422*	NM_000816	NP_000807	P18507	GBRG2_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	9	1622	+	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	422			Cytoplasmic (Probable).		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Nonsense_Mutation	SNP	ENST00000361925.4	37	c.1264G>T	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	G	39	7.306330	0.98200	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	.	.	.	X	430;470;422;327	.	ENSP00000349000:E430X	E	+	1	0	GABRG2	161512812	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.751000	0.98889	2.824000	0.97209	0.655000	0.94253	GAA		0.468	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1			27	97	1	0	3.01185e-09	0.003954	4.43477e-09	27	97				
TENM2	57451	broad.mit.edu	37	5	167642143	167642143	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:167642143C>A	ENST00000518659.1	+	21	3983	c.3944C>A	c.(3943-3945)tCt>tAt	p.S1315Y	TENM2_ENST00000520394.1_Missense_Mutation_p.S1076Y|TENM2_ENST00000519204.1_Missense_Mutation_p.S1194Y|TENM2_ENST00000403607.2_Missense_Mutation_p.S1139Y|TENM2_ENST00000545108.1_Missense_Mutation_p.S1314Y	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1315					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.S1148Y(1)|p.S1194Y(1)|p.S1315Y(1)									CGCGTCAAGTCTCTGAGTGGA	0.582																																							uc010jjd.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(6)|central_nervous_system(4)	10						c.(3916-3918)TCT>TAT		odz, odd Oz/ten-m homolog 2							105.0	109.0	108.0					5																	167642143		1951	4141	6092	SO:0001583	missense	57451							g.chr5:167642143C>A	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.3944C>A	5.37:g.167642143C>A	ENSP00000429430:p.Ser1315Tyr					ODZ2_uc003lzr.3_Missense_Mutation_p.S1076Y|ODZ2_uc003lzt.3_Missense_Mutation_p.S679Y|ODZ2_uc010jje.2_Missense_Mutation_p.S570Y	p.S1306Y	NM_001122679	NP_001116151			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	21	3917	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37	c.3917C>A		.	.	.	.	.	.	.	.	.	.	C	23.2	4.388157	0.82902	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90676	-2.23;-2.23;-2.33;-2.7;-2.71	5.1	5.1	0.69264	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.95465	0.8527	M	0.85299	2.745	0.53688	D	0.999972	D;D;D	0.71674	0.997;0.995;0.998	D;P;D	0.79108	0.935;0.862;0.992	D	0.96039	0.9023	10	0.87932	D	0	.	14.9734	0.71251	0.0:0.8571:0.1429:0.0	.	1314;1315;1076	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	Y	1315;1314;1194;1076;1139	ENSP00000429430:S1315Y;ENSP00000438635:S1314Y;ENSP00000428964:S1194Y;ENSP00000427874:S1076Y;ENSP00000384905:S1139Y	ENSP00000384905:S1139Y	S	+	2	0	ODZ2	167574721	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.996000	0.70639	2.368000	0.80403	0.655000	0.94253	TCT		0.582	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		10	58	1	0	7.48243e-07	0.006214	1.02883e-06	10	58				
DOCK2	1794	broad.mit.edu	37	5	169446071	169446071	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:169446071A>C	ENST00000256935.8	+	33	3420	c.3340A>C	c.(3340-3342)Atg>Ctg	p.M1114L	DOCK2_ENST00000540750.1_Missense_Mutation_p.M175L|DOCK2_ENST00000520908.1_Missense_Mutation_p.M606L|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1114	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.M1114L(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTCTTCGACATGATGCTGTG	0.463																																							uc003maf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(2)	7						c.(3340-3342)ATG>CTG		dedicator of cytokinesis 2							178.0	179.0	179.0					5																	169446071		2203	4300	6503	SO:0001583	missense	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169446071A>C	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3340A>C	5.37:g.169446071A>C	ENSP00000256935:p.Met1114Leu					DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.M606L	p.M1114L	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		33	3420	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	1114			Interaction with CRKL.		Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	c.3340A>C	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	A	18.77	3.695101	0.68386	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.27720	1.65;1.65;1.65	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.38506	0.1043	M	0.81497	2.545	0.51012	D	0.9999	B;B	0.15719	0.014;0.007	B;B	0.11329	0.006;0.002	T	0.32455	-0.9906	10	0.49607	T	0.09	.	14.3619	0.66779	1.0:0.0:0.0:0.0	.	606;1114	E7ERW7;Q92608	.;DOCK2_HUMAN	L	1114;606;175	ENSP00000256935:M1114L;ENSP00000429283:M606L;ENSP00000438827:M175L	ENSP00000256935:M1114L	M	+	1	0	DOCK2	169378649	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.218000	0.95166	1.795000	0.52594	0.528000	0.53228	ATG		0.463	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		47	214	0	0	0	0.00361	0	47	214				
HRH2	3274	broad.mit.edu	37	5	175110816	175110816	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:175110816C>G	ENST00000231683.2	+	1	2353	c.580C>G	c.(580-582)Ccg>Gcg	p.P194A	HRH2_ENST00000377291.2_Missense_Mutation_p.P194A	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2	194					digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)	p.P194A(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	CTTCTACCTCCCGCTACTGAT	0.542																																							uc003mdd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(580-582)CCG>GCG		histamine receptor H2 isoform 2	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)						87.0	74.0	78.0					5																	175110816		2203	4300	6503	SO:0001583	missense	3274				G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity	g.chr5:175110816C>G		CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660	ENST00000231683.2:c.580C>G	5.37:g.175110816C>G	ENSP00000231683:p.Pro194Ala					HRH2_uc003mdc.3_Missense_Mutation_p.P194A	p.P194A	NM_022304	NP_071640	P25021	HRH2_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	1	2353	+	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	194			Helical; Name=5; (Potential).		B5BUP7|Q14464|Q7Z5R9	Missense_Mutation	SNP	ENST00000231683.2	37	c.580C>G	CCDS4395.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.449235	0.63178	.	.	ENSG00000113749	ENST00000377291;ENST00000231683	T;T	0.56275	0.47;0.47	5.4	5.4	0.78164	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.84933	0.5582	H	0.99273	4.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91452	0.5182	10	0.87932	D	0	.	18.1764	0.89762	0.0:1.0:0.0:0.0	.	194;194	P25021;Q7Z5R9	HRH2_HUMAN;.	A	194	ENSP00000366506:P194A;ENSP00000231683:P194A	ENSP00000231683:P194A	P	+	1	0	HRH2	175043422	1.000000	0.71417	0.994000	0.49952	0.223000	0.24884	7.818000	0.86416	2.540000	0.85666	0.462000	0.41574	CCG		0.542	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253151.1			4	51	0	0	0	0.009096	0	4	51				
F13A1	2162	broad.mit.edu	37	6	6145961	6145961	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:6145961C>A	ENST00000264870.3	-	15	2355	c.2090G>T	c.(2089-2091)cGg>cTg	p.R697L		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	697					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.R697L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GACCCAGGGCCGGCACACTTC	0.542																																							uc003mwv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6						c.(2089-2091)CGG>CTG		coagulation factor XIII A1 subunit precursor	L-Glutamine(DB00130)						104.0	92.0	96.0					6																	6145961		2203	4300	6503	SO:0001583	missense	2162				peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr6:6145961C>A	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.2090G>T	6.37:g.6145961C>A	ENSP00000264870:p.Arg697Leu					F13A1_uc011dib.1_Missense_Mutation_p.G591C	p.R697L	NM_000129	NP_000120	P00488	F13A_HUMAN			15	2213	-	Ovarian(93;0.0816)	all_hematologic(90;0.152)	697					Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	c.2090G>T	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	C	9.192	1.026248	0.19512	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.64438	-0.1	5.91	2.19	0.27852	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.717109	0.13716	N	0.367777	T	0.28400	0.0702	M	0.65975	2.015	0.25596	N	0.986649	B	0.02656	0.0	B	0.04013	0.001	T	0.28396	-1.0045	10	0.09843	T	0.71	.	4.8058	0.13319	0.1376:0.5632:0.0:0.2991	.	697	P00488	F13A_HUMAN	L	697;591	ENSP00000264870:R697L	ENSP00000264870:R697L	R	-	2	0	F13A1	6090960	0.006000	0.16342	0.331000	0.25455	0.530000	0.34684	0.180000	0.16860	0.119000	0.18210	-0.136000	0.14681	CGG		0.542	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129		16	74	1	0	6.94344e-10	0.006122	1.04152e-09	16	74				
GCNT2	2651	broad.mit.edu	37	6	10529565	10529565	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:10529565A>G	ENST00000379597.3	+	1	977	c.421A>G	c.(421-423)Aaa>Gaa	p.K141E	GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000410107.1_Intron|GCNT2_ENST00000495262.1_Missense_Mutation_p.K141E			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)	141					maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)	p.K141E(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		AGGTGCAGTGAAACAGTTACT	0.517																																							uc010joo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(421-423)AAA>GAA		glucosaminyl (N-acetyl) transferase 2,							81.0	74.0	76.0					6																	10529565		2203	4300	6503	SO:0001583	missense	2651					Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity	g.chr6:10529565A>G	L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.421A>G	6.37:g.10529565A>G	ENSP00000368917:p.Lys141Glu					GCNT2_uc010jol.2_Intron|GCNT2_uc010jom.2_Intron|GCNT2_uc010jop.2_Intron|GCNT2_uc003mza.2_Intron|GCNT2_uc003mzc.3_Missense_Mutation_p.K140E|GCNT2_uc010jon.2_Missense_Mutation_p.K140E	p.K141E	NM_145649	NP_663624	Q8N0V5	GNT2A_HUMAN		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)	3	972	+	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)	141			Lumenal (Potential).			Missense_Mutation	SNP	ENST00000379597.3	37	c.421A>G	CCDS34338.1	.	.	.	.	.	.	.	.	.	.	A	0.053	-1.245230	0.01481	.	.	ENSG00000111846	ENST00000495262;ENST00000379597	T;T	0.11063	2.81;2.81	5.47	-10.9	0.00192	.	2.578380	0.00906	N	0.002404	T	0.01489	0.0048	N	0.12853	0.265	0.58432	D	0.999993	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.48969	-0.8987	10	0.07990	T	0.79	-2.7696	16.2898	0.82742	0.1097:0.3754:0.5149:0.0	.	141;140	Q8N0V5;Q08M29	GNT2A_HUMAN;.	E	141	ENSP00000419411:K141E;ENSP00000368917:K141E	ENSP00000368917:K141E	K	+	1	0	GCNT2	10637551	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-3.012000	0.00647	-2.949000	0.00294	0.459000	0.35465	AAA		0.517	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327912.3	NM_145649		13	100	0	0	0	0.00245	0	13	100				
MCUR1	63933	broad.mit.edu	37	6	13802537	13802537	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:13802537C>T	ENST00000379170.4	-	3	715	c.577G>A	c.(577-579)Gtc>Atc	p.V193I		NM_001031713.3	NP_001026883.1	Q96AQ8	MCUR1_HUMAN	mitochondrial calcium uniporter regulator 1	193					calcium ion import (GO:0070509)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	integral component of mitochondrial inner membrane (GO:0031305)		p.V193I(1)									AGGATCTTGACCAATGCAGAC	0.438																																							uc003nbd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(577-579)GTC>ATC		coiled-coil domain containing 90A precursor							203.0	157.0	173.0					6																	13802537		2203	4300	6503	SO:0001583	missense	63933					integral to membrane|mitochondrion		g.chr6:13802537C>T	BC016850	CCDS35495.1	6p23	2013-03-13	2013-03-13	2013-03-13	ENSG00000050393	ENSG00000050393			21097	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 79"", ""coiled-coil domain containing 90A"""	C6orf79, CCDC90A		23178883	Standard	NM_001031713		Approved	FLJ20958	uc003nbc.2	Q96AQ8	OTTHUMG00000014279	ENST00000379170.4:c.577G>A	6.37:g.13802537C>T	ENSP00000368468:p.Val193Ile					CCDC90A_uc010jpf.2_RNA	p.V193I	NM_001031713	NP_001026883	Q96AQ8	CC90A_HUMAN			3	705	-	Breast(50;0.0027)|Ovarian(93;0.0964)	all_hematologic(90;0.117)	193					Q96JS7|Q9H7F8	Missense_Mutation	SNP	ENST00000379170.4	37	c.577G>A	CCDS35495.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.368256	0.42003	.	.	ENSG00000050393	ENST00000379170	T	0.47869	0.83	5.69	3.9	0.45041	.	0.224693	0.44902	N	0.000417	T	0.23846	0.0577	L	0.42632	1.34	0.80722	D	1	P	0.43578	0.811	B	0.40038	0.317	T	0.03695	-1.1012	10	0.35671	T	0.21	-17.1895	9.9967	0.41905	0.0:0.7802:0.0:0.2198	.	193	Q96AQ8	CC90A_HUMAN	I	193	ENSP00000368468:V193I	ENSP00000368468:V193I	V	-	1	0	CCDC90A	13910516	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	1.600000	0.36762	1.410000	0.46936	0.650000	0.86243	GTC		0.438	MCUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039909.3	NM_022102		14	106	0	0	0	0.003163	0	14	106				
OR14J1	442191	broad.mit.edu	37	6	29274833	29274833	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:29274833G>T	ENST00000377160.2	+	1	431	c.367G>T	c.(367-369)Gca>Tca	p.A123S		NM_030946.1	NP_112208.1	Q9UGF5	O14J1_HUMAN	olfactory receptor, family 14, subfamily J, member 1	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A123S(1)		endometrium(2)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(2)	17						CAGGTACGCAGCAATCTGTCA	0.478																																							uc011dln.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(367-369)GCA>TCA		olfactory receptor, family 5, subfamily U member							128.0	131.0	130.0					6																	29274833		1511	2709	4220	SO:0001583	missense	442191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29274833G>T		CCDS34362.1	6p21.3	2012-08-09	2008-04-02	2008-04-02	ENSG00000204695	ENSG00000204695		"""GPCR / Class A : Olfactory receptors"""	13971	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily U, member 1"""	OR5U1			Standard	NM_030946		Approved	hs6M1-28	uc011dln.2	Q9UGF5	OTTHUMG00000031184	ENST00000377160.2:c.367G>T	6.37:g.29274833G>T	ENSP00000366365:p.Ala123Ser						p.A123S	NM_030946	NP_112208	Q9UGF5	O14J1_HUMAN			1	367	+			123			Cytoplasmic (Potential).		A2BEC2|B0V078|Q5ST27	Missense_Mutation	SNP	ENST00000377160.2	37	c.367G>T	CCDS34362.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745713	0.49151	.	.	ENSG00000204695	ENST00000377160	T	0.01209	5.17	4.86	4.86	0.63082	GPCR, rhodopsin-like superfamily (1);	0.150639	0.29846	N	0.011058	T	0.02688	0.0081	H	0.96576	3.845	0.52501	D	0.999955	P	0.45212	0.853	B	0.39258	0.295	T	0.24905	-1.0147	10	0.44086	T	0.13	.	18.1302	0.89599	0.0:0.0:1.0:0.0	.	123	Q9UGF5	O14J1_HUMAN	S	123	ENSP00000366365:A123S	ENSP00000366365:A123S	A	+	1	0	OR14J1	29382812	0.995000	0.38212	0.977000	0.42913	0.010000	0.07245	2.556000	0.45862	2.680000	0.91292	0.650000	0.86243	GCA		0.478	OR14J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076362.2			46	116	1	0	7.88023e-25	0.00361	1.3772e-24	46	116				
OR5V1	81696	broad.mit.edu	37	6	29323943	29323943	+	Silent	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:29323943A>G	ENST00000377154.1	-	4	329	c.30T>C	c.(28-30)acT>acC	p.T10T	OR5V1_ENST00000543825.1_Silent_p.T10T			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	10						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T10T(1)		breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TGATGAATTCAGTTATAGCTG	0.353																																					Ovarian(32;43 883 21137 32120 42650)	Ovarian(32;43 883 21137 32120 42650)	uc011dlo.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|kidney(1)	4						c.(28-30)ACT>ACC		olfactory receptor, family 5, subfamily V,							59.0	61.0	60.0					6																	29323943		2181	4246	6427	SO:0001819	synonymous_variant	81696				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29323943A>G		CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.30T>C	6.37:g.29323943A>G							p.T10T	NM_030876	NP_110503	Q9UGF6	OR5V1_HUMAN			1	112	-			10			Extracellular (Potential).		A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Silent	SNP	ENST00000377154.1	37	c.30T>C	CCDS4657.1																																																																																				0.353	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076398.3			40	72	0	0	0	0.00874	0	40	72				
DPCR1	135656	broad.mit.edu	37	6	30920784	30920784	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:30920784C>G	ENST00000462446.1	+	3	4100	c.4072C>G	c.(4072-4074)Cag>Gag	p.Q1358E	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_Missense_Mutation_p.Q200E			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	482						integral component of membrane (GO:0016021)		p.Q1358E(1)|p.Q200E(1)|p.Q482E(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						CACACTAACCCAGAACACCCA	0.522																																							uc003nsg.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(4072-4074)CAG>GAG		diffuse panbronchiolitis critical region 1							151.0	110.0	124.0					6																	30920784		2203	4300	6503	SO:0001583	missense	135656					integral to membrane		g.chr6:30920784C>G	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.4072C>G	6.37:g.30920784C>G	ENSP00000417182:p.Gln1358Glu						p.Q1358E	NM_080870	NP_543146	Q3MIW9	DPCR1_HUMAN			3	4072	+			482			Cytoplasmic (Potential).		C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	37	c.4072C>G	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	C	16.98	3.272018	0.59649	.	.	ENSG00000168631	ENST00000462446;ENST00000450344;ENST00000304311	T;T	0.24538	1.85;1.91	3.82	1.79	0.24919	.	.	.	.	.	T	0.10465	0.0256	L	0.42245	1.32	0.09310	N	1	P	0.45474	0.859	B	0.42030	0.373	T	0.08659	-1.0711	9	0.87932	D	0	-1.5385	8.046	0.30549	0.4389:0.5611:0.0:0.0	.	1358	E9PEI6	.	E	1358;482;200	ENSP00000417182:Q1358E;ENSP00000305948:Q200E	ENSP00000305948:Q200E	Q	+	1	0	DPCR1	31028763	0.001000	0.12720	0.003000	0.11579	0.773000	0.43773	1.094000	0.30951	0.903000	0.36546	0.574000	0.79327	CAG		0.522	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3	NM_080870		8	38	0	0	0	0.00308	0	8	38				
TNXA	7146	broad.mit.edu	37	6	31977528	31977528	+	5'Flank	SNP	C	C	G	rs76310711		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:31977528C>G	ENST00000594256.1	-	0	0				CYP21A1P_ENST00000342991.6_RNA																							TCTCCATGTCCCAAAACACGT	0.667																																							uc011dpc.1		NA																	0					0						c.(1465-1467)TGG>TGC		tenascin XB isoform 2																																				SO:0001631	upstream_gene_variant	7148				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding	g.chr6:31977528C>G																													6.37:g.31977528C>G	Exception_encountered						p.W489C	NM_032470	NP_115859	P22105	TENX_HUMAN			12	2376	-			4105			Fibrinogen C-terminal.			Missense_Mutation	SNP	ENST00000594256.1	37	c.1467G>C																																																																																					0.667	AL645922.1-201	NOVEL	basic|appris_principal	protein_coding	protein_coding				5	26	0	0	0	0.00308	0	5	26				
NOTCH4	4855	broad.mit.edu	37	6	32169207	32169207	+	Missense_Mutation	SNP	C	C	G	rs139568674		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:32169207C>G	ENST00000375023.3	-	22	3964	c.3826G>C	c.(3826-3828)Gag>Cag	p.E1276Q		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1276					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.E1276Q(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CAGCCACACTCTGCAGTGTTG	0.617																																							uc003obb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						c.(3826-3828)GAG>CAG		notch4 preproprotein							65.0	62.0	63.0					6																	32169207		1510	2709	4219	SO:0001583	missense	4855				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity	g.chr6:32169207C>G		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.3826G>C	6.37:g.32169207C>G	ENSP00000364163:p.Glu1276Gln					NOTCH4_uc003oba.2_5'UTR|NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA	p.E1276Q	NM_004557	NP_004548	Q99466	NOTC4_HUMAN			22	3965	-			1276			LNR 3.|Extracellular (Potential).		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	c.3826G>C	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	C	8.375	0.836162	0.16891	.	.	ENSG00000204301	ENST00000375023	T	0.80566	-1.39	4.57	2.76	0.32466	Notch domain (5);	0.387007	0.18450	N	0.140853	T	0.69495	0.3117	M	0.76727	2.345	0.80722	D	1	B	0.06786	0.001	B	0.13407	0.009	T	0.68569	-0.5374	10	0.52906	T	0.07	.	12.8219	0.57698	0.0:0.6871:0.3129:0.0	.	1276	Q99466	NOTC4_HUMAN	Q	1276	ENSP00000364163:E1276Q	ENSP00000364163:E1276Q	E	-	1	0	NOTCH4	32277185	0.997000	0.39634	0.007000	0.13788	0.160000	0.22226	3.712000	0.54875	0.550000	0.28991	-0.273000	0.10243	GAG		0.617	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			5	60	0	0	0	0.000602	0	5	60				
NOTCH4	4855	broad.mit.edu	37	6	32181503	32181503	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:32181503C>A	ENST00000375023.3	-	14	2420	c.2282G>T	c.(2281-2283)gGg>gTg	p.G761V	NOTCH4_ENST00000465528.1_5'UTR	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	761	EGF-like 19. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.G761V(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GCACTGGGGCCCTGTGTGGCT	0.587																																							uc003obb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						c.(2281-2283)GGG>GTG		notch4 preproprotein							98.0	87.0	91.0					6																	32181503		1510	2709	4219	SO:0001583	missense	4855				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity	g.chr6:32181503C>A		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.2282G>T	6.37:g.32181503C>A	ENSP00000364163:p.Gly761Val					NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA	p.G761V	NM_004557	NP_004548	Q99466	NOTC4_HUMAN			14	2421	-			761			EGF-like 19.|Extracellular (Potential).		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	c.2282G>T	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152480	0.57259	.	.	ENSG00000204301	ENST00000375023	T	0.76316	-1.01	3.88	3.88	0.44766	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.41712	D	0.000831	D	0.89227	0.6655	M	0.94142	3.5	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.91816	0.5463	10	0.87932	D	0	.	13.7033	0.62622	0.0:1.0:0.0:0.0	.	761	Q99466	NOTC4_HUMAN	V	761	ENSP00000364163:G761V	ENSP00000364163:G761V	G	-	2	0	NOTCH4	32289481	1.000000	0.71417	0.760000	0.31359	0.323000	0.28346	6.675000	0.74493	2.169000	0.68431	0.561000	0.74099	GGG		0.587	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			14	90	1	0	2.32078e-09	0.003163	3.44434e-09	14	90				
HLA-DMB	3109	broad.mit.edu	37	6	32903146	32903146	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:32903146G>A	ENST00000418107.2	-	5	1010	c.748C>T	c.(748-750)Cct>Tct	p.P250S	AL645941.1_ENST00000390777.1_RNA	NM_002118.4	NP_002109.2	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM beta	250					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|MHC class II protein complex assembly (GO:0002399)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001190)|positive regulation of T cell proliferation (GO:0042102)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)	p.P250S(1)		breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						CCAGGAAGAGGAGTGTAACCT	0.438																																							uc003ocl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(748-750)CCT>TCT		major histocompatibility complex, class II, DM							113.0	108.0	110.0					6																	32903146		1511	2708	4219	SO:0001583	missense	3109				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex		g.chr6:32903146G>A		CCDS4760.1	6p21.3	2014-05-16			ENSG00000242574	ENSG00000242574		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4935	protein-coding gene	gene with protein product		142856				1922365	Standard	NM_002118		Approved	D6S221E, RING7	uc003ocl.2	P28068	OTTHUMG00000031176	ENST00000418107.2:c.748C>T	6.37:g.32903146G>A	ENSP00000398890:p.Pro250Ser					HLA-DMB_uc003ocj.1_3'UTR|HLA-DMB_uc003ock.1_RNA|HLA-DMB_uc010jud.1_Intron|HLA-DMB_uc010jue.1_Missense_Mutation_p.P80S|HLA-DMB_uc010juf.1_Intron	p.P250S	NM_002118	NP_002109	P28068	DMB_HUMAN			5	981	-			250			YXXZ motif.|Cytoplasmic (Potential).		O77936|Q13012|Q29751|Q58ZE2|Q5SNZ8|Q5STC4|Q9XRX2	Missense_Mutation	SNP	ENST00000418107.2	37	c.748C>T	CCDS4760.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653912	0.47362	.	.	ENSG00000242574	ENST00000438510;ENST00000418107	T;T	0.04360	3.64;5.26	4.61	-4.7	0.03288	.	2.134300	0.02199	N	0.062077	T	0.02888	0.0086	M	0.64404	1.975	0.09310	N	1	P;B	0.52170	0.951;0.065	P;B	0.51701	0.677;0.017	T	0.31308	-0.9948	10	0.30854	T	0.27	.	1.9027	0.03271	0.2874:0.3879:0.1947:0.13	.	93;250	B0V061;P28068	.;DMB_HUMAN	S	93;250	ENSP00000390848:P93S;ENSP00000398890:P250S	ENSP00000398890:P250S	P	-	1	0	HLA-DMB	33011124	0.000000	0.05858	0.001000	0.08648	0.931000	0.56810	-1.104000	0.03326	-0.638000	0.05509	0.478000	0.44815	CCT		0.438	HLA-DMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076340.2	NM_002118		10	126	0	0	0	0.000978	0	10	126				
PKHD1	5314	broad.mit.edu	37	6	51524526	51524526	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:51524526C>T	ENST00000371117.3	-	61	10673	c.10398G>A	c.(10396-10398)agG>agA	p.R3466R		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3466					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.R3466R(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TGGTGATTTGCCTGATGGGTA	0.408																																							uc003pah.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44						c.(10396-10398)AGG>AGA		fibrocystin isoform 1							94.0	94.0	94.0					6																	51524526		2203	4300	6503	SO:0001819	synonymous_variant	5314				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	g.chr6:51524526C>T	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10398G>A	6.37:g.51524526C>T							p.R3466R	NM_138694	NP_619639	P08F94	PKHD1_HUMAN			61	10674	-	Lung NSC(77;0.0605)		3466			Extracellular (Potential).		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	37	c.10398G>A	CCDS4935.1																																																																																				0.408	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		12	158	0	0	0	0.000978	0	12	158				
GSTA5	221357	broad.mit.edu	37	6	52701131	52701131	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:52701131C>G	ENST00000370989.2	-	3	204	c.175G>C	c.(175-177)Gag>Cag	p.E59Q	GSTA5_ENST00000284562.2_Missense_Mutation_p.E59Q|GSTA5_ENST00000475052.1_Intron			Q7RTV2	GSTA5_HUMAN	glutathione S-transferase alpha 5	59	GST N-terminal.				glutathione metabolic process (GO:0006749)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)	p.E59Q(1)		endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Lung NSC(77;0.0912)				Glutathione(DB00143)	CCGTCAATCTCAACCATTGGT	0.423																																							uc003pba.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(175-177)GAG>CAG		glutathione S-transferase alpha 5	Glutathione(DB00143)						118.0	116.0	117.0					6																	52701131		2203	4300	6503	SO:0001583	missense	221357				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity	g.chr6:52701131C>G	BK000212	CCDS4946.1	6p12.2	2012-06-21	2008-11-26		ENSG00000182793	ENSG00000182793	2.5.1.18	"""Glutathione S-transferases / Soluble"""	19662	protein-coding gene	gene with protein product		607605	"""glutathione S-transferase A5"""			12042665	Standard	NM_153699		Approved		uc003pba.1	Q7RTV2	OTTHUMG00000014857	ENST00000370989.2:c.175G>C	6.37:g.52701131C>G	ENSP00000360028:p.Glu59Gln						p.E59Q	NM_153699	NP_714543	Q7RTV2	GSTA5_HUMAN			4	245	-	Lung NSC(77;0.0912)		59			GST N-terminal.		Q5SZC2	Missense_Mutation	SNP	ENST00000370989.2	37	c.175G>C	CCDS4946.1	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587357	0.66105	.	.	ENSG00000182793	ENST00000370989;ENST00000284562	T;T	0.09538	2.97;2.97	2.63	2.63	0.31362	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.19167	0.0460	M	0.88640	2.97	0.48571	D	0.999677	P	0.39831	0.69	P	0.49799	0.622	T	0.04495	-1.0947	10	0.72032	D	0.01	.	13.2149	0.59854	0.0:1.0:0.0:0.0	.	59	Q7RTV2	GSTA5_HUMAN	Q	59	ENSP00000360028:E59Q;ENSP00000284562:E59Q	ENSP00000284562:E59Q	E	-	1	0	GSTA5	52809090	1.000000	0.71417	0.998000	0.56505	0.739000	0.42172	4.215000	0.58534	1.456000	0.47831	0.205000	0.17691	GAG		0.423	GSTA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040917.1	NM_153699		12	266	0	0	0	0.001368	0	12	266				
FAM83B	222584	broad.mit.edu	37	6	54805963	54805963	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:54805963G>A	ENST00000306858.7	+	5	2310	c.2194G>A	c.(2194-2196)Ggc>Agc	p.G732S	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	732								p.G732S(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					CTCTCCAAGTGGCACTACTAC	0.408																																							uc003pck.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)	6						c.(2194-2196)GGC>AGC		hypothetical protein LOC222584							86.0	88.0	87.0					6																	54805963		2203	4300	6503	SO:0001583	missense	222584							g.chr6:54805963G>A	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.2194G>A	6.37:g.54805963G>A	ENSP00000304078:p.Gly732Ser						p.G732S	NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN			5	2310	+	Lung NSC(77;0.0178)|Renal(3;0.122)		732					Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	c.2194G>A	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-2.997626	0.00044	.	.	ENSG00000168143	ENST00000306858	T	0.33438	1.41	5.48	-3.35	0.04928	.	1.570300	0.03101	N	0.161075	T	0.05686	0.0149	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.13045	-1.0524	10	0.09590	T	0.72	-0.0075	5.2053	0.15287	0.4372:0.099:0.3849:0.079	.	732	Q5T0W9	FA83B_HUMAN	S	732	ENSP00000304078:G732S	ENSP00000304078:G732S	G	+	1	0	FAM83B	54913922	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.192000	0.09587	-0.672000	0.05266	-0.940000	0.02684	GGC		0.408	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		8	146	0	0	0	0.004482	0	8	146				
ZNF451	26036	broad.mit.edu	37	6	56999642	56999642	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:56999642C>T	ENST00000370706.4	+	7	920	c.676C>T	c.(676-678)Caa>Taa	p.Q226*	RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|ZNF451_ENST00000357489.3_Nonsense_Mutation_p.Q226*|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|ZNF451_ENST00000491832.2_Nonsense_Mutation_p.Q226*|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	226					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q226*(2)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TACTCAACAACAATATAGAGA	0.343																																							uc003pdm.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(676-678)CAA>TAA		zinc finger protein 451 isoform 1							99.0	91.0	93.0					6																	56999642		2203	4299	6502	SO:0001587	stop_gained	26036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:56999642C>T	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.676C>T	6.37:g.56999642C>T	ENSP00000359740:p.Gln226*					ZNF451_uc003pdl.2_Nonsense_Mutation_p.Q226*|ZNF451_uc003pdn.1_Nonsense_Mutation_p.Q226*|uc003pdq.1_Intron|ZNF451_uc003pdk.1_Nonsense_Mutation_p.Q226*	p.Q226*	NM_001031623	NP_001026794	Q9Y4E5	ZN451_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)		7	900	+	Lung NSC(77;0.145)		226					Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Nonsense_Mutation	SNP	ENST00000370706.4	37	c.676C>T	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	C	37	6.082998	0.97267	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	.	.	.	5.47	5.47	0.80525	.	0.209202	0.41294	D	0.000916	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-16.58	17.1118	0.86678	0.0:1.0:0.0:0.0	.	.	.	.	X	226	.	ENSP00000350083:Q226X	Q	+	1	0	ZNF451	57107601	1.000000	0.71417	0.965000	0.40720	0.830000	0.47004	2.607000	0.46300	2.560000	0.86352	0.585000	0.79938	CAA		0.343	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555		8	70	0	0	0	0.00308	0	8	70				
COL9A1	1297	broad.mit.edu	37	6	70964868	70964868	+	Silent	SNP	C	C	A	rs145650924		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:70964868C>A	ENST00000357250.6	-	23	1754	c.1596G>T	c.(1594-1596)ggG>ggT	p.G532G	COL9A1_ENST00000370499.4_Silent_p.G289G|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000320755.7_Silent_p.G289G	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	532	Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.G289G(1)|p.G532G(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						CTCCTTTGGGCCCAGGGAGAC	0.423																																							uc003pfg.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)	4						c.(1594-1596)GGG>GGT		alpha 1 type IX collagen isoform 1 precursor							158.0	160.0	159.0					6																	70964868		2203	4300	6503	SO:0001819	synonymous_variant	1297				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding	g.chr6:70964868C>A		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1596G>T	6.37:g.70964868C>A						COL9A1_uc003pfe.3_Silent_p.G105G|COL9A1_uc003pff.3_Silent_p.G289G	p.G532G	NM_001851	NP_001842	P20849	CO9A1_HUMAN			23	1755	-			532			Triple-helical region (COL2).		Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Silent	SNP	ENST00000357250.6	37	c.1596G>T	CCDS4971.1																																																																																				0.423	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			35	117	1	0	6.5261e-18	0.00874	1.09288e-17	35	117				
CD109	135228	broad.mit.edu	37	6	74521964	74521964	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:74521964G>C	ENST00000287097.5	+	29	3851	c.3739G>C	c.(3739-3741)Gca>Cca	p.A1247P	CD109_ENST00000437994.2_Missense_Mutation_p.A1230P|CD109_ENST00000422508.2_Missense_Mutation_p.A1170P			Q6YHK3	CD109_HUMAN	CD109 molecule	1247					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)	p.A1247P(1)|p.A1247T(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TAATATTTCCGCAAATGGTTT	0.333																																							uc003php.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	large_intestine(2)|ovary(2)	4						c.(3739-3741)GCA>CCA		CD109 antigen isoform 1 precursor							155.0	145.0	149.0					6																	74521964		2203	4300	6503	SO:0001583	missense	135228					anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	g.chr6:74521964G>C	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.3739G>C	6.37:g.74521964G>C	ENSP00000287097:p.Ala1247Pro					CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Missense_Mutation_p.A1230P|CD109_uc010kba.2_Missense_Mutation_p.A1170P	p.A1247P	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN			29	4164	+			1247					A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	c.3739G>C	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.747457	0.69533	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.32515	1.59;1.68;1.45	5.25	5.25	0.73442	.	0.110181	0.64402	D	0.000009	T	0.53417	0.1795	M	0.80332	2.49	0.54753	D	0.999987	D;D;D	0.76494	0.997;0.999;0.967	D;D;P	0.72625	0.954;0.978;0.908	T	0.57883	-0.7734	10	0.72032	D	0.01	.	19.0112	0.92874	0.0:0.0:1.0:0.0	.	1170;1230;1247	Q6YHK3-2;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	P	1230;1170;1247	ENSP00000388062:A1230P;ENSP00000404475:A1170P;ENSP00000287097:A1247P	ENSP00000287097:A1247P	A	+	1	0	CD109	74578685	1.000000	0.71417	0.895000	0.35142	0.479000	0.33129	4.895000	0.63214	2.727000	0.93392	0.563000	0.77884	GCA		0.333	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493		36	74	0	0	0	0.007835	0	36	74				
GPR6	2830	broad.mit.edu	37	6	110300445	110300445	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:110300445C>A	ENST00000275169.3	+	1	148	c.130C>A	c.(130-132)Cta>Ata	p.L44I	GPR6_ENST00000414000.2_Missense_Mutation_p.L59I	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	44					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.L44I(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		TGCGGCGGCTCTAGGAGCCGG	0.726																																							uc011eaw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(130-132)CTA>ATA		G protein-coupled receptor 6							24.0	35.0	31.0					6																	110300445		2077	4124	6201	SO:0001583	missense	2830					integral to plasma membrane		g.chr6:110300445C>A		CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.130C>A	6.37:g.110300445C>A	ENSP00000275169:p.Leu44Ile					GPR6_uc011eav.1_Missense_Mutation_p.L59I|GPR6_uc003ptu.2_Missense_Mutation_p.L44I	p.L44I	NM_005284	NP_005275	P46095	GPR6_HUMAN		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)	2	310	+		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)	44			Extracellular (Potential).		B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Missense_Mutation	SNP	ENST00000275169.3	37	c.130C>A	CCDS5079.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.282167	0.40394	.	.	ENSG00000146360	ENST00000428489;ENST00000414000;ENST00000275169	T;T	0.72615	-0.67;-0.65	4.65	4.65	0.58169	.	2.020370	0.02760	N	0.118493	T	0.60090	0.2242	L	0.27053	0.805	0.41984	D	0.990811	D;P	0.56968	0.978;0.849	P;B	0.50754	0.649;0.396	T	0.57015	-0.7883	10	0.21014	T	0.42	.	15.8618	0.79032	0.0:1.0:0.0:0.0	.	59;44	B4DHS9;P46095	.;GPR6_HUMAN	I	44;59;44	ENSP00000406986:L59I;ENSP00000275169:L44I	ENSP00000275169:L44I	L	+	1	2	GPR6	110407138	1.000000	0.71417	0.998000	0.56505	0.234000	0.25298	4.365000	0.59486	2.401000	0.81631	0.563000	0.77884	CTA		0.726	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041774.1			28	56	1	0	7.01153e-11	0.007291	1.0631e-10	28	56				
HS3ST5	222537	broad.mit.edu	37	6	114378649	114378649	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:114378649C>T	ENST00000312719.5	-	5	2001	c.813G>A	c.(811-813)aaG>aaA	p.K271K	RP3-399L15.3_ENST00000519104.1_RNA|RP3-399L15.3_ENST00000519270.1_RNA|RP3-399L15.3_ENST00000523087.1_RNA|HS3ST5_ENST00000411826.1_Silent_p.K271K			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	271					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)	p.K271K(1)		breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		GATTTAGGAACTTCTCCACGA	0.413																																							uc003pwg.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(811-813)AAG>AAA		heparan sulfate (glucosamine)							94.0	96.0	96.0					6																	114378649		2203	4300	6503	SO:0001819	synonymous_variant	222537				heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding	g.chr6:114378649C>T	AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.813G>A	6.37:g.114378649C>T						uc003pwf.2_Intron|HS3ST5_uc003pwh.3_Silent_p.K271K	p.K271K	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)	2	845	-		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)	271			Lumenal (Potential).		A8K1J2|Q52LI2|Q8N285	Silent	SNP	ENST00000312719.5	37	c.813G>A	CCDS34517.1																																																																																				0.413	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041911.2	NM_153612		11	72	0	0	0	0.001368	0	11	72				
TAAR1	134864	broad.mit.edu	37	6	132966566	132966566	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:132966566G>C	ENST00000275216.1	-	1	576	c.577C>G	c.(577-579)Ctg>Gtg	p.L193V		NM_138327.1	NP_612200.1	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	193					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.L193V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)	18	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)|Dextroamphetamine(DB01576)|Methamphetamine(DB01577)|Propylhexedrine(DB06714)	ATAAAGGTCAGTACCCCAGAT	0.353																																							uc003qdm.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(577-579)CTG>GTG		trace amine associated receptor 1	Amphetamine(DB00182)						79.0	83.0	82.0					6																	132966566		2203	4300	6503	SO:0001583	missense	134864					plasma membrane		g.chr6:132966566G>C	AY180374	CCDS5158.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146399	ENSG00000146399		"""GPCR / Class A : Trace amine associated receptors"""	17734	protein-coding gene	gene with protein product		609333	"""trace amine receptor 1"""	TRAR1		11459929, 15718104	Standard	NM_138327		Approved	TAR1, TA1	uc003qdm.1	Q96RJ0	OTTHUMG00000015583	ENST00000275216.1:c.577C>G	6.37:g.132966566G>C	ENSP00000275216:p.Leu193Val						p.L193V	NM_138327	NP_612200	Q96RJ0	TAAR1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	1	577	-	Breast(56;0.135)		193			Helical; Name=5; (Potential).		Q2M1W5|Q3MIH8|Q5VUQ1	Missense_Mutation	SNP	ENST00000275216.1	37	c.577C>G	CCDS5158.1	.	.	.	.	.	.	.	.	.	.	G	1.762	-0.486498	0.04352	.	.	ENSG00000146399	ENST00000275216	T	0.37584	1.19	5.78	-6.54	0.01860	GPCR, rhodopsin-like superfamily (1);	0.267312	0.29822	N	0.011105	T	0.04318	0.0119	N	0.11845	0.185	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.37454	-0.9705	10	0.12766	T	0.61	-0.5983	9.5672	0.39405	0.4245:0.3154:0.2601:0.0	.	193	Q96RJ0	TAAR1_HUMAN	V	193	ENSP00000275216:L193V	ENSP00000275216:L193V	L	-	1	2	TAAR1	133008259	0.000000	0.05858	0.000000	0.03702	0.170000	0.22686	-2.209000	0.01228	-1.347000	0.02208	-0.314000	0.08810	CTG		0.353	TAAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042259.1	NM_138327		17	92	0	0	0	0.004007	0	17	92				
UST	10090	broad.mit.edu	37	6	149275032	149275032	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:149275032A>G	ENST00000367463.4	+	4	575	c.472A>G	c.(472-474)Act>Gct	p.T158A	RP11-162J8.2_ENST00000413845.1_RNA	NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	158					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.T158A(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		AAATATAAGTACTGCCGAACA	0.299																																							uc003qmg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(472-474)ACT>GCT		uronyl-2-sulfotransferase							70.0	73.0	72.0					6																	149275032		2202	4300	6502	SO:0001583	missense	10090				protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity	g.chr6:149275032A>G	AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.472A>G	6.37:g.149275032A>G	ENSP00000356433:p.Thr158Ala						p.T158A	NM_005715	NP_005706	Q9Y2C2	UST_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)	4	768	+		Ovarian(120;0.0907)	158			Lumenal (Potential).		B2RCX6	Missense_Mutation	SNP	ENST00000367463.4	37	c.472A>G	CCDS5213.1	.	.	.	.	.	.	.	.	.	.	A	14.31	2.496428	0.44352	.	.	ENSG00000111962	ENST00000367463	T	0.72725	-0.68	6.16	6.16	0.99307	.	0.251129	0.43747	D	0.000540	T	0.39200	0.1069	N	0.17379	0.485	0.51012	D	0.9999	B	0.15719	0.014	B	0.22152	0.038	T	0.40098	-0.9581	10	0.12103	T	0.63	-12.6776	15.7887	0.78332	1.0:0.0:0.0:0.0	.	158	Q9Y2C2	UST_HUMAN	A	158	ENSP00000356433:T158A	ENSP00000356433:T158A	T	+	1	0	UST	149316725	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.768000	0.74980	2.367000	0.80283	0.528000	0.53228	ACT		0.299	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043363.1	NM_005715		4	35	0	0	0	0.001168	0	4	35				
TULP4	56995	broad.mit.edu	37	6	158882747	158882747	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:158882747G>T	ENST00000367097.3	+	6	2369	c.1012G>T	c.(1012-1014)Gac>Tac	p.D338Y	TULP4_ENST00000367094.2_Missense_Mutation_p.D338Y	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	338					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D338Y(1)		endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		CTTCACACTGGACACTCTCGT	0.428																																							uc003qrf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1012-1014)GAC>TAC		tubby like protein 4 isoform 1							107.0	85.0	92.0					6																	158882747		2203	4300	6503	SO:0001583	missense	56995				intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity	g.chr6:158882747G>T		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.1012G>T	6.37:g.158882747G>T	ENSP00000356064:p.Asp338Tyr					TULP4_uc011efo.1_Missense_Mutation_p.D338Y|TULP4_uc003qrg.2_Missense_Mutation_p.D338Y	p.D338Y	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)	6	2369	+		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)	338					Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	37	c.1012G>T	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686081	0.88639	.	.	ENSG00000130338	ENST00000367097;ENST00000367094	T;T	0.18174	2.23;2.23	5.58	5.58	0.84498	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.130601	0.56097	D	0.000037	T	0.16471	0.0396	L	0.43152	1.355	0.58432	D	0.999999	P;P;P	0.46220	0.681;0.696;0.874	B;B;P	0.47206	0.34;0.413;0.541	T	0.00681	-1.1612	10	0.62326	D	0.03	-33.7929	19.5619	0.95375	0.0:0.0:1.0:0.0	.	338;338;338	B4E202;Q9NRJ4-2;Q9NRJ4	.;.;TULP4_HUMAN	Y	338	ENSP00000356064:D338Y;ENSP00000356061:D338Y	ENSP00000356061:D338Y	D	+	1	0	TULP4	158802735	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.218000	0.95166	2.616000	0.88540	0.650000	0.86243	GAC		0.428	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245		20	56	1	0	1.9806e-07	0.002299	2.77086e-07	20	56				
FNDC1	84624	broad.mit.edu	37	6	159653518	159653518	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:159653518C>A	ENST00000297267.9	+	11	2174	c.1974C>A	c.(1972-1974)caC>caA	p.H658Q	FNDC1_ENST00000340366.6_Missense_Mutation_p.H595Q	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	658					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.H658Q(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GCTCCCTCCACCCCAAGGGCG	0.677																																							uc010kjv.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(4)|ovary(3)|central_nervous_system(1)	8						c.(1972-1974)CAC>CAA		fibronectin type III domain containing 1							23.0	28.0	26.0					6																	159653518		2019	4148	6167	SO:0001583	missense	84624					extracellular region		g.chr6:159653518C>A	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1974C>A	6.37:g.159653518C>A	ENSP00000297267:p.His658Gln					FNDC1_uc010kjw.1_Missense_Mutation_p.H543Q	p.H658Q	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)	11	2174	+		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)	658					A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	c.1974C>A	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.50|10.50	1.367464|1.367464	0.24771|0.24771	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000297267;ENST00000340366|ENST00000329629	T;T|.	0.07327|.	3.2;4.03|.	4.62|4.62	0.588|0.588	0.17445|0.17445	.|.	1.433220|.	0.03868|.	N|.	0.275158|.	T|T	0.06690|0.06690	0.0171|0.0171	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B|.	0.13145|.	0.007;0.004|.	B;B|.	0.16289|.	0.015;0.006|.	T|T	0.35895|0.35895	-0.9770|-0.9770	10|5	0.23302|.	T|.	0.38|.	-3.018|-3.018	1.6615|1.6615	0.02792|0.02792	0.167:0.4804:0.1625:0.1901|0.167:0.4804:0.1625:0.1901	.|.	595;658|.	Q4ZHG4-2;Q4ZHG4|.	.;FNDC1_HUMAN|.	Q|T	658;595|554	ENSP00000297267:H658Q;ENSP00000342460:H595Q|.	ENSP00000297267:H658Q|.	H|P	+|+	3|1	2|0	FNDC1|FNDC1	159573508|159573508	0.000000|0.000000	0.05858|0.05858	0.005000|0.005000	0.12908|0.12908	0.016000|0.016000	0.09150|0.09150	-1.128000|-1.128000	0.03247|0.03247	0.161000|0.161000	0.19458|0.19458	-0.140000|-0.140000	0.14226|0.14226	CAC|CCC		0.677	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532		8	33	1	0	0.000274275	0.004482	0.000324617	8	33				
LPA	4018	broad.mit.edu	37	6	161032655	161032655	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:161032655G>T	ENST00000316300.5	-	16	2586	c.2542C>A	c.(2542-2544)Caa>Aaa	p.Q848K	LPA_ENST00000447678.1_Missense_Mutation_p.Q848K			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3356	Kringle 8. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.Q848K(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GACCAAGCTTGGCAGGTTCTT	0.507																																							uc003qtl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|pancreas(1)	6						c.(2542-2544)CAA>AAA		lipoprotein Lp(a) precursor	Aminocaproic Acid(DB00513)						176.0	189.0	185.0					6																	161032655		1225	2546	3771	SO:0001583	missense	4018				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	g.chr6:161032655G>T	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2542C>A	6.37:g.161032655G>T	ENSP00000321334:p.Gln848Lys						p.Q848K	NM_005577	NP_005568	P08519	APOA_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	17	2662	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	3356			Kringle 30.		Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	c.2542C>A	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	g	9.051	0.992071	0.18966	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.66099	-0.19;-0.19	2.17	2.17	0.27698	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.74321	0.3701	M	0.93854	3.465	0.09310	N	1	D	0.59357	0.985	D	0.70716	0.97	T	0.62158	-0.6913	9	0.72032	D	0.01	.	7.8282	0.29328	0.0:0.0:1.0:0.0	.	3356	P08519	APOA_HUMAN	K	848	ENSP00000321334:Q848K;ENSP00000395608:Q848K	ENSP00000321334:Q848K	Q	-	1	0	LPA	160952645	0.997000	0.39634	0.070000	0.20053	0.165000	0.22458	4.624000	0.61254	1.217000	0.43442	0.194000	0.17425	CAA		0.507	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577		38	242	1	0	9.59449e-18	0.00361	1.60194e-17	38	242				
PLG	5340	broad.mit.edu	37	6	161173185	161173185	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:161173185C>A	ENST00000308192.9	+	18	2227	c.2164C>A	c.(2164-2166)Cct>Act	p.P722T		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	722	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.P722T(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	AGCCCAGCTCCCTGTGATTGA	0.473																																							uc003qtm.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(2164-2166)CCT>ACT		plasminogen	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)						59.0	59.0	59.0					6																	161173185		2203	4300	6503	SO:0001583	missense	5340				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity	g.chr6:161173185C>A	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.2164C>A	6.37:g.161173185C>A	ENSP00000308938:p.Pro722Thr						p.P722T	NM_000301	NP_000292	P00747	PLMN_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	18	2227	+			722			Peptidase S1.		Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	c.2164C>A	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	.	15.77	2.931492	0.52866	.	.	ENSG00000122194	ENST00000308192;ENST00000316325	D	0.89681	-2.55	3.38	3.38	0.38709	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.39146	U	0.001449	D	0.90693	0.7080	L	0.53780	1.695	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.91300	0.5066	10	0.54805	T	0.06	.	14.6685	0.68926	0.0:1.0:0.0:0.0	.	722	P00747	PLMN_HUMAN	T	722;122	ENSP00000308938:P722T	ENSP00000308938:P722T	P	+	1	0	PLG	161093175	1.000000	0.71417	0.870000	0.34147	0.409000	0.31022	7.148000	0.77389	1.582000	0.49881	0.411000	0.27672	CCT		0.473	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301		16	48	1	0	0.00316338	0.003163	0.00355642	16	48				
RBAK	57786	broad.mit.edu	37	7	5104882	5104882	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:5104882G>T	ENST00000353796.3	+	6	2119	c.1795G>T	c.(1795-1797)Gaa>Taa	p.E599*	RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK_ENST00000396912.1_Nonsense_Mutation_p.E599*	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	599	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TGAATGTTACGAATGTGGAAA	0.378																																							uc010kss.1		NA																	0				ovary(3)|kidney(1)|skin(1)	5						c.(1795-1797)GAA>TAA		RB-associated KRAB repressor							49.0	53.0	52.0					7																	5104882		2202	4300	6502	SO:0001587	stop_gained	57786				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr7:5104882G>T	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.1795G>T	7.37:g.5104882G>T	ENSP00000275423:p.Glu599*					LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_Nonsense_Mutation_p.E599*	p.E599*	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)	6	2119	+		Ovarian(82;0.0175)	599			C2H2-type 13.|Interaction with AR.		A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Nonsense_Mutation	SNP	ENST00000353796.3	37	c.1795G>T	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	G	39	7.343477	0.98224	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	.	.	.	3.76	2.83	0.33086	.	0.129647	0.35349	N	0.003261	.	.	.	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1671	0.48550	0.0:0.1893:0.8107:0.0	.	.	.	.	X	599	.	.	E	+	1	0	RBAK	5071408	0.002000	0.14202	0.976000	0.42696	0.974000	0.67602	1.115000	0.31209	1.097000	0.41459	0.555000	0.69702	GAA		0.378	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163		3	60	1	0	6.4e-05	0.004672	7.85819e-05	3	60				
DGKB	1607	broad.mit.edu	37	7	14378261	14378261	+	Missense_Mutation	SNP	A	A	C	rs530774661	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:14378261A>C	ENST00000403951.2	-	23	2423	c.2004T>G	c.(2002-2004)caT>caG	p.H668Q	DGKB_ENST00000406247.3_Missense_Mutation_p.H668Q|DGKB_ENST00000407950.1_Missense_Mutation_p.H660Q|DGKB_ENST00000444700.2_Missense_Mutation_p.H649Q|DGKB_ENST00000258767.5_Missense_Mutation_p.H668Q|DGKB_ENST00000399322.3_Missense_Mutation_p.H668Q|DGKB_ENST00000402815.1_Missense_Mutation_p.H667Q|DGKB_ENST00000403963.1_5'UTR			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	668					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.H668Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TGGATCCTCCATGCATGCTTG	0.403																																							uc003ssz.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|ovary(4)|breast(2)|skin(1)	12						c.(2002-2004)CAT>CAG		diacylglycerol kinase, beta isoform 1	Phosphatidylserine(DB00144)						132.0	119.0	123.0					7																	14378261		1849	4092	5941	SO:0001583	missense	1607				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding	g.chr7:14378261A>C	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.2004T>G	7.37:g.14378261A>C	ENSP00000385780:p.His668Gln					DGKB_uc011jxt.1_Missense_Mutation_p.H649Q|DGKB_uc003sta.2_Missense_Mutation_p.H668Q|DGKB_uc011jxu.1_Missense_Mutation_p.H667Q	p.H668Q	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN			22	2191	-			668					A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	c.2004T>G	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	A	18.72	3.683641	0.68157	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01	5.5	0.645	0.17782	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.55784	0.1942	M	0.76328	2.33	0.40931	D	0.984399	P;D;D;D	0.62365	0.947;0.982;0.991;0.991	P;D;D;P	0.66602	0.79;0.945;0.945;0.821	T	0.54609	-0.8268	10	0.33141	T	0.24	.	9.5259	0.39165	0.7321:0.0:0.2679:0.0	.	667;649;668;668	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	Q	668;668;668;667;660;649;668	ENSP00000385780:H668Q;ENSP00000382260:H668Q;ENSP00000258767:H668Q;ENSP00000384909:H667Q;ENSP00000385031:H660Q;ENSP00000388451:H649Q;ENSP00000386066:H668Q	ENSP00000258767:H668Q	H	-	3	2	DGKB	14344786	0.064000	0.20934	1.000000	0.80357	0.999000	0.98932	-0.408000	0.07169	0.382000	0.24878	0.528000	0.53228	CAT		0.403	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080		13	99	0	0	0	0.001368	0	13	99				
HOXA2	3199	broad.mit.edu	37	7	27140891	27140891	+	Missense_Mutation	SNP	C	C	A	rs941002		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:27140891C>A	ENST00000222718.5	-	2	895	c.585G>T	c.(583-585)agG>agT	p.R195S	HOTAIRM1_ENST00000593300.1_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000428939.3_RNA|HOTAIRM1_ENST00000425358.2_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	195					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R195S(1)		breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						TGTGCTTCATCCTCCGGTTCT	0.493																																							uc003syh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(583-585)AGG>AGT		homeobox A2							92.0	81.0	85.0					7																	27140891		2203	4300	6503	SO:0001583	missense	3199					nucleus	sequence-specific DNA binding transcription factor activity	g.chr7:27140891C>A		CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.585G>T	7.37:g.27140891C>A	ENSP00000222718:p.Arg195Ser						p.R195S	NM_006735	NP_006726	O43364	HXA2_HUMAN			2	860	-			195			Homeobox.		A1L4K3|B2RMW3	Missense_Mutation	SNP	ENST00000222718.5	37	c.585G>T	CCDS5403.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.585158	0.46110	.	.	ENSG00000105996	ENST00000222718	D	0.99158	-5.5	5.45	3.63	0.41609	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99447	0.9804	H	0.97077	3.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98789	1.0735	10	0.87932	D	0	.	9.7277	0.40342	0.0:0.7821:0.0:0.2179	.	195	O43364	HXA2_HUMAN	S	195	ENSP00000222718:R195S	ENSP00000222718:R195S	R	-	3	2	HOXA2	27107416	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.126000	0.31344	0.767000	0.33267	0.655000	0.94253	AGG		0.493	HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358508.2			17	85	1	0	6.94344e-10	0.006122	1.04152e-09	17	85				
ELMO1	9844	broad.mit.edu	37	7	36917705	36917705	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:36917705G>T	ENST00000310758.4	-	19	2379	c.1732C>A	c.(1732-1734)Cgg>Agg	p.R578R	ELMO1_ENST00000396045.3_Silent_p.R98R|ELMO1_ENST00000341056.3_Silent_p.R280R|ELMO1_ENST00000448602.1_Silent_p.R578R|ELMO1_ENST00000442504.1_Silent_p.R578R|ELMO1_ENST00000396040.2_Silent_p.R98R	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	578	PH.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.R578R(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GGCGAAAGCCGACAATACCAA	0.418																																							uc003tfk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						c.(1732-1734)CGG>AGG		engulfment and cell motility 1 isoform 1							65.0	61.0	62.0					7																	36917705		2203	4300	6503	SO:0001819	synonymous_variant	9844				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding	g.chr7:36917705G>T	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1732C>A	7.37:g.36917705G>T						ELMO1_uc003tfi.1_Silent_p.R98R|ELMO1_uc003tfj.1_Silent_p.R98R|ELMO1_uc011kbb.1_RNA|ELMO1_uc011kbc.1_Silent_p.R482R|ELMO1_uc010kxg.1_Silent_p.R578R	p.R578R	NM_014800	NP_055615	Q92556	ELMO1_HUMAN			19	2039	-			578			PH.		A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Silent	SNP	ENST00000310758.4	37	c.1732C>A	CCDS5449.1																																																																																				0.418	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442		5	57	1	0	0.000602214	0.000602	0.000699466	5	57				
POLM	27434	broad.mit.edu	37	7	44113476	44113476	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:44113476C>A	ENST00000242248.5	-	9	1321	c.1220G>T	c.(1219-1221)aGg>aTg	p.R407M	POLM_ENST00000395831.3_Missense_Mutation_p.R327M|POLM_ENST00000492971.1_5'Flank|POLM_ENST00000335195.6_Missense_Mutation_p.R370M	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	407					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.R407M(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						TGGGCAGGGCCTCGTGGATCC	0.612								DNA polymerases (catalytic subunits)																															uc003tjt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1219-1221)AGG>ATG	DNA_polymerases_(catalytic_subunits)	DNA-directed DNA polymerase mu							61.0	70.0	67.0					7																	44113476		2203	4300	6503	SO:0001583	missense	27434				DNA recombination|DNA repair	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding	g.chr7:44113476C>A	AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.1220G>T	7.37:g.44113476C>A	ENSP00000242248:p.Arg407Met					POLM_uc003tjw.1_Missense_Mutation_p.R26M|POLM_uc003tju.2_Missense_Mutation_p.R370M|POLM_uc003tjx.2_Missense_Mutation_p.R327M|POLM_uc003tjv.2_RNA|POLM_uc011kbt.1_Missense_Mutation_p.R57M	p.R407M	NM_013284	NP_037416	Q9NP87	DPOLM_HUMAN			9	1312	-			407					D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	ENST00000242248.5	37	c.1220G>T	CCDS34625.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389127	0.42410	.	.	ENSG00000122678	ENST00000335195;ENST00000242248;ENST00000395831	T;T;T	0.45276	0.9;0.9;0.9	5.3	-3.12	0.05282	DNA-directed DNA polymerase X (1);	2.289880	0.01298	N	0.010229	T	0.50871	0.1641	L	0.43152	1.355	0.09310	N	1	D;P;P	0.57571	0.98;0.913;0.85	P;B;B	0.61722	0.893;0.339;0.258	T	0.50013	-0.8877	10	0.54805	T	0.06	-0.0221	6.6649	0.23035	0.0:0.3847:0.124:0.4913	.	327;370;407	Q86WQ9;Q6P5X8;Q9NP87	.;.;DPOLM_HUMAN	M	370;407;327	ENSP00000335141:R370M;ENSP00000242248:R407M;ENSP00000379174:R327M	ENSP00000242248:R407M	R	-	2	0	POLM	44080001	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.938000	0.03938	-1.146000	0.02854	-0.261000	0.10672	AGG		0.612	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1	NM_013284		19	78	1	0	0.00152264	0.010504	0.00173266	19	78				
TBRG4	9238	broad.mit.edu	37	7	45141142	45141142	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:45141142G>A	ENST00000258770.3	-	9	1760	c.1639C>T	c.(1639-1641)Cag>Tag	p.Q547*	SNORA5A_ENST00000384111.1_RNA|TBRG4_ENST00000494076.1_Nonsense_Mutation_p.Q547*|TBRG4_ENST00000361278.3_Nonsense_Mutation_p.Q437*|TBRG4_ENST00000395655.4_Nonsense_Mutation_p.Q437*	NM_004749.3	NP_004740.2	Q969Z0	TBRG4_HUMAN	transforming growth factor beta regulator 4	547					cell cycle arrest (GO:0007050)|cellular respiration (GO:0045333)|positive regulation of cell proliferation (GO:0008284)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.Q547*(1)		cervix(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(2)	17						CCAGTTGGCTGGGCAAGGTGA	0.592																																							uc003tmv.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1639-1641)CAG>TAG		cell cycle progression 2 protein isoform 1							56.0	51.0	53.0					7																	45141142		2202	4300	6502	SO:0001587	stop_gained	9238				apoptosis|cell cycle arrest|cellular respiration|G1 phase of mitotic cell cycle|positive regulation of cell proliferation	mitochondrion	ATP binding|protein binding|protein kinase activity	g.chr7:45141142G>A	AB023165	CCDS5501.1, CCDS5502.1	7p13	2006-07-07			ENSG00000136270	ENSG00000136270			17443	protein-coding gene	gene with protein product	"""FAST kinase domains 4"", ""cell cycle progression 2 protein"""	611325				9383053	Standard	NM_004749		Approved	Cpr2, KIAA0948, H_TD2522F11.8, FASTKD4	uc011kcd.3	Q969Z0	OTTHUMG00000129247	ENST00000258770.3:c.1639C>T	7.37:g.45141142G>A	ENSP00000258770:p.Gln547*					TBRG4_uc003tmu.2_Nonsense_Mutation_p.Q372*|TBRG4_uc003tmw.2_Nonsense_Mutation_p.Q437*|TBRG4_uc003tmx.2_Nonsense_Mutation_p.Q437*|TBRG4_uc011kcd.1_Nonsense_Mutation_p.Q558*	p.Q547*	NM_004749	NP_004740	Q969Z0	TBRG4_HUMAN			9	1765	-			547					A4D2L2|A4D2L3|D3DVL5|D3DVL6|O14710|Q53GI8|Q8NDM4|Q9BUC6|Q9Y2F6	Nonsense_Mutation	SNP	ENST00000258770.3	37	c.1639C>T	CCDS5501.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.6|23.6	4.434685|4.434685	0.83885|0.83885	.|.	.|.	ENSG00000136270|ENSG00000136270	ENST00000483615|ENST00000258770;ENST00000361278;ENST00000395655;ENST00000494076	.|.	.|.	.|.	4.79|4.79	3.9|3.9	0.45041|0.45041	.|.	.|0.436377	.|0.25222	.|N	.|0.032236	T|.	0.39600|.	0.1084|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.38564|.	-0.9655|.	3|.	.|0.07175	.|T	.|0.84	.|.	13.8567|13.8567	0.63531|0.63531	0.0:0.1543:0.8457:0.0|0.0:0.1543:0.8457:0.0	.|.	.|.	.|.	.|.	L|X	261|547;437;437;547	.|.	.|ENSP00000258770:Q547X	P|Q	-|-	2|1	0|0	TBRG4|TBRG4	45107667|45107667	0.002000|0.002000	0.14202|0.14202	0.033000|0.033000	0.17914|0.17914	0.650000|0.650000	0.38633|0.38633	0.853000|0.853000	0.27777|0.27777	1.203000|1.203000	0.43233|0.43233	0.591000|0.591000	0.81541|0.81541	CCA|CAG		0.592	TBRG4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251351.1	NM_030900		5	19	0	0	0	0.000602	0	5	19				
ADCY1	107	broad.mit.edu	37	7	45650023	45650023	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:45650023A>T	ENST00000297323.7	+	3	857	c.835A>T	c.(835-837)Atg>Ttg	p.M279L	ADCY1_ENST00000432715.1_Missense_Mutation_p.M54L	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	279					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.M279L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGCCATGGAGATGAAGGAGGA	0.602																																							uc003tne.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(835-837)ATG>TTG		adenylate cyclase 1	Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						85.0	89.0	87.0					7																	45650023		2203	4300	6503	SO:0001583	missense	107				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding	g.chr7:45650023A>T	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.835A>T	7.37:g.45650023A>T	ENSP00000297323:p.Met279Leu					ADCY1_uc003tnd.2_Missense_Mutation_p.M54L	p.M279L	NM_021116	NP_066939	Q08828	ADCY1_HUMAN			3	853	+			279			Cytoplasmic (Potential).		A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	c.835A>T	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	a	18.97	3.736091	0.69189	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	T;T	0.78707	-1.2;-1.15	4.88	4.88	0.63580	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.100388	0.64402	D	0.000003	T	0.76744	0.4030	M	0.81802	2.56	0.53005	D	0.999968	B;B	0.24132	0.027;0.098	B;B	0.17433	0.014;0.018	T	0.73799	-0.3869	10	0.30854	T	0.27	.	12.4522	0.55682	1.0:0.0:0.0:0.0	.	279;54	Q08828;C9J1J0	ADCY1_HUMAN;.	L	54;279;279	ENSP00000392721:M54L;ENSP00000297323:M279L	ENSP00000297323:M279L	M	+	1	0	ADCY1	45616548	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.433000	0.90291	1.814000	0.52955	0.409000	0.27619	ATG		0.602	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116		15	146	0	0	0	0.006122	0	15	146				
UPP1	7378	broad.mit.edu	37	7	48143002	48143002	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:48143002G>A	ENST00000331803.4	+	7	1053	c.430G>A	c.(430-432)Ggg>Agg	p.G144R	UPP1_ENST00000341253.4_Missense_Mutation_p.G144R|UPP1_ENST00000395564.4_Missense_Mutation_p.G144R|UPP1_ENST00000482015.1_Intron|UPP1_ENST00000429491.2_Intron			Q16831	UPP1_HUMAN	uridine phosphorylase 1	144					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)	p.G144R(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	CACTTCTGGTGGGATAGGTAA	0.522																																							uc003toj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(430-432)GGG>AGG		uridine phosphorylase 1							142.0	121.0	128.0					7																	48143002		2203	4300	6503	SO:0001583	missense	7378				nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage	cytosol	uridine phosphorylase activity	g.chr7:48143002G>A	AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.430G>A	7.37:g.48143002G>A	ENSP00000330032:p.Gly144Arg					UPP1_uc003tok.2_Missense_Mutation_p.G144R|UPP1_uc003tol.2_Missense_Mutation_p.G144R|UPP1_uc011kcg.1_Missense_Mutation_p.G144R|UPP1_uc011kch.1_Intron|UPP1_uc003ton.2_Intron|UPP1_uc003too.2_Intron	p.G144R	NM_181597	NP_853628	Q16831	UPP1_HUMAN			7	959	+			144					D3DVM4|Q15362	Missense_Mutation	SNP	ENST00000331803.4	37	c.430G>A	CCDS5507.1	.	.	.	.	.	.	.	.	.	.	G	32	5.171687	0.94807	.	.	ENSG00000183696	ENST00000416681;ENST00000331803;ENST00000341253;ENST00000395564;ENST00000436673	T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47	5.43	5.43	0.79202	Nucleoside phosphorylase domain (1);	0.000000	0.85682	D	0.000000	T	0.80549	0.4644	M	0.94063	3.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85726	0.1328	10	0.87932	D	0	-37.0937	18.2379	0.89956	0.0:0.0:1.0:0.0	.	144;144	B4DND0;Q16831	.;UPP1_HUMAN	R	144	ENSP00000405209:G144R;ENSP00000330032:G144R;ENSP00000342878:G144R;ENSP00000378931:G144R;ENSP00000390118:G144R	ENSP00000330032:G144R	G	+	1	0	UPP1	48109527	1.000000	0.71417	0.483000	0.27378	0.971000	0.66376	9.658000	0.98594	2.532000	0.85374	0.563000	0.77884	GGG		0.522	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251360.1	NM_003364		6	89	0	0	0	0.001168	0	6	89				
POM121L12	285877	broad.mit.edu	37	7	53104146	53104146	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:53104146C>A	ENST00000408890.4	+	1	798	c.782C>A	c.(781-783)cCa>cAa	p.P261Q		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	261								p.P261Q(1)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CAGCCCGCCCCATCCGCCATC	0.652																																							uc003tpz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(781-783)CCA>CAA		POM121 membrane glycoprotein-like 12							50.0	57.0	55.0					7																	53104146		2018	4174	6192	SO:0001583	missense	285877							g.chr7:53104146C>A		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.782C>A	7.37:g.53104146C>A	ENSP00000386133:p.Pro261Gln						p.P261Q	NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN			1	798	+			261					Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	37	c.782C>A	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	C	5.984	0.365558	0.11352	.	.	ENSG00000221900	ENST00000408890	T	0.34472	1.36	2.16	-4.31	0.03698	.	.	.	.	.	T	0.12987	0.0315	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.18085	-1.0348	9	0.23891	T	0.37	.	1.0686	0.01616	0.1737:0.3708:0.176:0.2794	.	261	Q8N7R1	P1L12_HUMAN	Q	261	ENSP00000386133:P261Q	ENSP00000386133:P261Q	P	+	2	0	POM121L12	53071640	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.231000	0.00269	-1.621000	0.01562	-1.157000	0.01802	CCA		0.652	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		9	47	1	0	5.16669e-11	0.000978	7.87639e-11	9	47				
WBSCR27	155368	broad.mit.edu	37	7	73249147	73249147	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:73249147G>A	ENST00000297873.4	-	6	713	c.664C>T	c.(664-666)Ctg>Ttg	p.L222L		NM_152559.2	NP_689772.2	Q8N6F8	WBS27_HUMAN	Williams Beuren syndrome chromosome region 27	222								p.L222L(1)		NS(1)|central_nervous_system(1)|lung(2)|prostate(1)	5		Lung NSC(55;0.159)				ATCCTTGGCAGAGATGCCGGA	0.642																																							uc003tzj.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(664-666)CTG>TTG		Williams-Beuren syndrome chromosome region 27							68.0	61.0	63.0					7																	73249147		2203	4300	6503	SO:0001819	synonymous_variant	155368							g.chr7:73249147G>A	AF534110	CCDS5561.1	7q11.23	2004-07-05			ENSG00000165171	ENSG00000165171			19068	protein-coding gene	gene with protein product		612546					Standard	NM_152559		Approved		uc003tzj.2	Q8N6F8	OTTHUMG00000130033	ENST00000297873.4:c.664C>T	7.37:g.73249147G>A						RFC2_uc011kfa.1_Intron	p.L222L	NM_152559	NP_689772	Q8N6F8	WBS27_HUMAN			6	704	-		Lung NSC(55;0.159)	222						Silent	SNP	ENST00000297873.4	37	c.664C>T	CCDS5561.1																																																																																				0.642	WBSCR27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252312.1	NM_152559		5	51	0	0	0	0.001168	0	5	51				
RFC2	5982	broad.mit.edu	37	7	73668693	73668693	+	Silent	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:73668693A>G	ENST00000055077.3	-	1	81	c.21T>C	c.(19-21)tgT>tgC	p.C7C	RFC2_ENST00000352131.3_Silent_p.C7C	NM_181471.1	NP_852136.1	P35250	RFC2_HUMAN	replication factor C (activator 1) 2, 40kDa	7					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.C7C(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)	8						CCGCGCCACCACAGACGGCCT	0.736																																							uc003uaj.2		NA																	1	Substitution - coding silent(1)		lung(1)	liver(1)|central_nervous_system(1)	2						c.(19-21)TGT>TGC		replication factor C 2 isoform 1							24.0	19.0	20.0					7																	73668693		2195	4297	6492	SO:0001819	synonymous_variant	5982				cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding	g.chr7:73668693A>G		CCDS5567.1, CCDS5568.1, CCDS75618.1	7q11.23	2010-04-21	2002-08-29		ENSG00000049541	ENSG00000049541		"""ATPases / AAA-type"""	9970	protein-coding gene	gene with protein product	"""activator 1"""	600404	"""replication factor C (activator 1) 2 (40kD)"""			1313560, 7774928	Standard	NM_181471		Approved	A1, RFC40	uc003uaj.3	P35250	OTTHUMG00000023239	ENST00000055077.3:c.21T>C	7.37:g.73668693A>G						RFC2_uc011kfa.1_RNA|RFC2_uc003uak.2_Silent_p.C7C|RFC2_uc010lbp.2_5'UTR|RFC2_uc003ual.2_5'UTR	p.C7C	NM_181471	NP_852136	P35250	RFC2_HUMAN			1	46	-			7					B5BU07|D3DXG3|P32846|Q9BU93	Silent	SNP	ENST00000055077.3	37	c.21T>C	CCDS5568.1																																																																																				0.736	RFC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252459.2	NM_181471		3	8	0	0	0	0.004672	0	3	8				
GTF2IRD1	9569	broad.mit.edu	37	7	73952477	73952477	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:73952477G>C	ENST00000265755.3	+	12	1814	c.1421G>C	c.(1420-1422)gGc>gCc	p.G474A	GTF2IRD1_ENST00000489094.1_3'UTR|GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.G506A|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.G474A|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.G474A	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	474					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G474A(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TCAGACAAGGGCAGCATGTCT	0.652																																							uc003uaq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(1420-1422)GGC>GCC		GTF2I repeat domain containing 1 isoform 1							78.0	76.0	77.0					7																	73952477		2203	4300	6503	SO:0001583	missense	9569					nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr7:73952477G>C	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.1421G>C	7.37:g.73952477G>C	ENSP00000265755:p.Gly474Ala					GTF2IRD1_uc010lbq.2_Missense_Mutation_p.G506A|GTF2IRD1_uc003uap.2_Missense_Mutation_p.G474A|GTF2IRD1_uc003uar.1_Missense_Mutation_p.G474A	p.G474A	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN			12	1814	+			474					O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	c.1421G>C	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	G	7.603	0.673192	0.14776	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.28454	1.62;1.62;1.62;1.61	4.01	3.09	0.35607	.	0.697471	0.14246	N	0.331737	T	0.18130	0.0435	N	0.14661	0.345	0.26485	N	0.975031	B;B;B;B	0.15141	0.005;0.009;0.007;0.012	B;B;B;B	0.17098	0.009;0.009;0.011;0.017	T	0.18903	-1.0322	10	0.28530	T	0.3	-12.6976	10.2937	0.43612	0.102:0.0:0.898:0.0	.	506;474;474;474	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	A	474;506;474;474	ENSP00000265755:G474A;ENSP00000397566:G506A;ENSP00000408477:G474A;ENSP00000418383:G474A	ENSP00000265755:G474A	G	+	2	0	GTF2IRD1	73590413	0.990000	0.36364	0.727000	0.30756	0.929000	0.56500	4.223000	0.58587	0.987000	0.38709	0.561000	0.74099	GGC		0.652	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328		6	80	0	0	0	0.00308	0	6	80				
CACNA2D1	781	broad.mit.edu	37	7	81624225	81624225	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:81624225C>G	ENST00000356253.5	-	21	2005	c.1750G>C	c.(1750-1752)Gga>Cga	p.G584R	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.G565R			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	584					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.G565R(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GTTTTTTCTCCACTTTCCCCA	0.289																																							uc003uhr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(1)	6						c.(1693-1695)GGA>CGA		calcium channel, voltage-dependent, alpha	Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)						76.0	75.0	75.0					7																	81624225		2200	4291	6491	SO:0001583	missense	781					voltage-gated calcium channel complex	metal ion binding	g.chr7:81624225C>G	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.1750G>C	7.37:g.81624225C>G	ENSP00000348589:p.Gly584Arg						p.G565R	NM_000722	NP_000713	P54289	CA2D1_HUMAN			20	1949	-			584			Extracellular (Potential).		Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37	c.1693G>C		.	.	.	.	.	.	.	.	.	.	C	25.1	4.602877	0.87157	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	T;T	0.78816	-1.21;-1.21	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.88074	0.6339	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88955	0.3389	10	0.87932	D	0	-18.3899	19.2359	0.93858	0.0:1.0:0.0:0.0	.	565	P54289-2	.	R	565;584;584	ENSP00000349320:G565R;ENSP00000348589:G584R	ENSP00000284088:G584R	G	-	1	0	CACNA2D1	81462161	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.853000	0.75435	2.538000	0.85594	0.655000	0.94253	GGA		0.289	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				7	63	0	0	0	0.00308	0	7	63				
SAMD9L	219285	broad.mit.edu	37	7	92762155	92762155	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:92762155G>T	ENST00000318238.4	-	5	4346	c.3130C>A	c.(3130-3132)Cgc>Agc	p.R1044S	SAMD9L_ENST00000437805.1_Missense_Mutation_p.R1044S|SAMD9L_ENST00000411955.1_Missense_Mutation_p.R1044S	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1044					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.R1044S(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TACACCTTGCGCTGTCTTGTA	0.358																																							uc003umh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(3130-3132)CGC>AGC		sterile alpha motif domain containing 9-like							90.0	87.0	88.0					7																	92762155		2203	4299	6502	SO:0001583	missense	219285							g.chr7:92762155G>T	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.3130C>A	7.37:g.92762155G>T	ENSP00000326247:p.Arg1044Ser					SAMD9L_uc003umj.1_Missense_Mutation_p.R1044S|SAMD9L_uc003umi.1_Missense_Mutation_p.R1044S|SAMD9L_uc010lfb.1_Missense_Mutation_p.R1044S|SAMD9L_uc003umk.1_Missense_Mutation_p.R1044S|SAMD9L_uc010lfc.1_Missense_Mutation_p.R1044S|SAMD9L_uc010lfd.1_Missense_Mutation_p.R1044S|SAMD9L_uc011khx.1_Intron	p.R1044S	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		5	4346	-	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		1044					A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	c.3130C>A	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.191306	0.58017	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.24723	1.84;1.84;1.84	4.92	3.12	0.35913	.	0.401322	0.19548	N	0.111622	T	0.32376	0.0827	M	0.63843	1.955	0.35614	D	0.808902	D	0.55385	0.971	P	0.50590	0.645	T	0.43669	-0.9377	10	0.87932	D	0	-5.9842	6.3087	0.21153	0.1556:0.0:0.6971:0.1474	.	1044	Q8IVG5	SAM9L_HUMAN	S	1044	ENSP00000326247:R1044S;ENSP00000405760:R1044S;ENSP00000408796:R1044S	ENSP00000326247:R1044S	R	-	1	0	SAMD9L	92600091	0.204000	0.23447	1.000000	0.80357	0.871000	0.50021	1.044000	0.30329	0.794000	0.33899	-0.373000	0.07131	CGC		0.358	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		15	109	1	0	1.49906e-05	0.00245	1.92884e-05	15	109				
SERPINE1	5054	broad.mit.edu	37	7	100777155	100777155	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:100777155C>T	ENST00000223095.4	+	5	1037	c.880C>T	c.(880-882)Cgc>Tgc	p.R294C	SERPINE1_ENST00000445463.2_Missense_Mutation_p.R279C	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	294					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.R294C(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	CAGGCTGCCCCGCCTCCTGGT	0.587																																							uc003uxt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)	3						c.(880-882)CGC>TGC		plasminogen activator inhibitor-1 isoform 1	Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)						102.0	88.0	93.0					7																	100777155		2203	4300	6503	SO:0001583	missense	5054				angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity	g.chr7:100777155C>T	M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.880C>T	7.37:g.100777155C>T	ENSP00000223095:p.Arg294Cys					SERPINE1_uc011kkj.1_Missense_Mutation_p.R279C|SERPINE1_uc003uxu.1_Missense_Mutation_p.R125C	p.R294C	NM_000602	NP_000593	P05121	PAI1_HUMAN			5	1028	+	Lung NSC(181;0.136)|all_lung(186;0.182)		294					B7Z4S0|F8WD53	Missense_Mutation	SNP	ENST00000223095.4	37	c.880C>T	CCDS5711.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109160	0.77096	.	.	ENSG00000106366	ENST00000223095;ENST00000445463;ENST00000536888	T;T	0.22134	1.97;1.97	5.47	5.47	0.80525	Serpin domain (3);	0.061905	0.64402	D	0.000010	T	0.41465	0.1160	L	0.46157	1.445	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	T	0.08310	-1.0728	10	0.56958	D	0.05	.	17.1908	0.86879	0.0:1.0:0.0:0.0	.	279;294	F8WD53;P05121	.;PAI1_HUMAN	C	294;279;71	ENSP00000223095:R294C;ENSP00000396766:R279C	ENSP00000223095:R294C	R	+	1	0	SERPINE1	100563875	0.988000	0.35896	0.998000	0.56505	0.994000	0.84299	2.855000	0.48333	2.724000	0.93272	0.561000	0.74099	CGC		0.587	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602		3	37	0	0	0	0.009096	0	3	37				
CUX1	1523	broad.mit.edu	37	7	101845330	101845330	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:101845330C>T	ENST00000292535.7	+	18	2791	c.2753C>T	c.(2752-2754)cCc>cTc	p.P918L	CUX1_ENST00000360264.3_Missense_Mutation_p.P929L|CUX1_ENST00000549414.2_Missense_Mutation_p.P896L|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000550008.2_Missense_Mutation_p.P862L|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000556210.1_Missense_Mutation_p.P760L|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000546411.2_Missense_Mutation_p.P816L	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	918					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.P918L(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CCGATCGTGCCCATGTCCAAG	0.657																																							uc003uyx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						c.(2752-2754)CCC>CTC		cut-like homeobox 1 isoform a							131.0	125.0	127.0					7																	101845330		2203	4300	6503	SO:0001583	missense	1523				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:101845330C>T	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2753C>T	7.37:g.101845330C>T	ENSP00000292535:p.Pro918Leu					CUX1_uc003uys.3_Missense_Mutation_p.P929L|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	p.P918L	NM_181552	NP_853530	P39880	CUX1_HUMAN			18	2791	+			918					B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	c.2753C>T	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.116956	0.37339	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.61980	0.08;0.09;0.08;0.08;0.07;0.06	5.29	4.42	0.53409	.	0.243898	0.36268	N	0.002688	T	0.57562	0.2062	L	0.50333	1.59	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.13407	0.004;0.009	T	0.57774	-0.7753	10	0.87932	D	0	-24.3777	13.8612	0.63561	0.0:0.9265:0.0:0.0735	.	918;929	P39880;P39880-3	CUX1_HUMAN;.	L	929;918;896;862;816;760	ENSP00000353401:P929L;ENSP00000292535:P918L;ENSP00000446630:P896L;ENSP00000447373:P862L;ENSP00000450125:P816L;ENSP00000451558:P760L	ENSP00000292535:P918L	P	+	2	0	CUX1	101632050	1.000000	0.71417	0.964000	0.40570	0.304000	0.27724	3.835000	0.55805	1.246000	0.43901	-0.136000	0.14681	CCC		0.657	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913		9	62	0	0	0	0.000978	0	9	62				
RELN	5649	broad.mit.edu	37	7	103163929	103163929	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:103163929G>T	ENST00000428762.1	-	47	7558	c.7399C>A	c.(7399-7401)Cag>Aag	p.Q2467K	RELN_ENST00000343529.5_Missense_Mutation_p.Q2467K|RELN_ENST00000424685.2_Missense_Mutation_p.Q2467K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2467					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.Q2467K(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CATGTCTGCTGCTTGTCAAAA	0.468																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(7399-7401)CAG>AAG		reelin isoform a							152.0	137.0	142.0					7																	103163929		2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103163929G>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7399C>A	7.37:g.103163929G>T	ENSP00000392423:p.Gln2467Lys					RELN_uc010liz.2_Missense_Mutation_p.Q2467K	p.Q2467K	NM_005045	NP_005036	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	47	7559	-			2467					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.7399C>A	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.762972	0.69763	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.22539	1.95;1.95;1.95	5.55	5.55	0.83447	Neuraminidase (1);	0.116434	0.64402	D	0.000011	T	0.23210	0.0561	L	0.38175	1.15	0.58432	D	0.999999	B;B	0.27117	0.168;0.001	B;B	0.34093	0.175;0.003	T	0.03394	-1.1041	10	0.25751	T	0.34	.	19.5283	0.95215	0.0:0.0:1.0:0.0	.	2467;2467	P78509-2;P78509	.;RELN_HUMAN	K	2467	ENSP00000392423:Q2467K;ENSP00000345694:Q2467K;ENSP00000388446:Q2467K	ENSP00000345694:Q2467K	Q	-	1	0	RELN	102951165	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.596000	0.87737	0.655000	0.94253	CAG		0.468	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		22	111	1	0	1.9806e-07	0.002299	2.77086e-07	22	111				
ST7	7982	broad.mit.edu	37	7	116869938	116869938	+	3'UTR	SNP	A	A	C	rs201022134		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:116869938A>C	ENST00000393446.2	+	0	1902				ST7_ENST00000422922.1_3'UTR|ST7_ENST00000393451.3_3'UTR|ST7_ENST00000432298.1_3'UTR|ST7_ENST00000393444.3_3'UTR|ST7_ENST00000393449.1_3'UTR|ST7_ENST00000323984.3_3'UTR|ST7_ENST00000393447.4_3'UTR|ST7_ENST00000393443.1_3'UTR			Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7						endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CACTCACCTCACCCGCCGCTG	0.507																																							uc011knn.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1465-1467)ACC>CCC		suppression of tumorigenicity 7 isoform b							60.0	58.0	59.0					7																	116869938		2203	4300	6503	SO:0001624	3_prime_UTR_variant	7982					integral to membrane	binding	g.chr7:116869938A>C	AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000393446.2:c.*27A>C	7.37:g.116869938A>C						ST7_uc003vio.2_3'UTR|ST7_uc003viq.2_3'UTR|ST7_uc011knm.1_3'UTR|ST7_uc003vir.2_3'UTR	p.T489P	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)	14	1470	+	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		Error:Variant_position_missing_in_Q9NRC1_after_alignment					A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000393446.2	37	c.1465A>C		.	.	.	.	.	.	.	.	.	.	A	3.912	-0.019789	0.07634	.	.	ENSG00000004866	ENST00000446490;ENST00000490039	T;T	0.20069	2.1;2.1	4.85	-9.7	0.00521	.	.	.	.	.	T	0.12902	0.0313	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16988	-1.0384	8	0.87932	D	0	.	8.0486	0.30564	0.3268:0.2885:0.3847:0.0	.	489	C9JU30	.	P	487;489	ENSP00000402934:T487P;ENSP00000419516:T489P	ENSP00000402934:T487P	T	+	1	0	ST7	116657174	0.000000	0.05858	0.008000	0.14137	0.044000	0.14063	-0.532000	0.06164	-1.939000	0.01044	-1.252000	0.01501	ACC		0.507	ST7-013	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000319687.1	NM_021908		10	22	0	0	0	0.00361	0	10	22				
PTPRZ1	5803	broad.mit.edu	37	7	121651013	121651013	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:121651013G>A	ENST00000393386.2	+	12	2324	c.1913G>A	c.(1912-1914)gGt>gAt	p.G638D	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.G638D	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	638					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G638D(2)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ACTTCATCAGGTTCAGAAGAA	0.423																																							uc003vjy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						c.(1912-1914)GGT>GAT		protein tyrosine phosphatase, receptor-type,							60.0	57.0	58.0					7																	121651013		2203	4300	6503	SO:0001583	missense	5803				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:121651013G>A	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1913G>A	7.37:g.121651013G>A	ENSP00000377047:p.Gly638Asp					PTPRZ1_uc003vjz.2_Missense_Mutation_p.G638D|PTPRZ1_uc011knt.1_Missense_Mutation_p.G88D	p.G638D	NM_002851	NP_002842	P23471	PTPRZ_HUMAN			12	2308	+			638			Extracellular (Potential).		A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	c.1913G>A	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.579110	0.28180	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.44881	0.91;0.96	5.87	4.89	0.63831	.	0.282757	0.32106	N	0.006573	T	0.34019	0.0883	L	0.45137	1.4	0.24658	N	0.993488	B;B;B	0.17465	0.001;0.007;0.022	B;B;B	0.17433	0.006;0.004;0.018	T	0.13229	-1.0517	10	0.41790	T	0.15	.	9.9777	0.41795	0.1774:0.0:0.8226:0.0	.	638;638;638	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	D	638	ENSP00000377047:G638D;ENSP00000410000:G638D	ENSP00000377047:G638D	G	+	2	0	PTPRZ1	121438249	0.992000	0.36948	0.944000	0.38274	0.934000	0.57294	2.348000	0.44045	2.778000	0.95560	0.655000	0.94253	GGT		0.423	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		14	94	0	0	0	0.003163	0	14	94				
SPAM1	6677	broad.mit.edu	37	7	123594501	123594501	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:123594501G>C	ENST00000439500.1	+	4	1490	c.877G>C	c.(877-879)Gat>Cat	p.D293H	SPAM1_ENST00000460182.1_Missense_Mutation_p.D293H|SPAM1_ENST00000223028.7_Missense_Mutation_p.D293H|SPAM1_ENST00000402183.2_Missense_Mutation_p.D293H|SPAM1_ENST00000340011.5_Missense_Mutation_p.D293H	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	293					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.D293H(2)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CAAAATACCTGATGCAAAAAG	0.413																																							uc003vld.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|kidney(1)	4						c.(877-879)GAT>CAT		sperm adhesion molecule 1 isoform 2	Hyaluronidase(DB00070)						62.0	59.0	60.0					7																	123594501		2203	4299	6502	SO:0001583	missense	6677				binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity	g.chr7:123594501G>C	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.877G>C	7.37:g.123594501G>C	ENSP00000402123:p.Asp293His					SPAM1_uc003vle.2_Missense_Mutation_p.D293H|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Missense_Mutation_p.D293H|SPAM1_uc010lku.2_Missense_Mutation_p.D293H	p.D293H	NM_153189	NP_694859	P38567	HYALP_HUMAN			4	1279	+			293					Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	37	c.877G>C	CCDS5791.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.681640	0.29872	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93	6.17	-4.85	0.03142	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.913099	0.09600	N	0.780320	T	0.18509	0.0444	L	0.42686	1.345	0.09310	N	1	B;B	0.14805	0.004;0.011	B;B	0.20384	0.018;0.029	T	0.36504	-0.9745	9	.	.	.	-5.851	9.9976	0.41909	0.3418:0.105:0.5532:0.0	.	293;293	Q8TC30;P38567	.;HYALP_HUMAN	H	293	ENSP00000386028:D293H;ENSP00000417934:D293H;ENSP00000345849:D293H;ENSP00000402123:D293H;ENSP00000223028:D293H	.	D	+	1	0	SPAM1	123381737	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.554000	0.06006	-0.523000	0.06409	-0.137000	0.14449	GAT		0.413	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1			14	58	0	0	0	0.003163	0	14	58				
DGKI	9162	broad.mit.edu	37	7	137148322	137148322	+	Missense_Mutation	SNP	C	C	A	rs78898727		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:137148322C>A	ENST00000288490.5	-	28	2672	c.2672G>T	c.(2671-2673)cGc>cTc	p.R891L	DGKI_ENST00000453654.2_Intron|DGKI_ENST00000446122.1_Missense_Mutation_p.R873L|DGKI_ENST00000424189.2_Missense_Mutation_p.R904L	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	891					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.R891L(2)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						ACTCAGCATGCGTTTCCGCAG	0.507																																							uc003vtt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|kidney(1)|skin(1)	3						c.(2671-2673)CGC>CTC		diacylglycerol kinase, iota							89.0	76.0	80.0					7																	137148322		2203	4300	6503	SO:0001583	missense	9162				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chr7:137148322C>A	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2672G>T	7.37:g.137148322C>A	ENSP00000288490:p.Arg891Leu					DGKI_uc003vtu.2_Intron	p.R891L	NM_004717	NP_004708	O75912	DGKI_HUMAN			28	2673	-			891					A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	c.2672G>T	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.094241	0.56075	.	.	ENSG00000157680	ENST00000424189;ENST00000288490;ENST00000446122	T;T	0.34667	1.35;1.53	5.91	4.11	0.48088	.	0.505418	0.20476	N	0.091600	T	0.19087	0.0458	N	0.08118	0	0.44247	D	0.997094	B	0.29301	0.241	B	0.20955	0.032	T	0.04041	-1.0982	10	0.37606	T	0.19	.	12.7037	0.57049	0.0:0.8666:0.0:0.1334	.	891	O75912	DGKI_HUMAN	L	894;891;873	ENSP00000288490:R891L;ENSP00000399131:R873L	ENSP00000288490:R891L	R	-	2	0	DGKI	136798862	1.000000	0.71417	0.864000	0.33941	0.989000	0.77384	2.655000	0.46707	0.844000	0.35094	0.655000	0.94253	CGC		0.507	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717		6	39	1	0	3.59834e-05	0.001168	4.51603e-05	6	39				
BRAF	673	broad.mit.edu	37	7	140494268	140494268	+	Splice_Site	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:140494268C>A	ENST00000288602.6	-	8	1041		c.e8-1			NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase						activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	AATTTGGGGCCTGGAAAAATG	0.363		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	Colon(40;35 892 2973 5743 27438)	uc003vwc.3		61		Dom	yes		7	7q34	673	Mis|T|O	v-raf murine sarcoma viral oncogene homolog B1	yes	Cardio-facio-cutaneous syndrome	E	AKAP9|KIAA1549		melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	1	Unknown(1)		lung(1)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290						c.e8-1		B-Raf	Sorafenib(DB00398)						118.0	119.0	119.0					7																	140494268		2203	4300	6503	SO:0001630	splice_region_variant	673	Cardiofaciocutaneous_syndrome	Familial Cancer Database	CFC, CFCS	activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	g.chr7:140494268C>A	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.981-1G>T	7.37:g.140494268C>A							p.G327_splice	NM_004333	NP_004324	P15056	BRAF_HUMAN			8	1042	-	Melanoma(164;0.00956)							A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Splice_Site	SNP	ENST00000288602.6	37	c.981_splice	CCDS5863.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.818230	0.90790	.	.	ENSG00000157764	ENST00000288602	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1649	0.98147	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BRAF	140140737	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.986000	0.76200	2.753000	0.94483	0.655000	0.94253	.		0.363	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	Intron	4	84	1	0	1.23904e-05	0.000602	1.60532e-05	4	84				
EPHB6	2051	broad.mit.edu	37	7	142568118	142568118	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:142568118G>A	ENST00000392957.2	+	18	3546	c.2759G>A	c.(2758-2760)cGc>cAc	p.R920H	EPHB6_ENST00000411471.2_Missense_Mutation_p.R643H|EPHB6_ENST00000476059.1_3'UTR|EPHB6_ENST00000442129.1_Missense_Mutation_p.R920H	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	920						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)	p.R905H(1)		NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					AAGATGATCCGCAAGCCAGAT	0.572																																							uc011kst.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(2758-2760)CGC>CAC		ephrin receptor EphB6 precursor							59.0	70.0	66.0					7																	142568118		2203	4300	6503	SO:0001583	missense	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142568118G>A	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.2759G>A	7.37:g.142568118G>A	ENSP00000376684:p.Arg920His					EPHB6_uc011ksu.1_Missense_Mutation_p.R920H|EPHB6_uc003wbs.2_Missense_Mutation_p.R628H|EPHB6_uc003wbt.2_Missense_Mutation_p.R394H|EPHB6_uc003wbu.2_Missense_Mutation_p.R628H|EPHB6_uc003wbv.2_Missense_Mutation_p.R304H	p.R920H	NM_004445	NP_004436	O15197	EPHB6_HUMAN			18	3546	+	Melanoma(164;0.059)		920			Cytoplasmic (Potential).		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	c.2759G>A	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946903	0.92593	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.62364	0.03;0.03;0.03	5.58	5.58	0.84498	Protein kinase-like domain (1);	0.000000	0.47852	D	0.000201	T	0.78181	0.4243	M	0.62154	1.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	T	0.79381	-0.1827	10	0.72032	D	0.01	.	18.554	0.91077	0.0:0.0:1.0:0.0	.	920;643	O15197;O15197-2	EPHB6_HUMAN;.	H	920;920;643	ENSP00000376684:R920H;ENSP00000410789:R920H;ENSP00000409061:R643H	ENSP00000376684:R920H	R	+	2	0	EPHB6	142278240	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.819000	0.86621	2.606000	0.88127	0.655000	0.94253	CGC		0.572	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			27	111	0	0	0	0.00632	0	27	111				
KEL	3792	broad.mit.edu	37	7	142651453	142651453	+	Missense_Mutation	SNP	G	G	A	rs61728832		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:142651453G>A	ENST00000355265.2	-	8	1216	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	248			R -> Q (in KEL25 antigen).		vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.R248W(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					AGGTATTCCCGAAAGATCTGG	0.527																																							uc003wcb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(742-744)CGG>TGG		Kell blood group, metallo-endopeptidase		G	TRP/ARG	0,4406		0,0,2203	115.0	113.0	114.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	742	5.1	0.7	7	dbSNP_129	114	1,8599	1.2+/-3.3	0,1,4299	no	missense	KEL	NM_000420.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	248/733	142651453	1,13005	2203	4300	6503	SO:0001583	missense	3792				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr7:142651453G>A	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.742C>T	7.37:g.142651453G>A	ENSP00000347409:p.Arg248Trp						p.R248W	NM_000420	NP_000411	P23276	KELL_HUMAN			8	952	-	Melanoma(164;0.059)		248		R -> Q (in KEL25 antigen).	Extracellular (Potential).		B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	c.742C>T	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	G	9.266	1.044536	0.19748	0.0	1.16E-4	ENSG00000197993	ENST00000355265;ENST00000476829	T;T	0.74421	-0.84;0.79	6.07	5.11	0.69529	Peptidase M13 (1);	0.000000	0.52532	D	0.000076	D	0.83894	0.5353	M	0.75447	2.3	0.49483	D	0.999796	D	0.89917	1.0	D	0.74674	0.984	D	0.85125	0.0971	10	0.72032	D	0.01	-27.3895	10.1012	0.42507	0.0:0.0:0.6441:0.3559	rs61728832	248	P23276	KELL_HUMAN	W	248;178	ENSP00000347409:R248W;ENSP00000419889:R178W	ENSP00000347409:R248W	R	-	1	2	KEL	142361575	0.941000	0.31946	0.666000	0.29783	0.340000	0.28889	1.647000	0.37260	1.505000	0.48720	0.585000	0.79938	CGG		0.527	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		11	74	0	0	0	0.001855	0	11	74				
CLCN1	1180	broad.mit.edu	37	7	143039237	143039237	+	Splice_Site	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:143039237T>C	ENST00000343257.2	+	15	1883		c.e15+2			NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1						chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.?(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					CCAGCTCAGGTCAGGGGCACT	0.512																																							uc003wcr.1		NA																	1	Unknown(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.e15+2		chloride channel 1, skeletal muscle							44.0	43.0	43.0					7																	143039237		2203	4300	6503	SO:0001630	splice_region_variant	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143039237T>C	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1796+2T>C	7.37:g.143039237T>C						CLCN1_uc011ktc.1_Splice_Site_p.S211_splice	p.S599_splice	NM_000083	NP_000074	P35523	CLCN1_HUMAN			15	1883	+	Melanoma(164;0.205)							A4D2H5|Q2M202	Splice_Site	SNP	ENST00000343257.2	37	c.1796_splice	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.001741	0.74932	.	.	ENSG00000188037	ENST00000343257	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5757	0.84637	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CLCN1	142749359	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.497000	0.66924	2.317000	0.78254	0.523000	0.50628	.		0.512	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	Intron	8	27	0	0	0	0.004482	0	8	27				
OR2A2	442361	broad.mit.edu	37	7	143806842	143806842	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:143806842C>A	ENST00000408979.2	+	1	236	c.167C>A	c.(166-168)aCa>aAa	p.T56K		NM_001005480.2	NP_001005480.2	Q6IF42	OR2A2_HUMAN	olfactory receptor, family 2, subfamily A, member 2	56						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)|skin(4)	22	Melanoma(164;0.0783)					AAGCTTCACACACCCATGTAC	0.473																																							uc011ktz.1		NA																	0				skin(2)	2						c.(166-168)ACA>AAA		olfactory receptor, family 2, subfamily A,							217.0	215.0	215.0					7																	143806842		2105	4259	6364	SO:0001583	missense	442361				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143806842C>A		CCDS43671.1	7q35	2013-09-20		2004-03-10	ENSG00000221989	ENSG00000221989		"""GPCR / Class A : Olfactory receptors"""	8230	protein-coding gene	gene with protein product				OR2A2P, OR2A17P			Standard	NM_001005480		Approved	OST008	uc011ktz.2	Q6IF42	OTTHUMG00000158001	ENST00000408979.2:c.167C>A	7.37:g.143806842C>A	ENSP00000386209:p.Thr56Lys						p.T56K	NM_001005480	NP_001005480	Q6IF42	OR2A2_HUMAN			1	167	+	Melanoma(164;0.0783)		56			Cytoplasmic (Potential).		B2RN85|Q8NGT6	Missense_Mutation	SNP	ENST00000408979.2	37	c.167C>A	CCDS43671.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.383775	0.25031	.	.	ENSG00000221989	ENST00000408979	T	0.00478	7.13	3.22	0.0392	0.14203	GPCR, rhodopsin-like superfamily (1);	0.267751	0.19526	U	0.112155	T	0.00875	0.0029	M	0.81112	2.525	0.09310	N	1	D	0.57899	0.981	P	0.59115	0.852	T	0.46400	-0.9194	10	0.87932	D	0	-16.6216	5.0885	0.14696	0.0:0.6075:0.1721:0.2204	.	56	Q6IF42	OR2A2_HUMAN	K	56	ENSP00000386209:T56K	ENSP00000386209:T56K	T	+	2	0	OR2A2	143437775	0.004000	0.15560	0.030000	0.17652	0.311000	0.27955	0.168000	0.16622	-0.118000	0.11851	-0.192000	0.12808	ACA		0.473	OR2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349978.1			6	245	1	0	0.00198382	0.001984	0.00223928	6	245				
OR2A7	401427	broad.mit.edu	37	7	143955988	143955988	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:143955988C>A	ENST00000493325.1	-	1	827	c.734G>T	c.(733-735)tGt>tTt	p.C245F	OR2A1-AS1_ENST00000463561.1_RNA|OR2A1-AS1_ENST00000487102.1_RNA|ARHGEF35_ENST00000543357.1_Intron|OR2A1-AS1_ENST00000476560.1_RNA|OR2A1-AS1_ENST00000489488.1_RNA|OR2A1-AS1_ENST00000478806.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|OR2A1-AS1_ENST00000498397.1_RNA|RP4-545C24.1_ENST00000460955.1_RNA	NM_001005328.1	NP_001005328.1	Q96R45	OR2A7_HUMAN	olfactory receptor, family 2, subfamily A, member 7	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C245F(2)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)	6	Melanoma(164;0.14)					TCCAATCACACAGAGGTGGGA	0.453																																							uc011kuc.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(733-735)TGT>TTT		olfactory receptor, family 2, subfamily A,							201.0	204.0	203.0					7																	143955988		2203	4300	6503	SO:0001583	missense	401427				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143955988C>A		CCDS55177.1	7q35	2013-09-20			ENSG00000243896	ENSG00000243896		"""GPCR / Class A : Olfactory receptors"""	8234	protein-coding gene	gene with protein product							Standard	NM_001005328		Approved	HSDJ0798C17	uc011kuc.2	Q96R45	OTTHUMG00000158002	ENST00000493325.1:c.734G>T	7.37:g.143955988C>A	ENSP00000420502:p.Cys245Phe					OR2A9P_uc003wec.1_Intron|uc003wed.2_5'Flank	p.C245F	NM_001005328	NP_001005328	Q96R45	OR2A7_HUMAN			1	734	-	Melanoma(164;0.14)		245			Helical; Name=6; (Potential).		B2RN57|Q6IFP4	Missense_Mutation	SNP	ENST00000493325.1	37	c.734G>T	CCDS55177.1	.	.	.	.	.	.	.	.	.	.	c	4.701	0.130352	0.08981	.	.	ENSG00000243896	ENST00000493325	T	0.35236	1.32	3.17	3.17	0.36434	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.31979	0.0814	L	0.50333	1.59	0.34781	D	0.734742	B	0.33494	0.414	B	0.30105	0.111	T	0.53136	-0.8481	9	0.59425	D	0.04	.	12.5872	0.56424	0.0:1.0:0.0:0.0	.	245	Q96R45	OR2A7_HUMAN	F	245	ENSP00000420502:C245F	ENSP00000420502:C245F	C	-	2	0	OR2A7	143586921	0.000000	0.05858	1.000000	0.80357	0.227000	0.25037	0.420000	0.21263	2.062000	0.61559	0.508000	0.49915	TGT		0.453	OR2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349979.1			15	340	1	0	7.93312e-07	0.00245	1.08814e-06	15	340				
NOBOX	135935	broad.mit.edu	37	7	144097292	144097292	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:144097292C>A	ENST00000467773.1	-	5	957	c.958G>T	c.(958-960)Ggg>Tgg	p.G320W	NOBOX_ENST00000483238.1_Intron|NOBOX_ENST00000223140.5_Intron	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	320					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.G320W(1)|p.?(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					GAGCCGGCCCCCTTTACCATG	0.587																																							uc011kue.1		NA																	2	Substitution - Missense(1)|Unknown(1)		lung(2)	ovary(1)	1						c.(958-960)GGG>TGG		NOBOX oogenesis homeobox							59.0	60.0	60.0					7																	144097292		1944	4119	6063	SO:0001583	missense	135935				cell differentiation|oogenesis	nucleus	sequence-specific DNA binding	g.chr7:144097292C>A			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.958G>T	7.37:g.144097292C>A	ENSP00000419457:p.Gly320Trp						p.G320W	NM_001080413	NP_001073882	O60393	NOBOX_HUMAN			5	958	-	Melanoma(164;0.14)		320			Homeobox.		A6NCD3|A8MZN5	Missense_Mutation	SNP	ENST00000467773.1	37	c.958G>T		.	.	.	.	.	.	.	.	.	.	C	13.69	2.311879	0.40895	.	.	ENSG00000106410	ENST00000467773	D	0.94000	-3.33	5.48	3.54	0.40534	Homeobox (2);	.	.	.	.	D	0.93936	0.8059	L	0.36672	1.1	0.41786	D	0.989845	D	0.89917	1.0	D	0.79784	0.993	D	0.93903	0.7190	9	0.66056	D	0.02	.	11.6577	0.51328	0.0:0.654:0.346:0.0	.	320	O60393	NOBOX_HUMAN	W	320	ENSP00000419457:G320W	ENSP00000419457:G320W	G	-	1	0	NOBOX	143728225	0.000000	0.05858	0.707000	0.30419	0.341000	0.28922	-0.005000	0.12855	1.284000	0.44531	0.650000	0.86243	GGG		0.587	NOBOX-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000350095.1	XM_001134420		10	77	1	0	6.40141e-05	0.000978	7.85819e-05	10	77				
NOS3	4846	broad.mit.edu	37	7	150704248	150704248	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:150704248G>T	ENST00000297494.3	+	17	2353	c.1996G>T	c.(1996-1998)Gcc>Tcc	p.A666S	NOS3_ENST00000461406.1_Missense_Mutation_p.A460S	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.A666S(1)		NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTTTGCTCGTGCCGTGGACAC	0.697																																							uc003wif.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|large_intestine(2)|skin(1)	8						c.(1996-1998)GCC>TCC		nitric oxide synthase 3 isoform 1	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)						79.0	84.0	82.0					7																	150704248		2203	4300	6503	SO:0001583	missense	4846				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding	g.chr7:150704248G>T		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.1996G>T	7.37:g.150704248G>T	ENSP00000297494:p.Ala666Ser					NOS3_uc011kuy.1_Missense_Mutation_p.A460S	p.A666S	NM_000603	NP_000594	P29474	NOS3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	17	2292	+	all_neural(206;0.219)		666			Flavodoxin-like.|FMN (By similarity).		Q495E5	Missense_Mutation	SNP	ENST00000297494.3	37	c.1996G>T	CCDS5912.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.619359	0.46736	.	.	ENSG00000164867	ENST00000297494;ENST00000461406	T;T	0.73897	-0.79;-0.79	4.93	4.93	0.64822	Flavodoxin/nitric oxide synthase (2);	0.000000	0.64402	D	0.000010	T	0.69052	0.3068	L	0.45352	1.415	0.80722	D	1	B;B	0.22211	0.066;0.035	B;B	0.30179	0.112;0.038	T	0.63871	-0.6539	10	0.23302	T	0.38	-23.2072	16.0722	0.80943	0.0:0.0:1.0:0.0	.	460;666	E7ESA7;P29474	.;NOS3_HUMAN	S	666;460	ENSP00000297494:A666S;ENSP00000417143:A460S	ENSP00000297494:A666S	A	+	1	0	NOS3	150335181	1.000000	0.71417	0.984000	0.44739	0.938000	0.57974	7.935000	0.87658	2.462000	0.83206	0.505000	0.49811	GCC		0.697	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350750.2	NM_000603		22	98	1	0	3.08376e-08	0.00333	4.42453e-08	22	98				
PRSS55	203074	broad.mit.edu	37	8	10383137	10383137	+	Silent	SNP	G	G	T	rs373798436		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:10383137G>T	ENST00000328655.3	+	1	82	c.42G>T	c.(40-42)acG>acT	p.T14T	PRSS55_ENST00000522210.1_Silent_p.T14T|PRSS51_ENST00000523024.1_RNA	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	14						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.T14T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						CCCTGGTCACGGGAACTCAGC	0.677																																							uc003wta.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(40-42)ACG>ACT		hypothetical protein LOC203074 precursor							92.0	75.0	81.0					8																	10383137		2203	4300	6503	SO:0001819	synonymous_variant	203074				proteolysis	integral to membrane	serine-type endopeptidase activity	g.chr8:10383137G>T	AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.42G>T	8.37:g.10383137G>T						uc010lru.2_Intron	p.T14T	NM_198464	NP_940866	Q6UWB4	PRS55_HUMAN			1	57	+			14					E5RJX5	Silent	SNP	ENST00000328655.3	37	c.42G>T	CCDS5976.1																																																																																				0.677	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	NM_198464		5	43	1	0	8.12818e-05	0.001984	9.89135e-05	5	43				
RP1L1	94137	broad.mit.edu	37	8	10465503	10465503	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:10465503C>A	ENST00000382483.3	-	4	6328	c.6105G>T	c.(6103-6105)caG>caT	p.Q2035H		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2115	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.Q2035H(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTTCAACCTCCTGGGCCTCTT	0.617																																							uc003wtc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(6103-6105)CAG>CAT		retinitis pigmentosa 1-like 1							154.0	173.0	167.0					8																	10465503		2089	4204	6293	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10465503C>A	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.6105G>T	8.37:g.10465503C>A	ENSP00000371923:p.Gln2035His						p.Q2035H	NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	6334	-			2035					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.6105G>T	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	2.388	-0.340481	0.05243	.	.	ENSG00000183638	ENST00000382483	T	0.04551	3.6	1.13	-2.26	0.06867	.	.	.	.	.	T	0.01870	0.0059	N	0.08118	0	0.09310	N	1	P	0.36616	0.561	B	0.20577	0.03	T	0.39143	-0.9628	9	0.52906	T	0.07	.	5.6269	0.17487	0.1695:0.6294:0.0:0.2011	.	2035	A6NKC6	.	H	2035	ENSP00000371923:Q2035H	ENSP00000371923:Q2035H	Q	-	3	2	RP1L1	10502913	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.803000	0.27083	-1.893000	0.01106	-1.875000	0.00549	CAG		0.617	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			15	160	1	0	0.00244969	0.00245	0.0027596	15	160				
SLC35G5	83650	broad.mit.edu	37	8	11189238	11189238	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:11189238T>A	ENST00000382435.4	+	1	842	c.623T>A	c.(622-624)cTg>cAg	p.L208Q		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	208						integral component of membrane (GO:0016021)		p.L208Q(1)									CTGGGGCTTCTGGTCTATCGT	0.617																																							uc003wtp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(622-624)CTG>CAG		acyl-malonyl condensing enzyme							84.0	91.0	89.0					8																	11189238		2203	4300	6503	SO:0001583	missense	83650					integral to membrane		g.chr8:11189238T>A	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.623T>A	8.37:g.11189238T>A	ENSP00000371872:p.Leu208Gln						p.L208Q	NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)	1	744	+			208			Helical; (Potential).		A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	37	c.623T>A	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	T	5.993	0.367198	0.11352	.	.	ENSG00000177710	ENST00000382435	T	0.27720	1.65	.	.	.	.	0.213535	0.23148	N	0.051395	T	0.16769	0.0403	N	0.22421	0.69	0.20821	N	0.999846	B	0.21905	0.062	B	0.17098	0.017	T	0.14144	-1.0483	8	0.56958	D	0.05	-0.4069	.	.	.	.	208	Q96KT7	S35G5_HUMAN	Q	208	ENSP00000371872:L208Q	ENSP00000371872:L208Q	L	+	2	0	SLC35G5	11226648	0.650000	0.27331	0.118000	0.21660	0.118000	0.20060	1.541000	0.36126	0.077000	0.16863	0.076000	0.15429	CTG		0.617	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028		11	83	0	0	0	0.008291	0	11	83				
ATP6V1B2	526	broad.mit.edu	37	8	20073974	20073974	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:20073974A>G	ENST00000276390.2	+	11	1169	c.1129A>G	c.(1129-1131)Atc>Gtc	p.I377V		NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2	377					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.I377V(1)		endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	AGAGGGGCAGATCTATGTGGA	0.493																																					Pancreas(119;1230 1726 3901 4036 31644)	Pancreas(119;1230 1726 3901 4036 31644)	uc003wzp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1129-1131)ATC>GTC		vacuolar H+ATPase B2							133.0	109.0	117.0					8																	20073974		2203	4300	6503	SO:0001583	missense	526				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|endomembrane system|Golgi apparatus|melanosome|plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism	g.chr8:20073974A>G	L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.1129A>G	8.37:g.20073974A>G	ENSP00000276390:p.Ile377Val					ATP6V1B2_uc003wzq.1_5'Flank	p.I377V	NM_001693	NP_001684	P21281	VATB2_HUMAN		Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	11	1343	+			377					B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Missense_Mutation	SNP	ENST00000276390.2	37	c.1129A>G	CCDS6014.1	.	.	.	.	.	.	.	.	.	.	A	14.44	2.536914	0.45176	.	.	ENSG00000147416	ENST00000276390;ENST00000542368	T	0.80304	-1.36	5.63	5.63	0.86233	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.047393	0.85682	D	0.000000	T	0.81847	0.4909	M	0.77486	2.375	0.80722	D	1	B	0.15473	0.013	B	0.21546	0.035	T	0.79529	-0.1766	10	0.59425	D	0.04	-15.8711	14.9609	0.71156	1.0:0.0:0.0:0.0	.	377	P21281	VATB2_HUMAN	V	377;251	ENSP00000276390:I377V	ENSP00000276390:I377V	I	+	1	0	ATP6V1B2	20118254	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.417000	0.52714	2.258000	0.74832	0.533000	0.62120	ATC		0.493	ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253732.1	NM_001693		4	35	0	0	0	0.000602	0	4	35				
ADAM7	8756	broad.mit.edu	37	8	24326279	24326279	+	Splice_Site	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:24326279G>T	ENST00000175238.6	+	7	662		c.e7-1		RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000380789.1_Splice_Site	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TAACTTTACAGGGCATCCATG	0.308																																							uc003xeb.2		NA																	1	Unknown(1)		lung(1)	skin(3)|ovary(1)|kidney(1)	5						c.e7-1		a disintegrin and metalloproteinase domain 7							204.0	183.0	190.0					8																	24326279		2203	4300	6503	SO:0001630	splice_region_variant	8756				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr8:24326279G>T	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.580-1G>T	8.37:g.24326279G>T							p.G194_splice	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)	7	693	+		Prostate(55;0.0181)						A8K8X7|O75959|Q6PEJ6	Splice_Site	SNP	ENST00000175238.6	37	c.580_splice	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118444	0.37339	.	.	ENSG00000069206	ENST00000175238;ENST00000380789	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3013	0.66355	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAM7	24382169	0.960000	0.32886	0.842000	0.33263	0.005000	0.04900	4.046000	0.57376	2.834000	0.97654	0.557000	0.71058	.		0.308	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	Intron	9	33	1	0	0.000442599	0.006214	0.000519452	9	33				
KAT6A	7994	broad.mit.edu	37	8	41792282	41792282	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:41792282C>T	ENST00000396930.3	-	18	3999	c.3456G>A	c.(3454-3456)tgG>tgA	p.W1152*	KAT6A_ENST00000265713.2_Nonsense_Mutation_p.W1152*|KAT6A_ENST00000406337.1_Nonsense_Mutation_p.W1152*	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1152					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.W1152*(1)									TGCCTTTGGGCCATCCCTTTT	0.438																																							uc010lxb.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(3454-3456)TGG>TGA		MYST histone acetyltransferase (monocytic							169.0	179.0	176.0					8																	41792282		2203	4300	6503	SO:0001587	stop_gained	7994				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding	g.chr8:41792282C>T	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3456G>A	8.37:g.41792282C>T	ENSP00000380136:p.Trp1152*					MYST3_uc010lxc.2_Nonsense_Mutation_p.W1152*|MYST3_uc003xon.3_Nonsense_Mutation_p.W1152*	p.W1152*	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)		18	4000	-	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	1152					Q76L81	Nonsense_Mutation	SNP	ENST00000396930.3	37	c.3456G>A	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	C	45	11.376574	0.99553	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	.	.	.	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-12.1968	20.0887	0.97806	0.0:1.0:0.0:0.0	.	.	.	.	X	1152	.	ENSP00000265713:W1152X	W	-	3	0	KAT6A	41911439	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.252000	0.78309	2.825000	0.97269	0.655000	0.94253	TGG		0.438	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766		31	437	0	0	0	0.002445	0	31	437				
PLAT	5327	broad.mit.edu	37	8	42046462	42046462	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:42046462C>A	ENST00000220809.4	-	4	499	c.243G>T	c.(241-243)gtG>gtT	p.V81V	PLAT_ENST00000519510.1_Silent_p.V81V|PLAT_ENST00000429710.2_Silent_p.V81V|PLAT_ENST00000352041.3_Intron|PLAT_ENST00000270189.6_Silent_p.V81V|PLAT_ENST00000524009.1_Silent_p.V81V|PLAT_ENST00000429089.2_Silent_p.V81V	NM_000930.3	NP_000921.1	P00750	TPA_HUMAN	plasminogen activator, tissue	81	Fibronectin type-I. {ECO:0000255|PROSITE- ProRule:PRU00478}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|fibrinolysis (GO:0042730)|negative regulation of proteolysis (GO:0045861)|plasminogen activation (GO:0031639)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of ovulation (GO:0060279)|proteolysis (GO:0006508)|regulation of synaptic plasticity (GO:0048167)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|smooth muscle cell migration (GO:0014909)|synaptic transmission, glutamatergic (GO:0035249)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|synapse (GO:0045202)	serine-type endopeptidase activity (GO:0004252)	p.V81V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|skin(1)|soft_tissue(1)|urinary_tract(1)	27	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Aminocaproic Acid(DB00513)|Ibuprofen(DB01050)|Iloprost(DB01088)|Urokinase(DB00013)	TTTTGACAGGCACTGAGTGGC	0.572																																							uc003xos.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)|skin(1)	2						c.(241-243)GTG>GTT		plasminogen activator, tissue isoform 1	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Iloprost(DB01088)|Reteplase(DB00015)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)						225.0	221.0	222.0					8																	42046462		2203	4300	6503	SO:0001819	synonymous_variant	5327				blood coagulation|fibrinolysis|negative regulation of proteolysis|protein modification process|proteolysis	cell surface|cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity	g.chr8:42046462C>A		CCDS6126.1, CCDS6127.1	8p11.21	2012-10-02			ENSG00000104368	ENSG00000104368			9051	protein-coding gene	gene with protein product		173370					Standard	NM_033011		Approved		uc003xos.2	P00750	OTTHUMG00000164072	ENST00000220809.4:c.243G>T	8.37:g.42046462C>A						PLAT_uc010lxf.1_Intron|PLAT_uc010lxg.1_Silent_p.V81V|PLAT_uc003xot.2_Intron|PLAT_uc011lcm.1_Silent_p.V81V|PLAT_uc011lcn.1_Silent_p.V81V	p.V81V	NM_000930	NP_000921	P00750	TPA_HUMAN	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		4	452	-	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	81			Fibronectin type-I.		A8K022|B2R8E8|Q15103|Q503B0|Q6PJA5|Q7Z7N2|Q86YK8|Q9BU99|Q9BZW1	Silent	SNP	ENST00000220809.4	37	c.243G>T	CCDS6126.1																																																																																				0.572	PLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377100.1	NM_000930		115	232	1	0	3.79751e-50	0.00361	6.76319e-50	115	232				
PREX2	80243	broad.mit.edu	37	8	68942818	68942818	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:68942818C>T	ENST00000288368.4	+	6	907	c.630C>T	c.(628-630)aaC>aaT	p.N210N	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	210	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.N210N(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TCTGTTCCAACATAAACGAGG	0.468																																							uc003xxv.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						c.(628-630)AAC>AAT		DEP domain containing 2 isoform a							121.0	103.0	109.0					8																	68942818		2203	4300	6503	SO:0001819	synonymous_variant	80243				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity	g.chr8:68942818C>T	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.630C>T	8.37:g.68942818C>T						PREX2_uc003xxu.1_Silent_p.N210N|PREX2_uc011lez.1_Silent_p.N145N	p.N210N	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN			6	657	+			210			DH.		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	37	c.630C>T	CCDS6201.1																																																																																				0.468	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170		32	73	0	0	0	0.003271	0	32	73				
ZFHX4	79776	broad.mit.edu	37	8	77618756	77618756	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:77618756G>T	ENST00000521891.2	+	2	2881	c.2433G>T	c.(2431-2433)ttG>ttT	p.L811F	ZFHX4_ENST00000518282.1_Missense_Mutation_p.L811F|ZFHX4_ENST00000050961.6_Missense_Mutation_p.L811F|ZFHX4_ENST00000455469.2_Missense_Mutation_p.L811F|ZFHX4_ENST00000517683.1_Intron	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	811					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.L811F(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATCTGCACTTGGGCCTCGCCC	0.517										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(2431-2433)TTG>TTT		zinc finger homeodomain 4							24.0	25.0	25.0					8																	77618756		2045	4203	6248	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77618756G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2433G>T	8.37:g.77618756G>T	ENSP00000430497:p.Leu811Phe	HNSCC(33;0.089)				ZFHX4_uc003yat.1_Missense_Mutation_p.L811F|ZFHX4_uc003yau.1_Missense_Mutation_p.L811F|ZFHX4_uc003yaw.1_Missense_Mutation_p.L811F	p.L811F	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		2	2820	+			811					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.2433G>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	11.88	1.771570	0.31320	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.55588	0.51;0.56;0.52;0.52	4.91	4.91	0.64330	.	0.000000	0.34435	U	0.003966	T	0.65903	0.2736	M	0.81942	2.565	0.58432	D	0.999999	D;D;D;D	0.63046	0.987;0.992;0.992;0.981	P;P;P;P	0.60541	0.755;0.801;0.876;0.823	T	0.68973	-0.5268	10	0.59425	D	0.04	.	6.1334	0.20217	0.2217:0.0:0.7783:0.0	.	811;811;811;811	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	F	811	ENSP00000430497:L811F;ENSP00000399605:L811F;ENSP00000050961:L811F;ENSP00000430848:L811F	ENSP00000050961:L811F	L	+	3	2	ZFHX4	77781311	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.314000	0.59166	2.699000	0.92147	0.585000	0.79938	TTG		0.517	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		10	13	1	0	2.17888e-05	0.006214	2.79075e-05	10	13				
SLC7A13	157724	broad.mit.edu	37	8	87242447	87242447	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:87242447A>T	ENST00000297524.3	-	1	163	c.60T>A	c.(58-60)agT>agA	p.S20R	SLC7A13_ENST00000419776.2_Missense_Mutation_p.S20R|SLC7A13_ENST00000520624.1_Intron	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	20						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)	p.S20R(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						TAAGCAAAAAACTTGTGCCCC	0.388																																							uc003ydq.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(58-60)AGT>AGA		solute carrier family 7, (cationic amino acid							68.0	65.0	66.0					8																	87242447		2203	4300	6503	SO:0001583	missense	157724					integral to membrane	amino acid transmembrane transporter activity	g.chr8:87242447A>T	AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.60T>A	8.37:g.87242447A>T	ENSP00000297524:p.Ser20Arg					SLC7A13_uc003ydr.1_Missense_Mutation_p.S20R	p.S20R	NM_138817	NP_620172	Q8TCU3	S7A13_HUMAN			1	158	-			20			Helical; Name=1; (Potential).		Q05C37|Q08AH9|Q96N84	Missense_Mutation	SNP	ENST00000297524.3	37	c.60T>A	CCDS34917.1	.	.	.	.	.	.	.	.	.	.	A	5.819	0.335385	0.11013	.	.	ENSG00000164893	ENST00000297524;ENST00000419776	D;D	0.89810	-2.57;-2.57	3.74	-1.81	0.07882	.	0.896444	0.09568	N	0.784586	D	0.84638	0.5516	L	0.51914	1.62	0.09310	N	0.999998	B;B	0.24132	0.098;0.006	B;B	0.34346	0.18;0.007	T	0.75099	-0.3437	10	0.66056	D	0.02	.	4.4143	0.11448	0.3766:0.3339:0.2895:0.0	.	20;20	Q8TCU3-2;Q8TCU3	.;S7A13_HUMAN	R	20	ENSP00000297524:S20R;ENSP00000410982:S20R	ENSP00000297524:S20R	S	-	3	2	SLC7A13	87311563	0.004000	0.15560	0.004000	0.12327	0.278000	0.26855	-0.059000	0.11731	-0.311000	0.08754	0.496000	0.49642	AGT		0.388	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1	NM_138817		9	131	0	0	0	0.008291	0	9	131				
MMP16	4325	broad.mit.edu	37	8	89086833	89086833	+	Splice_Site	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:89086833C>G	ENST00000286614.6	-	7	1503	c.1222G>C	c.(1222-1224)Ggt>Cgt	p.G408R	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	408					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G408R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	ACATCCTTACCTTTAAAGAAC	0.388																																							uc003yeb.3		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						c.(1222-1224)GGT>CGT		matrix metalloproteinase 16 isoform 1							91.0	91.0	91.0					8																	89086833		2203	4300	6503	SO:0001630	splice_region_variant	4325				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding	g.chr8:89086833C>G	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1222+1G>C	8.37:g.89086833C>G						MMP16_uc003yec.2_Missense_Mutation_p.V408L	p.G408R	NM_005941	NP_005932	P51512	MMP16_HUMAN			7	1504	-			408			Hemopexin-like 2.|Extracellular (Potential).		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	37	c.1222G>C	CCDS6246.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964921	0.74131	.	.	ENSG00000156103	ENST00000286614	T	0.10288	2.89	4.64	4.64	0.57946	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.24736	0.0600	M	0.89163	3.01	0.80722	D	1	P	0.42692	0.787	B	0.42214	0.38	T	0.25813	-1.0121	9	.	.	.	.	17.8943	0.88881	0.0:1.0:0.0:0.0	.	408	P51512	MMP16_HUMAN	R	408	ENSP00000286614:G408R	.	G	-	1	0	MMP16	89155949	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	7.776000	0.85560	2.280000	0.76307	0.650000	0.86243	GGT		0.388	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941	Missense_Mutation	6	73	0	0	0	0.001984	0	6	73				
SLC26A7	115111	broad.mit.edu	37	8	92307866	92307866	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:92307866T>C	ENST00000276609.3	+	4	651	c.412T>C	c.(412-414)Tcc>Ccc	p.S138P	SLC26A7_ENST00000523719.1_Missense_Mutation_p.S138P|SLC26A7_ENST00000309536.2_Missense_Mutation_p.S138P	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7									p.S138P(2)		breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			GCTGGGCTTATCCGACTTTGA	0.483																																							uc003yex.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(412-414)TCC>CCC		solute carrier family 26, member 7 isoform a							160.0	134.0	143.0					8																	92307866		2203	4300	6503	SO:0001583	missense	115111					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity	g.chr8:92307866T>C	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.412T>C	8.37:g.92307866T>C	ENSP00000276609:p.Ser138Pro					SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Missense_Mutation_p.S138P|SLC26A7_uc003yfa.2_Missense_Mutation_p.S138P	p.S138P	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.00802)		5	690	+			138			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000276609.3	37	c.412T>C	CCDS6254.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.042733	0.55003	.	.	ENSG00000147606	ENST00000522862;ENST00000523719;ENST00000276609;ENST00000309536	D;D;D;D	0.92965	-2.91;-3.14;-3.14;-3.14	5.48	4.32	0.51571	.	0.080630	0.53938	N	0.000056	D	0.94584	0.8255	M	0.72894	2.215	0.37009	D	0.895655	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	D	0.93843	0.7138	10	0.30854	T	0.27	.	10.3281	0.43805	0.0:0.0788:0.0:0.9212	.	138;138	Q8TE54-2;Q8TE54	.;S26A7_HUMAN	P	138	ENSP00000428881:S138P;ENSP00000428849:S138P;ENSP00000276609:S138P;ENSP00000309504:S138P	ENSP00000276609:S138P	S	+	1	0	SLC26A7	92377042	1.000000	0.71417	0.911000	0.35937	0.461000	0.32589	3.365000	0.52335	0.923000	0.37045	0.460000	0.39030	TCC		0.483	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1			9	85	0	0	0	0.008291	0	9	85				
RAD54B	25788	broad.mit.edu	37	8	95403926	95403926	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:95403926C>A	ENST00000336148.5	-	10	1844	c.1720G>T	c.(1720-1722)Ggg>Tgg	p.G574W		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	574					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)	p.G574W(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			TCCAACAACCCTTGAAGGCAG	0.398								Direct reversal of damage;Homologous recombination																															uc003ygk.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(2)|lung(1)|skin(1)	4						c.(1720-1722)GGG>TGG	Direct_reversal_of_damage|Homologous_recombination	RAD54 homolog B							119.0	121.0	120.0					8																	95403926		2203	4300	6503	SO:0001583	missense	25788				double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding	g.chr8:95403926C>A	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.1720G>T	8.37:g.95403926C>A	ENSP00000336606:p.Gly574Trp					RAD54B_uc010may.1_Missense_Mutation_p.G381W|RAD54B_uc003ygl.1_RNA	p.G574W	NM_012415	NP_036547	O95073	FSBP_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00217)		10	1818	-	Breast(36;4.5e-05)		Error:Variant_position_missing_in_O95073_after_alignment					F6WBS8	Missense_Mutation	SNP	ENST00000336148.5	37	c.1720G>T	CCDS6262.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.800723	0.90538	.	.	ENSG00000197275	ENST00000336148;ENST00000546218	T	0.75704	-0.96	5.11	5.11	0.69529	SNF2-related (1);	0.049360	0.85682	D	0.000000	D	0.90721	0.7088	H	0.95745	3.715	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.93396	0.6756	10	0.87932	D	0	0.0975	18.9031	0.92451	0.0:1.0:0.0:0.0	.	574	Q9Y620	RA54B_HUMAN	W	574;246	ENSP00000336606:G574W	ENSP00000336606:G574W	G	-	1	0	RAD54B	95473102	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	7.776000	0.85560	2.520000	0.84964	0.650000	0.86243	GGG		0.398	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415		133	202	1	0	1.19401e-59	0.00361	2.13324e-59	133	202				
INTS8	55656	broad.mit.edu	37	8	95877917	95877917	+	Splice_Site	SNP	C	C	T	rs372594000		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:95877917C>T	ENST00000523731.1	+	17	2393	c.2260C>T	c.(2260-2262)Cgg>Tgg	p.R754W	INTS8_ENST00000447247.1_Splice_Site_p.R754W|INTS8_ENST00000520845.1_Intron	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	754					snRNA processing (GO:0016180)	integrator complex (GO:0032039)		p.R754W(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					TATCATGTATCGGTATGTATT	0.333																																							uc003yhb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2260-2262)CGG>TGG		integrator complex subunit 8		C	TRP/ARG	0,4406		0,0,2203	211.0	207.0	208.0		2260	2.4	1.0	8		208	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice	INTS8	NM_017864.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	754/996	95877917	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	55656				snRNA processing	integrator complex	protein binding	g.chr8:95877917C>T	AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.2261+1C>T	8.37:g.95877917C>T						INTS8_uc011lgq.1_RNA|INTS8_uc011lgr.1_RNA|INTS8_uc010mba.2_Missense_Mutation_p.R581W	p.R754W	NM_017864	NP_060334	Q75QN2	INT8_HUMAN			17	2386	+	Breast(36;1.05e-06)		754					B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Missense_Mutation	SNP	ENST00000523731.1	37	c.2260C>T	CCDS34925.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425152	0.62733	0.0	1.16E-4	ENSG00000164941	ENST00000523731;ENST00000447247	T;T	0.36878	1.23;1.23	4.43	2.39	0.29439	.	0.000000	0.85682	D	0.000000	T	0.36026	0.0952	N	0.14661	0.345	0.58432	D	0.999999	D	0.69078	0.997	P	0.60117	0.869	T	0.36432	-0.9748	10	0.87932	D	0	-11.7372	12.0129	0.53297	0.4135:0.5865:0.0:0.0	.	754	Q75QN2	INT8_HUMAN	W	754	ENSP00000430338:R754W;ENSP00000398203:R754W	ENSP00000343274:R754W	R	+	1	2	INTS8	95947093	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	0.878000	0.28126	1.126000	0.42016	0.563000	0.77884	CGG		0.333	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379794.1	NM_017864	Missense_Mutation	12	284	0	0	0	0.00245	0	12	284				
SLC25A32	81034	broad.mit.edu	37	8	104415420	104415420	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:104415420T>G	ENST00000297578.4	-	4	690	c.524A>C	c.(523-525)aAg>aCg	p.K175T	SLC25A32_ENST00000523701.1_5'Flank|SLC25A32_ENST00000543107.1_Missense_Mutation_p.K43T	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32	175					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)	p.K175T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	ACCTTCATACTTATATATTTT	0.323																																							uc003yll.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(523-525)AAG>ACG		solute carrier family 25, member 32	Folic Acid(DB00158)						70.0	67.0	68.0					8																	104415420		2202	4300	6502	SO:0001583	missense	81034				folic acid metabolic process|mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding|folic acid transporter activity	g.chr8:104415420T>G	AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.524A>C	8.37:g.104415420T>G	ENSP00000297578:p.Lys175Thr					SLC25A32_uc011lhr.1_Missense_Mutation_p.K43T	p.K175T	NM_030780	NP_110407	Q9H2D1	MFTC_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		4	827	-			175			Solcar 2.		Q96JZ6|Q96SU7	Missense_Mutation	SNP	ENST00000297578.4	37	c.524A>C	CCDS6300.1	.	.	.	.	.	.	.	.	.	.	T	18.12	3.553123	0.65425	.	.	ENSG00000164933	ENST00000297578;ENST00000424899;ENST00000543107	D;D	0.81996	-1.56;-1.56	5.91	5.91	0.95273	Mitochondrial carrier domain (2);	0.044188	0.85682	D	0.000000	D	0.83027	0.5165	M	0.65975	2.015	0.58432	D	0.999995	P	0.36837	0.571	B	0.42163	0.378	T	0.82843	-0.0257	10	0.46703	T	0.11	-17.7404	10.6467	0.45623	0.0:0.0712:0.0:0.9288	.	175	Q9H2D1	MFTC_HUMAN	T	175;159;43	ENSP00000297578:K175T;ENSP00000443497:K43T	ENSP00000297578:K175T	K	-	2	0	SLC25A32	104484596	1.000000	0.71417	0.988000	0.46212	0.987000	0.75469	4.281000	0.58965	2.266000	0.75297	0.472000	0.43445	AAG		0.323	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380290.2	NM_030780		21	36	0	0	0	0.010504	0	21	36				
CSMD3	114788	broad.mit.edu	37	8	113326767	113326767	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:113326767A>T	ENST00000297405.5	-	48	7684	c.7440T>A	c.(7438-7440)aaT>aaA	p.N2480K	CSMD3_ENST00000352409.3_Missense_Mutation_p.N2410K|CSMD3_ENST00000343508.3_Missense_Mutation_p.N2440K|CSMD3_ENST00000455883.2_Missense_Mutation_p.N2376K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2480	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N2480K(1)|p.N2440K(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACATTTGAAGATTTGGGTAAC	0.393										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(7438-7440)AAT>AAA		CUB and Sushi multiple domains 3 isoform 1							114.0	108.0	110.0					8																	113326767		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113326767A>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7440T>A	8.37:g.113326767A>T	ENSP00000297405:p.Asn2480Lys	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.N1682K|CSMD3_uc003ynt.2_Missense_Mutation_p.N2440K|CSMD3_uc011lhx.1_Missense_Mutation_p.N2376K|CSMD3_uc003ynw.1_Missense_Mutation_p.N191K	p.N2480K	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			48	7599	-			2480			CUB 14.|Extracellular (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.7440T>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.054274	0.75960	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22	4.98	4.98	0.66077	CUB (5);	0.000000	0.85682	D	0.000000	T	0.53206	0.1782	M	0.76727	2.345	0.45914	D	0.998758	D;D;D	0.76494	0.999;0.999;0.984	D;D;P	0.91635	0.998;0.999;0.804	T	0.52946	-0.8507	10	0.16420	T	0.52	.	8.3062	0.32045	0.8455:0.0:0.1545:0.0	.	2376;2480;2440	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	K	2440;2480;1750;2376;2410	ENSP00000345799:N2440K;ENSP00000297405:N2480K;ENSP00000341558:N1750K;ENSP00000412263:N2376K;ENSP00000343124:N2410K	ENSP00000297405:N2480K	N	-	3	2	CSMD3	113395943	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.736000	0.38187	2.081000	0.62600	0.472000	0.43445	AAT		0.393	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		5	121	0	0	0	0.000602	0	5	121				
CSMD3	114788	broad.mit.edu	37	8	113668537	113668537	+	Silent	SNP	T	T	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:113668537T>C	ENST00000297405.5	-	18	3094	c.2850A>G	c.(2848-2850)gaA>gaG	p.E950E	CSMD3_ENST00000352409.3_Silent_p.E950E|CSMD3_ENST00000343508.3_Silent_p.E910E|CSMD3_ENST00000455883.2_Silent_p.E846E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	950	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E950E(1)|p.E910E(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CATCATGAACTTCCAGAACAT	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(2848-2850)GAA>GAG		CUB and Sushi multiple domains 3 isoform 1							67.0	72.0	70.0					8																	113668537		2203	4300	6503	SO:0001819	synonymous_variant	114788					integral to membrane|plasma membrane		g.chr8:113668537T>C	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2850A>G	8.37:g.113668537T>C		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Silent_p.E222E|CSMD3_uc003ynt.2_Silent_p.E910E|CSMD3_uc011lhx.1_Silent_p.E846E	p.E950E	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			18	3009	-			950			Extracellular (Potential).|CUB 5.		Q96PZ3	Silent	SNP	ENST00000297405.5	37	c.2850A>G	CCDS6315.1																																																																																				0.343	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		5	77	0	0	0	0.000602	0	5	77				
TRPS1	7227	broad.mit.edu	37	8	116426404	116426404	+	Silent	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:116426404A>G	ENST00000220888.5	-	6	3852	c.3693T>C	c.(3691-3693)gcT>gcC	p.A1231A	TRPS1_ENST00000520276.1_Silent_p.A1235A|TRPS1_ENST00000519076.1_Silent_p.A985A|TRPS1_ENST00000395715.3_Silent_p.A1244A			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1231	Transcriptional repressor domain. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.A1231A(1)|p.A1244A(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TCATATGCAAAGCATACATCA	0.413									Langer-Giedion syndrome																														uc003ynz.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(3691-3693)GCT>GCC		zinc finger transcription factor TRPS1							142.0	135.0	137.0					8																	116426404		2037	4197	6234	SO:0001819	synonymous_variant	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116426404A>G	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3693T>C	8.37:g.116426404A>G						TRPS1_uc011lhy.1_Silent_p.A1235A|TRPS1_uc003yny.2_Silent_p.A1244A|TRPS1_uc010mcy.2_Silent_p.A1231A	p.A1231A	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		6	4152	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		1231			Transcriptional repressor domain (By similarity).|C2H2-type 6.		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	37	c.3693T>C																																																																																					0.413	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		21	130	0	0	0	0.002299	0	21	130				
CD274	29126	broad.mit.edu	37	9	5466808	5466808	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:5466808A>T	ENST00000381577.3	+	6	915	c.829A>T	c.(829-831)Aca>Tca	p.T277S	CD274_ENST00000498261.1_3'UTR|CD274_ENST00000381573.4_Missense_Mutation_p.T163S	NM_014143.3	NP_054862.1	Q9NZQ7	PD1L1_HUMAN	CD274 molecule	277					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of T cell proliferation (GO:0042102)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T277S(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000742)|Lung(218;0.111)		CATCCAAGATACAAACTCAAA	0.348			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																		uc003zje.2		NA		Dom	yes		9	9p24	29126	T	CD274 molecule			L	CIITA		PMBL|Hodgkin Lymphona|		1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(829-831)ACA>TCA		CD274 molecule precursor							126.0	121.0	122.0					9																	5466808		2203	4300	6503	SO:0001583	missense	29126				cell proliferation|cell surface receptor linked signaling pathway|immune response|T cell costimulation	endomembrane system|integral to membrane	receptor activity	g.chr9:5466808A>T	AF177937	CCDS6464.1, CCDS59118.1	9p24.1	2014-01-30	2006-03-28	2005-02-25	ENSG00000120217	ENSG00000120217		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17635	protein-coding gene	gene with protein product	"""B7 homolog 1"""	605402	"""programmed cell death 1 ligand 1"", ""CD274 antigen"""	PDCD1LG1		11015443, 10581077	Standard	NM_014143		Approved	B7-H, B7H1, PD-L1, PDL1, B7-H1	uc003zje.3	Q9NZQ7	OTTHUMG00000019503	ENST00000381577.3:c.829A>T	9.37:g.5466808A>T	ENSP00000370989:p.Thr277Ser					C9orf46_uc003zjd.2_Intron|CD274_uc010mhn.2_RNA|CD274_uc003zjf.2_Missense_Mutation_p.T163S	p.T277S	NM_014143	NP_054862	Q9NZQ7	PD1L1_HUMAN		GBM - Glioblastoma multiforme(50;0.000742)|Lung(218;0.111)	6	881	+	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)	277			Cytoplasmic (Potential).		B2RBA2|B4DU27|Q14CJ2|Q2V8D5|Q66RK1|Q6WEX4|Q9NUZ5	Missense_Mutation	SNP	ENST00000381577.3	37	c.829A>T	CCDS6464.1	.	.	.	.	.	.	.	.	.	.	A	3.665	-0.068728	0.07228	.	.	ENSG00000120217	ENST00000381573;ENST00000381577	T;T	0.30182	1.54;5.26	4.16	1.83	0.25207	.	1.335430	0.04875	N	0.446658	T	0.22437	0.0541	L	0.36672	1.1	0.09310	N	1	B;B	0.29716	0.255;0.255	B;B	0.26614	0.071;0.023	T	0.22417	-1.0217	10	0.16420	T	0.52	3.5105	5.6987	0.17871	0.7836:0.0:0.2164:0.0	.	163;277	Q2V8D5;Q9NZQ7	.;PD1L1_HUMAN	S	163;277	ENSP00000370985:T163S;ENSP00000370989:T277S	ENSP00000370985:T163S	T	+	1	0	CD274	5456808	0.000000	0.05858	0.001000	0.08648	0.121000	0.20230	0.466000	0.22019	0.401000	0.25424	-0.441000	0.05720	ACA		0.348	CD274-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051631.2	NM_014143		10	73	0	0	0	0.000978	0	10	73				
KIAA2026	158358	broad.mit.edu	37	9	5920563	5920563	+	Silent	SNP	C	C	A	rs376686942		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:5920563C>A	ENST00000399933.3	-	8	5432	c.5433G>T	c.(5431-5433)tcG>tcT	p.S1811S	KIAA2026_ENST00000381461.2_Silent_p.S1781S	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1811								p.S986S(1)|p.S1811S(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TTGAAAGGGACGACAATTCAG	0.398																																							uc003zjq.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(5431-5433)TCG>TCT		hypothetical protein LOC158358							420.0	408.0	412.0					9																	5920563		1893	4108	6001	SO:0001819	synonymous_variant	158358							g.chr9:5920563C>A	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.5433G>T	9.37:g.5920563C>A						KIAA2026_uc010mht.2_Silent_p.S986S	p.S1811S	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)	8	5649	-		Acute lymphoblastic leukemia(23;0.158)	1811					A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37	c.5433G>T																																																																																					0.398	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969		41	527	1	0	5.44703e-19	0.009718	9.14905e-19	41	527				
PTPRD	5789	broad.mit.edu	37	9	8340448	8340448	+	Silent	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:8340448A>T	ENST00000381196.4	-	39	5691	c.5148T>A	c.(5146-5148)gcT>gcA	p.A1716A	PTPRD_ENST00000358503.5_Silent_p.A1694A|PTPRD_ENST00000537002.1_Silent_p.A1306A|PTPRD_ENST00000397606.3_Silent_p.A1309A|PTPRD_ENST00000360074.4_Silent_p.A1703A|PTPRD_ENST00000397617.3_Silent_p.A1309A|PTPRD_ENST00000397611.3_Silent_p.A1306A|PTPRD_ENST00000540109.1_Silent_p.A1716A|PTPRD_ENST00000486161.1_Silent_p.A1309A|PTPRD_ENST00000355233.5_Silent_p.A1310A|PTPRD_ENST00000356435.5_Silent_p.A1716A	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1716	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A1716A(2)|p.A1310A(1)|p.A1187A(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GCCCCTGGGTAGCGATGTAGG	0.448										TSP Lung(15;0.13)																													uc003zkk.2		NA																	4	Substitution - coding silent(4)		lung(4)	lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(5146-5148)GCT>GCA		protein tyrosine phosphatase, receptor type, D							105.0	95.0	98.0					9																	8340448		2203	4300	6503	SO:0001819	synonymous_variant	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8340448A>T	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.5148T>A	9.37:g.8340448A>T		TSP Lung(15;0.13)				PTPRD_uc003zkp.2_Silent_p.A1310A|PTPRD_uc003zkq.2_Silent_p.A1309A|PTPRD_uc003zkr.2_Silent_p.A1300A|PTPRD_uc003zks.2_Silent_p.A1309A|PTPRD_uc003zkl.2_Silent_p.A1707A|PTPRD_uc003zkm.2_Silent_p.A1703A|PTPRD_uc003zkn.2_Silent_p.A1305A|PTPRD_uc003zko.2_Silent_p.A1306A	p.A1716A	NM_002839	NP_002830	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	41	5859	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	1716			Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	37	c.5148T>A	CCDS43786.1																																																																																				0.448	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			4	72	0	0	0	0.009096	0	4	72				
MPDZ	8777	broad.mit.edu	37	9	13119528	13119528	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:13119528G>A	ENST00000319217.7	-	39	5599	c.5352C>T	c.(5350-5352)acC>acT	p.T1784T	MPDZ_ENST00000546205.1_Silent_p.T1798T|MPDZ_ENST00000538841.1_Silent_p.T643T|MPDZ_ENST00000381022.2_Silent_p.T1784T|MPDZ_ENST00000381015.4_Silent_p.T1784T|MPDZ_ENST00000536827.1_Silent_p.T1751T|MPDZ_ENST00000447879.1_Silent_p.T1751T|MPDZ_ENST00000541093.1_Silent_p.T18T|MPDZ_ENST00000541718.1_Silent_p.T1784T	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1784	PDZ 11. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.T1784T(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CCGCTTCTTGGGTGGCATTAC	0.398																																							uc010mia.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|central_nervous_system(1)	6						c.(5350-5352)ACC>ACT		multiple PDZ domain protein							154.0	150.0	152.0					9																	13119528		1872	4108	5980	SO:0001819	synonymous_variant	8777				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding	g.chr9:13119528G>A	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.5352C>T	9.37:g.13119528G>A						MPDZ_uc003zkx.3_Silent_p.T49T|MPDZ_uc003zky.3_Silent_p.T318T|MPDZ_uc010mib.2_Silent_p.T489T|MPDZ_uc010mhx.2_Silent_p.T606T|MPDZ_uc011lmm.1_Silent_p.T643T|MPDZ_uc003zkz.3_Silent_p.T477T|MPDZ_uc010mhy.2_Silent_p.T1784T|MPDZ_uc010mhz.2_Silent_p.T1751T|MPDZ_uc011lmn.1_Silent_p.T1751T|MPDZ_uc003zlb.3_Silent_p.T1784T	p.T1784T	NM_003829	NP_003820	O75970	MPDZ_HUMAN		GBM - Glioblastoma multiforme(50;2.03e-06)	38	5409	-			1784			PDZ 11.		A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Silent	SNP	ENST00000319217.7	37	c.5352C>T																																																																																					0.398	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		11	127	0	0	0	0.000978	0	11	127				
MPDZ	8777	broad.mit.edu	37	9	13125264	13125264	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:13125264C>T	ENST00000319217.7	-	35	5005	c.4758G>A	c.(4756-4758)caG>caA	p.Q1586Q	MPDZ_ENST00000546205.1_Silent_p.Q1600Q|MPDZ_ENST00000538841.1_Silent_p.Q445Q|MPDZ_ENST00000381022.2_Silent_p.Q1586Q|MPDZ_ENST00000381015.4_Silent_p.Q1586Q|MPDZ_ENST00000536827.1_Silent_p.Q1553Q|MPDZ_ENST00000447879.1_Silent_p.Q1553Q|MPDZ_ENST00000541093.1_5'UTR|MPDZ_ENST00000541718.1_Silent_p.Q1586Q	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1586					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.Q1586Q(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CCATCAGAGACTGGGAGCTGT	0.517																																							uc010mia.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|central_nervous_system(1)	6						c.(4756-4758)CAG>CAA		multiple PDZ domain protein							114.0	113.0	113.0					9																	13125264		1891	4117	6008	SO:0001819	synonymous_variant	8777				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding	g.chr9:13125264C>T	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.4758G>A	9.37:g.13125264C>T						MPDZ_uc003zky.3_Silent_p.Q148Q|MPDZ_uc010mib.2_Silent_p.Q291Q|MPDZ_uc010mhx.2_Silent_p.Q408Q|MPDZ_uc011lmm.1_Silent_p.Q445Q|MPDZ_uc003zkz.3_Silent_p.Q279Q|MPDZ_uc010mhy.2_Silent_p.Q1586Q|MPDZ_uc010mhz.2_Silent_p.Q1553Q|MPDZ_uc011lmn.1_Silent_p.Q1553Q|MPDZ_uc003zlb.3_Silent_p.Q1586Q	p.Q1586Q	NM_003829	NP_003820	O75970	MPDZ_HUMAN		GBM - Glioblastoma multiforme(50;2.03e-06)	34	4815	-			1586					A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Silent	SNP	ENST00000319217.7	37	c.4758G>A																																																																																					0.517	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		7	81	0	0	0	0.00308	0	7	81				
SH3GL2	6456	broad.mit.edu	37	9	17795682	17795682	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:17795682G>T	ENST00000380607.4	+	9	1120	c.1000G>T	c.(1000-1002)Ggc>Tgc	p.G334C	SH3GL2_ENST00000537391.1_Missense_Mutation_p.G287C	NM_003026.2	NP_003017.1	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	334	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of receptor internalization (GO:0002090)|signal transduction (GO:0007165)|synaptic vesicle endocytosis (GO:0048488)	clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.G334C(1)		NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		GATGCTGCATGGCCATTCAGG	0.478																																							uc003zna.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1000-1002)GGC>TGC		SH3-domain GRB2-like 2							121.0	105.0	110.0					9																	17795682		2203	4300	6503	SO:0001583	missense	6456				axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding	g.chr9:17795682G>T	X99657	CCDS6483.1	9p22	2008-02-05			ENSG00000107295	ENSG00000107295			10831	protein-coding gene	gene with protein product		604465				9169142	Standard	XM_005251549		Approved	SH3P4, SH3D2A, CNSA2, EEN-B1	uc003zna.3	Q99962	OTTHUMG00000019601	ENST00000380607.4:c.1000G>T	9.37:g.17795682G>T	ENSP00000369981:p.Gly334Cys					SH3GL2_uc011lmy.1_Missense_Mutation_p.G287C	p.G334C	NM_003026	NP_003017	Q99962	SH3G2_HUMAN		GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)	9	1288	+			334			SH3.		B2R618|Q9NQK5	Missense_Mutation	SNP	ENST00000380607.4	37	c.1000G>T	CCDS6483.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.209854	0.79240	.	.	ENSG00000107295	ENST00000541215;ENST00000380607;ENST00000537391	T;T	0.66460	-0.21;-0.21	5.7	5.7	0.88788	Src homology-3 domain (3);Spectrin alpha chain, SH3 domain (1);Variant SH3 (1);	0.296876	0.34750	N	0.003717	D	0.89501	0.6733	H	0.98068	4.14	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92900	0.6338	10	0.87932	D	0	.	19.8388	0.96673	0.0:0.0:1.0:0.0	.	334	Q99962	SH3G2_HUMAN	C	163;334;287	ENSP00000369981:G334C;ENSP00000443365:G287C	ENSP00000369981:G334C	G	+	1	0	SH3GL2	17785682	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.799000	0.99117	2.695000	0.91970	0.561000	0.74099	GGC		0.478	SH3GL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051796.1	NM_003026		6	38	1	0	1.06961e-07	0.00308	1.50767e-07	6	38				
ANXA1	301	broad.mit.edu	37	9	75778406	75778406	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:75778406G>A	ENST00000376911.1	+	7	1452	c.570G>A	c.(568-570)gaG>gaA	p.E190E	ANXA1_ENST00000257497.6_Silent_p.E190E			P04083	ANXA1_HUMAN	annexin A1	190					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)	p.E190E(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	ACCGATCTGAGGACTTTGGTG	0.388																																							uc004ajf.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)|central_nervous_system(1)	2						c.(568-570)GAG>GAA		annexin I	Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Clobetasol(DB01013)|Clocortolone(DB00838)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Flumethasone Pivalate(DB00663)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol Etabonate(DB00873)|Methylprednisolone(DB00959)|Mometasone(DB00764)|Prednicarbate(DB01130)|Prednisone(DB00635)|Rimexolone(DB00896)|Triamcinolone(DB00620)						175.0	160.0	165.0					9																	75778406		2203	4300	6503	SO:0001819	synonymous_variant	301				alpha-beta T cell differentiation|anti-apoptosis|cell surface receptor linked signaling pathway|cellular component movement|inflammatory response|keratinocyte differentiation|lipid metabolic process|peptide cross-linking|positive regulation of vesicle fusion	basolateral plasma membrane|cilium|cornified envelope|cytoplasm|extracellular region|nucleus	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity|protein binding, bridging|receptor binding|structural molecule activity	g.chr9:75778406G>A	X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.570G>A	9.37:g.75778406G>A						ANXA1_uc004aje.1_Silent_p.E190E|ANXA1_uc004ajg.1_Silent_p.E190E	p.E190E	NM_000700	NP_000691	P04083	ANXA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	8	644	+		all_epithelial(88;2.54e-11)	190						Silent	SNP	ENST00000376911.1	37	c.570G>A	CCDS6645.1																																																																																				0.388	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052665.1	NM_000700		16	64	0	0	0	0.00499	0	16	64				
PCSK5	5125	broad.mit.edu	37	9	78789943	78789943	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:78789943G>T	ENST00000545128.1	+	14	2336	c.1798G>T	c.(1798-1800)Gtg>Ttg	p.V600L	PCSK5_ENST00000376767.3_Missense_Mutation_p.V600L|PCSK5_ENST00000376752.4_Missense_Mutation_p.V600L	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	600					anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.V600L(3)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						CGGCACCTCCGTGCAGCCATA	0.443																																							uc004ajz.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)|skin(1)	3						c.(1798-1800)GTG>TTG		proprotein convertase subtilisin/kexin type 5							127.0	119.0	122.0					9																	78789943		2203	4300	6503	SO:0001583	missense	5125				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity	g.chr9:78789943G>T		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1798G>T	9.37:g.78789943G>T	ENSP00000446280:p.Val600Leu					PCSK5_uc004ajy.2_Missense_Mutation_p.V600L|PCSK5_uc004aka.2_RNA	p.V600L	NM_006200	NP_006191	Q92824	PCSK5_HUMAN			14	2336	+			600			Homo B/P.		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	c.1798G>T	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174866	0.38413	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376767;ENST00000396108;ENST00000376752;ENST00000424854	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	5.74	1.43	0.22495	.	0.572244	0.18976	N	0.126017	T	0.43500	0.1250	L	0.34521	1.04	0.19775	N	0.99996	B;B	0.06786	0.001;0.001	B;B	0.09377	0.002;0.004	T	0.18935	-1.0321	10	0.33141	T	0.24	-5.6522	4.7577	0.13092	0.3388:0.164:0.4972:0.0	.	600;600	Q92824-2;B1AMG5	.;.	L	600;303;600;600;600;273	ENSP00000446280:V600L;ENSP00000365958:V600L;ENSP00000365943:V600L;ENSP00000411654:V273L	ENSP00000365943:V600L	V	+	1	0	PCSK5	77979763	0.990000	0.36364	0.558000	0.28319	0.889000	0.51656	2.546000	0.45778	0.798000	0.33994	-0.145000	0.13849	GTG		0.443	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				9	73	1	0	0.000978159	0.000978	0.00112448	9	73				
SPATA31D1	389763	broad.mit.edu	37	9	84604696	84604696	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:84604696C>G	ENST00000344803.2	+	2	237	c.190C>G	c.(190-192)Cag>Gag	p.Q64E		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	64					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.Q64E(2)									TTCTCAGCATCAGGGCAGAGC	0.438																																							uc004amn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(190-192)CAG>GAG		hypothetical protein LOC389763							117.0	111.0	113.0					9																	84604696		1939	4140	6079	SO:0001583	missense	389763					integral to membrane		g.chr9:84604696C>G		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.190C>G	9.37:g.84604696C>G	ENSP00000341988:p.Gln64Glu						p.Q64E	NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN			2	237	+			64						Missense_Mutation	SNP	ENST00000344803.2	37	c.190C>G	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.426270	0.25726	.	.	ENSG00000214929	ENST00000344803	T	0.06687	3.27	2.87	1.87	0.25490	.	1.961470	0.02465	N	0.086915	T	0.11623	0.0283	L	0.47190	1.495	0.09310	N	1	D	0.54964	0.969	P	0.44518	0.452	T	0.25047	-1.0143	10	0.46703	T	0.11	0.4803	6.7123	0.23284	0.3502:0.6498:0.0:0.0	.	64	Q6ZQQ2	F75D1_HUMAN	E	64	ENSP00000341988:Q64E	ENSP00000341988:Q64E	Q	+	1	0	FAM75D1	83794516	0.002000	0.14202	0.001000	0.08648	0.012000	0.07955	0.673000	0.25203	0.687000	0.31509	0.586000	0.80456	CAG		0.438	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		7	41	0	0	0	0.00308	0	7	41				
DAPK1	1612	broad.mit.edu	37	9	90312088	90312088	+	Silent	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:90312088G>T	ENST00000408954.3	+	22	2915	c.2580G>T	c.(2578-2580)ctG>ctT	p.L860L	DAPK1_ENST00000491893.1_Intron|DAPK1_ENST00000469640.2_Silent_p.L860L|DAPK1_ENST00000358077.5_Silent_p.L860L|DAPK1_ENST00000472284.1_Silent_p.L860L	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	860					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L861L(1)|p.L860L(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						TCAGTTTCCTGAAGTCCCTTG	0.502									Chronic Lymphocytic Leukemia, Familial Clustering of																														uc004apc.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|breast(1)	2						c.(2578-2580)CTG>CTT		death-associated protein kinase 1							118.0	110.0	112.0					9																	90312088		1940	4146	6086	SO:0001819	synonymous_variant	1612	Chronic_Lymphocytic_Leukemia_Familial_Clustering_of	Familial Cancer Database	Familial CLL	apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity	g.chr9:90312088G>T	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.2580G>T	9.37:g.90312088G>T						DAPK1_uc004apd.2_Silent_p.L860L|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Silent_p.L597L	p.L860L	NM_004938	NP_004929	P53355	DAPK1_HUMAN			22	2718	+			860					B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	ENST00000408954.3	37	c.2580G>T	CCDS43842.1																																																																																				0.502	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938		9	56	1	0	1.12685e-05	0.004482	1.47015e-05	9	56				
ROR2	4920	broad.mit.edu	37	9	94486199	94486199	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:94486199G>A	ENST00000375708.3	-	9	2775	c.2577C>T	c.(2575-2577)ccC>ccT	p.P859P	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Intron	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	859	Ser/Thr-rich.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.P859P(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GGTGTGAGCTGGGCTTGGGGA	0.652																																							uc004arj.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						c.(2575-2577)CCC>CCT		receptor tyrosine kinase-like orphan receptor 2							91.0	91.0	91.0					9																	94486199		2203	4300	6503	SO:0001819	synonymous_variant	4920				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding	g.chr9:94486199G>A	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2577C>T	9.37:g.94486199G>A						ROR2_uc004ari.1_Intron	p.P859P	NM_004560	NP_004551	Q01974	ROR2_HUMAN			9	2776	-			859			Cytoplasmic (Potential).|Ser/Thr-rich.		Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Silent	SNP	ENST00000375708.3	37	c.2577C>T	CCDS6691.1																																																																																				0.652	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1			9	68	0	0	0	0.006214	0	9	68				
COL15A1	1306	broad.mit.edu	37	9	101747956	101747956	+	Silent	SNP	G	G	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:101747956G>A	ENST00000375001.3	+	3	633	c.210G>A	c.(208-210)ggG>ggA	p.G70G		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	70	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.G70G(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				ACAGTTTCGGGCCTGGTGCCA	0.632																																							uc004azb.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)	6						c.(208-210)GGG>GGA		alpha 1 type XV collagen precursor							65.0	61.0	62.0					9																	101747956		2203	4300	6503	SO:0001819	synonymous_variant	1306				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding	g.chr9:101747956G>A	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.210G>A	9.37:g.101747956G>A						COL15A1_uc004aza.2_Silent_p.G70G	p.G70G	NM_001855	NP_001846	P39059	COFA1_HUMAN			3	416	+		Acute lymphoblastic leukemia(62;0.0562)	70			TSP N-terminal.		Q5T6J4|Q9UDC5|Q9Y4W4	Silent	SNP	ENST00000375001.3	37	c.210G>A	CCDS35081.1																																																																																				0.632	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855		9	30	0	0	0	0.008291	0	9	30				
OR13F1	138805	broad.mit.edu	37	9	107267232	107267232	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:107267232C>A	ENST00000334726.2	+	1	778	c.689C>A	c.(688-690)tCa>tAa	p.S230*		NM_001004485.1	NP_001004485.1	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F, member 1	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S230*(1)		endometrium(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						AGAATCAGCTCAGTGGAAGGT	0.478																																							uc011lvm.1		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(688-690)TCA>TAA		olfactory receptor, family 13, subfamily F,							220.0	198.0	206.0					9																	107267232		2203	4300	6503	SO:0001587	stop_gained	138805				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107267232C>A		CCDS35087.1	9q31.1	2013-09-24			ENSG00000186881	ENSG00000186881		"""GPCR / Class A : Olfactory receptors"""	14723	protein-coding gene	gene with protein product							Standard	NM_001004485		Approved		uc011lvm.2	Q8NGS4	OTTHUMG00000020404	ENST00000334726.2:c.689C>A	9.37:g.107267232C>A	ENSP00000334452:p.Ser230*						p.S230*	NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN			1	689	+			230			Cytoplasmic (Potential).		Q6IF50	Nonsense_Mutation	SNP	ENST00000334726.2	37	c.689C>A	CCDS35087.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720977	0.48728	.	.	ENSG00000186881	ENST00000334726	.	.	.	4.3	4.3	0.51218	.	0.000000	0.43416	D	0.000576	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0807	0.72113	0.0:1.0:0.0:0.0	.	.	.	.	X	230	.	ENSP00000334452:S230X	S	+	2	0	OR13F1	106307053	0.686000	0.27661	0.930000	0.37139	0.378000	0.30076	3.457000	0.53007	2.681000	0.91329	0.655000	0.94253	TCA		0.478	OR13F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053475.1			38	144	1	0	4.92203e-23	0.00623	8.54878e-23	38	144				
ACTL7B	10880	broad.mit.edu	37	9	111617373	111617373	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:111617373C>A	ENST00000374667.3	-	1	1866	c.838G>T	c.(838-840)Gac>Tac	p.D280Y		NM_006686.3	NP_006677.1	Q9Y614	ACL7B_HUMAN	actin-like 7B	280						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of cytoskeleton (GO:0005200)	p.D280Y(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						AGCTCGTAGTCCACGCGCAGC	0.627																																							uc004bdi.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(838-840)GAC>TAC		actin-like 7B							46.0	50.0	48.0					9																	111617373		2203	4299	6502	SO:0001583	missense	10880					actin cytoskeleton|cytoplasm	structural constituent of cytoskeleton	g.chr9:111617373C>A	BC033789	CCDS6771.1	9q31	2009-05-15			ENSG00000148156	ENSG00000148156			162	protein-coding gene	gene with protein product		604304				10373328, 12907721	Standard	NM_006686		Approved	Tact1	uc004bdi.3	Q9Y614	OTTHUMG00000020462	ENST00000374667.3:c.838G>T	9.37:g.111617373C>A	ENSP00000363799:p.Asp280Tyr						p.D280Y	NM_006686	NP_006677	Q9Y614	ACL7B_HUMAN			1	903	-			280					B2R9Q2|Q5JSV1	Missense_Mutation	SNP	ENST00000374667.3	37	c.838G>T	CCDS6771.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698131	0.68386	.	.	ENSG00000148156	ENST00000374667	D	0.94758	-3.51	5.24	5.24	0.73138	.	0.175650	0.27240	N	0.020279	D	0.94948	0.8366	L	0.52905	1.665	0.40064	D	0.975938	P	0.51933	0.949	P	0.57846	0.828	D	0.94990	0.8133	10	0.87932	D	0	.	9.8635	0.41129	0.0:0.9075:0.0:0.0925	.	280	Q9Y614	ACL7B_HUMAN	Y	280	ENSP00000363799:D280Y	ENSP00000363799:D280Y	D	-	1	0	ACTL7B	110657194	0.997000	0.39634	0.979000	0.43373	0.962000	0.63368	4.659000	0.61504	2.449000	0.82847	0.561000	0.74099	GAC		0.627	ACTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053571.1	NM_006686		14	52	1	0	3.27435e-08	0.00245	4.67408e-08	14	52				
SUSD1	64420	broad.mit.edu	37	9	114904686	114904686	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:114904686C>G	ENST00000374270.3	-	5	792	c.620G>C	c.(619-621)aGa>aCa	p.R207T	SUSD1_ENST00000374264.2_Missense_Mutation_p.R207T|SUSD1_ENST00000374263.3_Missense_Mutation_p.R207T|SUSD1_ENST00000482851.1_5'UTR	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	207	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.R207T(1)	SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						GAATCCTTCTCTGCAAGCATA	0.453																																							uc004bfu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(619-621)AGA>ACA		sushi domain containing 1 precursor							144.0	149.0	147.0					9																	114904686		2203	4300	6503	SO:0001583	missense	64420					integral to membrane	calcium ion binding	g.chr9:114904686C>G	AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.620G>C	9.37:g.114904686C>G	ENSP00000363388:p.Arg207Thr					SUSD1_uc010mui.2_Missense_Mutation_p.R207T|SUSD1_uc010muj.2_Missense_Mutation_p.R207T	p.R207T	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN			5	661	-			207			Sushi 1.|Extracellular (Potential).		A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Missense_Mutation	SNP	ENST00000374270.3	37	c.620G>C	CCDS6783.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	11.26|11.26|11.26	1.586492|1.586492|1.586492	0.28268|0.28268|0.28268	.|.|.	.|.|.	ENSG00000106868|ENSG00000106868|ENSG00000106868	ENST00000415074|ENST00000355396|ENST00000374270;ENST00000374263;ENST00000374264	.|.|T;T;T	.|.|0.65178	.|.|-0.14;-0.14;-0.14	5.76|5.76|5.76	1.96|1.96|1.96	0.26148|0.26148|0.26148	.|.|Complement control module (2);Sushi/SCR/CCP (3);	.|.|0.534254	.|.|0.15669	.|.|N	.|.|0.250518	T|T|T	0.44561|0.44561|0.44561	0.1299|0.1299|0.1299	L|L|L	0.35542|0.35542|0.35542	1.07|1.07|1.07	0.21675|0.21675|0.21675	N|N|N	0.999591|0.999591|0.999591	.|.|B;B;B	.|.|0.32467	.|.|0.257;0.372;0.285	.|.|B;B;B	.|.|0.32677	.|.|0.051;0.15;0.131	T|T|T	0.23297|0.23297|0.23297	-1.0192|-1.0192|-1.0192	5|5|10	.|.|0.28530	.|.|T	.|.|0.3	-11.5889|-11.5889|-11.5889	4.6223|4.6223|4.6223	0.12461|0.12461|0.12461	0.1413:0.3431:0.0:0.5156|0.1413:0.3431:0.0:0.5156|0.1413:0.3431:0.0:0.5156	.|.|.	.|.|207;207;207	.|.|F8WAQ1;Q6UWL2-2;Q6UWL2	.|.|.;.;SUSD1_HUMAN	Q|H|T	21|190|207	.|.|ENSP00000363388:R207T;ENSP00000363381:R207T;ENSP00000363382:R207T	.|.|ENSP00000363381:R207T	E|Q|R	-|-|-	1|3|2	0|2|0	SUSD1|SUSD1|SUSD1	113944507|113944507|113944507	0.989000|0.989000|0.989000	0.36119|0.36119|0.36119	0.998000|0.998000|0.998000	0.56505|0.56505|0.56505	0.653000|0.653000|0.653000	0.38743|0.38743|0.38743	0.480000|0.480000|0.480000	0.22244|0.22244|0.22244	0.136000|0.136000|0.136000	0.18733|0.18733|0.18733	-0.355000|-0.355000|-0.355000	0.07637|0.07637|0.07637	GAG|CAG|AGA		0.453	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053668.3	NM_022486		15	204	0	0	0	0.00245	0	15	204				
OR1L8	138881	broad.mit.edu	37	9	125329898	125329898	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:125329898G>T	ENST00000304865.2	-	1	940	c.859C>A	c.(859-861)Cct>Act	p.P287T		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P287T(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TAGATAAAAGGATTGAGCATG	0.458																																							uc004bmp.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(859-861)CCT>ACT		olfactory receptor, family 1, subfamily L,							102.0	101.0	101.0					9																	125329898		2203	4300	6503	SO:0001583	missense	138881				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125329898G>T		CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.859C>A	9.37:g.125329898G>T	ENSP00000306607:p.Pro287Thr						p.P287T	NM_001004454	NP_001004454	Q8NGR8	OR1L8_HUMAN			1	859	-			287			Helical; Name=7; (Potential).		A3KFM3|B9EIR6|Q6IF15|Q96R79	Missense_Mutation	SNP	ENST00000304865.2	37	c.859C>A	CCDS35124.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.819824	0.71028	.	.	ENSG00000171496	ENST00000304865	T	0.63913	-0.07	4.64	4.64	0.57946	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45606	D	0.000360	D	0.85940	0.5814	H	0.97023	3.925	0.40283	D	0.978414	D	0.76494	0.999	D	0.79784	0.993	D	0.91103	0.4916	10	0.87932	D	0	-16.2642	16.9536	0.86252	0.0:0.0:1.0:0.0	.	287	Q8NGR8	OR1L8_HUMAN	T	287	ENSP00000306607:P287T	ENSP00000306607:P287T	P	-	1	0	OR1L8	124369719	1.000000	0.71417	0.985000	0.45067	0.964000	0.63967	5.791000	0.69045	2.613000	0.88420	0.449000	0.29647	CCT		0.458	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053939.1			15	123	1	0	4.7546e-09	0.004007	6.94618e-09	15	123				
LAMC3	10319	broad.mit.edu	37	9	133932433	133932433	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:133932433C>G	ENST00000361069.4	+	12	2190	c.2057C>G	c.(2056-2058)tCc>tGc	p.S686C	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	686	Laminin EGF-like 5; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)	p.S686C(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		TTCTGTGAATCCTGTGCTCCG	0.622																																							uc004caa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(2056-2058)TCC>TGC		laminin, gamma 3 precursor							89.0	92.0	91.0					9																	133932433		2203	4300	6503	SO:0001583	missense	10319				cell adhesion	basement membrane|membrane	structural molecule activity	g.chr9:133932433C>G	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.2057C>G	9.37:g.133932433C>G	ENSP00000354360:p.Ser686Cys						p.S686C	NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)	12	2155	+	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)	686			Laminin EGF-like 5; second part.		B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	c.2057C>G	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783009	0.49891	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.62232	0.04	4.89	3.98	0.46160	EGF-like, laminin (2);	0.588805	0.18731	N	0.132740	T	0.75488	0.3856	M	0.84082	2.675	0.30229	N	0.796077	D	0.67145	0.996	D	0.64687	0.928	T	0.72164	-0.4373	10	0.45353	T	0.12	.	7.5235	0.27641	0.0:0.7423:0.1672:0.0905	.	686	Q9Y6N6	LAMC3_HUMAN	C	686	ENSP00000354360:S686C	ENSP00000347156:S686C	S	+	2	0	LAMC3	132922254	0.707000	0.27866	0.991000	0.47740	0.990000	0.78478	0.407000	0.21049	1.039000	0.40074	0.644000	0.83932	TCC		0.622	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059		13	100	0	0	0	0.00245	0	13	100				
TSC1	7248	broad.mit.edu	37	9	135781380	135781381	+	Missense_Mutation	DNP	CG	CG	AA	rs149439187		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr9:135781380_135781381CG>AA	ENST00000298552.3	-	15	1805_1806	c.1584_1585CG>TT	c.(1582-1587)ggCGcc>ggTTcc	p.A529S	TSC1_ENST00000545250.1_Missense_Mutation_p.A478S|TSC1_ENST00000440111.2_Missense_Mutation_p.A529S	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	529					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.A529S(1)|p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TTCACGCTGGCGCCCTGAGAAC	0.594			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														uc004cca.2		NA	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	D|Mis|N|F|S	tuberous sclerosis 1 gene			"""E, O"""		hamartoma|renal cell			2	Substitution - Missense(1)|Unknown(1)	p.?(1)	lung(1)|bone(1)	lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14						c.(1582-1587)GGCGCC>GGTTCC		tuberous sclerosis 1 protein isoform 1																																				SO:0001583	missense	7248	Tuberous_Sclerosis	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	g.chr9:135781380_135781381CG>AA	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.1584_1585delinsAA	9.37:g.135781380_135781381delinsAA	ENSP00000298552:p.Ala529Ser					TSC1_uc004ccb.3_Missense_Mutation_p.A528S|TSC1_uc011mcq.1_Missense_Mutation_p.A478S|TSC1_uc011mcr.1_Intron	p.A529S	NM_000368	NP_000359	Q92574	TSC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)	15	1818_1819	-			529					B7Z897|Q5VVN5	Missense_Mutation	DNP	ENST00000298552.3	37	c.1584_1585CG>TT	CCDS6956.1																																																																																				0.594	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1			5	28	0	0	0	0.004672	0	5	28				
MSL3	10943	broad.mit.edu	37	X	11790301	11790301	+	Silent	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:11790301C>T	ENST00000312196.4	+	11	1413	c.1308C>T	c.(1306-1308)gaC>gaT	p.D436D	MSL3_ENST00000380693.3_Silent_p.D270D|MSL3_ENST00000398527.2_Silent_p.D424D|MSL3_ENST00000361672.2_Silent_p.D287D	NM_078629.3	NP_523353.2	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3 homolog (Drosophila)	436	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.|Required for the histone acetyltransferase activity of the MSL complex.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|multicellular organismal development (GO:0007275)|transcription from RNA polymerase II promoter (GO:0006366)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D436D(2)		breast(1)|central_nervous_system(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	19						TTGTGCCTGACAATTACCCCC	0.463																																							uc004cuw.2		NA																	2	Substitution - coding silent(2)		lung(1)|kidney(1)	ovary(1)	1						c.(1306-1308)GAC>GAT		male-specific lethal 3-like 1 isoform a							133.0	123.0	126.0					X																	11790301		2203	4300	6503	SO:0001819	synonymous_variant	10943				histone H4-K16 acetylation|multicellular organismal development|transcription from RNA polymerase II promoter	MSL complex	DNA binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity	g.chrX:11790301C>T	AF117065	CCDS14147.1, CCDS14148.1, CCDS14149.1, CCDS55369.1, CCDS65213.1	Xp22.3	2008-10-29	2008-10-29	2008-10-29	ENSG00000005302	ENSG00000005302			7370	protein-coding gene	gene with protein product		300609	"""male-specific lethal-3 (Drosophila)-like 1"", ""male-specific lethal 3-like 1 (Drosophila)"""	MSL3L1		10395802, 10908644	Standard	NM_078628		Approved		uc004cuw.3	Q8N5Y2	OTTHUMG00000021132	ENST00000312196.4:c.1308C>T	X.37:g.11790301C>T						MSL3_uc004cux.2_Silent_p.D377D|MSL3_uc011mig.1_Silent_p.D287D|MSL3_uc011mih.1_Silent_p.D424D|MSL3_uc004cuy.2_Silent_p.D270D	p.D436D	NM_078629	NP_523353	Q8N5Y2	MS3L1_HUMAN			11	1413	+			436					A6NCU2|A6NHW8|A8K165|B4DUV8|B7Z227|Q9UG70|Q9Y5Z8	Silent	SNP	ENST00000312196.4	37	c.1308C>T	CCDS14147.1																																																																																				0.463	MSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055757.1	NM_006800		8	178	0	0	0	0.006214	0	8	178				
DMD	1756	broad.mit.edu	37	X	32380907	32380907	+	Nonsense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:32380907T>A	ENST00000357033.4	-	37	5529	c.5323A>T	c.(5323-5325)Aag>Tag	p.K1775*	DMD_ENST00000378677.2_Nonsense_Mutation_p.K1771*	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1775	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.K1775*(1)|p.K1771*(1)|p.K1770*(1)|p.K434*(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTTCCTACCTTTCCAGTCTTA	0.488																																							uc004dda.1		NA																	4	Substitution - Nonsense(4)		lung(4)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(5323-5325)AAG>TAG		dystrophin Dp427m isoform							170.0	133.0	146.0					X																	32380907		2202	4300	6502	SO:0001587	stop_gained	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32380907T>A	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5323A>T	X.37:g.32380907T>A	ENSP00000354923:p.Lys1775*					DMD_uc004dcw.2_Nonsense_Mutation_p.K431*|DMD_uc004dcx.2_Nonsense_Mutation_p.K434*|DMD_uc004dcz.2_Nonsense_Mutation_p.K1652*|DMD_uc004dcy.1_Nonsense_Mutation_p.K1771*|DMD_uc004ddb.1_Nonsense_Mutation_p.K1767*|DMD_uc010ngo.1_Intron	p.K1775*	NM_004006	NP_003997	P11532	DMD_HUMAN			37	5567	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	1775			Spectrin 12.|Interaction with SYNM (By similarity).		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	ENST00000357033.4	37	c.5323A>T	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	T	48	13.979454	0.99773	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	.	.	.	5.42	5.42	0.78866	.	0.000000	0.36555	U	0.002536	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.4886	0.67634	0.0:0.0:0.0:1.0	.	.	.	.	X	1767;434;431;1771;1775;1775;1652	.	ENSP00000354923:K1775X	K	-	1	0	DMD	32290828	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.165000	0.58196	1.801000	0.52704	0.441000	0.28932	AAG		0.488	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		12	80	0	0	0	0.000978	0	12	80				
RPGR	6103	broad.mit.edu	37	X	38144877	38144877	+	Intron	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:38144877C>A	ENST00000339363.3	-	14	2688				RPGR_ENST00000309513.3_Intron|RPGR_ENST00000342811.3_Intron|RPGR_ENST00000318842.7_Intron|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.Q1125H|RPGR_ENST00000338898.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.Q1125H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						GTCGTTTTGACTGGACTGGCA	0.358																																							uc004ded.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3373-3375)CAG>CAT		retinitis pigmentosa GTPase regulator isoform C							269.0	244.0	253.0					X																	38144877		2202	4300	6502	SO:0001627	intron_variant	6103				intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding	g.chrX:38144877C>A	U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+1469G>T	X.37:g.38144877C>A						RPGR_uc004deb.2_Intron|RPGR_uc004dea.2_Intron|RPGR_uc004dec.2_Intron	p.Q1125H	NM_001034853	NP_001030025	Q92834	RPGR_HUMAN			15	3543	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	ENST00000339363.3	37	c.3375G>T		.	.	.	.	.	.	.	.	.	.	c	0.012	-1.687789	0.00738	.	.	ENSG00000156313	ENST00000378505	T	0.39229	1.09	2.55	-0.502	0.12004	.	.	.	.	.	T	0.31888	0.0811	L	0.53249	1.67	0.25467	N	0.987861	B	0.22346	0.068	B	0.10450	0.005	T	0.35176	-0.9799	9	0.87932	D	0	.	2.5999	0.04864	0.221:0.3462:0.0:0.4328	.	1125	E9PE28	.	H	1125	ENSP00000367766:Q1125H	ENSP00000367766:Q1125H	Q	-	3	2	RPGR	38029821	0.020000	0.18652	0.015000	0.15790	0.005000	0.04900	0.544000	0.23253	-0.243000	0.09653	-0.463000	0.05309	CAG		0.358	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328		34	231	1	0	5.43694e-19	0.005524	9.14905e-19	34	231				
OTUD5	55593	broad.mit.edu	37	X	48781242	48781242	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:48781242G>C	ENST00000156084.4	-	7	1426	c.1366C>G	c.(1366-1368)Cgg>Ggg	p.R456G	OTUD5_ENST00000396743.3_Missense_Mutation_p.R451G|OTUD5_ENST00000376488.3_Missense_Mutation_p.R451G|OTUD5_ENST00000428668.2_Missense_Mutation_p.R234G|OTUD5_ENST00000484499.1_5'Flank	NM_017602.3	NP_060072.1	Q96G74	OTUD5_HUMAN	OTU deubiquitinase 5	456					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)	ubiquitin-specific protease activity (GO:0004843)	p.R427G(1)|p.R456G(1)		endometrium(2)|large_intestine(3)|lung(6)|pancreas(2)	13						GCTGAACTCCGCTGCCGCGGG	0.637																																							uc004dlu.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1366-1368)CGG>GGG		OTU domain containing 5 isoform a							42.0	40.0	41.0					X																	48781242		2202	4300	6502	SO:0001583	missense	55593				negative regulation of type I interferon production		cysteine-type peptidase activity	g.chrX:48781242G>C		CCDS14313.1, CCDS48104.1, CCDS48105.1	Xp11.23	2014-06-09	2014-02-24		ENSG00000068308	ENSG00000068308		"""OTU domain containing"""	25402	protein-coding gene	gene with protein product		300713	"""OTU domain containing 5"""			24143256	Standard	NM_001136157		Approved	DKFZp761A052, DUBA	uc004dlu.3	Q96G74	OTTHUMG00000024130	ENST00000156084.4:c.1366C>G	X.37:g.48781242G>C	ENSP00000156084:p.Arg456Gly					OTUD5_uc004dlt.3_Missense_Mutation_p.R451G|OTUD5_uc004dlv.2_Missense_Mutation_p.R451G|OTUD5_uc011mmp.1_Missense_Mutation_p.R234G	p.R456G	NM_017602	NP_060072	Q96G74	OTUD5_HUMAN			7	1427	-			456					B4DGG7|G5E9D7|Q4KMN9|Q8N6T5|Q9H650|Q9H9U0|Q9NT65	Missense_Mutation	SNP	ENST00000156084.4	37	c.1366C>G	CCDS14313.1	.	.	.	.	.	.	.	.	.	.	G	10.86	1.468582	0.26335	.	.	ENSG00000068308	ENST00000396743;ENST00000453548;ENST00000455452;ENST00000156084;ENST00000376488;ENST00000428668	T;T;D;T;T	0.84223	0.97;0.97;-1.82;0.97;0.97	4.26	2.45	0.29901	.	0.085191	0.46758	D	0.000275	T	0.77772	0.4180	L	0.51422	1.61	0.46185	D	0.998918	P;B;B	0.35242	0.492;0.18;0.275	B;B;B	0.34093	0.111;0.085;0.175	T	0.73033	-0.4110	10	0.59425	D	0.04	-3.9289	6.0732	0.19901	0.104:0.0:0.7093:0.1867	.	234;456;451	B4DGG7;Q96G74;G5E9D7	.;OTUD5_HUMAN;.	G	451;427;329;456;451;234	ENSP00000379969:R451G;ENSP00000390767:R329G;ENSP00000156084:R456G;ENSP00000365671:R451G;ENSP00000401629:R234G	ENSP00000156084:R456G	R	-	1	2	OTUD5	48666186	1.000000	0.71417	1.000000	0.80357	0.085000	0.17905	4.739000	0.62080	0.540000	0.28808	0.523000	0.50628	CGG		0.637	OTUD5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000060799.1	NM_017602		4	14	0	0	0	0.009096	0	4	14				
PAGE2	203569	broad.mit.edu	37	X	55116444	55116444	+	Splice_Site	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:55116444A>T	ENST00000374968.4	+	2	96		c.e2-1		PAGE2_ENST00000374965.1_Splice_Site	NM_207339.2	NP_997222.1	Q7Z2X7	PAGE2_HUMAN	P antigen family, member 2 (prostate associated)											endometrium(1)|large_intestine(2)|lung(1)|ovary(2)	6						TTCTGTTTGCAGTGGGAAATA	0.368																																							uc004duf.1		NA																	0				ovary(2)	2						c.e2-2		P antigen family, member 2							68.0	59.0	62.0					X																	55116444		2165	4294	6459	SO:0001630	splice_region_variant	203569							g.chrX:55116444A>T	BC054022	CCDS14367.1	Xp11.22	2009-06-17			ENSG00000234068	ENSG00000234068			31804	protein-coding gene	gene with protein product		300738	"""G antigen, family C, 2"""	GAGEC2		9724777	Standard	NM_207339		Approved	MGC62094, PAGE-2, CT16.4		Q7Z2X7	OTTHUMG00000021648	ENST00000374968.4:c.-8-1A>T	X.37:g.55116444A>T								NM_207339	NP_997222	Q7Z2X7	GGEE2_HUMAN			2	47	+								Q5JRK7|Q5JRK8	Splice_Site	SNP	ENST00000374968.4	37	c.-7_splice	CCDS14367.1																																																																																				0.368	PAGE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056857.1	NM_207339	Intron	3	46	0	0	0	0.004672	0	3	46				
OGT	8473	broad.mit.edu	37	X	70783033	70783033	+	Silent	SNP	A	A	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:70783033A>T	ENST00000373719.3	+	17	2419	c.2202A>T	c.(2200-2202)atA>atT	p.I734I	OGT_ENST00000373701.3_Silent_p.I724I	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	734					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)	p.I724I(1)|p.I734I(1)		breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					ACAATCGGATAGTTCTGAATG	0.343																																							uc004eaa.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|kidney(1)|pancreas(1)	5						c.(2200-2202)ATA>ATT		O-linked GlcNAc transferase isoform 1							123.0	108.0	113.0					X																	70783033		2203	4300	6503	SO:0001819	synonymous_variant	8473				cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity	g.chrX:70783033A>T	U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.2202A>T	X.37:g.70783033A>T						BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Silent_p.I724I|OGT_uc004eac.2_Silent_p.I595I|OGT_uc004ead.2_Silent_p.I353I	p.I734I	NM_181672	NP_858058	O15294	OGT1_HUMAN			17	2419	+	Renal(35;0.156)		734					Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Silent	SNP	ENST00000373719.3	37	c.2202A>T	CCDS14414.1																																																																																				0.343	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3	NM_003605, NM_181672		5	153	0	0	0	0.000602	0	5	153				
TGIF2LX	90316	broad.mit.edu	37	X	89177403	89177403	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:89177403C>G	ENST00000561129.2	+	1	449	c.319C>G	c.(319-321)Cgc>Ggc	p.R107G	TGIF2LX_ENST00000283891.5_Missense_Mutation_p.R107G			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	107					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R107G(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						TGCTCGCAGACGCATTCTCCC	0.493																																							uc004efe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(319-321)CGC>GGC		TGFB-induced factor homeobox 2-like, X-linked							142.0	128.0	133.0					X																	89177403		2203	4300	6503	SO:0001583	missense	90316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:89177403C>G	AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.319C>G	X.37:g.89177403C>G	ENSP00000453704:p.Arg107Gly						p.R107G	NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN			2	368	+			107			Homeobox; TALE-type.		Q5JRM9|Q8TD48	Missense_Mutation	SNP	ENST00000561129.2	37	c.319C>G	CCDS14459.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.510192	0.44660	.	.	ENSG00000153779	ENST00000283891	D	0.98633	-5.04	3.08	-0.0188	0.13962	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);	.	.	.	.	D	0.99339	0.9768	H	0.99169	4.455	0.09310	N	0.999991	D	0.89917	1.0	D	0.73708	0.981	D	0.95753	0.8793	8	.	.	.	-22.4853	4.514	0.11926	0.3788:0.499:0.0:0.1222	.	107	Q8IUE1	TF2LX_HUMAN	G	107	ENSP00000355119:R107G	.	R	+	1	0	TGIF2LX	89064059	0.004000	0.15560	0.001000	0.08648	0.292000	0.27327	-0.506000	0.06359	-0.118000	0.11851	0.513000	0.50165	CGC		0.493	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417911.2	NM_138960		16	150	0	0	0	0.010504	0	16	150				
COL4A5	1287	broad.mit.edu	37	X	107807111	107807111	+	Splice_Site	SNP	G	G	T	rs104886350		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:107807111G>T	ENST00000361603.2	+	4	475		c.e4-1		COL4A5_ENST00000328300.6_Splice_Site	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5						axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.?(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GCATTTTTCAGGGTGATGATG	0.333									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	1	Unknown(1)		lung(1)	ovary(3)|central_nervous_system(1)	4	GRCh37	CS010533	COL4A5	S	rs104886350	c.e4-1		type IV collagen alpha 5 isoform 2 precursor							59.0	59.0	59.0					X																	107807111		2203	4298	6501	SO:0001630	splice_region_variant	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107807111G>T	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.232-1G>T	X.37:g.107807111G>T						COL4A5_uc011mso.1_Splice_Site_p.G78_splice	p.G78_splice	NM_033380	NP_203699	P29400	CO4A5_HUMAN			4	434	+								Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Splice_Site	SNP	ENST00000361603.2	37	c.232_splice	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.601159	0.87055	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3866	0.87417	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL4A5	107693767	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.584000	0.90798	2.375000	0.81037	0.600000	0.82982	.		0.333	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		Intron	14	45	1	0	0.000422831	0.004007	0.000498337	14	45				
COL4A5	1287	broad.mit.edu	37	X	107898561	107898561	+	Splice_Site	SNP	G	G	T	rs104886223		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:107898561G>T	ENST00000361603.2	+	37	3491	c.3247G>T	c.(3247-3249)Ggt>Tgt	p.G1083C	COL4A5_ENST00000328300.6_Splice_Site_p.G1083C	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1083	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.G1083C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GTGTTTTCAGGGTGAGCCTGG	0.433									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4	GRCh37	CM052215	COL4A5	M	rs104886223	c.(3247-3249)GGT>TGT		type IV collagen alpha 5 isoform 2 precursor							68.0	67.0	67.0					X																	107898561		2203	4300	6503	SO:0001630	splice_region_variant	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107898561G>T	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3247-1G>T	X.37:g.107898561G>T						COL4A5_uc011mso.1_Missense_Mutation_p.G1083C	p.G1083C	NM_033380	NP_203699	P29400	CO4A5_HUMAN			37	3449	+			1083			Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	c.3247G>T	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.515298	0.64634	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.99369	-5.78;-5.78	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.99743	0.9898	H	0.99169	4.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96949	0.9693	9	.	.	.	.	18.3652	0.90388	0.0:0.0:1.0:0.0	.	1083;1083	E7EVY4;P29400	.;CO4A5_HUMAN	C	1083	ENSP00000331902:G1083C;ENSP00000354505:G1083C	.	G	+	1	0	COL4A5	107785217	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.937000	0.75898	2.463000	0.83235	0.600000	0.82982	GGT		0.433	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		Missense_Mutation	18	54	1	0	4.96729e-08	0.008871	7.07271e-08	18	54				
IRS4	8471	broad.mit.edu	37	X	107977781	107977781	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:107977781T>A	ENST00000372129.2	-	1	1870	c.1794A>T	c.(1792-1794)aaA>aaT	p.K598N	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	598					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.K598N(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CATCGGATCCTTTCCCACTTC	0.537																																							uc004eoc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1792-1794)AAA>AAT		insulin receptor substrate 4							208.0	207.0	207.0					X																	107977781		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107977781T>A	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1794A>T	X.37:g.107977781T>A	ENSP00000361202:p.Lys598Asn						p.K598N	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	1827	-			598						Missense_Mutation	SNP	ENST00000372129.2	37	c.1794A>T	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	T	3.718	-0.058150	0.07317	.	.	ENSG00000133124	ENST00000372129	T	0.38077	1.16	4.9	-2.19	0.07015	.	1.384240	0.04639	N	0.405031	T	0.44435	0.1293	M	0.61703	1.905	0.09310	N	1	P	0.51791	0.948	P	0.54312	0.748	T	0.42447	-0.9451	10	0.29301	T	0.29	-16.6924	5.3692	0.16131	0.0:0.4292:0.1682:0.4026	.	598	O14654	IRS4_HUMAN	N	598	ENSP00000361202:K598N	ENSP00000361202:K598N	K	-	3	2	IRS4	107864437	0.010000	0.17322	0.017000	0.16124	0.126000	0.20510	-0.332000	0.07904	-0.320000	0.08640	0.486000	0.48141	AAA		0.537	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		77	174	0	0	0	0.00361	0	77	174				
TMEM164	84187	broad.mit.edu	37	X	109388104	109388104	+	Splice_Site	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:109388104G>T	ENST00000372073.1	+	5	922	c.586G>T	c.(586-588)Ggt>Tgt	p.G196C	TMEM164_ENST00000288381.4_Splice_Site_p.G157C|TMEM164_ENST00000372072.3_Splice_Site_p.G47C|TMEM164_ENST00000464177.1_3'UTR|TMEM164_ENST00000372068.2_Splice_Site_p.G196C			Q5U3C3	TM164_HUMAN	transmembrane protein 164	196						integral component of membrane (GO:0016021)		p.G196C(1)|p.G157C(1)		cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|skin(1)	14						TTGGAAAGGAGGTAAGGCCAG	0.493																																							uc004eom.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|lung(1)|skin(1)	3						c.(586-588)GGT>TGT		transmembrane protein 164 isoform b							171.0	128.0	143.0					X																	109388104		2203	4300	6503	SO:0001630	splice_region_variant	84187					integral to membrane		g.chrX:109388104G>T	AK094127	CCDS14550.2, CCDS55475.1	Xq22.3	2008-02-05			ENSG00000157600	ENSG00000157600			26217	protein-coding gene	gene with protein product						12477932	Standard	NM_032227		Approved	FLJ22679, RP13-360B22.2	uc004eom.3	Q5U3C3	OTTHUMG00000022192	ENST00000372073.1:c.586+1G>T	X.37:g.109388104G>T						TMEM164_uc004eol.2_Missense_Mutation_p.G47C|TMEM164_uc010npq.2_Missense_Mutation_p.G157C	p.G196C	NM_032227	NP_115603	Q5U3C3	TM164_HUMAN			5	905	+			196					B3KSQ8|F5H2P2	Missense_Mutation	SNP	ENST00000372073.1	37	c.586G>T	CCDS14550.2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299050	0.81025	.	.	ENSG00000157600	ENST00000372072;ENST00000372073;ENST00000372068;ENST00000288381;ENST00000501872	T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.84642	0.5517	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.86752	0.1961	10	0.87932	D	0	-2.7222	15.4421	0.75190	0.0:0.0:1.0:0.0	.	157;196	Q9H617;Q5U3C3	.;TM164_HUMAN	C	47;196;196;157;157	ENSP00000384075:G47C;ENSP00000361143:G196C;ENSP00000361138:G196C;ENSP00000288381:G157C	ENSP00000288381:G157C	G	+	1	0	TMEM164	109274760	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.013000	0.76373	2.354000	0.79902	0.600000	0.82982	GGT		0.493	TMEM164-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057898.1	NM_032227	Missense_Mutation	5	95	1	0	3.59834e-05	0.001168	4.51603e-05	5	95				
KIAA1210	57481	broad.mit.edu	37	X	118223471	118223471	+	Silent	SNP	A	A	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:118223471A>C	ENST00000402510.2	-	11	1721	c.1722T>G	c.(1720-1722)ccT>ccG	p.P574P		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	574								p.P398P(1)|p.P574P(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TCTTATTGGTAGGTGAAGACC	0.488																																							uc004era.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|skin(1)	5						c.(1720-1722)CCT>CCG		hypothetical protein LOC57481							144.0	138.0	140.0					X																	118223471		1991	4153	6144	SO:0001819	synonymous_variant	57481							g.chrX:118223471A>C	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.1722T>G	X.37:g.118223471A>C							p.P574P	NM_020721	NP_065772	Q9ULL0	K1210_HUMAN			11	1722	-			574					B7ZCI8|Q5JPN4	Silent	SNP	ENST00000402510.2	37	c.1722T>G	CCDS48156.1																																																																																				0.488	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721		42	90	0	0	0	0.00874	0	42	90				
KIAA1210	57481	broad.mit.edu	37	X	118284525	118284525	+	Silent	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:118284525C>A	ENST00000402510.2	-	1	17	c.18G>T	c.(16-18)acG>acT	p.T6T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	6								p.T6T(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						AGCCTCGAGGCGTCCAGCCGG	0.652																																							uc004era.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(1)	5						c.(16-18)ACG>ACT		hypothetical protein LOC57481							57.0	66.0	63.0					X																	118284525		2017	4144	6161	SO:0001819	synonymous_variant	57481							g.chrX:118284525C>A	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.18G>T	X.37:g.118284525C>A							p.T6T	NM_020721	NP_065772	Q9ULL0	K1210_HUMAN			1	18	-			6					B7ZCI8|Q5JPN4	Silent	SNP	ENST00000402510.2	37	c.18G>T	CCDS48156.1																																																																																				0.652	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721		8	70	1	0	2.17888e-05	0.006214	2.79075e-05	8	70				
TENM1	10178	broad.mit.edu	37	X	123519722	123519722	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:123519722C>A	ENST00000371130.3	-	28	5923	c.5860G>T	c.(5860-5862)Ggc>Tgc	p.G1954C	TENM1_ENST00000422452.2_Missense_Mutation_p.G1961C|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1954					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.G1956C(1)									AGCAATCGGCCATCTCGACTA	0.498																																							uc004euj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(5860-5862)GGC>TGC		odz, odd Oz/ten-m homolog 1 isoform 3							174.0	144.0	154.0					X																	123519722		2203	4300	6503	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123519722C>A	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.5860G>T	X.37:g.123519722C>A	ENSP00000360171:p.Gly1954Cys					ODZ1_uc011muj.1_Missense_Mutation_p.G1960C|ODZ1_uc010nqy.2_Missense_Mutation_p.G1961C	p.G1954C	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN			28	5924	-			1954			YD 11.|Extracellular (Potential).		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.5860G>T	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828209	0.90955	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.89343	-2.5;-2.46	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.94062	0.8097	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.94443	0.7660	10	0.87932	D	0	.	18.8571	0.92257	0.0:1.0:0.0:0.0	.	1960;1961;1954	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	C	1954;1961	ENSP00000360171:G1954C;ENSP00000403954:G1961C	ENSP00000360171:G1954C	G	-	1	0	ODZ1	123347403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.081000	0.71309	2.400000	0.81607	0.591000	0.81541	GGC		0.498	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		8	159	1	0	0.000274275	0.004482	0.000324617	8	159				
HTATSF1	27336	broad.mit.edu	37	X	135593508	135593508	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:135593508C>T	ENST00000218364.4	+	9	1778	c.1604C>T	c.(1603-1605)cCc>cTc	p.P535L	HTATSF1_ENST00000535601.1_Missense_Mutation_p.P535L	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	535	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P535L(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					GAGGTTGGCCCCACAAAAGAG	0.418																																							uc004ezw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(1603-1605)CCC>CTC		HIV-1 Tat specific factor 1							44.0	43.0	43.0					X																	135593508		2194	4291	6485	SO:0001583	missense	27336				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding	g.chrX:135593508C>T	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1604C>T	X.37:g.135593508C>T	ENSP00000218364:p.Pro535Leu					HTATSF1_uc004ezx.2_Missense_Mutation_p.P535L	p.P535L	NM_001163280	NP_001156752	O43719	HTSF1_HUMAN			10	2026	+	Acute lymphoblastic leukemia(192;0.000127)		535			Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.		D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	37	c.1604C>T	CCDS14657.1	.	.	.	.	.	.	.	.	.	.	C	0.193	-1.051186	0.01981	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.03860	3.78;3.78	3.38	0.529	0.17095	.	0.498256	0.17116	N	0.186428	T	0.02119	0.0066	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44982	-0.9292	10	0.28530	T	0.3	0.4042	3.6674	0.08261	0.0:0.453:0.1874:0.3596	.	535	O43719	HTSF1_HUMAN	L	535	ENSP00000442699:P535L;ENSP00000218364:P535L	ENSP00000218364:P535L	P	+	2	0	HTATSF1	135421174	0.000000	0.05858	0.054000	0.19295	0.047000	0.14425	-0.373000	0.07494	-0.010000	0.14271	0.429000	0.28392	CCC		0.418	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500		22	50	0	0	0	0.010504	0	22	50				
MAGEC3	139081	broad.mit.edu	37	X	140985169	140985169	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:140985169G>C	ENST00000298296.1	+	7	1625	c.1625G>C	c.(1624-1626)gGc>gCc	p.G542A	MAGEC3_ENST00000544766.1_Missense_Mutation_p.G244A|MAGEC3_ENST00000409007.1_Missense_Mutation_p.G244A|MAGEC3_ENST00000443323.2_Missense_Mutation_p.G164A|MAGEC3_ENST00000536088.1_Missense_Mutation_p.G244A	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	542	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.G244A(1)|p.G542A(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GATGACCAGGGCATGCCCAAG	0.478																																							uc011mwp.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|central_nervous_system(1)	3						c.(1624-1626)GGC>GCC		melanoma antigen family C, 3 isoform 1							147.0	131.0	136.0					X																	140985169		2203	4300	6503	SO:0001583	missense	139081							g.chrX:140985169G>C	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1625G>C	X.37:g.140985169G>C	ENSP00000298296:p.Gly542Ala					MAGEC3_uc004fbs.2_Missense_Mutation_p.G244A|MAGEC3_uc010nsj.2_Missense_Mutation_p.G244A	p.G542A	NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN			7	1625	+	Acute lymphoblastic leukemia(192;6.56e-05)		542			MAGE 2.		Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	c.1625G>C	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	g	9.115	1.007587	0.19199	.	.	ENSG00000165509	ENST00000298296;ENST00000536088;ENST00000443323;ENST00000544766;ENST00000409007	T;T;T;T;T	0.04758	3.56;3.56;3.56;3.56;3.56	1.25	0.197	0.15164	.	.	.	.	.	T	0.15046	0.0363	M	0.83312	2.635	0.09310	N	1	P;P	0.52577	0.802;0.954	B;P	0.60415	0.394;0.874	T	0.08289	-1.0729	9	0.44086	T	0.13	.	4.7714	0.13157	0.0:0.3957:0.6043:0.0	.	542;244	Q8TD91;Q3SYA7	MAGC3_HUMAN;.	A	542;244;164;244;244	ENSP00000298296:G542A;ENSP00000441107:G244A;ENSP00000438254:G164A;ENSP00000440444:G244A;ENSP00000386566:G244A	ENSP00000298296:G542A	G	+	2	0	MAGEC3	140812835	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.423000	0.21313	0.001000	0.14605	0.284000	0.19432	GGC		0.478	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702		15	167	0	0	0	0.004007	0	15	167				
MAGEC1	9947	broad.mit.edu	37	X	140995914	140995915	+	Missense_Mutation	DNP	GG	GG	TA			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:140995914_140995915GG>TA	ENST00000285879.4	+	4	3010_3011	c.2724_2725GG>TA	c.(2722-2727)ctGGat>ctTAat	p.D909N	MAGEC1_ENST00000406005.2_De_novo_Start_OutOfFrame	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	909	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.D909N(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CTTATACACTGGATGAAAAGGT	0.46										HNSCC(15;0.026)																													uc004fbt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2722-2727)CTGGAT>CTTAAT		melanoma antigen family C, 1																																				SO:0001583	missense	9947						protein binding	g.chrX:140995914_140995915GG>TA	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	Exception_encountered	X.37:g.140995914_140995915delinsTA	ENSP00000285879:p.Asp909Asn	HNSCC(15;0.026)				MAGEC1_uc010nsl.1_5'UTR	p.D909N	NM_005462	NP_005453	O60732	MAGC1_HUMAN			4	3010_3011	+	Acute lymphoblastic leukemia(192;6.56e-05)		909			MAGE.		A0PK03|O75451|Q8TCV4	Missense_Mutation	DNP	ENST00000285879.4	37	c.2724_2725GG>TA	CCDS35417.1																																																																																				0.460	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		33	341	0	0	0	0.004672	0	33	341				
SLITRK4	139065	broad.mit.edu	37	X	142718545	142718545	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:142718545A>G	ENST00000381779.4	-	2	605	c.380T>C	c.(379-381)tTc>tCc	p.F127S	SLITRK4_ENST00000338017.4_Missense_Mutation_p.F127S|SLITRK4_ENST00000356928.1_Missense_Mutation_p.F127S	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	127						integral component of membrane (GO:0016021)		p.F127S(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TATGCCAAGGAAAGTGTCAGC	0.418																																							uc004fbx.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|large_intestine(1)	2						c.(379-381)TTC>TCC		slit and trk like 4 protein precursor							79.0	79.0	79.0					X																	142718545		2203	4300	6503	SO:0001583	missense	139065					integral to membrane		g.chrX:142718545A>G	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.380T>C	X.37:g.142718545A>G	ENSP00000371198:p.Phe127Ser					SLITRK4_uc004fby.2_Missense_Mutation_p.F127S	p.F127S	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN			2	756	-	Acute lymphoblastic leukemia(192;6.56e-05)		127			Extracellular (Potential).|LRR 3.		Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	c.380T>C	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.245855	0.59103	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.59772	0.24;0.24;0.24	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.83496	0.5267	H	0.97131	3.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88768	0.3262	10	0.87932	D	0	-12.2544	13.5168	0.61545	1.0:0.0:0.0:0.0	.	127	Q8IW52	SLIK4_HUMAN	S	127	ENSP00000371198:F127S;ENSP00000349400:F127S;ENSP00000336627:F127S	ENSP00000336627:F127S	F	-	2	0	SLITRK4	142546211	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	1.876000	0.54355	0.486000	0.48141	TTC		0.418	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078		11	184	0	0	0	0.008291	0	11	184				
SLITRK2	84631	broad.mit.edu	37	X	144904874	144904874	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:144904874C>G	ENST00000370490.1	+	1	5186	c.931C>G	c.(931-933)Cca>Gca	p.P311A	SLITRK2_ENST00000447897.2_Missense_Mutation_p.P311A|SLITRK2_ENST00000428560.2_Missense_Mutation_p.P311A|SLITRK2_ENST00000413937.2_Missense_Mutation_p.P311A|SLITRK2_ENST00000434188.2_Missense_Mutation_p.P311A			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	311					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.P311A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GAGAAATCGTCCAACTCCTCG	0.552																																							uc004fcd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(931-933)CCA>GCA		SLIT and NTRK-like family, member 2 precursor							69.0	62.0	64.0					X																	144904874		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144904874C>G	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.931C>G	X.37:g.144904874C>G	ENSP00000359521:p.Pro311Ala					SLITRK2_uc010nsp.2_Missense_Mutation_p.P311A|SLITRK2_uc010nso.2_Missense_Mutation_p.P311A|SLITRK2_uc011mwq.1_Missense_Mutation_p.P311A|SLITRK2_uc011mwr.1_Missense_Mutation_p.P311A|SLITRK2_uc011mws.1_Missense_Mutation_p.P311A|SLITRK2_uc004fcg.2_Missense_Mutation_p.P311A|SLITRK2_uc011mwt.1_Missense_Mutation_p.P311A	p.P311A	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN			5	1921	+	Acute lymphoblastic leukemia(192;6.56e-05)		311			Extracellular (Potential).		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.931C>G	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389092	0.42410	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.55760	0.57;0.5;0.5;0.5;0.5;0.5	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.68705	0.3030	M	0.75615	2.305	0.80722	D	1	D	0.64830	0.994	D	0.63703	0.917	T	0.65269	-0.6209	10	0.18276	T	0.48	-5.3148	15.945	0.79787	0.0:1.0:0.0:0.0	.	311	Q9H156	SLIK2_HUMAN	A	311	ENSP00000334374:P311A;ENSP00000411681:P311A;ENSP00000359521:P311A;ENSP00000397015:P311A;ENSP00000407347:P311A;ENSP00000412010:P311A	ENSP00000334374:P311A	P	+	1	0	SLITRK2	144712566	1.000000	0.71417	0.987000	0.45799	0.996000	0.88848	7.487000	0.81328	2.365000	0.80145	0.600000	0.82982	CCA		0.552	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		5	78	0	0	0	0.000602	0	5	78				
AFF2	2334	broad.mit.edu	37	X	147743813	147743813	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:147743813T>G	ENST00000370460.2	+	3	1044	c.565T>G	c.(565-567)Tct>Gct	p.S189A	AFF2_ENST00000342251.3_Missense_Mutation_p.S185A|AFF2_ENST00000370457.5_Missense_Mutation_p.S185A|AFF2_ENST00000370458.1_Missense_Mutation_p.S185A	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	189					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.S189A(2)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					ACAGGACCAGTCTCAAGCCAA	0.493																																							uc004fcp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|pancreas(2)	5						c.(565-567)TCT>GCT		fragile X mental retardation 2							131.0	125.0	127.0					X																	147743813		2203	4300	6503	SO:0001583	missense	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:147743813T>G	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.565T>G	X.37:g.147743813T>G	ENSP00000359489:p.Ser189Ala					AFF2_uc004fco.2_Missense_Mutation_p.S185A|AFF2_uc004fcq.2_Missense_Mutation_p.S185A|AFF2_uc004fcr.2_Missense_Mutation_p.S185A|AFF2_uc011mxb.1_Missense_Mutation_p.S189A|AFF2_uc004fcs.2_Missense_Mutation_p.S185A	p.S189A	NM_002025	NP_002016	P51816	AFF2_HUMAN			3	1044	+	Acute lymphoblastic leukemia(192;6.56e-05)		189					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	c.565T>G	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	T	5.535	0.283691	0.10458	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.82	0.832	0.18867	.	0.722065	0.13626	N	0.374084	T	0.41743	0.1172	L	0.29908	0.895	0.36695	D	0.879772	B;B;B;B;B;B	0.16802	0.015;0.015;0.015;0.015;0.019;0.019	B;B;B;B;B;B	0.19666	0.009;0.009;0.009;0.015;0.026;0.013	T	0.23583	-1.0184	10	0.11182	T	0.66	.	4.9893	0.14205	0.2305:0.498:0.0:0.2716	.	189;185;185;185;189;185	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	A	189;185;185;185	ENSP00000359489:S189A;ENSP00000359486:S185A;ENSP00000345459:S185A;ENSP00000359487:S185A	ENSP00000345459:S185A	S	+	1	0	AFF2	147551505	0.834000	0.29399	0.560000	0.28344	0.695000	0.40330	-0.038000	0.12144	-0.051000	0.13334	-0.287000	0.09952	TCT		0.493	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		14	223	0	0	0	0.001855	0	14	223				
AFF2	2334	broad.mit.edu	37	X	148037217	148037217	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:148037217C>A	ENST00000370460.2	+	11	2121	c.1642C>A	c.(1642-1644)Caa>Aaa	p.Q548K	AFF2_ENST00000342251.3_Missense_Mutation_p.Q515K|AFF2_ENST00000286437.5_Missense_Mutation_p.Q189K|AFF2_ENST00000370457.5_Missense_Mutation_p.Q515K	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	548				Q -> P (in Ref. 1; AAC82513, 2; AAA99416 and 4; AAB71534). {ECO:0000305}.	brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.Q548K(1)|p.P548T(1)|p.Q189K(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TATTTGTGGCCAAAATGAAAC	0.463																																							uc004fcp.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|pancreas(2)	5						c.(1642-1644)CAA>AAA		fragile X mental retardation 2							186.0	201.0	196.0					X																	148037217		2203	4300	6503	SO:0001583	missense	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:148037217C>A	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1642C>A	X.37:g.148037217C>A	ENSP00000359489:p.Gln548Lys					AFF2_uc004fcq.2_Missense_Mutation_p.Q538K|AFF2_uc004fcr.2_Missense_Mutation_p.Q509K|AFF2_uc011mxb.1_Missense_Mutation_p.Q513K|AFF2_uc004fcs.2_Missense_Mutation_p.Q515K|AFF2_uc011mxc.1_Missense_Mutation_p.Q189K	p.Q548K	NM_002025	NP_002016	P51816	AFF2_HUMAN			11	2121	+	Acute lymphoblastic leukemia(192;6.56e-05)		548	Q -> P (in Ref. 1; AAC82513, 2; AAA99416 and 4; AAB71534).				A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	c.1642C>A	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930712	0.73327	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.74842	-0.24;-0.5;-0.48;-0.88	5.42	5.42	0.78866	.	0.000000	0.50627	D	0.000110	T	0.81903	0.4921	L	0.53249	1.67	0.50813	D	0.999899	D;D;D;D;P;P	0.62365	0.991;0.989;0.989;0.989;0.917;0.932	D;D;D;D;D;D	0.74023	0.982;0.969;0.969;0.969;0.915;0.949	T	0.76735	-0.2850	10	0.09590	T	0.72	.	18.2979	0.90153	0.0:1.0:0.0:0.0	.	189;513;515;509;538;548	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	K	548;515;515;189	ENSP00000359489:Q548K;ENSP00000359486:Q515K;ENSP00000345459:Q515K;ENSP00000286437:Q189K	ENSP00000286437:Q189K	Q	+	1	0	AFF2	147844917	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	6.223000	0.72257	2.259000	0.74868	0.600000	0.82982	CAA		0.463	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		33	401	1	0	2.09667e-21	0.003755	3.63034e-21	33	401				
MAGEA10	4109	broad.mit.edu	37	X	151303295	151303295	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:151303295C>A	ENST00000370323.4	-	4	1114	c.798G>T	c.(796-798)gaG>gaT	p.E266D	MAGEA10_ENST00000244096.3_Missense_Mutation_p.E266D|RP11-1007I13.4_ENST00000509345.2_RNA	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	266	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					nucleus (GO:0005634)		p.E266D(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GCTTCCTGGGCTCCCCATAAA	0.547																																							uc004ffk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(796-798)GAG>GAT		melanoma antigen family A, 10							85.0	81.0	82.0					X																	151303295		2203	4300	6503	SO:0001583	missense	4109							g.chrX:151303295C>A		CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.798G>T	X.37:g.151303295C>A	ENSP00000359347:p.Glu266Asp					MAGEA10_uc004ffl.2_Missense_Mutation_p.E266D	p.E266D	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN			5	1206	-	Acute lymphoblastic leukemia(192;6.56e-05)		266			MAGE.			Missense_Mutation	SNP	ENST00000370323.4	37	c.798G>T	CCDS14705.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089329	0.36855	.	.	ENSG00000124260	ENST00000370323;ENST00000244096	T;T	0.04706	3.57;3.57	2.6	-4.35	0.03656	.	0.117651	0.53938	D	0.000041	T	0.03434	0.0099	L	0.49455	1.56	0.09310	N	1	B	0.22541	0.071	B	0.24848	0.056	T	0.38045	-0.9679	10	0.29301	T	0.29	.	1.2692	0.02017	0.3329:0.2055:0.3293:0.1323	.	266	P43363	MAGAA_HUMAN	D	266	ENSP00000359347:E266D;ENSP00000244096:E266D	ENSP00000244096:E266D	E	-	3	2	MAGEA10	151053951	0.016000	0.18221	0.004000	0.12327	0.833000	0.47200	-1.628000	0.02031	-1.368000	0.02149	0.292000	0.19580	GAG		0.547	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060916.3	NM_021048		12	114	1	0	0.00010058	0.001368	0.000121606	12	114				
RPL10	6134	broad.mit.edu	37	X	153626712	153626712	+	5'UTR	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrX:153626712G>T	ENST00000369817.2	+	0	530				RPL10_ENST00000406022.2_5'Flank|SNORA70_ENST00000384436.1_RNA|RPL10_ENST00000424325.2_5'UTR|RPL10_ENST00000479366.1_3'UTR			P27635	RL10_HUMAN	ribosomal protein L10						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCAGGCGGAGGAGCGCCTCTT	0.567											OREG0003599	type=REGULATORY REGION|Gene=RPL10|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc010nuv.1		NA																	0					NA						c.(151-153)CCT>ACT		Homo sapiens cDNA, FLJ97181.																																				SO:0001623	5_prime_UTR_variant	0							g.chrX:153626712G>T	AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.-47G>T	X.37:g.153626712G>T			OREG0003599	type=REGULATORY REGION|Gene=RPL10|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	1757	RPL10_uc004fkm.2_5'UTR|RPL10_uc004fko.2_5'UTR|RPL10_uc004fkn.1_5'Flank|RPL10_uc004fkp.1_5'Flank|RPL10_uc004fkq.1_5'Flank|RPL10_uc004fkr.1_5'Flank|SNORA70_uc010nux.1_5'Flank	p.P51T							1	467	-								A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	Missense_Mutation	SNP	ENST00000369817.2	37	c.151C>A	CCDS14746.1																																																																																				0.567	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127774.5	NM_006013		7	81	1	0	0.00198382	0.001984	0.00223928	7	81				
NLGN4Y	22829	broad.mit.edu	37	Y	16952497	16952497	+	3'UTR	SNP	G	G	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chrY:16952497G>T	ENST00000476359.1	+	0	2351							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.E602D(1)		large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						ACTTGAACGAGATATTCCAGT	0.478																																							uc004ftg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1804-1806)GAG>GAT		neuroligin 4, Y-linked isoform 1																																				SO:0001624	3_prime_UTR_variant	22829				brainstem development|cell adhesion|cerebellum development|male courtship behavior|positive regulation of organ growth|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|integral to plasma membrane|synapse	neurexin binding|receptor activity	g.chrY:16952497G>T		CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*2348G>T	Y.37:g.16952497G>T						NLGN4Y_uc004fte.2_Missense_Mutation_p.E434D|NLGN4Y_uc011nas.1_Missense_Mutation_p.E622D|NLGN4Y_uc004ftf.2_Missense_Mutation_p.E295D|NLGN4Y_uc004fth.2_Missense_Mutation_p.E602D	p.E602D	NM_014893	NP_055708	Q8NFZ3	NLGNY_HUMAN			6	2058	+			602			Extracellular (Potential).		F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Missense_Mutation	SNP	ENST00000476359.1	37	c.1806G>T																																																																																					0.478	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000089064.2	NM_014893		7	37	1	0	5.18039e-06	0.00308	6.90309e-06	7	37				
SYCP1	6847	broad.mit.edu	37	1	115527385	115527386	+	Frame_Shift_Ins	INS	-	-	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:115527385_115527386insA	ENST00000369522.3	+	30	2839_2840	c.2599_2600insA	c.(2599-2601)caafs	p.Q867fs	SYCP1_ENST00000369518.1_Frame_Shift_Ins_p.Q867fs|SYCP1_ENST00000477590.1_Intron	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	867					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAACTACAGCAAAGAGAAAAC	0.267																																							uc001efr.2		NA																	0				skin(1)	1						c.(2599-2601)CAAfs		synaptonemal complex protein 1																																				SO:0001589	frameshift_variant	6847				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding	g.chr1:115527385_115527386insA	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2602dupA	1.37:g.115527388_115527388dupA	ENSP00000358535:p.Gln867fs					SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Frame_Shift_Ins_p.Q867fs|SYCP1_uc009wgw.2_Frame_Shift_Ins_p.Q842fs	p.Q867fs	NM_003176	NP_003167	Q15431	SYCP1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	30	2808_2809	+	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)	867					O14963|Q5VXJ6	Frame_Shift_Ins	INS	ENST00000369522.3	37	c.2599_2600insA	CCDS879.1																																																																																				0.267	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176		9	153	NA	NA	NA	NA	NA	9	153	---	---	---	---
FLG	2312	broad.mit.edu	37	1	152280635	152280635	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:152280635delC	ENST00000368799.1	-	3	6762	c.6727delG	c.(6727-6729)gttfs	p.V2243fs	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2243	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCTGGCTAACACTGGATCCC	0.572									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(6727-6729)GTTfs		filaggrin							207.0	208.0	208.0					1																	152280635		2203	4300	6503	SO:0001589	frameshift_variant	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152280635delC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6727delG	1.37:g.152280635delC	ENSP00000357789:p.Val2243fs						p.V2243fs	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6763	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2243			Ser-rich.|Filaggrin 13.		Q01720|Q5T583|Q9UC71	Frame_Shift_Del	DEL	ENST00000368799.1	37	c.6727delG	CCDS30860.1																																																																																				0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		22	357	NA	NA	NA	NA	NA	22	357	---	---	---	---
FMO1	2326	broad.mit.edu	37	1	171250038	171250038	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:171250038delC	ENST00000354841.4	+	5	872	c.741delC	c.(739-741)ctcfs	p.L247fs	FMO1_ENST00000402921.2_Frame_Shift_Del_p.L184fs|FMO1_ENST00000367750.3_Frame_Shift_Del_p.L247fs|FMO1_ENST00000469112.1_3'UTR	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	247					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GAAATTCCCTCCCAACCCCAA	0.468																																							uc009wvz.2		NA																	0				skin(1)	1						c.(739-741)CTCfs		flavin containing monooxygenase 1							110.0	101.0	104.0					1																	171250038		2203	4300	6503	SO:0001589	frameshift_variant	2326				NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum lumen|integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding	g.chr1:171250038delC	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.741delC	1.37:g.171250038delC	ENSP00000346901:p.Leu247fs					FMO1_uc010pme.1_Frame_Shift_Del_p.L184fs|FMO1_uc001ghl.2_Frame_Shift_Del_p.L247fs|FMO1_uc001ghm.2_Frame_Shift_Del_p.L247fs|FMO1_uc001ghn.2_Frame_Shift_Del_p.L247fs	p.L247fs	NM_002021	NP_002012	Q01740	FMO1_HUMAN			6	877	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		247					A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Frame_Shift_Del	DEL	ENST00000354841.4	37	c.741delC	CCDS1294.1																																																																																				0.468	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021		16	126	NA	NA	NA	NA	NA	16	126	---	---	---	---
SMG7	9887	broad.mit.edu	37	1	183511555	183511557	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	ACA	ACA	-	-	ACA	ACA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr1:183511555_183511557delACA	ENST00000347615.2	+	14	1879_1881	c.1760_1762delACA	c.(1759-1764)gacaac>gac	p.N589del	SMG7_ENST00000507469.1_Intron|SMG7_ENST00000367537.3_Intron|SMG7_ENST00000515829.2_Intron|SMG7_ENST00000456731.2_Intron|SMG7_ENST00000508461.1_In_Frame_Del_p.N547del	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	589					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						GGAAAGAAGGACAACAACAAGAG	0.404																																							uc001gqg.2		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(1759-1764)GACAAC>GAC		SMG-7 homolog isoform 1																																				SO:0001651	inframe_deletion	9887				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding	g.chr1:183511555_183511557delACA	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.1760_1762delACA	1.37:g.183511561_183511563delACA	ENSP00000340766:p.Asn589del					SMG7_uc010pob.1_Intron|SMG7_uc001gqf.2_Intron|SMG7_uc001gqh.2_Intron|SMG7_uc001gqi.2_Intron|SMG7_uc010poc.1_In_Frame_Del_p.N547del	p.N589del	NM_173156	NP_775179	Q92540	SMG7_HUMAN			14	1882_1884	+			589					B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	In_Frame_Del	DEL	ENST00000347615.2	37	c.1760_1762delACA	CCDS1355.1																																																																																				0.404	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	NM_014837		19	90	NA	NA	NA	NA	NA	19	90	---	---	---	---
NELL1	4745	broad.mit.edu	37	11	21594744	21594745	+	Frame_Shift_Ins	INS	-	-	T			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr11:21594744_21594745insT	ENST00000357134.5	+	19	2323_2324	c.2171_2172insT	c.(2170-2175)gattgcfs	p.C725fs	NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000532434.1_Frame_Shift_Ins_p.C678fs|NELL1_ENST00000325319.5_Frame_Shift_Ins_p.C668fs|NELL1_ENST00000298925.5_Frame_Shift_Ins_p.C753fs	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	725	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GGAGAGGTAGATTGCTGGCCAC	0.45																																							uc001mqe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(2170-2172)GATfs		nel-like 1 isoform 1 precursor																																				SO:0001589	frameshift_variant	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:21594744_21594745insT	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.2173dupT	11.37:g.21594746_21594746dupT	ENSP00000349654:p.Cys725fs					NELL1_uc001mqf.2_Frame_Shift_Ins_p.D677fs|NELL1_uc009yid.2_Frame_Shift_Ins_p.D752fs|NELL1_uc010rdo.1_Frame_Shift_Ins_p.D667fs|NELL1_uc010rdp.1_Frame_Shift_Ins_p.D437fs|NELL1_uc001mqh.2_Frame_Shift_Ins_p.D269fs	p.D724fs	NM_006157	NP_006148	Q92832	NELL1_HUMAN			19	2324_2325	+			724			VWFC 4.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Frame_Shift_Ins	INS	ENST00000357134.5	37	c.2171_2172insT	CCDS7855.1																																																																																				0.450	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		13	68	NA	NA	NA	NA	NA	13	68	---	---	---	---
FGD4	121512	broad.mit.edu	37	12	32735271	32735271	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:32735271delG	ENST00000427716.2	+	4	894	c.470delG	c.(469-471)aggfs	p.R157fs	FGD4_ENST00000546442.1_Frame_Shift_Del_p.R64fs|FGD4_ENST00000534526.2_Frame_Shift_Del_p.R294fs|FGD4_ENST00000472289.1_Frame_Shift_Del_p.R157fs|FGD4_ENST00000531134.1_Frame_Shift_Del_p.R242fs|FGD4_ENST00000525053.1_Frame_Shift_Del_p.R269fs|FGD4_ENST00000266482.3_5'UTR	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	157					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					AGTAGCTACAGGACTCCAGGC	0.507																																							uc001rkz.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(469-471)AGGfs		FYVE, RhoGEF and PH domain containing 4							75.0	77.0	77.0					12																	32735271		2203	4300	6503	SO:0001589	frameshift_variant	121512				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr12:32735271delG	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.470delG	12.37:g.32735271delG	ENSP00000394487:p.Arg157fs					FGD4_uc001rlc.2_Frame_Shift_Del_p.R242fs|FGD4_uc001rky.2_5'UTR|FGD4_uc001rla.2_5'UTR|FGD4_uc010ske.1_Frame_Shift_Del_p.R269fs|FGD4_uc001rlb.1_RNA|FGD4_uc001rkx.3_Frame_Shift_Del_p.R157fs	p.R157fs	NM_139241	NP_640334	Q96M96	FGD4_HUMAN			4	947	+	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		157					Q6ULS2|Q8TCP6	Frame_Shift_Del	DEL	ENST00000427716.2	37	c.470delG	CCDS8727.1																																																																																				0.507	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241		49	92	NA	NA	NA	NA	NA	49	92	---	---	---	---
MAP3K12	7786	broad.mit.edu	37	12	53877180	53877180	+	Frame_Shift_Del	DEL	A	A	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:53877180delA	ENST00000267079.2	-	11	1692	c.1467delT	c.(1465-1467)cttfs	p.L489fs	MAP3K12_ENST00000547488.1_Frame_Shift_Del_p.L522fs|MAP3K12_ENST00000547035.1_Frame_Shift_Del_p.L522fs	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	489					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						TCTTCTTGATAAGCTTCTCCA	0.532																																							uc001sdm.1		NA																	0				lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(1465-1467)CTTfs		mitogen-activated protein kinase kinase kinase							159.0	156.0	157.0					12																	53877180		2203	4300	6503	SO:0001589	frameshift_variant	7786				histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding	g.chr12:53877180delA	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1467delT	12.37:g.53877180delA	ENSP00000267079:p.Leu489fs					MAP3K12_uc001sdn.1_Frame_Shift_Del_p.L522fs	p.L489fs	NM_006301	NP_006292	Q12852	M3K12_HUMAN			11	1565	-			489					B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Frame_Shift_Del	DEL	ENST00000267079.2	37	c.1467delT	CCDS8860.1																																																																																				0.532	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301		23	153	NA	NA	NA	NA	NA	23	153	---	---	---	---
MON2	23041	broad.mit.edu	37	12	62954583	62954583	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr12:62954583delG	ENST00000393632.2	+	26	4113	c.3722delG	c.(3721-3723)tggfs	p.W1241fs	MON2_ENST00000280379.6_Frame_Shift_Del_p.W1242fs|MON2_ENST00000552738.1_Frame_Shift_Del_p.W1218fs|MON2_ENST00000546600.1_Frame_Shift_Del_p.W1241fs|MON2_ENST00000393629.2_Frame_Shift_Del_p.W1241fs|MON2_ENST00000393630.3_Frame_Shift_Del_p.W1242fs	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1241					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		AATCTATGGTGGGCTGCGTGG	0.383																																							uc001sre.2		NA																	0				central_nervous_system(2)	2						c.(3721-3723)TGGfs		MON2 homolog							93.0	92.0	92.0					12																	62954583		2203	4300	6503	SO:0001589	frameshift_variant	23041				Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding	g.chr12:62954583delG		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.3722delG	12.37:g.62954583delG	ENSP00000377252:p.Trp1241fs					MON2_uc009zqj.2_Frame_Shift_Del_p.W1241fs|MON2_uc010ssl.1_Frame_Shift_Del_p.W1169fs|MON2_uc010ssm.1_Frame_Shift_Del_p.W1218fs|MON2_uc010ssn.1_Frame_Shift_Del_p.W1241fs|MON2_uc001srf.2_Frame_Shift_Del_p.W1004fs|MON2_uc001srg.2_Frame_Shift_Del_p.W116fs	p.W1241fs	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)	26	4113	+			1242					A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Frame_Shift_Del	DEL	ENST00000393632.2	37	c.3722delG	CCDS31849.1																																																																																				0.383	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026		14	94	NA	NA	NA	NA	NA	14	94	---	---	---	---
TP53	7157	broad.mit.edu	37	17	7579471	7579471	+	Frame_Shift_Del	DEL	G	G	-	rs56275308		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:7579471delG	ENST00000269305.4	-	4	405	c.216delC	c.(214-216)cccfs	p.P72fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.P72fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.P72fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.P72fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.P72fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Frame_Shift_Del_p.P72fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	72	Interaction with HRMT1L2.|Interaction with WWOX.		P -> C (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> G (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in a sporadic cancer; somatic mutation).|P -> R (in dbSNP:rs1042522). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:16131611, ECO:0000269|PubMed:1999338, ECO:0000269|Ref.17}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V73fs*76(11)|p.0?(8)|p.G59fs*23(3)|p.R72fs*51(2)|p.V73fs*9(1)|p.R65fs*38(1)|p.E68fs*76(1)|p.V73fs*50(1)|p.D48fs*55(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.D57_A76del20(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGGGCCACGGGGGGAGCAG	0.602		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		32	Insertion - Frameshift(11)|Deletion - Frameshift(9)|Whole gene deletion(8)|Complex - frameshift(3)|Deletion - In frame(1)	p.0?(7)|p.R72fs*51(6)|p.G59fs*23(3)|p.R72C(2)|p.V73fs*76(2)|p.R72H(2)|p.V73fs*9(1)|p.R65fs*38(1)|p.E68fs*76(1)|p.V73fs*50(1)|p.D48fs*55(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.D57_A76del20(1)	upper_aerodigestive_tract(6)|lung(6)|breast(4)|bone(4)|central_nervous_system(3)|biliary_tract(3)|large_intestine(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|prostate(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(214-216)CCCfs	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							85.0	93.0	90.0					17																	7579471		2202	4299	6501	SO:0001589	frameshift_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7579471delG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.216delC	17.37:g.7579471delG	ENSP00000269305:p.Pro72fs	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Frame_Shift_Del_p.P72fs|TP53_uc002gih.2_Frame_Shift_Del_p.P72fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Frame_Shift_Del_p.P72fs|TP53_uc010cni.1_Frame_Shift_Del_p.P72fs|TP53_uc002gij.2_Frame_Shift_Del_p.P72fs|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Frame_Shift_Del_p.P33fs|TP53_uc010cnk.1_Frame_Shift_Del_p.P87fs	p.P72fs	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	4	410	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	72		P -> C (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> L (in a sporadic cancer; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> G (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).	Interaction with WWOX.|Interaction with HRMT1L2.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	c.216delC	CCDS11118.1																																																																																				0.602	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		31	138	NA	NA	NA	NA	NA	31	138	---	---	---	---
DDX5	1655	broad.mit.edu	37	17	62499955	62499958	+	Frame_Shift_Del	DEL	TGAT	TGAT	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	TGAT	TGAT	-	-	TGAT	TGAT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr17:62499955_62499958delTGAT	ENST00000225792.5	-	5	871_874	c.470_473delATCA	c.(469-474)aatcatfs	p.NH157fs	MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000450599.2_Intron|DDX5_ENST00000578804.1_Frame_Shift_Del_p.NH157fs|DDX5_ENST00000580026.1_5'Flank|CEP95_ENST00000556440.2_5'Flank|MIR3064_ENST00000581130.1_RNA	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	157	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			GAATGGCTGATGATTGATGTGGAC	0.328			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)	NSCLC(22;406 813 4871 19580 40307)	uc002jek.2		NA		Dom	yes		17	17q21	1655	T	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5			E	ETV4		prostate		0				ovary(2)|lung(1)	3						c.(469-474)AATCATfs		DEAD (Asp-Glu-Ala-Asp) box polypeptide 5																																				SO:0001589	frameshift_variant	1655				cell growth|regulation of alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA helicase activity|transcription cofactor activity	g.chr17:62499955_62499958delTGAT	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.470_473delATCA	17.37:g.62499959_62499962delTGAT	ENSP00000225792:p.Asn157fs					DDX5_uc010deh.2_Frame_Shift_Del_p.N157fs|DDX5_uc002jej.2_Frame_Shift_Del_p.N52fs|DDX5_uc010wqa.1_Intron|DDX5_uc002jel.1_5'Flank	p.N157fs	NM_004396	NP_004387	P17844	DDX5_HUMAN	BRCA - Breast invasive adenocarcinoma(8;8.6e-12)		5	717_720	-	Breast(5;2.15e-14)		157_158			Helicase ATP-binding.		B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Frame_Shift_Del	DEL	ENST00000225792.5	37	c.470_473delATCA	CCDS11659.1																																																																																				0.328	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396		16	118	NA	NA	NA	NA	NA	16	118	---	---	---	---
REG3A	5068	broad.mit.edu	37	2	79385513	79385513	+	Frame_Shift_Del	DEL	A	A	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:79385513delA	ENST00000409839.3	-	4	308	c.272delT	c.(271-273)ctgfs	p.L91fs	AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000393878.1_Frame_Shift_Del_p.L91fs|REG3A_ENST00000305165.2_Frame_Shift_Del_p.L91fs	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	91	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)			breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						GCTCTTCACCAGGGAGGACAC	0.552																																							uc002sod.1		NA																	0				skin(1)	1						c.(271-273)CTGfs		pancreatitis-associated protein precursor							138.0	113.0	121.0					2																	79385513		2203	4300	6503	SO:0001589	frameshift_variant	5068				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding	g.chr2:79385513delA	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.272delT	2.37:g.79385513delA	ENSP00000386630:p.Leu91fs					REG3A_uc002soe.1_Frame_Shift_Del_p.L91fs|REG3A_uc002sof.1_Frame_Shift_Del_p.L91fs	p.L91fs	NM_138938	NP_620355	Q06141	REG3A_HUMAN			3	527	-			91			C-type lectin.			Frame_Shift_Del	DEL	ENST00000409839.3	37	c.272delT	CCDS1965.1																																																																																				0.552	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580		11	58	NA	NA	NA	NA	NA	11	58	---	---	---	---
FAM168B	130074	broad.mit.edu	37	2	131813266	131813266	+	Frame_Shift_Del	DEL	A	A	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:131813266delA	ENST00000409185.1	-	4	264	c.157delT	c.(157-159)tacfs	p.Y53fs	FAM168B_ENST00000389915.3_Frame_Shift_Del_p.Y53fs	NM_001009993.2	NP_001009993.2	A1KXE4	F168B_HUMAN	family with sequence similarity 168, member B	53						cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|lung(2)	5						CCAGGAGTGTAACCTGGAACA	0.622																																							uc002tsd.2		NA																	0					0						c.(157-159)TACfs		hypothetical protein LOC130074							35.0	40.0	38.0					2																	131813266		2074	4204	6278	SO:0001589	frameshift_variant	130074							g.chr2:131813266delA		CCDS42755.1	2q21.1	2008-08-08			ENSG00000152102	ENSG00000152102			27016	protein-coding gene	gene with protein product							Standard	NM_001009993		Approved	KIAA0280L	uc002tsd.3	A1KXE4	OTTHUMG00000153473	ENST00000409185.1:c.157delT	2.37:g.131813266delA	ENSP00000387051:p.Tyr53fs						p.Y53fs	NM_001009993	NP_001009993	A1KXE4	F168B_HUMAN			4	386	-			53					Q2TAZ6|Q6NZ40	Frame_Shift_Del	DEL	ENST00000409185.1	37	c.157delT	CCDS42755.1																																																																																				0.622	FAM168B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331299.2	NM_001009993		10	28	NA	NA	NA	NA	NA	10	28	---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	140997093	140997094	+	Frame_Shift_Ins	INS	-	-	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:140997093_140997094insA	ENST00000389484.3	-	88	14303_14304	c.13332_13333insT	c.(13330-13335)attgccfs	p.A4445fs		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4445					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACAATGATGGCAATGCTTCCTG	0.317										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(13330-13335)ATTGCCfs		low density lipoprotein-related protein 1B																																				SO:0001589	frameshift_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:140997093_140997094insA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13333dupT	2.37:g.140997095_140997095dupA	ENSP00000374135:p.Ala4445fs	TSP Lung(27;0.18)					p.I4444fs	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	88	14304_14305	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4444_4445			Helical; (Potential).		Q8WY29|Q8WY30|Q8WY31	Frame_Shift_Ins	INS	ENST00000389484.3	37	c.13332_13333insT	CCDS2182.1																																																																																				0.317	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		13	46	NA	NA	NA	NA	NA	13	46	---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141806572	141806573	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:141806572_141806573delTC	ENST00000389484.3	-	11	2742_2743	c.1771_1772delGA	c.(1771-1773)gaafs	p.E591fs		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	591					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAGGATGGTTTCTCTCTCTGTG	0.436										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(1771-1773)GAAfs		low density lipoprotein-related protein 1B																																				SO:0001589	frameshift_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141806572_141806573delTC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1771_1772delGA	2.37:g.141806578_141806579delTC	ENSP00000374135:p.Glu591fs	TSP Lung(27;0.18)				LRP1B_uc010fnl.1_Intron	p.E591fs	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	11	2743_2744	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	591			Extracellular (Potential).|LDL-receptor class B 5.		Q8WY29|Q8WY30|Q8WY31	Frame_Shift_Del	DEL	ENST00000389484.3	37	c.1771_1772delGA	CCDS2182.1																																																																																				0.436	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		14	151	NA	NA	NA	NA	NA	14	151	---	---	---	---
ZEB2	9839	broad.mit.edu	37	2	145156965	145156966	+	Frame_Shift_Ins	INS	-	-	A			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:145156965_145156966insA	ENST00000558170.2	-	8	2972_2973	c.1788_1789insT	c.(1786-1791)ttgcatfs	p.H597fs	ZEB2_ENST00000409487.3_Frame_Shift_Ins_p.H597fs|ZEB2_ENST00000539609.3_Frame_Shift_Ins_p.H573fs|ZEB2_ENST00000303660.4_Frame_Shift_Ins_p.H597fs	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	597					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		TCATGCTGATGCAAAGGGATGG	0.426																																					Melanoma(33;1235 1264 5755 16332)	Melanoma(33;1235 1264 5755 16332)	uc002tvu.2		NA																	0				ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9						c.(1786-1791)TTGCATfs		zinc finger homeobox 1b																																				SO:0001589	frameshift_variant	9839					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding	g.chr2:145156965_145156966insA	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.1788_1789insT	2.37:g.145156965_145156966insA	ENSP00000454157:p.His597fs					ZEB2_uc002tvv.2_Frame_Shift_Ins_p.L590fs|ZEB2_uc010zbm.1_Frame_Shift_Ins_p.L567fs|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Frame_Shift_Ins_p.L625fs	p.L596fs	NM_014795	NP_055610	O60315	ZEB2_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.112)	8	2268_2269	-			596_597					A0JP09|B7Z2P2|F5H814|Q9UED1	Frame_Shift_Ins	INS	ENST00000558170.2	37	c.1788_1789insT	CCDS2186.1																																																																																				0.426	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795		7	158	NA	NA	NA	NA	NA	7	158	---	---	---	---
GALNT13	114805	broad.mit.edu	37	2	154801049	154801049	+	Frame_Shift_Del	DEL	T	T	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:154801049delT	ENST00000392825.3	+	3	606	c.39delT	c.(37-39)actfs	p.T13fs	GALNT13_ENST00000409237.1_Frame_Shift_Del_p.T13fs	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	13					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						TTCTAGCCACTTCGCTGATGT	0.408																																							uc002tyr.3		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						c.(37-39)ACTfs		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							260.0	229.0	239.0					2																	154801049		2203	4300	6503	SO:0001589	frameshift_variant	114805					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:154801049delT	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.39delT	2.37:g.154801049delT	ENSP00000376570:p.Thr13fs					GALNT13_uc002tyt.3_Frame_Shift_Del_p.T13fs	p.T13fs	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN			3	606	+			13			Helical; Signal-anchor for type II membrane protein; (Potential).		Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Frame_Shift_Del	DEL	ENST00000392825.3	37	c.39delT	CCDS2199.1																																																																																				0.408	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917		26	263	NA	NA	NA	NA	NA	26	263	---	---	---	---
CPS1	1373	broad.mit.edu	37	2	211466964	211466964	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr2:211466964delC	ENST00000233072.5	+	16	1942	c.1746delC	c.(1744-1746)tacfs	p.Y582fs	CPS1_ENST00000451903.2_Frame_Shift_Del_p.Y131fs|CPS1_ENST00000430249.2_Frame_Shift_Del_p.Y588fs	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	582	ATP-grasp 1.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CCATTGGCTACCCAGTGATGA	0.488																																							uc002vee.3		NA																	0				ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.(1744-1746)TACfs		carbamoyl-phosphate synthetase 1 isoform b							127.0	113.0	118.0					2																	211466964		2203	4300	6503	SO:0001589	frameshift_variant	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211466964delC	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1746delC	2.37:g.211466964delC	ENSP00000233072:p.Tyr582fs					CPS1_uc010fur.2_Frame_Shift_Del_p.Y588fs|CPS1_uc010fus.2_Frame_Shift_Del_p.Y131fs	p.Y582fs	NM_001875	NP_001866	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	16	1878	+			582			ATP-grasp 1.		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Frame_Shift_Del	DEL	ENST00000233072.5	37	c.1746delC	CCDS2393.1																																																																																				0.488	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			9	77	NA	NA	NA	NA	NA	9	77	---	---	---	---
SETD2	29072	broad.mit.edu	37	3	47164413	47164414	+	Frame_Shift_Ins	INS	-	-	C			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr3:47164413_47164414insC	ENST00000409792.3	-	3	1754_1755	c.1712_1713insG	c.(1711-1713)aatfs	p.N571fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	571					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AACAGAAAGAATTTTTAAATTT	0.327			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		0				kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(1711-1713)AATfs		SET domain containing 2																																				SO:0001589	frameshift_variant	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47164413_47164414insC	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.1712_1713insG	3.37:g.47164413_47164414insC	ENSP00000386759:p.Asn571fs					SETD2_uc003cqv.2_Frame_Shift_Ins_p.N560fs	p.N571fs	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	3	1765_1766	-		Acute lymphoblastic leukemia(5;0.0169)	571					O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Ins	INS	ENST00000409792.3	37	c.1712_1713insG	CCDS2749.2																																																																																				0.327	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		21	153	NA	NA	NA	NA	NA	21	153	---	---	---	---
SGTB	54557	broad.mit.edu	37	5	65008852	65008852	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr5:65008852delG	ENST00000381007.4	-	3	375	c.140delC	c.(139-141)ccafs	p.P47fs		NM_019072.2	NP_061945.1	Q96EQ0	SGTB_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta	47										large_intestine(3)|lung(3)|skin(3)	9		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)		TGTATCTTCTGGGCTGATCTT	0.299																																							uc003jud.2		NA																	0					0						c.(139-141)CCAfs		small glutamine-rich tetratricopeptide repeat							127.0	124.0	125.0					5																	65008852		2203	4300	6503	SO:0001589	frameshift_variant	54557						binding	g.chr5:65008852delG	AK096321	CCDS3988.1	5q12.3	2013-01-10			ENSG00000197860	ENSG00000197860		"""Tetratricopeptide (TTC) repeat domain containing"""	23567	protein-coding gene	gene with protein product						12477932	Standard	XM_005248548		Approved	Sgt2, FLJ39002	uc003jud.3	Q96EQ0	OTTHUMG00000097801	ENST00000381007.4:c.140delC	5.37:g.65008852delG	ENSP00000370395:p.Pro47fs						p.P47fs	NM_019072	NP_061945	Q96EQ0	SGTB_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)	3	360	-		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)	47			TPR 1.			Frame_Shift_Del	DEL	ENST00000381007.4	37	c.140delC	CCDS3988.1																																																																																				0.299	SGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215057.2	NM_019072		22	153	NA	NA	NA	NA	NA	22	153	---	---	---	---
DEK	7913	broad.mit.edu	37	6	18222173	18222173	+	IGR	DEL	G	G	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr6:18222173delG	ENST00000397239.3	-	0	3427				KDM1B_ENST00000388870.2_Frame_Shift_Del_p.G808fs|KDM1B_ENST00000397244.1_Frame_Shift_Del_p.G576fs|KDM1B_ENST00000546309.2_Frame_Shift_Del_p.G98fs|KDM1B_ENST00000297792.5_Frame_Shift_Del_p.G575fs	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene						chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			AACTGTTACAGGGGCATATTT	0.393			T	NUP214	AML																																		uc003nco.1		NA		Dom	yes		6	6p23	7913		DEK oncogene (DNA binding)			L					0				skin(1)	1						c.(1810-1812)GGGfs		amine oxidase (flavin containing) domain 1							170.0	160.0	163.0					6																	18222173		2203	4300	6503	SO:0001628	intergenic_variant	221656				multicellular organismal development|regulation of DNA methylation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-monomethyl-K4 specific)|oxidoreductase activity|zinc ion binding	g.chr6:18222173delG	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319		6.37:g.18222173delG						KDM1B_uc003ncn.1_Frame_Shift_Del_p.G575fs|KDM1B_uc003ncp.1_Frame_Shift_Del_p.G160fs|KDM1B_uc003ncq.1_Frame_Shift_Del_p.R158fs	p.G604fs	NM_153042	NP_694587	Q8NB78	KDM1B_HUMAN			15	1885	+			807					B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Frame_Shift_Del	DEL	ENST00000397239.3	37	c.1810delG	CCDS34344.1																																																																																				0.393	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039962.4			28	218	NA	NA	NA	NA	NA	28	218	---	---	---	---
HIP1	3092	broad.mit.edu	37	7	75228558	75228559	+	Frame_Shift_Ins	INS	-	-	T	rs587658319		TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:75228558_75228559insT	ENST00000336926.6	-	2	153_154	c.127_128insA	c.(127-129)agcfs	p.S43fs	HIP1_ENST00000434438.2_Frame_Shift_Ins_p.S43fs	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	43	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CTTATTGATGCTGACAGTCTGA	0.505			T	PDGFRB	CMML																																		uc003uds.1		NA		Dom	yes		7	7q11.23	3092	T	huntingtin interacting protein 1			L	PDGFRB		CMML		0				lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						c.(127-129)AGCfs		huntingtin interacting protein 1																																				SO:0001589	frameshift_variant	3092				activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton	g.chr7:75228558_75228559insT	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.128dupA	7.37:g.75228559_75228559dupT	ENSP00000336747:p.Ser43fs						p.S43fs	NM_005338	NP_005329	O00291	HIP1_HUMAN			2	168_169	-			43			ENTH.		B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Frame_Shift_Ins	INS	ENST00000336926.6	37	c.127_128insA	CCDS34669.1																																																																																				0.505	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338		7	141	NA	NA	NA	NA	NA	7	141	---	---	---	---
SAMD9	54809	broad.mit.edu	37	7	92731758	92731759	+	Frame_Shift_Ins	INS	-	-	G	rs199887936	byFrequency	TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:92731758_92731759insG	ENST00000379958.2	-	3	3921_3922	c.3652_3653insC	c.(3652-3654)gatfs	p.D1218fs		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1218						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			ATTTTTATTATCAAAAAAAGGA	0.337																																							uc003umf.2		NA																	0				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(3652-3654)GATfs		sterile alpha motif domain containing 9																																				SO:0001589	frameshift_variant	54809					cytoplasm		g.chr7:92731758_92731759insG	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.3652_3653insC	7.37:g.92731758_92731759insG	ENSP00000369292:p.Asp1218fs					SAMD9_uc003umg.2_Frame_Shift_Ins_p.D1218fs	p.D1218fs	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		3	3908_3909	-	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		1218					A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Frame_Shift_Ins	INS	ENST00000379958.2	37	c.3652_3653insC	CCDS34680.1																																																																																				0.337	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654		16	138	NA	NA	NA	NA	NA	16	138	---	---	---	---
NUB1	51667	broad.mit.edu	37	7	151064199	151064199	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr7:151064199delG	ENST00000355851.4	+	9	1052	c.975delG	c.(973-975)ctgfs	p.L325fs	NUB1_ENST00000566856.1_Frame_Shift_Del_p.L325fs|NUB1_ENST00000568733.1_Frame_Shift_Del_p.L349fs|NUB1_ENST00000413040.2_Frame_Shift_Del_p.L349fs	NM_001243351.1	NP_001230280.1	Q9Y5A7	NUB1_HUMAN	negative regulator of ubiquitin-like proteins 1	325					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|response to interferon-gamma (GO:0034341)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(7)|lung(3)	11			OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		ATCAGAGACTGGTCCACATAA	0.378																																							uc003wjx.2		NA																	0					0						c.(1045-1047)CTGfs		NEDD8 ultimate buster-1							58.0	58.0	58.0					7																	151064199		1837	4092	5929	SO:0001589	frameshift_variant	51667				positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|response to interferon-gamma|response to tumor necrosis factor|ubiquitin-dependent protein catabolic process	nucleus	protein binding	g.chr7:151064199delG	AF300717	CCDS47751.1, CCDS47751.2, CCDS59089.1	7q36	2006-07-27			ENSG00000013374	ENSG00000013374			17623	protein-coding gene	gene with protein product	"""NEDD8 ultimate buster-1"""	607981				10508479, 11259415	Standard	NM_001243351		Approved	BS4, NYREN18	uc003wjx.3	Q9Y5A7	OTTHUMG00000157365	ENST00000355851.4:c.975delG	7.37:g.151064199delG	ENSP00000348110:p.Leu325fs					NUB1_uc003wjw.2_Frame_Shift_Del_p.L325fs|NUB1_uc010lqc.2_RNA|uc003wjz.1_RNA	p.L349fs	NM_016118	NP_057202	Q9Y5A7	NUB1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)	9	1052	+			325					O95422|Q75MR9|Q8IX22|Q9BXR2	Frame_Shift_Del	DEL	ENST00000355851.4	37	c.1047delG																																																																																					0.378	NUB1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_016118		7	74	NA	NA	NA	NA	NA	7	74	---	---	---	---
PKHD1L1	93035	broad.mit.edu	37	8	110445422	110445424	+	In_Frame_Del	DEL	GTT	GTT	-			TCGA-50-5941-01A-11D-1753-08	TCGA-50-5941-10A-01D-1753-08	GTT	GTT	-	-	GTT	GTT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	86ef12c0-d5fc-4852-9960-593366e717b4	9054c3ce-7029-46bc-933e-18046c1bba73	g.chr8:110445422_110445424delGTT	ENST00000378402.5	+	28	3421_3423	c.3317_3319delGTT	c.(3316-3321)ggttgt>ggt	p.C1107del		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1107	IPT/TIG 4.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GGACCAGTAGGTTGTTCTCTTCT	0.369										HNSCC(38;0.096)																													uc003yne.2		NA																	0				ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(3316-3321)GGTTGT>GGT		fibrocystin L precursor																																				SO:0001651	inframe_deletion	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110445422_110445424delGTT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.3317_3319delGTT	8.37:g.110445425_110445427delGTT	ENSP00000367655:p.Cys1107del	HNSCC(38;0.096)					p.C1107del	NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		28	3421_3423	+			1107			Extracellular (Potential).|IPT/TIG 4.		Q567P2|Q9UF27	In_Frame_Del	DEL	ENST00000378402.5	37	c.3317_3319delGTT	CCDS47911.1																																																																																				0.369	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		22	417	NA	NA	NA	NA	NA	22	417	---	---	---	---
