#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
TNFRSF8	943	broad.mit.edu	37	1	12170177	12170177	+	Missense_Mutation	SNP	A	A	C			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr1:12170177A>C	ENST00000263932.2	+	6	814	c.592A>C	c.(592-594)Acc>Ccc	p.T198P	TNFRSF8_ENST00000417814.2_Missense_Mutation_p.T87P	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	198					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	AAGAGGGGGCACCCGCCTCGC	0.617																																							uc001atq.2		NA																	0				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5						c.(592-594)ACC>CCC		tumor necrosis factor receptor superfamily,							50.0	48.0	49.0					1																	12170177		2203	4300	6503	SO:0001583	missense	943				cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane		g.chr1:12170177A>C	M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.592A>C	1.37:g.12170177A>C	ENSP00000263932:p.Thr198Pro					TNFRSF8_uc010obc.1_Missense_Mutation_p.T87P	p.T198P	NM_001243	NP_001234	P28908	TNR8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	6	814	+	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	198			Extracellular (Potential).		B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	ENST00000263932.2	37	c.592A>C	CCDS144.1	.	.	.	.	.	.	.	.	.	.	.	9.449	1.090127	0.20390	.	.	ENSG00000120949	ENST00000263932;ENST00000417814	T;T	0.07114	3.22;3.22	3.76	-6.84	0.01687	.	.	.	.	.	T	0.03959	0.0111	N	0.14661	0.345	0.09310	N	1	B;B	0.12630	0.006;0.003	B;B	0.12837	0.008;0.002	T	0.45011	-0.9290	9	0.22706	T	0.39	-1.904	8.8135	0.34983	0.2837:0.153:0.5633:0.0	.	87;198	D3YTD8;P28908	.;TNR8_HUMAN	P	198;87	ENSP00000263932:T198P;ENSP00000390650:T87P	ENSP00000263932:T198P	T	+	1	0	TNFRSF8	12092764	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.401000	0.07232	-1.506000	0.01805	-1.039000	0.02377	ACC		0.617	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005130.1			6	57	0	0	0	0.007413	0	6	57				
FAM46B	115572	broad.mit.edu	37	1	27332767	27332767	+	Silent	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr1:27332767G>A	ENST00000289166.5	-	2	1111	c.946C>T	c.(946-948)Ctg>Ttg	p.L316L		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	316								p.L315L(1)		breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		TGCTCCACCAGGTCTGGAAAG	0.687																																							uc010ofj.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(946-948)CTG>TTG		hypothetical protein LOC115572							20.0	23.0	22.0					1																	27332767		2198	4297	6495	SO:0001819	synonymous_variant	115572							g.chr1:27332767G>A	AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.946C>T	1.37:g.27332767G>A							p.L316L	NM_052943	NP_443175	Q96A09	FA46B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)	2	1118	-		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)	316						Silent	SNP	ENST00000289166.5	37	c.946C>T	CCDS294.2																																																																																				0.687	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012347.2	NM_052943		3	32	0	0	0	0.004672	0	3	32				
NASP	4678	broad.mit.edu	37	1	46083204	46083204	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr1:46083204G>A	ENST00000350030.3	+	14	2314	c.2227G>A	c.(2227-2229)Gga>Aga	p.G743R	NASP_ENST00000372052.4_Missense_Mutation_p.G377R|NASP_ENST00000530073.1_3'UTR|NASP_ENST00000402363.3_Missense_Mutation_p.G745R|NASP_ENST00000351223.3_Missense_Mutation_p.G404R|NASP_ENST00000537798.1_Missense_Mutation_p.G679R	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	743					blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)	p.G745R(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					GGAGGTGAACGGAGGCAGTGG	0.493																																							uc001coi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2227-2229)GGA>AGA		nuclear autoantigenic sperm protein isoform 2							105.0	86.0	93.0					1																	46083204		2203	4300	6503	SO:0001583	missense	4678				blastocyst development|cell cycle|cell proliferation|DNA replication|histone exchange|protein transport	cytoplasm|nucleus	Hsp90 protein binding	g.chr1:46083204G>A	M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.2227G>A	1.37:g.46083204G>A	ENSP00000255120:p.Gly743Arg					NASP_uc001coh.1_Missense_Mutation_p.G745R|NASP_uc001coj.1_Missense_Mutation_p.G404R|NASP_uc010olr.1_Missense_Mutation_p.G679R|NASP_uc001col.1_Missense_Mutation_p.G251R	p.G743R	NM_002482	NP_002473	P49321	NASP_HUMAN			14	2329	+	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)		743					A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Missense_Mutation	SNP	ENST00000350030.3	37	c.2227G>A	CCDS524.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002853	0.74932	.	.	ENSG00000132780	ENST00000537798;ENST00000402363;ENST00000341288;ENST00000350030;ENST00000372052;ENST00000351223	T;T;T;T;T	0.62364	0.31;0.09;0.03;0.51;0.48	4.56	3.63	0.41609	.	0.242902	0.40064	N	0.001182	T	0.74207	0.3686	L	0.53249	1.67	0.43275	D	0.995232	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.997;0.999	T	0.77517	-0.2558	10	0.87932	D	0	-16.6973	14.3637	0.66789	0.0:0.0:0.8509:0.1491	.	679;404;743;745	F5H3J2;Q5T626;P49321;P49321-3	.;.;NASP_HUMAN;.	R	679;745;643;743;377;404	ENSP00000438871:G679R;ENSP00000384529:G745R;ENSP00000255120:G743R;ENSP00000361122:G377R;ENSP00000255121:G404R	ENSP00000345532:G643R	G	+	1	0	NASP	45855791	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.403000	0.59729	1.248000	0.43934	0.563000	0.77884	GGA		0.493	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021533.2	NM_002482		3	57	0	0	0	0.004672	0	3	57				
PDE4DIP	9659	broad.mit.edu	37	1	144874795	144874795	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr1:144874795G>A	ENST00000369354.3	-	30	5002	c.4813C>T	c.(4813-4815)Cgc>Tgc	p.R1605C	RP4-791M13.5_ENST00000531288.1_RNA|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.R1605C|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.R1561C|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.R1741C|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.R1741C|AL138796.1_ENST00000582173.1_RNA|PDE4DIP_ENST00000524974.1_5'UTR			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1605	NBPF. {ECO:0000255|PROSITE- ProRule:PRU00647}.				cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.R1605C(2)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTGGGAGAGCGGTGGGAGTCA	0.547			T	PDGFRB	MPD																																		uc001elw.3		NA		Dom	yes		1	1q12	9659	T	phosphodiesterase 4D interacting protein (myomegalin)			L	PDGFRB		MPD		2	Substitution - Missense(2)		lung(2)	ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5						c.(4813-4815)CGC>TGC		phosphodiesterase 4D interacting protein isoform							225.0	211.0	216.0					1																	144874795		2203	4296	6499	SO:0001583	missense	9659				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding	g.chr1:144874795G>A	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.4813C>T	1.37:g.144874795G>A	ENSP00000358360:p.Arg1605Cys					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.R1561C|PDE4DIP_uc001elv.3_Missense_Mutation_p.R612C	p.R1605C	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN		Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)	30	5104	-			1605			NBPF.		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	c.4813C>T	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.931035	0.73327	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.01804	4.63;4.75;4.75;4.76;4.75	5.78	3.91	0.45181	DUF1220 (2);	.	.	.	.	T	0.03434	0.0099	L	0.56769	1.78	0.80722	D	1	B;D	0.89917	0.004;1.0	B;D	0.91635	0.001;0.999	T	0.36792	-0.9733	9	0.87932	D	0	.	9.4144	0.38512	0.0754:0.0:0.7816:0.1429	.	1561;1605	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	C	1561;1605;1605;1741;1741	ENSP00000327209:R1561C;ENSP00000358360:R1605C;ENSP00000358363:R1605C;ENSP00000435654:R1741C;ENSP00000358366:R1741C	ENSP00000327209:R1561C	R	-	1	0	PDE4DIP	143586152	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	3.863000	0.56016	0.797000	0.33971	-0.234000	0.12200	CGC		0.547	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359		66	252	0	0	0	0.00361	0	66	252				
SPTA1	6708	broad.mit.edu	37	1	158631093	158631093	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr1:158631093G>T	ENST00000368147.4	-	18	2751	c.2571C>A	c.(2569-2571)aaC>aaA	p.N857K		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	857					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.N857K(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTACCATTTTGTTTCCCCTTT	0.433																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(2569-2571)AAC>AAA		spectrin, alpha, erythrocytic 1							281.0	280.0	280.0					1																	158631093		1950	4140	6090	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158631093G>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2571C>A	1.37:g.158631093G>T	ENSP00000357129:p.Asn857Lys						p.N857K	NM_003126	NP_003117	P02549	SPTA1_HUMAN			18	2770	-	all_hematologic(112;0.0378)		857			Spectrin 9.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.2571C>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	10.42	1.344307	0.24339	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.34072	1.38;1.38	4.81	1.94	0.25998	.	.	.	.	.	T	0.10294	0.0252	L	0.40543	1.245	0.36907	D	0.890721	B	0.12630	0.006	B	0.23018	0.043	T	0.09930	-1.0652	9	0.23891	T	0.37	.	3.5111	0.07708	0.2764:0.0:0.5456:0.1779	.	857	P02549	SPTA1_HUMAN	K	857	ENSP00000357130:N857K;ENSP00000357129:N857K	ENSP00000357129:N857K	N	-	3	2	SPTA1	156897717	0.993000	0.37304	0.998000	0.56505	0.756000	0.42949	0.185000	0.16958	0.248000	0.21435	-0.158000	0.13435	AAC		0.433	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		83	131	1	0	1.59627e-33	0.00361	2.216e-33	83	131				
CACNA1E	777	broad.mit.edu	37	1	181708389	181708389	+	Splice_Site	SNP	C	C	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr1:181708389C>A	ENST00000367573.2	+	25	3719	c.3719C>A	c.(3718-3720)gCg>gAg	p.A1240E	CACNA1E_ENST00000360108.3_Splice_Site_p.A1221E|CACNA1E_ENST00000357570.5_Splice_Site_p.A1191D|CACNA1E_ENST00000358338.5_Splice_Site_p.A1172D|CACNA1E_ENST00000526775.1_Splice_Site_p.A1221E|CACNA1E_ENST00000367567.4_Splice_Site_p.A847E|CACNA1E_ENST00000367570.1_Splice_Site_p.A1240E	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1240					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.A1240E(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TTTGCTCTGGCGTAAGTGACT	0.507																																							uc001gow.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(3718-3720)GCG>GAG		calcium channel, voltage-dependent, R type,							333.0	339.0	337.0					1																	181708389		2116	4234	6350	SO:0001630	splice_region_variant	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181708389C>A	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.3719+1C>A	1.37:g.181708389C>A						CACNA1E_uc009wxs.2_Missense_Mutation_p.A1128E|CACNA1E_uc001gox.1_Missense_Mutation_p.A466E|CACNA1E_uc009wxt.2_Missense_Mutation_p.A466E	p.A1240E	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			25	3884	+			1240			III.|Helical; Name=S3 of repeat III.		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.3719C>A	CCDS55664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.4|21.4	4.143895|4.143895	0.77888|0.77888	.|.	.|.	ENSG00000198216|ENSG00000198216	ENST00000357570;ENST00000358338|ENST00000367570;ENST00000526775;ENST00000367567;ENST00000360108;ENST00000367573	D;D|D;D;D;D;D	0.98362|0.98419	-4.89;-4.89|-4.92;-4.92;-4.92;-4.92;-4.92	5.01|5.01	5.01|5.01	0.66863|0.66863	.|Ion transport (1);	0.194695|0.194695	0.35407|0.35407	N|N	0.003235|0.003235	D|D	0.97682|0.97682	0.9240|0.9240	N|N	0.16708|0.16708	0.43|0.43	0.80722|0.80722	D|D	1|1	.|P;D;D	.|0.71674	.|0.677;0.988;0.998	.|P;D;D	.|0.79108	.|0.557;0.944;0.992	D|D	0.99886|0.99886	1.1123|1.1123	8|10	0.28530|0.72032	T|D	0.3|0.01	.|.	18.2808|18.2808	0.90097|0.90097	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1221;1240;1240	.|Q15878-2;Q15878;Q15878-3	.|.;CAC1E_HUMAN;.	D|E	1191;1172|1240;1221;847;1221;1240	ENSP00000350183:A1191D;ENSP00000351101:A1172D|ENSP00000356542:A1240E;ENSP00000434814:A1221E;ENSP00000356539:A847E;ENSP00000353222:A1221E;ENSP00000356545:A1240E	ENSP00000350183:A1191D|ENSP00000353222:A1221E	A|A	+|+	2|2	0|0	CACNA1E|CACNA1E	179975012|179975012	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	7.669000|7.669000	0.83911|0.83911	2.475000|2.475000	0.83589|0.83589	0.561000|0.561000	0.74099|0.74099	GCT|GCG		0.507	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	Missense_Mutation	5	162	1	0	4.096e-09	0.001168	5.55549e-09	5	162				
HMCN1	83872	broad.mit.edu	37	1	186057109	186057109	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr1:186057109G>T	ENST00000271588.4	+	61	9638	c.9409G>T	c.(9409-9411)Gga>Tga	p.G3137*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.G3137*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3137	Ig-like C2-type 29.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.G3137*(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AAATGTAGCAGGACGGGATGA	0.353																																							uc001grq.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(22)|skin(1)	23						c.(9409-9411)GGA>TGA		hemicentin 1 precursor							138.0	142.0	141.0					1																	186057109		2203	4300	6503	SO:0001587	stop_gained	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186057109G>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.9409G>T	1.37:g.186057109G>T	ENSP00000271588:p.Gly3137*						p.G3137*	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN			61	9638	+			3137			Ig-like C2-type 29.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	ENST00000271588.4	37	c.9409G>T	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	52	19.586316	0.99921	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.7939	0.96471	0.0:0.0:1.0:0.0	.	.	.	.	X	3137	.	ENSP00000271588:G3137X	G	+	1	0	HMCN1	184323732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.750000	0.98875	2.668000	0.90789	0.563000	0.77884	GGA		0.353	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		7	80	1	0	8.12818e-05	0.001984	0.00010657	7	80				
TPR	7175	broad.mit.edu	37	1	186324846	186324846	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr1:186324846G>A	ENST00000367478.4	-	16	2239	c.1943C>T	c.(1942-1944)tCa>tTa	p.S648L	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	648					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)	p.S648L(1)|p.S649L(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AACAGTCTGTGATGTACTTGG	0.408			T	NTRK1	papillary thyroid																																		uc001grv.2		NA		Dom	yes		1	1q25	7175	T	translocated promoter region			E	NTRK1		papillary thyroid		2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7						c.(1942-1944)TCA>TTA		nuclear pore complex-associated protein TPR							136.0	133.0	134.0					1																	186324846		1928	4138	6066	SO:0001583	missense	7175				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity	g.chr1:186324846G>A	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.1943C>T	1.37:g.186324846G>A	ENSP00000356448:p.Ser648Leu						p.S648L	NM_003292	NP_003283	P12270	TPR_HUMAN		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)	16	2240	-		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)	648					Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	c.1943C>T	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648490	0.47258	.	.	ENSG00000047410	ENST00000367478	T	0.17528	2.27	5.04	4.12	0.48240	.	0.638783	0.15882	N	0.239989	T	0.11495	0.0280	N	0.14661	0.345	0.31683	N	0.642883	B	0.09022	0.002	B	0.06405	0.002	T	0.06285	-1.0835	10	0.34782	T	0.22	.	13.8399	0.63432	0.0745:0.0:0.9255:0.0	.	648	P12270	TPR_HUMAN	L	648	ENSP00000356448:S648L	ENSP00000356448:S648L	S	-	2	0	TPR	184591469	1.000000	0.71417	0.990000	0.47175	0.898000	0.52572	4.649000	0.61433	1.257000	0.44085	0.591000	0.81541	TCA		0.408	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292		30	70	0	0	0	0.008361	0	30	70				
USH2A	7399	broad.mit.edu	37	1	215963477	215963477	+	Missense_Mutation	SNP	T	T	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr1:215963477T>A	ENST00000307340.3	-	51	10492	c.10106A>T	c.(10105-10107)aAa>aTa	p.K3369I	USH2A_ENST00000366943.2_Missense_Mutation_p.K3369I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3369					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.K3369I(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATTACAGCATTTCTGGCTCTT	0.393										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(10105-10107)AAA>ATA		usherin isoform B							126.0	122.0	123.0					1																	215963477		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215963477T>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.10106A>T	1.37:g.215963477T>A	ENSP00000305941:p.Lys3369Ile	HNSCC(13;0.011)					p.K3369I	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	51	10493	-			3369			Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.10106A>T	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.629701	0.46944	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.13778	2.56;2.56	5.76	-4.11	0.03928	Fibronectin, type III (2);	0.892412	0.09372	N	0.811167	T	0.11281	0.0275	L	0.44542	1.39	0.22796	N	0.998728	P	0.34780	0.468	B	0.36030	0.216	T	0.21042	-1.0257	10	0.46703	T	0.11	.	8.0233	0.30423	0.0:0.3577:0.1069:0.5353	.	3369	O75445	USH2A_HUMAN	I	3369	ENSP00000305941:K3369I;ENSP00000355910:K3369I	ENSP00000305941:K3369I	K	-	2	0	USH2A	214030100	0.920000	0.31207	0.017000	0.16124	0.995000	0.86356	1.074000	0.30703	-1.133000	0.02903	-0.256000	0.11100	AAA		0.393	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		18	71	0	0	0	0.001882	0	18	71				
USH2A	7399	broad.mit.edu	37	1	215963479	215963479	+	Silent	SNP	C	C	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr1:215963479C>T	ENST00000307340.3	-	51	10490	c.10104G>A	c.(10102-10104)caG>caA	p.Q3368Q	USH2A_ENST00000366943.2_Silent_p.Q3368Q	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3368					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.Q3368Q(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TACAGCATTTCTGGCTCTTTG	0.388										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(10102-10104)CAG>CAA		usherin isoform B							126.0	122.0	123.0					1																	215963479		2203	4300	6503	SO:0001819	synonymous_variant	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215963479C>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.10104G>A	1.37:g.215963479C>T		HNSCC(13;0.011)					p.Q3368Q	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	51	10491	-			3368			Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	c.10104G>A	CCDS31025.1																																																																																				0.388	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		20	70	0	0	0	0.00278	0	20	70				
TTC13	79573	broad.mit.edu	37	1	231064840	231064840	+	Splice_Site	SNP	C	C	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr1:231064840C>T	ENST00000366661.4	-	12	1308		c.e12-1		TTC13_ENST00000414259.1_Splice_Site|TTC13_ENST00000366662.4_Splice_Site	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13									p.?(1)		central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		CGAGAATACTCTGCAGAAAGG	0.398																																							uc001huf.3		NA																	1	Unknown(1)		lung(1)	ovary(1)|skin(1)	2						c.e12-1		tetratricopeptide repeat domain 13 isoform a							86.0	86.0	86.0					1																	231064840		2203	4300	6503	SO:0001630	splice_region_variant	79573						binding	g.chr1:231064840C>T		CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.1301-1G>A	1.37:g.231064840C>T						TTC13_uc009xfi.2_Splice_Site_p.E381_splice|TTC13_uc009xfj.2_Splice_Site|TTC13_uc001hug.3_Splice_Site_p.E381_splice|TTC13_uc009xfk.1_Splice_Site_p.E324_splice	p.E434_splice	NM_024525	NP_078801	Q8NBP0	TTC13_HUMAN		COAD - Colon adenocarcinoma(196;0.243)	12	1332	-	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)						B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Splice_Site	SNP	ENST00000366661.4	37	c.1301_splice	CCDS1588.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.992342	0.74703	.	.	ENSG00000143643	ENST00000366661;ENST00000366662;ENST00000414259	.	.	.	5.74	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8784	0.86058	0.0:0.8718:0.1282:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TTC13	229131463	1.000000	0.71417	0.997000	0.53966	0.810000	0.45777	7.814000	0.86154	1.401000	0.46761	0.557000	0.71058	.		0.398	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092229.2	NM_024525	Intron	27	46	0	0	0	0.007291	0	27	46				
OR51A7	119687	broad.mit.edu	37	11	4929375	4929375	+	Missense_Mutation	SNP	C	C	G			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr11:4929375C>G	ENST00000359350.4	+	1	776	c.776C>G	c.(775-777)gCc>gGc	p.A259G	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A259G(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACCCTGGCTGCCATGCATCAC	0.493																																							uc010qyq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(775-777)GCC>GGC		olfactory receptor, family 51, subfamily A,							222.0	214.0	216.0					11																	4929375		2201	4298	6499	SO:0001583	missense	119687				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4929375C>G	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.776C>G	11.37:g.4929375C>G	ENSP00000352305:p.Ala259Gly						p.A259G	NM_001004749	NP_001004749	Q8NH64	O51A7_HUMAN		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	776	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	259			Extracellular (Potential).		Q6IFH8	Missense_Mutation	SNP	ENST00000359350.4	37	c.776C>G	CCDS31364.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.790985	0.50102	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.37752	1.18	5.02	3.12	0.35913	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000244	T	0.31949	0.0813	L	0.39514	1.22	0.09310	N	1	P	0.37276	0.589	B	0.43018	0.405	T	0.19321	-1.0309	10	0.87932	D	0	.	6.7571	0.23520	0.0:0.6669:0.0:0.3331	.	259	Q8NH64	O51A7_HUMAN	G	259;259;248	ENSP00000352305:A259G	ENSP00000352305:A259G	A	+	2	0	OR51A7	4885951	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	-0.211000	0.09332	1.340000	0.45581	0.655000	0.94253	GCC		0.493	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749		79	221	0	0	0	0.00361	0	79	221				
ACP2	53	broad.mit.edu	37	11	47261720	47261720	+	Nonsense_Mutation	SNP	G	G	A	rs376131793		TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr11:47261720G>A	ENST00000256997.3	-	11	1335	c.1219C>T	c.(1219-1221)Cag>Tag	p.Q407*	ACP2_ENST00000525230.1_5'UTR|ACP2_ENST00000537863.1_Nonsense_Mutation_p.Q220*|ACP2_ENST00000529444.1_Nonsense_Mutation_p.Q344*|ACP2_ENST00000533929.1_Nonsense_Mutation_p.Q379*|ACP2_ENST00000527256.1_Nonsense_Mutation_p.Q375*	NM_001610.2	NP_001601.1	P11117	PPAL_HUMAN	acid phosphatase 2, lysosomal	407					dephosphorylation (GO:0016311)|lysosome organization (GO:0007040)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)	acid phosphatase activity (GO:0003993)	p.Q407*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10						GGCTGGGCCTGCATCCGGAAG	0.642																																					Melanoma(90;262 1440 11488 44828 48531)	Melanoma(90;262 1440 11488 44828 48531)	uc001nei.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1219-1221)CAG>TAG		acid phosphatase 2, lysosomal isoform 1							96.0	70.0	79.0					11																	47261720		2201	4298	6499	SO:0001587	stop_gained	53					integral to membrane|lysosomal lumen|lysosomal membrane	acid phosphatase activity	g.chr11:47261720G>A	X15525	CCDS7928.1, CCDS44583.1	11p11.2	2008-02-05			ENSG00000134575	ENSG00000134575	3.1.3.2		123	protein-coding gene	gene with protein product		171650				975882	Standard	NM_001610		Approved		uc001nei.3	P11117	OTTHUMG00000166949	ENST00000256997.3:c.1219C>T	11.37:g.47261720G>A	ENSP00000256997:p.Gln407*					ACP2_uc010rhe.1_Nonsense_Mutation_p.Q379*|ACP2_uc009ylj.2_Nonsense_Mutation_p.Q335*|ACP2_uc010rhf.1_Nonsense_Mutation_p.Q375*|ACP2_uc010rhg.1_Nonsense_Mutation_p.Q344*|ACP2_uc010rhh.1_Nonsense_Mutation_p.Q220*	p.Q407*	NM_001610	NP_001601	P11117	PPAL_HUMAN			11	1336	-			407			Cytoplasmic (Potential).		E9PCI1|Q561W5|Q9BTU7	Nonsense_Mutation	SNP	ENST00000256997.3	37	c.1219C>T	CCDS7928.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.966974	0.92855	.	.	ENSG00000134575	ENST00000256997;ENST00000529444;ENST00000527256;ENST00000537863;ENST00000540414;ENST00000533929	.	.	.	5.75	5.75	0.90469	.	0.382752	0.32204	N	0.006438	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	13.9043	0.63823	0.0:0.0:0.8482:0.1518	.	.	.	.	X	407;344;375;220;397;379	.	ENSP00000256997:Q407X	Q	-	1	0	ACP2	47218296	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.846000	0.55888	2.720000	0.93068	0.655000	0.94253	CAG		0.642	ACP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392022.2	NM_001610		29	55	0	0	0	0.005443	0	29	55				
SF1	7536	broad.mit.edu	37	11	64533557	64533557	+	Silent	SNP	G	G	C	rs368437614		TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr11:64533557G>C	ENST00000377390.3	-	13	1990	c.1653C>G	c.(1651-1653)gcC>gcG	p.A551A	SF1_ENST00000334944.5_Silent_p.A551A|SF1_ENST00000227503.9_Intron|SF1_ENST00000433274.2_Silent_p.A525A|SF1_ENST00000422298.2_Intron|SF1_ENST00000489544.1_5'Flank|SF1_ENST00000377394.3_Intron|SF1_ENST00000377387.1_Intron	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	551	Pro-rich.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A551A(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						GAGAAGCTGCGGCAGCCGCCT	0.682																																							uc001obb.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(1651-1653)GCC>GCG		splicing factor 1 isoform 1							24.0	33.0	30.0					11																	64533557		2145	4262	6407	SO:0001819	synonymous_variant	7536				nuclear mRNA 3'-splice site recognition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ribosome|spliceosomal complex	protein binding|RNA binding|transcription corepressor activity|zinc ion binding	g.chr11:64533557G>C	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.1653C>G	11.37:g.64533557G>C						SF1_uc010rnm.1_Intron|SF1_uc010rnn.1_Silent_p.A525A|SF1_uc001oaz.1_Intron|SF1_uc001oba.1_Silent_p.A551A|SF1_uc001obc.1_Intron|SF1_uc001obd.1_Intron|SF1_uc001obe.1_Intron|SF1_uc010rno.1_Intron	p.A551A	NM_004630	NP_004621	Q15637	SF01_HUMAN			13	2030	-			551			Pro-rich.		B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Silent	SNP	ENST00000377390.3	37	c.1653C>G	CCDS31599.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.72|10.72	1.428790|1.428790	0.25726|0.25726	.|.	.|.	ENSG00000168066|ENSG00000168066	ENST00000413725|ENST00000486867	.|T	.|0.54279	.|0.58	5.24|5.24	4.31|4.31	0.51392|0.51392	.|.	.|.	.|.	.|.	.|.	T|T	0.59059|0.59059	0.2166|0.2166	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.61491|0.61491	-0.7052|-0.7052	4|6	.|0.87932	.|D	.|0	.|.	6.7168|6.7168	0.23308|0.23308	0.0899:0.0:0.7315:0.1786|0.0899:0.0:0.7315:0.1786	.|.	.|.	.|.	.|.	R|G	121|271	.|ENSP00000419062:R271G	.|ENSP00000419062:R271G	P|R	-|-	2|1	0|0	SF1|SF1	64290133|64290133	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.462000|0.462000	0.21956|0.21956	1.190000|1.190000	0.43042|0.43042	-0.314000|-0.314000	0.08810|0.08810	CCG|CGC		0.682	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143242.1	NM_004630		15	30	0	0	0	0.00499	0	15	30				
PPFIA1	8500	broad.mit.edu	37	11	70172763	70172763	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr11:70172763G>A	ENST00000253925.7	+	7	984	c.769G>A	c.(769-771)Gaa>Aaa	p.E257K	CTA-797E19.2_ENST00000526017.1_RNA|AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Missense_Mutation_p.E257K	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	257					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)	p.E257K(1)		breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TGAGCTCCAAGAAATCATAAG	0.438																																							uc001opo.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(769-771)GAA>AAA		PTPRF interacting protein alpha 1 isoform b							193.0	204.0	200.0					11																	70172763		2200	4294	6494	SO:0001583	missense	8500				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity	g.chr11:70172763G>A	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.769G>A	11.37:g.70172763G>A	ENSP00000253925:p.Glu257Lys					PPFIA1_uc001opn.1_Missense_Mutation_p.E257K|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	p.E257K	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)		7	967	+			257			Potential.		A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	c.769G>A	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935102	0.73442	.	.	ENSG00000131626	ENST00000253925;ENST00000389547	T;T	0.50001	0.76;0.76	4.67	4.67	0.58626	.	0.207799	0.37955	U	0.001868	T	0.58293	0.2112	M	0.84511	2.7	0.47737	D	0.999507	B;P	0.35628	0.259;0.513	B;B	0.40741	0.236;0.339	T	0.66143	-0.5997	10	0.62326	D	0.03	.	14.473	0.67529	0.0:0.1477:0.8523:0.0	.	257;257	Q13136;Q13136-2	LIPA1_HUMAN;.	K	257	ENSP00000253925:E257K;ENSP00000374198:E257K	ENSP00000253925:E257K	E	+	1	0	PPFIA1	69850411	1.000000	0.71417	0.949000	0.38748	0.944000	0.59088	7.807000	0.86032	2.309000	0.77851	0.655000	0.94253	GAA		0.438	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626		103	259	0	0	0	0.00361	0	103	259				
C11orf1	64776	broad.mit.edu	37	11	111753869	111753869	+	Missense_Mutation	SNP	T	T	G			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr11:111753869T>G	ENST00000260276.3	+	3	623	c.286T>G	c.(286-288)Tac>Gac	p.Y96D	C11orf1_ENST00000528125.1_Missense_Mutation_p.Y50D|C11orf1_ENST00000529270.1_Missense_Mutation_p.Y136D|C11orf1_ENST00000530214.1_Intron	NM_022761.2	NP_073598.1	Q9H5F2	CK001_HUMAN	chromosome 11 open reading frame 1	96						nucleus (GO:0005634)		p.Y96D(1)		kidney(2)|lung(3)	5		all_cancers(61;1.26e-15)|all_epithelial(67;9.52e-10)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|Medulloblastoma(222;0.0228)|all_neural(223;0.0281)		all cancers(92;6.28e-09)|Epithelial(105;4.11e-08)|OV - Ovarian serous cystadenocarcinoma(223;1.52e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)		GTTTGGACACTACTTTGAAAC	0.333																																							uc001pmd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(286-288)TAC>GAC		hypothetical protein LOC64776							102.0	89.0	94.0					11																	111753869		2195	4293	6488	SO:0001583	missense	64776					nucleus		g.chr11:111753869T>G	AJ250229	CCDS8350.1	11q23.1	2012-05-30			ENSG00000137720	ENSG00000137720			1163	protein-coding gene	gene with protein product						10873569	Standard	NM_022761		Approved	FLJ23499	uc001pmd.3	Q9H5F2	OTTHUMG00000166884	ENST00000260276.3:c.286T>G	11.37:g.111753869T>G	ENSP00000260276:p.Tyr96Asp					C11orf1_uc001pme.2_Missense_Mutation_p.Y136D	p.Y96D	NM_022761	NP_073598	Q9H5F2	CK001_HUMAN		all cancers(92;6.28e-09)|Epithelial(105;4.11e-08)|OV - Ovarian serous cystadenocarcinoma(223;1.52e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)	3	623	+		all_cancers(61;1.26e-15)|all_epithelial(67;9.52e-10)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|Medulloblastoma(222;0.0228)|all_neural(223;0.0281)	96					Q6I9X7|Q9NQC6	Missense_Mutation	SNP	ENST00000260276.3	37	c.286T>G	CCDS8350.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.127476	0.56721	.	.	ENSG00000137720	ENST00000528125;ENST00000260276;ENST00000530799;ENST00000529270	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	5.23	4.08	0.47627	.	0.407810	0.22949	N	0.053696	T	0.36635	0.0974	M	0.63843	1.955	0.27507	N	0.951815	P;P	0.48589	0.912;0.884	P;P	0.52598	0.703;0.625	T	0.14839	-1.0458	10	0.44086	T	0.13	-6.4923	10.2424	0.43321	0.0:0.0:0.1658:0.8342	.	136;96	E9PMC1;Q9H5F2	.;CK001_HUMAN	D	50;96;112;136	ENSP00000433224:Y50D;ENSP00000260276:Y96D;ENSP00000432128:Y112D;ENSP00000431180:Y136D	ENSP00000260276:Y96D	Y	+	1	0	C11orf1	111259079	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	2.640000	0.46579	0.962000	0.38057	0.528000	0.53228	TAC		0.333	C11orf1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391650.1	NM_022761		3	15	0	0	0	0.004672	0	3	15				
NXPE1	120400	broad.mit.edu	37	11	114393191	114393191	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr11:114393191G>C	ENST00000424269.1	-	5	1142	c.1143C>G	c.(1141-1143)atC>atG	p.I381M	NXPE1_ENST00000251921.2_Missense_Mutation_p.I239M|NXPE1_ENST00000536271.1_Missense_Mutation_p.I97M			Q8N323	NXPE1_HUMAN	neurexophilin and PC-esterase domain family, member 1	381						extracellular region (GO:0005576)		p.I239M(1)									GTTTCTTAAAGATTCCAGTTT	0.323																																							uc001ppa.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(715-717)ATC>ATG		hypothetical protein LOC120400							74.0	78.0	77.0					11																	114393191		2200	4296	6496	SO:0001583	missense	120400					extracellular region		g.chr11:114393191G>C	BC029049	CCDS8372.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000095110	ENSG00000095110			28527	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member A"""	FAM55A		12477932	Standard	NM_152315		Approved	MGC34290	uc001ppa.3	Q8N323	OTTHUMG00000168284	ENST00000424269.1:c.1143C>G	11.37:g.114393191G>C	ENSP00000411690:p.Ile381Met					FAM55A_uc010rxd.1_Missense_Mutation_p.I88M	p.I239M	NM_152315	NP_689528	Q8N323	FA55A_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.02e-06)|Epithelial(105;0.000144)|all cancers(92;0.00106)	6	1134	-		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)	381					B0YJ13	Missense_Mutation	SNP	ENST00000424269.1	37	c.717C>G		.	.	.	.	.	.	.	.	.	.	G	0.186	-1.057972	0.01965	.	.	ENSG00000095110	ENST00000536271;ENST00000251921;ENST00000424269	T;T;T	0.16743	2.32;2.32;2.32	3.79	-7.57	0.01318	.	5.566490	0.00465	N	0.000115	T	0.09024	0.0223	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.16722	0.016	T	0.17289	-1.0374	10	0.45353	T	0.12	.	1.2802	0.02039	0.1528:0.3286:0.1689:0.3498	.	381	Q8N323	FA55A_HUMAN	M	97;239;381	ENSP00000445200:I97M;ENSP00000251921:I239M;ENSP00000411690:I381M	ENSP00000251921:I239M	I	-	3	3	FAM55A	113898401	0.000000	0.05858	0.000000	0.03702	0.276000	0.26787	-1.707000	0.01893	-2.358000	0.00611	-1.324000	0.01287	ATC		0.323	NXPE1-201	KNOWN	basic	protein_coding	protein_coding		NM_152315		15	70	0	0	0	0.00245	0	15	70				
FAM90A1	55138	broad.mit.edu	37	12	8376143	8376143	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr12:8376143G>A	ENST00000538603.1	-	6	892	c.334C>T	c.(334-336)Ccg>Tcg	p.P112S	FAM90A1_ENST00000307435.6_Missense_Mutation_p.P112S	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	112							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.P112S(1)		endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		TTCCTCTGCGGGTCTTGTGGC	0.547																																							uc001qui.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(334-336)CCG>TCG		hypothetical protein LOC55138							34.0	32.0	33.0					12																	8376143		2201	4295	6496	SO:0001583	missense	55138						nucleic acid binding|zinc ion binding	g.chr12:8376143G>A	AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.334C>T	12.37:g.8376143G>A	ENSP00000445418:p.Pro112Ser					FAM90A1_uc001quh.2_Missense_Mutation_p.P112S	p.P112S	NM_018088	NP_060558	Q86YD7	F90A1_HUMAN		Kidney(36;0.0866)	6	893	-			112					D3DUU9|Q9NVZ6	Missense_Mutation	SNP	ENST00000538603.1	37	c.334C>T	CCDS31738.1	.	.	.	.	.	.	.	.	.	.	.	0.480	-0.880445	0.02530	.	.	ENSG00000171847	ENST00000307435;ENST00000538603	T;T	0.11712	2.75;2.75	1.06	-2.12	0.07165	.	.	.	.	.	T	0.03871	0.0109	N	0.08118	0	0.09310	N	1	B	0.30973	0.302	B	0.24394	0.053	T	0.36065	-0.9763	9	0.38643	T	0.18	-4.2378	2.8523	0.05561	0.0:0.2952:0.4092:0.2956	.	112	Q86YD7	F90A1_HUMAN	S	112	ENSP00000307798:P112S;ENSP00000445418:P112S	ENSP00000307798:P112S	P	-	1	0	FAM90A1	8267410	0.010000	0.17322	0.000000	0.03702	0.113000	0.19764	0.304000	0.19228	-0.939000	0.03709	0.205000	0.17691	CCG		0.547	FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400468.1	NM_018088		14	46	0	0	0	0.00499	0	14	46				
SP7	121340	broad.mit.edu	37	12	53723126	53723126	+	Missense_Mutation	SNP	G	G	A	rs544873629		TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr12:53723126G>A	ENST00000536324.2	-	3	383	c.100C>T	c.(100-102)Cgg>Tgg	p.R34W	SP7_ENST00000537210.2_Missense_Mutation_p.R16W|SP7_ENST00000303846.3_Missense_Mutation_p.R34W	NM_001173467.1	NP_001166938.1	Q8TDD2	SP7_HUMAN	Sp7 transcription factor	34					hematopoietic stem cell differentiation (GO:0060218)|osteoblast differentiation (GO:0001649)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R34W(1)		cervix(2)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	14						GTTGAGTCCCGCAGAGGGCTA	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		19569	0.0		0.0	False		,,,				2504	0.001						uc001sct.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(100-102)CGG>TGG		osterix							95.0	98.0	97.0					12																	53723126		2112	4236	6348	SO:0001583	missense	121340				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr12:53723126G>A	AF477981	CCDS44897.1, CCDS73475.1	12q13.13	2013-01-08				ENSG00000170374		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	17321	protein-coding gene	gene with protein product		606633				11792318	Standard	NM_152860		Approved	osterix, OSX	uc001sct.3	Q8TDD2		ENST00000536324.2:c.100C>T	12.37:g.53723126G>A	ENSP00000443827:p.Arg34Trp					SP7_uc001scu.2_Missense_Mutation_p.R16W|SP7_uc001scv.2_Missense_Mutation_p.R34W	p.R34W	NM_152860	NP_690599	Q8TDD2	SP7_HUMAN			2	207	-			34					B3KY26|Q3MJ72|Q7Z718	Missense_Mutation	SNP	ENST00000536324.2	37	c.100C>T	CCDS44897.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.838582	0.51057	.	.	ENSG00000170374	ENST00000536324;ENST00000303846;ENST00000537210;ENST00000547755	T;T;T;T	0.46819	3.27;3.27;3.26;0.86	3.95	3.95	0.45737	.	0.125602	0.49916	D	0.000136	T	0.43545	0.1252	L	0.46157	1.445	0.45318	D	0.998317	D	0.61080	0.989	P	0.45428	0.48	T	0.47837	-0.9086	10	0.72032	D	0.01	.	11.1404	0.48400	0.0:0.0:0.8148:0.1852	.	34	Q8TDD2	SP7_HUMAN	W	34;34;16;16	ENSP00000443827:R34W;ENSP00000302812:R34W;ENSP00000441367:R16W;ENSP00000449355:R16W	ENSP00000302812:R34W	R	-	1	2	SP7	52009393	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	2.809000	0.47971	2.497000	0.84241	0.313000	0.20887	CGG		0.577	SP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406917.1			4	83	0	0	0	0.000248	0	4	83				
LRP1	4035	broad.mit.edu	37	12	57539234	57539234	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr12:57539234G>A	ENST00000243077.3	+	6	1268	c.802G>A	c.(802-804)Gtg>Atg	p.V268M	LRP1_ENST00000553277.1_Missense_Mutation_p.V268M|LRP1_ENST00000554174.1_Missense_Mutation_p.V268M|RP11-545N8.3_ENST00000554476.1_RNA|RP11-545N8.3_ENST00000555461.1_RNA|LRP1_ENST00000338962.4_Missense_Mutation_p.V268M	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	268					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.V268M(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AAAGGGCTTCGTGGATGAGCA	0.597																																							uc001snd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22						c.(802-804)GTG>ATG		low density lipoprotein-related protein 1	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						105.0	81.0	89.0					12																	57539234		2203	4300	6503	SO:0001583	missense	4035				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	g.chr12:57539234G>A	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.802G>A	12.37:g.57539234G>A	ENSP00000243077:p.Val268Met					LRP1_uc010sre.1_Missense_Mutation_p.V268M|LRP1_uc001snb.2_Missense_Mutation_p.V268M|LRP1_uc001snc.1_Missense_Mutation_p.V268M	p.V268M	NM_002332	NP_002323	Q07954	LRP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0103)	6	1268	+			268			Extracellular (Potential).		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	c.802G>A	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556685	0.65425	.	.	ENSG00000123384	ENST00000553277;ENST00000243077;ENST00000338962;ENST00000554174	D;D;D;D	0.94537	-3.45;-3.45;-3.45;-3.45	4.83	4.83	0.62350	Six-bladed beta-propeller, TolB-like (1);	0.170597	0.38837	N	0.001558	D	0.92358	0.7575	L	0.31476	0.935	0.33281	D	0.562266	D;P;B;D	0.67145	0.991;0.928;0.279;0.996	P;B;B;P	0.49502	0.613;0.288;0.023;0.613	D	0.94065	0.7330	10	0.46703	T	0.11	.	15.8256	0.78703	0.0:0.0:1.0:0.0	.	268;268;268;268	Q86SW0;Q07954;Q6PJ72;Q7Z7K9	.;LRP1_HUMAN;.;.	M	268	ENSP00000451449:V268M;ENSP00000243077:V268M;ENSP00000341264:V268M;ENSP00000451737:V268M	ENSP00000243077:V268M	V	+	1	0	LRP1	55825501	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.715000	0.61909	2.696000	0.92011	0.555000	0.69702	GTG		0.597	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		9	110	0	0	0	0.006214	0	9	110				
CPM	1368	broad.mit.edu	37	12	69260803	69260803	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr12:69260803G>C	ENST00000551568.1	-	7	873	c.813C>G	c.(811-813)atC>atG	p.I271M	CPM_ENST00000338356.3_Missense_Mutation_p.I271M|CPM_ENST00000546373.1_Missense_Mutation_p.I271M	NM_001005502.2|NM_198320.3	NP_001005502.1|NP_938079.1	P14384	CBPM_HUMAN	carboxypeptidase M	271					anatomical structure morphogenesis (GO:0009653)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.I271M(1)		large_intestine(1)|lung(6)|prostate(2)	9	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			ACTGGGCCCAGATGTAGTTGT	0.408																																							uc001sup.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(811-813)ATC>ATG		carboxypeptidase M precursor							103.0	99.0	100.0					12																	69260803		2203	4300	6503	SO:0001583	missense	1368				anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding	g.chr12:69260803G>C	AF368463	CCDS8987.1	12q15	2012-02-10			ENSG00000135678	ENSG00000135678	3.4.17.12		2311	protein-coding gene	gene with protein product	"""renal carboxypeptidase"", ""urinary carboxypeptidase B"""	114860				8586455	Standard	NM_001874		Approved		uc001suq.3	P14384	OTTHUMG00000169300	ENST00000551568.1:c.813C>G	12.37:g.69260803G>C	ENSP00000448517:p.Ile271Met					CPM_uc001sur.2_Missense_Mutation_p.I271M|CPM_uc001suq.2_Missense_Mutation_p.I271M	p.I271M	NM_198320	NP_938079	P14384	CBPM_HUMAN	all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)		7	874	-	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		271					B2R800|Q9H2K9	Missense_Mutation	SNP	ENST00000551568.1	37	c.813C>G	CCDS8987.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.9|20.9	4.063599|4.063599	0.76187|0.76187	.|.	.|.	ENSG00000135678|ENSG00000135678	ENST00000551568;ENST00000338356;ENST00000546373|ENST00000551897	T;T;T|.	0.10382|.	2.88;2.88;2.88|.	5.34|5.34	4.45|4.45	0.53987|0.53987	Peptidase M14, carboxypeptidase A (2);|.	0.276502|.	0.40144|.	N|.	0.001161|.	T|T	0.67674|0.67674	0.2918|0.2918	L|L	0.55743|0.55743	1.74|1.74	0.44194|0.44194	D|D	0.997017|0.997017	P|.	0.35307|.	0.494|.	D|.	0.65443|.	0.935|.	T|T	0.66320|0.66320	-0.5953|-0.5953	9|5	.|.	.|.	.|.	-11.2222|-11.2222	14.4326|14.4326	0.67261|0.67261	0.0714:0.0:0.9286:0.0|0.0714:0.0:0.9286:0.0	.|.	271|.	P14384|.	CBPM_HUMAN|.	M|C	271|74	ENSP00000448517:I271M;ENSP00000339157:I271M;ENSP00000447255:I271M|.	.|.	I|S	-|-	3|2	3|0	CPM|CPM	67547070|67547070	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	2.986000|2.986000	0.49370|0.49370	1.393000|1.393000	0.46605|0.46605	0.655000|0.655000	0.94253|0.94253	ATC|TCT		0.408	CPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403355.1	NM_198320		14	805	0	0	0	0.004007	0	14	805				
ATP2A2	488	broad.mit.edu	37	12	110783813	110783813	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr12:110783813G>A	ENST00000539276.2	+	19	2858	c.2749G>A	c.(2749-2751)Gaa>Aaa	p.E917K	ATP2A2_ENST00000308664.6_Missense_Mutation_p.E917K|ATP2A2_ENST00000395494.2_Missense_Mutation_p.E890K			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	917					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)	p.E917K(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						CAGCTTGTCCGAAAACCAGTC	0.567																																							uc001tqk.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4	GRCh37	CM032193|CM990261	ATP2A2	M		c.(2749-2751)GAA>AAA		ATPase, Ca++ transporting, slow twitch 2 isoform							178.0	136.0	150.0					12																	110783813		2203	4300	6503	SO:0001583	missense	488				ATP biosynthetic process|cell adhesion|epidermis development|platelet activation|sarcoplasmic reticulum calcium ion transport	integral to plasma membrane|microsome|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|protein C-terminus binding|S100 alpha binding	g.chr12:110783813G>A		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.2749G>A	12.37:g.110783813G>A	ENSP00000440045:p.Glu917Lys					ATP2A2_uc001tql.3_Missense_Mutation_p.E917K|ATP2A2_uc010sxy.1_Missense_Mutation_p.E890K|ATP2A2_uc001tqn.3_5'UTR|ATP2A2_uc009zvn.2_5'Flank	p.E917K	NM_170665	NP_733765	P16615	AT2A2_HUMAN			19	3312	+			917			Cytoplasmic (By similarity).		A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	37	c.2749G>A	CCDS9144.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.212342|5.212342	0.95069|0.95069	.|.	.|.	ENSG00000174437|ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276|ENST00000548169	D;D;D|.	0.88586|.	-2.4;-2.4;-2.4|.	6.17|6.17	6.17|6.17	0.99709|0.99709	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90549|0.90549	0.7038|0.7038	H|H	0.96748|0.96748	3.875|3.875	0.80722|0.80722	D|D	1|1	D;D;D|.	0.67145|.	0.994;0.996;0.994|.	P;P;P|.	0.54174|.	0.742;0.699;0.744|.	D|D	0.92383|0.92383	0.5915|0.5915	10|5	0.87932|.	D|.	0|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	890;917;917|.	P16615-4;P16615-2;P16615|.	.;.;AT2A2_HUMAN|.	K|Q	917;890;917|807	ENSP00000311186:E917K;ENSP00000378872:E890K;ENSP00000440045:E917K|.	ENSP00000311186:E917K|.	E|R	+|+	1|2	0|0	ATP2A2|ATP2A2	109268196|109268196	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	9.869000|9.869000	0.99810|0.99810	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAA|CGA		0.567	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681		9	52	0	0	0	0.006214	0	9	52				
SMAD9	4093	broad.mit.edu	37	13	37427571	37427571	+	Silent	SNP	C	C	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr13:37427571C>T	ENST00000399275.2	-	5	1384	c.1245G>A	c.(1243-1245)cgG>cgA	p.R415R	SMAD9_ENST00000350148.5_Silent_p.R378R|SMAD9_ENST00000379826.4_Silent_p.R415R			O15198	SMAD9_HUMAN	SMAD family member 9	415	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cartilage development (GO:0051216)|cellular response to organic cyclic compound (GO:0071407)|hindbrain development (GO:0030902)|intracellular signal transduction (GO:0035556)|midbrain development (GO:0030901)|Mullerian duct regression (GO:0001880)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)	p.R378R(1)|p.R415R(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)	18		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		CAAAACTCATCCGGATAGTAC	0.448																																							uc001uvw.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1243-1245)CGG>CGA		SMAD family member 9 isoform a							82.0	76.0	78.0					13																	37427571		2203	4300	6503	SO:0001819	synonymous_variant	4093				BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity	g.chr13:37427571C>T		CCDS9360.1, CCDS45032.1	13q12-q14	2014-09-17	2006-11-06	2004-05-26	ENSG00000120693	ENSG00000120693		"""SMADs"""	6774	protein-coding gene	gene with protein product		603295	"""MAD, mothers against decapentaplegic homolog 9 (Drosophila)"", ""SMAD, mothers against DPP homolog 9 (Drosophila)"""	MADH6, MADH9		9205116	Standard	NM_001127217		Approved		uc001uvw.3	O15198	OTTHUMG00000016740	ENST00000399275.2:c.1245G>A	13.37:g.37427571C>T						SMAD9_uc001uvx.2_Silent_p.R378R|SMAD9_uc010tep.1_Silent_p.R208R	p.R415R	NM_001127217	NP_001120689	O15198	SMAD9_HUMAN		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)	6	1588	-		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	415			MH2.		A2A2Y6|O14989|Q5TBA1	Silent	SNP	ENST00000399275.2	37	c.1245G>A	CCDS45032.1																																																																																				0.448	SMAD9-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044525.2	NM_005905		8	31	0	0	0	0.004482	0	8	31				
LRRC74A	145497	broad.mit.edu	37	14	77327095	77327095	+	Silent	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr14:77327095G>A	ENST00000393774.3	+	11	1288	c.1164G>A	c.(1162-1164)ccG>ccA	p.P388P		NM_194287.2	NP_919263.2												p.P388P(2)		breast(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(1)	18			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		CCGTTCACCCGCAGCTGGACG	0.537																																					Ovarian(165;1056 1958 32571 36789 48728)	Ovarian(165;1056 1958 32571 36789 48728)	uc001xsx.2		NA																	2	Substitution - coding silent(2)		lung(1)|kidney(1)		0						c.(1162-1164)CCG>CCA		hypothetical protein LOC145497							121.0	125.0	123.0					14																	77327095		2088	4207	6295	SO:0001819	synonymous_variant	145497							g.chr14:77327095G>A																												ENST00000393774.3:c.1164G>A	14.37:g.77327095G>A						C14orf166B_uc010asn.1_Silent_p.P148P|C14orf166B_uc001xsw.2_RNA	p.P388P	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)	11	1278	+			388						Silent	SNP	ENST00000393774.3	37	c.1164G>A	CCDS9853.2																																																																																				0.537	C14orf166B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316592.1			14	67	0	0	0	0.00245	0	14	67				
PDXDC1	23042	broad.mit.edu	37	16	15102638	15102638	+	Silent	SNP	C	C	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr16:15102638C>T	ENST00000396410.4	+	7	679	c.582C>T	c.(580-582)ctC>ctT	p.L194L	PDXDC1_ENST00000447912.2_Silent_p.L103L|PDXDC1_ENST00000455313.2_Intron|MIR1972-1_ENST00000459337.1_RNA|PDXDC1_ENST00000535621.2_Silent_p.L194L|PDXDC1_ENST00000569715.1_Silent_p.L167L|PDXDC1_ENST00000450288.2_Silent_p.L166L|PDXDC1_ENST00000563679.1_Silent_p.L212L|PDXDC1_ENST00000325823.7_Silent_p.L179L	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	194					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)	p.L194L(1)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TCCTGCAGCTCGGCTTGCCCT	0.458																																							uc002dda.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(580-582)CTC>CTT		pyridoxal-dependent decarboxylase domain	Pyridoxal Phosphate(DB00114)						334.0	277.0	297.0					16																	15102638		2197	4300	6497	SO:0001819	synonymous_variant	23042				carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding	g.chr16:15102638C>T	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.582C>T	16.37:g.15102638C>T						PDXDC1_uc010uzl.1_Silent_p.L179L|PDXDC1_uc010uzm.1_Silent_p.L103L|PDXDC1_uc010bvc.1_Silent_p.L135L|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002ddb.3_Silent_p.L167L|PDXDC1_uc010uzn.1_Silent_p.L166L|PDXDC1_uc002ddc.2_Silent_p.L194L	p.L194L	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN			7	806	+			194					B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Silent	SNP	ENST00000396410.4	37	c.582C>T	CCDS32393.1																																																																																				0.458	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027		6	351	0	0	0	0.001984	0	6	351				
PRDM7	11105	broad.mit.edu	37	16	90128579	90128579	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr16:90128579A>G	ENST00000449207.2	-	7	651	c.632T>C	c.(631-633)tTc>tCc	p.F211S	PRDM7_ENST00000407825.1_Missense_Mutation_p.F5S|PRDM7_ENST00000325921.6_Missense_Mutation_p.F5S	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	211					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)	p.F211S(1)|p.F5S(1)		lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		GTCAATGAAGAAGTTCTGACA	0.507																																							uc010cje.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(631-633)TTC>TCC		PR domain containing 7 isoform 1							59.0	57.0	58.0					16																	90128579		2198	4300	6498	SO:0001583	missense	11105					chromosome|nucleus	nucleic acid binding	g.chr16:90128579A>G	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.632T>C	16.37:g.90128579A>G	ENSP00000396732:p.Phe211Ser					PRDM7_uc002fqo.2_Missense_Mutation_p.F5S|PRDM7_uc010cjf.2_Missense_Mutation_p.F94S|PRDM7_uc010cjg.1_Missense_Mutation_p.F5S|PRDM7_uc010cjh.1_RNA	p.F211S	NM_001098173	NP_001091643	Q9NQW5	PRDM7_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0278)	7	652	-		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)	211					A4Q9G8|Q08EM4|Q9NQW4	Missense_Mutation	SNP	ENST00000449207.2	37	c.632T>C	CCDS45557.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	13.01|13.01	2.108696|2.108696	0.37242|0.37242	.|.	.|.	ENSG00000126856|ENSG00000126856	ENST00000325921;ENST00000449207;ENST00000407825|ENST00000414728	T;T;T|.	0.41065|.	1.01;1.01;1.01|.	2.45|2.45	1.25|1.25	0.21368|0.21368	.|.	.|.	.|.	.|.	.|.	T|T	0.46190|0.46190	0.1380|0.1380	L|L	0.45470|0.45470	1.425|1.425	0.36267|0.36267	D|D	0.854916|0.854916	D;D;D|.	0.71674|.	0.978;0.997;0.998|.	P;P;D|.	0.67725|.	0.643;0.827;0.953|.	T|T	0.44605|0.44605	-0.9317|-0.9317	8|5	.|.	.|.	.|.	-17.8803|-17.8803	4.8292|4.8292	0.13432|0.13432	0.7251:0.0:0.0:0.2749|0.7251:0.0:0.0:0.2749	.|.	5;211;5|.	Q9NQW5-1;Q9NQW5;Q9NQW5-2|.	.;PRDM7_HUMAN;.|.	S|P	5;211;5|125	ENSP00000315512:F5S;ENSP00000396732:F211S;ENSP00000385121:F5S|.	.|.	F|S	-|-	2|1	0|0	PRDM7|PRDM7	88656080|88656080	0.985000|0.985000	0.35326|0.35326	0.987000|0.987000	0.45799|0.45799	0.770000|0.770000	0.43624|0.43624	2.366000|2.366000	0.44204|0.44204	0.142000|0.142000	0.18901|0.18901	-0.669000|-0.669000	0.03829|0.03829	TTC|TCT		0.507	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420560.1			13	38	0	0	0	0.003163	0	13	38				
NLGN2	57555	broad.mit.edu	37	17	7311965	7311965	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr17:7311965G>A	ENST00000302926.2	+	1	464	c.391G>A	c.(391-393)Gcc>Acc	p.A131T	NLGN2_ENST00000575301.1_Missense_Mutation_p.A131T	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	131					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.A131T(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				GGAGGCGGCCGCCACCTACGT	0.687																																							uc002ggt.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(391-393)GCC>ACC		neuroligin 2 precursor							27.0	24.0	25.0					17																	7311965		2159	4200	6359	SO:0001583	missense	57555				cell-cell junction maintenance|neuron cell-cell adhesion|positive regulation of synaptogenesis|regulation of inhibitory postsynaptic membrane potential|synapse assembly	cell surface|integral to plasma membrane|postsynaptic membrane	neurexin binding|receptor activity	g.chr17:7311965G>A	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.391G>A	17.37:g.7311965G>A	ENSP00000305288:p.Ala131Thr						p.A131T	NM_020795	NP_065846	Q8NFZ4	NLGN2_HUMAN			1	464	+		Prostate(122;0.157)	131			Extracellular (Potential).		Q9P2I1	Missense_Mutation	SNP	ENST00000302926.2	37	c.391G>A	CCDS11103.1	.	.	.	.	.	.	.	.	.	.	g	16.02	3.003326	0.54254	.	.	ENSG00000169992	ENST00000302926	T	0.57752	0.38	3.42	3.42	0.39159	Carboxylesterase, type B (1);	0.000000	0.64402	D	0.000002	T	0.36635	0.0974	L	0.35723	1.085	0.50813	D	0.999892	B	0.26744	0.158	B	0.23716	0.048	T	0.18999	-1.0319	10	0.29301	T	0.29	.	6.8442	0.23979	0.1251:0.0:0.8749:0.0	.	131	Q8NFZ4	NLGN2_HUMAN	T	131	ENSP00000305288:A131T	ENSP00000305288:A131T	A	+	1	0	NLGN2	7252689	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.766000	0.85320	2.242000	0.73789	0.436000	0.28706	GCC		0.687	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226941.2	NM_020795		3	22	0	0	0	0.004672	0	3	22				
PMP22	5376	broad.mit.edu	37	17	15142888	15142888	+	Silent	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr17:15142888G>A	ENST00000395938.2	-	4	413	c.219C>T	c.(217-219)atC>atT	p.I73I	PMP22_ENST00000312280.3_Silent_p.I73I|snoU13_ENST00000458745.1_RNA|PMP22_ENST00000395936.1_Silent_p.I73I|PMP22_ENST00000426385.3_Silent_p.I73I|PMP22_ENST00000494511.1_Missense_Mutation_p.H14Y	NM_001281455.1|NM_153321.1	NP_001268384.1|NP_696996.1	Q01453	PMP22_HUMAN	peripheral myelin protein 22	73					cell death (GO:0008219)|peripheral nervous system development (GO:0007422)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I73I(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8				UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)		TGCTGAAGATGATCGACAGGA	0.542																																							uc002goj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(217-219)ATC>ATT		peripheral myelin protein 22							111.0	82.0	92.0					17																	15142888		2203	4300	6503	SO:0001819	synonymous_variant	5376				peripheral nervous system development|synaptic transmission	integral to membrane		g.chr17:15142888G>A	D11428	CCDS11168.1	17p12	2014-09-17			ENSG00000109099	ENSG00000109099			9118	protein-coding gene	gene with protein product		601097				8482547, 1497668	Standard	NM_001281456		Approved	HNPP, GAS-3, Sp110	uc002goj.3	Q01453	OTTHUMG00000058960	ENST00000395938.2:c.219C>T	17.37:g.15142888G>A						PMP22_uc002gok.2_Silent_p.I73I|PMP22_uc002gol.2_Silent_p.I73I	p.I73I	NM_153322	NP_696997	Q01453	PMP22_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)	3	268	-			73			Helical; (By similarity).		Q8WV01	Silent	SNP	ENST00000395938.2	37	c.219C>T	CCDS11168.1																																																																																				0.542	PMP22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130378.1	NM_000304		11	43	0	0	0	0.008291	0	11	43				
KRTAP4-7	100132476	broad.mit.edu	37	17	39240794	39240795	+	Missense_Mutation	DNP	CA	CA	AT	rs541163988|rs9894106|rs553572799|rs9894966	byFrequency	TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr17:39240794_39240795CA>AT	ENST00000391417.4	+	1	336_337	c.336_337CA>AT	c.(334-339)ccCAgc>ccATgc	p.S113C		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	138	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R111_C115delRPSCC(1)|p.S113C(1)|p.P112P(1)|p.?(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						gctgccgccccagctgctgccg	0.668																																							uc010wfn.1		NA																	4	Substitution - Missense(1)|Unknown(1)|Substitution - coding silent(1)|Deletion - In frame(1)		NS(2)|prostate(2)		0						c.(334-339)CCCAGC>CCATGC		keratin associated protein 4-7																																				SO:0001583	missense	100132476							g.chr17:39240794_39240795CA>AT	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	Exception_encountered	17.37:g.39240794_39240795delinsAT	ENSP00000375236:p.Ser113Cys						p.S113C	NM_033061	NP_149050					1	336_337	+								A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	DNP	ENST00000391417.4	37	c.336_337CA>AT	CCDS45673.1																																																																																				0.668	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1			3	9	0	0	0	0.004672	0	3	9				
CLTC	1213	broad.mit.edu	37	17	57762973	57762973	+	Missense_Mutation	SNP	C	C	G			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr17:57762973C>G	ENST00000269122.3	+	30	4905	c.4631C>G	c.(4630-4632)tCt>tGt	p.S1544C	CLTC_ENST00000393043.1_Missense_Mutation_p.S1544C|CLTC_ENST00000579456.1_Missense_Mutation_p.S481C	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	1544	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)	p.S1544C(1)	CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GCTTCTGAATCTAAAGATACT	0.368			T	"""ALK, TFE3"""	"""ALCL, renal """																																		uc002ixq.1		NA		Dom	yes		17	17q11-qter	1213	T	"""clathrin, heavy polypeptide (Hc)"""			L	ALK|TFE3		ALCL|renal 	CLTC/ALK(44)|CLTC/TFE3(2)	1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48						c.(4630-4632)TCT>TGT		clathrin heavy chain 1							99.0	101.0	100.0					17																	57762973		2203	4300	6503	SO:0001583	missense	1213				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity	g.chr17:57762973C>G	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.4631C>G	17.37:g.57762973C>G	ENSP00000269122:p.Ser1544Cys					CLTC_uc002ixp.2_Missense_Mutation_p.S1544C|CLTC_uc002ixr.1_Missense_Mutation_p.S1548C	p.S1544C	NM_004859	NP_004850	Q00610	CLH1_HUMAN			30	5074	+	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		1544			Heavy chain arm.|Proximal segment.		D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	c.4631C>G	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.809900	0.90707	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.39592	1.07;1.07	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.73877	0.3643	M	0.92555	3.32	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.999;1.0	T	0.81339	-0.0977	10	0.87932	D	0	.	18.8416	0.92186	0.0:1.0:0.0:0.0	.	1544;1544	Q00610;Q00610-2	CLH1_HUMAN;.	C	1544	ENSP00000269122:S1544C;ENSP00000376763:S1544C	ENSP00000269122:S1544C	S	+	2	0	CLTC	55117755	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.525000	0.85131	0.557000	0.71058	TCT		0.368	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859		9	141	0	0	0	0.006214	0	9	141				
BRIP1	83990	broad.mit.edu	37	17	59857699	59857699	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr17:59857699T>C	ENST00000259008.2	-	13	2125	c.1858A>G	c.(1858-1860)Atg>Gtg	p.M620V	BRIP1_ENST00000583837.1_5'Flank|BRIP1_ENST00000577598.1_Missense_Mutation_p.M620V	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	620					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M620V(2)		NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						AAGGATTTCATTGGTGATAAT	0.303			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																															uc002izk.1		NA	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	F|N|Mis	BRCA1 interacting protein C-terminal helicase 1			"""L, E"""		AML|leukemia|breast			2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1858-1860)ATG>GTG	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	BRCA1 interacting protein C-terminal helicase 1							88.0	91.0	90.0					17																	59857699		2203	4300	6503	SO:0001583	missense	83990	FanconAnemia			DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding	g.chr17:59857699T>C	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.1858A>G	17.37:g.59857699T>C	ENSP00000259008:p.Met620Val					BRIP1_uc002izl.1_Missense_Mutation_p.M1V	p.M620V	NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN			13	1999	-			620					Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000259008.2	37	c.1858A>G	CCDS11631.1	.	.	.	.	.	.	.	.	.	.	T	17.66	3.444105	0.63067	.	.	ENSG00000136492	ENST00000259008	T	0.13196	2.61	5.46	3.14	0.36123	.	0.037704	0.85682	D	0.000000	T	0.12646	0.0307	L	0.58810	1.83	0.42641	D	0.993413	P;B	0.43314	0.803;0.451	B;B	0.37731	0.257;0.112	T	0.06698	-1.0812	9	.	.	.	-9.2669	7.7322	0.28793	0.135:0.0:0.1504:0.7146	.	620;620	C9JGZ0;Q9BX63	.;FANCJ_HUMAN	V	620	ENSP00000259008:M620V	.	M	-	1	0	BRIP1	57212481	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	5.509000	0.67012	0.336000	0.23639	0.533000	0.62120	ATG		0.303	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043		4	211	0	0	0	0.000248	0	4	211				
HNRNPL	3191	broad.mit.edu	37	19	39330800	39330800	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr19:39330800T>C	ENST00000221419.5	-	8	1535	c.1169A>G	c.(1168-1170)gAt>gGt	p.D390G	HNRNPL_ENST00000600873.1_Missense_Mutation_p.D257G|AC104534.3_ENST00000594769.1_Missense_Mutation_p.I7V	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	390	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			CTTAGATTGATCCAAGCCATA	0.597																																							uc010xul.1		NA																	0					0						c.(1168-1170)GAT>GGT		heterogeneous nuclear ribonucleoprotein L							39.0	43.0	41.0					19																	39330800		2173	4237	6410	SO:0001583	missense	3191				nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding	g.chr19:39330800T>C	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1169A>G	19.37:g.39330800T>C	ENSP00000221419:p.Asp390Gly					HNRNPL_uc010ege.1_Missense_Mutation_p.D46G|HNRNPL_uc002ojj.1_Missense_Mutation_p.D46G|HNRNPL_uc002ojo.1_5'Flank|HNRNPL_uc002ojk.2_Missense_Mutation_p.D46G|HNRNPL_uc002ojl.2_Missense_Mutation_p.D46G|HNRNPL_uc010xum.1_Missense_Mutation_p.D257G|HNRNPL_uc002ojp.1_Missense_Mutation_p.D46G|HNRNPL_uc010xun.1_Missense_Mutation_p.I98V	p.D390G	NM_001533	NP_001524	P14866	HNRPL_HUMAN	Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)		8	1180	-	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		390			RRM 3.		A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	ENST00000221419.5	37	c.1169A>G	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	T	17.85	3.491031	0.64074	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750	T	0.44083	0.93	5.72	5.72	0.89469	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.042814	0.85682	D	0.000000	T	0.62171	0.2406	M	0.80982	2.52	0.80722	D	1	B;B;D	0.61697	0.397;0.236;0.99	B;B;P	0.57846	0.12;0.072;0.828	T	0.67162	-0.5740	10	0.59425	D	0.04	.	14.9915	0.71393	0.0:0.0:0.0:1.0	.	390;257;373	P14866;A6NIT8;Q6NTA2	HNRPL_HUMAN;.;.	G	390;257;257	ENSP00000221419:D390G	ENSP00000221419:D390G	D	-	2	0	HNRNPL	44022640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.690000	0.84178	2.188000	0.69820	0.454000	0.30748	GAT		0.597	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1			43	119	0	0	0	0.00361	0	43	119				
ZNF155	7711	broad.mit.edu	37	19	44495995	44495995	+	Splice_Site	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr19:44495995G>A	ENST00000270014.2	+	4	272	c.144G>A	c.(142-144)ggG>ggA	p.G48G	ZNF155_ENST00000590615.1_Splice_Site_p.G48G|ZNF155_ENST00000407951.2_Splice_Site_p.G59G	NM_001260487.1|NM_198089.2	NP_001247416|NP_932355	Q12901	ZN155_HUMAN	zinc finger protein 155	48	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G48G(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	15		Prostate(69;0.0352)				TATTCACAGGGCATCAACCGT	0.433																																					NSCLC(61;554 1277 20909 42067 42312)	NSCLC(61;554 1277 20909 42067 42312)	uc002oxy.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(142-144)GGG>GGA		zinc finger protein 155							149.0	142.0	145.0					19																	44495995		2203	4300	6503	SO:0001630	splice_region_variant	7711					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:44495995G>A	U09852	CCDS12634.1, CCDS58668.1	19q13.2-q13.32	2013-01-08	2006-08-22			ENSG00000204920		"""Zinc fingers, C2H2-type"", ""-"""	12940	protein-coding gene	gene with protein product		604086	"""zinc finger protein 155 (pHZ-96)"""			7557990	Standard	NM_001260486		Approved	pHZ-96	uc010xwt.2	Q12901		ENST00000270014.2:c.143-1G>A	19.37:g.44495995G>A						ZNF155_uc002oxz.1_Silent_p.G48G|ZNF155_uc010xwt.1_Silent_p.G59G	p.G48G	NM_003445	NP_003436	Q12901	ZN155_HUMAN			4	349	+		Prostate(69;0.0352)	48			KRAB.		A2BDE6|B2RB63|B4DM95|J3KQ08|Q6AZZ8|Q9UIE1|Q9UK14	Silent	SNP	ENST00000270014.2	37	c.144G>A	CCDS12634.1																																																																																				0.433	ZNF155-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460074.1	NM_003445	Silent	4	209	0	0	0	0.000248	0	4	209				
LILRA1	11024	broad.mit.edu	37	19	55107879	55107879	+	Missense_Mutation	SNP	A	A	C	rs558966089		TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr19:55107879A>C	ENST00000251372.3	+	7	1366	c.1184A>C	c.(1183-1185)tAc>tCc	p.Y395S	LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000453777.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	395	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.Y395S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		TCGGGGACCTACAGGTGCTAC	0.587																																							uc002qgh.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1183-1185)TAC>TCC		leukocyte immunoglobulin-like receptor,							145.0	132.0	136.0					19																	55107879		2203	4300	6503	SO:0001583	missense	11024				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity	g.chr19:55107879A>C	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.1184A>C	19.37:g.55107879A>C	ENSP00000251372:p.Tyr395Ser					LILRA2_uc010yfg.1_Missense_Mutation_p.Y393S|LILRA1_uc010yfh.1_Missense_Mutation_p.Y395S	p.Y395S	NM_006863	NP_006854	O75019	LIRA1_HUMAN		GBM - Glioblastoma multiforme(193;0.0348)	7	1366	+			395			Ig-like C2-type 4.|Extracellular (Potential).		O75018|Q3MJA6	Missense_Mutation	SNP	ENST00000251372.3	37	c.1184A>C	CCDS12901.1	.	.	.	.	.	.	.	.	.	.	A	12.93	2.084843	0.36758	.	.	ENSG00000104974	ENST00000251372	T	0.06142	3.34	1.8	1.8	0.24995	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.307617	0.17987	U	0.155321	T	0.36413	0.0966	H	0.99143	4.445	0.32099	N	0.590832	D	0.89917	1.0	D	0.97110	1.0	T	0.51505	-0.8697	10	0.87932	D	0	.	5.6299	0.17504	1.0:0.0:0.0:0.0	.	395	O75019	LIRA1_HUMAN	S	395	ENSP00000251372:Y395S	ENSP00000251372:Y395S	Y	+	2	0	LILRA1	59799691	0.998000	0.40836	0.432000	0.26747	0.022000	0.10575	3.571000	0.53841	1.086000	0.41228	0.172000	0.16884	TAC		0.587	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863		7	248	0	0	0	0.004482	0	7	248				
ADCY3	109	broad.mit.edu	37	2	25057771	25057771	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr2:25057771C>T	ENST00000260600.5	-	9	2548	c.1697G>A	c.(1696-1698)aGg>aAg	p.R566K	ADCY3_ENST00000450524.1_5'Flank|ADCY3_ENST00000405392.1_Missense_Mutation_p.R199K	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	566					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.R566K(1)		NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CAGGCGCAGCCTCCGGCGTGG	0.642																																							uc002rfs.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(1)	4						c.(1696-1698)AGG>AAG		adenylate cyclase 3							29.0	29.0	29.0					2																	25057771		2202	4300	6502	SO:0001583	missense	109				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding	g.chr2:25057771C>T	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.1697G>A	2.37:g.25057771C>T	ENSP00000260600:p.Arg566Lys					ADCY3_uc002rfr.3_Missense_Mutation_p.R199K|ADCY3_uc010ykm.1_Missense_Mutation_p.R566K	p.R566K	NM_004036	NP_004027	O60266	ADCY3_HUMAN			9	1896	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)		566			Cytoplasmic (Potential).		B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	37	c.1697G>A	CCDS1715.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.133384	0.77662	.	.	ENSG00000138031	ENST00000260600;ENST00000405392;ENST00000415879	T;T	0.40756	1.02;1.02	5.05	5.05	0.67936	.	0.053152	0.64402	D	0.000001	T	0.30479	0.0766	N	0.24115	0.695	0.40020	D	0.975398	B;B;B	0.19445	0.021;0.036;0.036	B;B;B	0.15052	0.007;0.012;0.012	T	0.09079	-1.0691	10	0.19147	T	0.46	.	16.9791	0.86322	0.0:1.0:0.0:0.0	.	566;566;199	B7ZLX9;O60266;B3KT86	.;ADCY3_HUMAN;.	K	566;199;541	ENSP00000260600:R566K;ENSP00000384484:R199K	ENSP00000260600:R566K	R	-	2	0	ADCY3	24911275	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.921000	0.75805	2.344000	0.79699	0.563000	0.77884	AGG		0.642	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2			9	30	0	0	0	0.004482	0	9	30				
C2orf71	388939	broad.mit.edu	37	2	29296770	29296770	+	Missense_Mutation	SNP	C	C	G	rs140625913		TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr2:29296770C>G	ENST00000331664.5	-	1	357	c.358G>C	c.(358-360)Ggt>Cgt	p.G120R		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	120					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)		p.G120R(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						CCATGGGAACCCTGTGTCTTG	0.453													C|||	1	0.000199681	0.0	0.0	5008	,	,		23311	0.001		0.0	False		,,,				2504	0.0						uc002rmt.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(358-360)GGT>CGT		hypothetical protein LOC388939							265.0	249.0	254.0					2																	29296770		1982	4167	6149	SO:0001583	missense	388939				response to stimulus|visual perception	photoreceptor outer segment		g.chr2:29296770C>G		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.358G>C	2.37:g.29296770C>G	ENSP00000332809:p.Gly120Arg						p.G120R	NM_001029883	NP_001025054	A6NGG8	CB071_HUMAN			1	358	-			120						Missense_Mutation	SNP	ENST00000331664.5	37	c.358G>C	CCDS42669.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	11.04	1.521997	0.27211	.	.	ENSG00000179270	ENST00000331664	T	0.19806	2.12	5.52	2.23	0.28157	.	0.405610	0.25660	N	0.029157	T	0.18341	0.0440	L	0.43152	1.355	0.09310	N	1	B	0.24920	0.114	B	0.27262	0.078	T	0.18272	-1.0342	10	0.62326	D	0.03	-2.7647	9.5195	0.39126	0.0:0.126:0.0:0.874	.	120	A6NGG8	CB071_HUMAN	R	120	ENSP00000332809:G120R	ENSP00000332809:G120R	G	-	1	0	C2orf71	29150274	0.815000	0.29118	0.002000	0.10522	0.087000	0.18053	1.012000	0.29924	0.181000	0.19994	0.561000	0.74099	GGT		0.453	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883		57	125	0	0	0	0.00361	0	57	125				
VIL1	7429	broad.mit.edu	37	2	219301247	219301247	+	Silent	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr2:219301247G>A	ENST00000248444.5	+	16	1957	c.1869G>A	c.(1867-1869)gaG>gaA	p.E623E	VIL1_ENST00000392114.2_Silent_p.E312E	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	623	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)	p.E623E(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGCTCTTTGAGTGTTCCAACA	0.507																																							uc002via.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1867-1869)GAG>GAA		villin 1							143.0	150.0	148.0					2																	219301247		2203	4300	6503	SO:0001819	synonymous_variant	7429				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity	g.chr2:219301247G>A	X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.1869G>A	2.37:g.219301247G>A						VIL1_uc010zke.1_Silent_p.E312E|VIL1_uc002vib.2_Silent_p.E623E	p.E623E	NM_007127	NP_009058	P09327	VILI_HUMAN		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	16	1934	+		Renal(207;0.0474)	623			Core.		B2R9A7|Q53S11|Q96AC8	Silent	SNP	ENST00000248444.5	37	c.1869G>A	CCDS2417.1																																																																																				0.507	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256778.3	NM_007127		89	153	0	0	0	0.00361	0	89	153				
DAW1	164781	broad.mit.edu	37	2	228762983	228762983	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr2:228762983C>T	ENST00000309931.2	+	6	609	c.526C>T	c.(526-528)Cat>Tat	p.H176Y	DAW1_ENST00000373666.2_Missense_Mutation_p.H176Y|DAW1_ENST00000545118.1_Missense_Mutation_p.H161Y	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1	176						cilium (GO:0005929)		p.H176Y(1)									CTTCAGGGGTCATACAGCAGA	0.333																																							uc002vpn.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(526-528)CAT>TAT		WD repeat domain 69							39.0	40.0	40.0					2																	228762983		2201	4299	6500	SO:0001583	missense	164781							g.chr2:228762983C>T		CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.526C>T	2.37:g.228762983C>T	ENSP00000311899:p.His176Tyr					WDR69_uc010zlw.1_Missense_Mutation_p.H161Y|WDR69_uc002vpo.1_RNA	p.H176Y	NM_178821	NP_849143	Q8N136	WDR69_HUMAN		Epithelial(121;1.22e-10)|all cancers(144;8.11e-08)|Lung(261;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0148)	6	605	+		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	176			WD 3.		Q6ZRY1|Q8N776	Missense_Mutation	SNP	ENST00000309931.2	37	c.526C>T	CCDS2470.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.652343	0.67472	.	.	ENSG00000123977	ENST00000373666;ENST00000309931;ENST00000545118	T;T;T	0.81415	-1.49;-1.49;-1.49	5.34	5.34	0.76211	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.93177	0.7827	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95155	0.8276	10	0.87932	D	0	.	17.5928	0.88001	0.0:1.0:0.0:0.0	.	176	Q8N136	WDR69_HUMAN	Y	176;176;161	ENSP00000362770:H176Y;ENSP00000311899:H176Y;ENSP00000437887:H161Y	ENSP00000311899:H176Y	H	+	1	0	WDR69	228471227	1.000000	0.71417	0.924000	0.36721	0.632000	0.37999	6.605000	0.74155	2.507000	0.84556	0.650000	0.86243	CAT		0.333	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331745.1	NM_178821		10	54	0	0	0	0.008291	0	10	54				
HAO1	54363	broad.mit.edu	37	20	7866404	7866404	+	Silent	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr20:7866404G>A	ENST00000378789.3	-	6	972	c.921C>T	c.(919-921)ggC>ggT	p.G307G		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	307	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)	p.G307G(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						CAGCCTTGGCGCCAAGAGCCA	0.483																																							uc002wmw.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(919-921)GGC>GGT		hydroxyacid oxidase 1							127.0	128.0	128.0					20																	7866404		2203	4300	6503	SO:0001819	synonymous_variant	54363				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity	g.chr20:7866404G>A	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.921C>T	20.37:g.7866404G>A						HAO1_uc010gbu.2_Silent_p.G307G	p.G307G	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN			6	945	-			307			FMN hydroxy acid dehydrogenase.|FMN (By similarity).		Q14CQ0|Q9UPZ0|Q9Y3I7	Silent	SNP	ENST00000378789.3	37	c.921C>T	CCDS13100.1																																																																																				0.483	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2			14	70	0	0	0	0.00245	0	14	70				
BPIFB1	92747	broad.mit.edu	37	20	31890785	31890785	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr20:31890785T>C	ENST00000253354.1	+	11	1206	c.1045T>C	c.(1045-1047)Ttt>Ctt	p.F349L	BPIFB1_ENST00000464032.1_3'UTR	NM_033197.2	NP_149974.2	Q8TDL5	BPIB1_HUMAN	BPI fold containing family B, member 1	349					innate immune response in mucosa (GO:0002227)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)	p.F349L(1)									TCCCGAGTTTTTTATAGACCA	0.547																																							uc002wyw.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(2)	4						c.(1045-1047)TTT>CTT		LPLUNC1 protein precursor							108.0	95.0	100.0					20																	31890785		2203	4300	6503	SO:0001583	missense	92747					extracellular space	lipid binding	g.chr20:31890785T>C	BC008429	CCDS13218.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000125999	ENSG00000125999		"""BPI fold containing"""	16108	protein-coding gene	gene with protein product	"""von Ebner minor salivary gland protein"""		"""chromosome 20 open reading frame 114"""	C20orf114		11971875, 21787333	Standard	NM_033197		Approved	dJ1187J4.1, MGC14597, bA49G10.6, LPLUNC1, VEMSGP	uc002wyw.1	Q8TDL5	OTTHUMG00000032252	ENST00000253354.1:c.1045T>C	20.37:g.31890785T>C	ENSP00000253354:p.Phe349Leu					C20orf114_uc002wyx.1_RNA	p.F349L	NM_033197	NP_149974	Q8TDL5	LPLC1_HUMAN			11	1206	+			349					A8K2H8|Q5QP43|Q6UWY1|Q6ZRU7|Q96HK6|Q9BQP8|Q9BWZ6|Q9H4V6	Missense_Mutation	SNP	ENST00000253354.1	37	c.1045T>C	CCDS13218.1	.	.	.	.	.	.	.	.	.	.	T	2.713	-0.268320	0.05716	.	.	ENSG00000125999	ENST00000253354	T	0.05925	3.37	5.28	-4.97	0.03029	.	1.404150	0.04237	N	0.336243	T	0.01835	0.0058	N	0.02736	-0.51	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40079	-0.9582	10	0.07030	T	0.85	-0.053	0.1423	0.00084	0.2611:0.1763:0.25:0.3126	.	349	Q8TDL5	BPIB1_HUMAN	L	349	ENSP00000253354:F349L	ENSP00000253354:F349L	F	+	1	0	BPIFB1	31354446	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.647000	0.05397	-0.594000	0.05836	-0.464000	0.05259	TTT		0.547	BPIFB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106499.2	NM_033197		13	61	0	0	0	0.003163	0	13	61				
EPB41L1	2036	broad.mit.edu	37	20	34797690	34797690	+	Missense_Mutation	SNP	C	C	T	rs201212477	byFrequency	TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr20:34797690C>T	ENST00000338074.2	+	15	2110	c.1949C>T	c.(1948-1950)tCg>tTg	p.S650L	EPB41L1_ENST00000202028.5_Missense_Mutation_p.S576L|EPB41L1_ENST00000441639.1_Missense_Mutation_p.S576L|EPB41L1_ENST00000373950.2_Missense_Mutation_p.S541L|EPB41L1_ENST00000373946.3_Intron|EPB41L1_ENST00000479336.1_3'UTR|EPB41L1_ENST00000373941.1_Missense_Mutation_p.S650L	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	650					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.S650L(1)|p.S939L(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					AAAAGCGACTCGGACACTGAG	0.632													C|||	3	0.000599042	0.0	0.0	5008	,	,		17892	0.002		0.0	False		,,,				2504	0.001						uc002xfb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(1948-1950)TCG>TTG		erythrocyte membrane protein band 4.1-like 1							48.0	47.0	47.0					20																	34797690		2203	4300	6503	SO:0001583	missense	2036				cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity	g.chr20:34797690C>T	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1949C>T	20.37:g.34797690C>T	ENSP00000337168:p.Ser650Leu					EPB41L1_uc002xeu.2_Missense_Mutation_p.S576L|EPB41L1_uc010zvo.1_Missense_Mutation_p.S650L|EPB41L1_uc002xev.2_Missense_Mutation_p.S650L|EPB41L1_uc002xew.2_Missense_Mutation_p.S541L|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Missense_Mutation_p.S576L|EPB41L1_uc010gfq.2_Missense_Mutation_p.S749L	p.S650L	NM_012156	NP_036288	Q9H4G0	E41L1_HUMAN			15	2120	+	Breast(12;0.0239)		650					O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	ENST00000338074.2	37	c.1949C>T	CCDS13271.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	C	12.94	2.089733	0.36855	.	.	ENSG00000088367	ENST00000202028;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000344237;ENST00000338074;ENST00000373941	D;D;D;D;D	0.84223	-1.81;-1.75;-1.81;-1.82;-1.82	5.87	4.87	0.63330	.	0.042047	0.85682	N	0.000000	T	0.75391	0.3843	N	0.24115	0.695	0.26737	N	0.970466	B;D;B;B;B;B	0.69078	0.078;0.997;0.044;0.03;0.225;0.213	B;P;B;B;B;B	0.53988	0.009;0.739;0.003;0.005;0.009;0.014	T	0.69694	-0.5076	10	0.33141	T	0.24	-5.201	8.8886	0.35418	0.1496:0.7733:0.0:0.0771	.	650;939;650;541;541;576	B7Z653;E9PCJ3;Q9H4G0;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;.;E41L1_HUMAN;.;.;.	L	576;541;650;541;576;939;650;650	ENSP00000202028:S576L;ENSP00000363061:S541L;ENSP00000399214:S576L;ENSP00000337168:S650L;ENSP00000363052:S650L	ENSP00000202028:S576L	S	+	2	0	EPB41L1	34261104	0.162000	0.22906	0.973000	0.42090	0.914000	0.54420	0.392000	0.20801	2.941000	0.99782	0.655000	0.94253	TCG		0.632	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156		9	29	0	0	0	0.004482	0	9	29				
C20orf195	79025	broad.mit.edu	37	20	62187706	62187706	+	Silent	SNP	C	C	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr20:62187706C>T	ENST00000370098.3	+	2	782	c.690C>T	c.(688-690)gtC>gtT	p.V230V	C20orf195_ENST00000370097.1_Silent_p.V230V	NM_024059.2	NP_076964.1	Q9BVV2	CT195_HUMAN	chromosome 20 open reading frame 195	230	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular vesicular exosome (GO:0070062)		p.V230V(1)		large_intestine(3)|lung(4)	7	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			GCTGGTTCGTCACCATCCAGC	0.647																																							uc002yfj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(688-690)GTC>GTT		hypothetical protein LOC79025							76.0	81.0	79.0					20																	62187706		2203	4299	6502	SO:0001819	synonymous_variant	79025							g.chr20:62187706C>T		CCDS13526.1	20q13.33	2014-02-12			ENSG00000125531	ENSG00000125531			28764	protein-coding gene	gene with protein product						12477932	Standard	NM_024059		Approved	MGC5356	uc002yfj.3	Q9BVV2	OTTHUMG00000032980	ENST00000370098.3:c.690C>T	20.37:g.62187706C>T						C20orf195_uc002yfk.2_Silent_p.V230V	p.V230V	NM_024059	NP_076964	Q9BVV2	CT195_HUMAN	Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)		2	782	+	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		230						Silent	SNP	ENST00000370098.3	37	c.690C>T	CCDS13526.1																																																																																				0.647	C20orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080155.1	NM_024059		39	125	0	0	0	0.006999	0	39	125				
GMEB2	26205	broad.mit.edu	37	20	62234341	62234341	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr20:62234341C>T	ENST00000266068.1	-	3	812	c.334G>A	c.(334-336)Ggc>Agc	p.G112S	GMEB2_ENST00000370077.1_Missense_Mutation_p.G112S|GMEB2_ENST00000370069.1_Missense_Mutation_p.G61S			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	112	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.				regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)	p.G112S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			ACATTGATGCCGGGACACACA	0.557																																							uc002yfp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(334-336)GGC>AGC		glucocorticoid modulatory element binding							172.0	151.0	158.0					20																	62234341		2203	4300	6503	SO:0001583	missense	26205				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding	g.chr20:62234341C>T	AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.334G>A	20.37:g.62234341C>T	ENSP00000266068:p.Gly112Ser					GMEB2_uc002yfo.1_Missense_Mutation_p.G34S|GMEB2_uc002yfq.1_Missense_Mutation_p.G112S	p.G112S	NM_012384	NP_036516	Q9UKD1	GMEB2_HUMAN	Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)		3	813	-	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		112			SAND.		E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Missense_Mutation	SNP	ENST00000266068.1	37	c.334G>A	CCDS13528.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609682	0.87258	.	.	ENSG00000101216	ENST00000370069;ENST00000370077;ENST00000266068	T;T;T	0.77229	-1.08;-1.08;-1.08	4.84	3.9	0.45041	SAND domain-like (2);SAND domain (3);	0.114961	0.64402	D	0.000013	D	0.89626	0.6769	M	0.91818	3.245	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.91239	0.5020	10	0.87932	D	0	0.0	13.0041	0.58694	0.0:0.9216:0.0:0.0784	.	112	Q9UKD1	GMEB2_HUMAN	S	61;112;112	ENSP00000359086:G61S;ENSP00000359094:G112S;ENSP00000266068:G112S	ENSP00000266068:G112S	G	-	1	0	GMEB2	61704785	1.000000	0.71417	0.483000	0.27378	0.966000	0.64601	7.621000	0.83083	1.024000	0.39682	0.655000	0.94253	GGC		0.557	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080166.1	NM_012384		15	119	0	0	0	0.004007	0	15	119				
ADAMTS1	9510	broad.mit.edu	37	21	28212371	28212371	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr21:28212371G>A	ENST00000284984.3	-	6	2129	c.1675C>T	c.(1675-1677)Cat>Tat	p.H559Y		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	559	Disintegrin.|TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.H559N(2)|p.H559Y(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		CAGCTTCCATGAAAAGGCGTC	0.463																																							uc002ymf.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(3)|large_intestine(2)|central_nervous_system(1)	6						c.(1675-1677)CAT>TAT		ADAM metallopeptidase with thrombospondin type 1							59.0	54.0	56.0					21																	28212371		2203	4300	6503	SO:0001583	missense	9510				integrin-mediated signaling pathway|negative regulation of cell proliferation|proteolysis		heparin binding|zinc ion binding	g.chr21:28212371G>A	AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.1675C>T	21.37:g.28212371G>A	ENSP00000284984:p.His559Tyr						p.H559Y	NM_006988	NP_008919	Q9UHI8	ATS1_HUMAN		Lung(58;0.215)	6	2130	-		Breast(209;0.000962)	559			Disintegrin.|TSP type-1 1.		D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	ENST00000284984.3	37	c.1675C>T	CCDS33524.1	.	.	.	.	.	.	.	.	.	.	G	19.79	3.892763	0.72524	.	.	ENSG00000154734	ENST00000284984	T	0.61274	0.12	4.89	4.89	0.63831	.	.	.	.	.	T	0.69851	0.3157	M	0.70275	2.135	0.58432	D	0.999993	P	0.51240	0.943	P	0.52710	0.707	T	0.74156	-0.3756	9	0.72032	D	0.01	.	18.6024	0.91253	0.0:0.0:1.0:0.0	.	559	Q9UHI8	ATS1_HUMAN	Y	559	ENSP00000284984:H559Y	ENSP00000284984:H559Y	H	-	1	0	ADAMTS1	27134242	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.673000	0.68109	2.709000	0.92574	0.655000	0.94253	CAT		0.463	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2			4	116	0	0	0	0.001168	0	4	116				
KCNJ15	3772	broad.mit.edu	37	21	39671440	39671440	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr21:39671440A>G	ENST00000328656.4	+	4	560	c.257A>G	c.(256-258)tAt>tGt	p.Y86C	KCNJ15_ENST00000398932.1_Missense_Mutation_p.Y86C|KCNJ15_ENST00000398938.2_Missense_Mutation_p.Y86C|KCNJ15_ENST00000398930.1_Missense_Mutation_p.Y86C|KCNJ15_ENST00000398934.1_Missense_Mutation_p.Y86C	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	86					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.Y86C(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	GTCATCTACTATGCCATCGCG	0.488																																							uc002ywv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	6						c.(256-258)TAT>TGT		potassium inwardly-rectifying channel J15							141.0	129.0	133.0					21																	39671440		2203	4300	6503	SO:0001583	missense	3772				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity	g.chr21:39671440A>G	Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.257A>G	21.37:g.39671440A>G	ENSP00000331698:p.Tyr86Cys					KCNJ15_uc002yww.2_Missense_Mutation_p.Y86C|KCNJ15_uc002ywx.2_Missense_Mutation_p.Y86C	p.Y86C	NM_002243	NP_002234	Q99712	IRK15_HUMAN			4	559	+			86			Helical; Name=M1; (By similarity).		D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	ENST00000328656.4	37	c.257A>G	CCDS13656.1	.	.	.	.	.	.	.	.	.	.	A	12.46	1.944087	0.34283	.	.	ENSG00000157551	ENST00000328656;ENST00000398928;ENST00000398938;ENST00000398932;ENST00000438657;ENST00000398930;ENST00000398934;ENST00000398927;ENST00000419868	D;D;D;D;D;D;D;D;D	0.95342	-3.68;-3.68;-3.68;-3.68;-3.68;-3.68;-3.68;-3.68;-3.68	5.0	5.0	0.66597	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.141727	0.49305	D	0.000152	D	0.97126	0.9061	M	0.88377	2.95	0.50171	D	0.999855	D	0.76494	0.999	D	0.74674	0.984	D	0.97357	0.9967	9	.	.	.	.	10.2747	0.43504	0.8526:0.0:0.0:0.1474	.	86	Q99712	IRK15_HUMAN	C	86	ENSP00000331698:Y86C;ENSP00000381902:Y86C;ENSP00000381911:Y86C;ENSP00000381905:Y86C;ENSP00000414487:Y86C;ENSP00000381904:Y86C;ENSP00000381907:Y86C;ENSP00000381901:Y86C;ENSP00000400849:Y86C	.	Y	+	2	0	KCNJ15	38593310	0.999000	0.42202	0.919000	0.36401	0.344000	0.29017	4.103000	0.57783	2.011000	0.59026	0.460000	0.39030	TAT		0.488	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243		54	213	0	0	0	0.00361	0	54	213				
OR11H1	81061	broad.mit.edu	37	22	16449695	16449695	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr22:16449695G>T	ENST00000252835.4	-	1	110	c.110C>A	c.(109-111)aCa>aAa	p.T37K		NM_001005239.1	NP_001005239.1	Q8NG94	O11H1_HUMAN	olfactory receptor, family 11, subfamily H, member 1	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T37K(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)	11	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)		GATCTGAATTGTCCACTCACA	0.428																																							uc011agd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(109-111)ACA>AAA		olfactory receptor, family 11, subfamily H,							16.0	18.0	18.0					22																	16449695		2056	4048	6104	SO:0001583	missense	81061				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr22:16449695G>T	AP000535, AF399611	CCDS74807.1	22q11.1	2012-08-09			ENSG00000130538	ENSG00000130538		"""GPCR / Class A : Olfactory receptors"""	15404	protein-coding gene	gene with protein product						12213199	Standard	NM_001005239		Approved	OR22-1	uc011agd.2	Q8NG94	OTTHUMG00000030069	ENST00000252835.4:c.110C>A	22.37:g.16449695G>T	ENSP00000252835:p.Thr37Lys						p.T37K	NM_001005239	NP_001005239	Q8NG94	O11H1_HUMAN		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)	1	110	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)	37			Extracellular (Potential).		Q6IEX0|Q96R32	Missense_Mutation	SNP	ENST00000252835.4	37	c.110C>A	CCDS33594.1	.	.	.	.	.	.	.	.	.	.	g	0.335	-0.953950	0.02285	.	.	ENSG00000130538	ENST00000252835	T	0.00424	7.45	2.19	1.03	0.20045	.	0.723524	0.11668	N	0.541123	T	0.00144	0.0004	N	0.00808	-1.17	0.20764	N	0.999854	B	0.02656	0.0	B	0.01281	0.0	T	0.10613	-1.0622	10	0.20046	T	0.44	.	6.5799	0.22588	0.0:0.0:0.2472:0.7528	.	37	Q8NG94	O11H1_HUMAN	K	37	ENSP00000252835:T37K	ENSP00000252835:T37K	T	-	2	0	OR11H1	14829695	0.000000	0.05858	0.961000	0.40146	0.184000	0.23303	0.397000	0.20883	0.052000	0.16007	-1.093000	0.02169	ACA		0.428	OR11H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074923.2	NM_001005239		10	126	1	0	1.22574e-08	0.002299	1.6436e-08	10	126				
KCNJ4	3761	broad.mit.edu	37	22	38824042	38824042	+	Silent	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr22:38824042G>A	ENST00000303592.3	-	2	354	c.96C>T	c.(94-96)ttC>ttT	p.F32F	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	32					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)	p.F32F(1)		endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					TCAGGTTGGCGAAGTACACGT	0.627																																							uc003avs.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(94-96)TTC>TTT		potassium inwardly-rectifying channel J4							335.0	262.0	287.0					22																	38824042		2203	4300	6503	SO:0001819	synonymous_variant	3761				synaptic transmission	basolateral plasma membrane|voltage-gated potassium channel complex	inward rectifier potassium channel activity|PDZ domain binding	g.chr22:38824042G>A	U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.96C>T	22.37:g.38824042G>A						KCNJ4_uc003avt.1_Silent_p.F32F	p.F32F	NM_004981	NP_004972	P48050	IRK4_HUMAN			2	193	-	Melanoma(58;0.0286)		32			Cytoplasmic (By similarity).		Q14D44	Silent	SNP	ENST00000303592.3	37	c.96C>T	CCDS13971.1																																																																																				0.627	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1	NM_004981		63	211	0	0	0	0.00361	0	63	211				
STAC	6769	broad.mit.edu	37	3	36484872	36484872	+	Missense_Mutation	SNP	G	G	A	rs369536237		TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr3:36484872G>A	ENST00000273183.3	+	2	428	c.128G>A	c.(127-129)cGa>cAa	p.R43Q	STAC_ENST00000476388.1_3'UTR|STAC_ENST00000457375.2_Missense_Mutation_p.R43Q	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	43					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)	p.R43Q(2)		endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						AAACTAAAACGATCACTTTCT	0.468																																							uc003cgh.1		NA																	2	Substitution - Missense(2)		lung(1)|skin(1)	skin(2)|ovary(1)|pancreas(1)	4						c.(127-129)CGA>CAA		SH3 and cysteine rich domain		G	GLN/ARG	0,4406		0,0,2203	62.0	50.0	54.0		128	4.9	1.0	3		54	1,8599	1.2+/-3.3	0,1,4299	no	missense	STAC	NM_003149.1	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	43/403	36484872	1,13005	2203	4300	6503	SO:0001583	missense	6769				intracellular signal transduction	cytoplasm|soluble fraction	metal ion binding	g.chr3:36484872G>A	D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.128G>A	3.37:g.36484872G>A	ENSP00000273183:p.Arg43Gln					STAC_uc010hgd.1_RNA|STAC_uc011aya.1_Missense_Mutation_p.R43Q	p.R43Q	NM_003149	NP_003140	Q99469	STAC_HUMAN			2	167	+			43					B2R8S8	Missense_Mutation	SNP	ENST00000273183.3	37	c.128G>A	CCDS2662.1	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846363	0.71603	0.0	1.16E-4	ENSG00000144681	ENST00000273183;ENST00000457375	T;T	0.79653	-1.29;-0.18	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000001	D	0.82912	0.5140	L	0.58101	1.795	0.41106	D	0.985707	D;D	0.69078	0.997;0.968	P;B	0.55545	0.778;0.34	T	0.81833	-0.0751	10	0.34782	T	0.22	.	11.5401	0.50661	0.0841:0.0:0.9159:0.0	.	43;43	E9PEA7;Q99469	.;STAC_HUMAN	Q	43	ENSP00000273183:R43Q;ENSP00000393713:R43Q	ENSP00000273183:R43Q	R	+	2	0	STAC	36459876	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.727000	0.74764	2.394000	0.81467	0.650000	0.86243	CGA		0.468	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	NM_003149		4	23	0	0	0	0.000248	0	4	23				
XRN1	54464	broad.mit.edu	37	3	142133085	142133085	+	Silent	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr3:142133085G>A	ENST00000264951.4	-	14	1602	c.1485C>T	c.(1483-1485)atC>atT	p.I495I	XRN1_ENST00000392981.2_Silent_p.I495I	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	495					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.I495I(1)		NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TGAGTGTACTGATGTTGTGTA	0.343																																							uc003eus.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(1483-1485)ATC>ATT		5'-3' exoribonuclease 1 isoform a							131.0	129.0	130.0					3																	142133085		2203	4300	6503	SO:0001819	synonymous_variant	54464				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding	g.chr3:142133085G>A	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1485C>T	3.37:g.142133085G>A						XRN1_uc010huu.2_5'Flank|XRN1_uc003eut.2_Silent_p.I495I|XRN1_uc003euu.2_Silent_p.I495I|XRN1_uc003euv.1_Silent_p.I356I	p.I495I	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN			14	1552	-			495					Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Silent	SNP	ENST00000264951.4	37	c.1485C>T	CCDS3123.1																																																																																				0.343	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001		16	79	0	0	0	0.00499	0	16	79				
TRIML2	205860	broad.mit.edu	37	4	189012797	189012797	+	Silent	SNP	G	G	A	rs371374323		TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr4:189012797G>A	ENST00000512729.1	-	7	1268	c.894C>T	c.(892-894)acC>acT	p.T298T	TRIML2_ENST00000326754.3_Silent_p.T323T	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	298	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)	p.T298T(1)		central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		GAGTCCACTCGGTCCCCATCA	0.577																																							uc003izl.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)	2						c.(892-894)ACC>ACT		tripartite motif family-like 2		G		0,4406		0,0,2203	136.0	149.0	145.0		894	-11.7	0.0	4		145	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TRIML2	NM_173553.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		298/388	189012797	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	205860						ligase activity	g.chr4:189012797G>A	AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.894C>T	4.37:g.189012797G>A						TRIML2_uc003izj.1_Silent_p.T126T|TRIML2_uc003izk.1_Silent_p.T106T|TRIML2_uc011cle.1_Silent_p.T373T	p.T298T	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)	7	930	-		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)	298			B30.2/SPRY.		B7Z6J6	Silent	SNP	ENST00000512729.1	37	c.894C>T	CCDS3850.1																																																																																				0.577	TRIML2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359733.1	NM_173553		35	166	0	0	0	0.003755	0	35	166				
NSUN2	54888	broad.mit.edu	37	5	6632745	6632745	+	Missense_Mutation	SNP	A	A	C			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr5:6632745A>C	ENST00000264670.6	-	2	532	c.221T>G	c.(220-222)cTc>cGc	p.L74R	NSUN2_ENST00000506139.1_Missense_Mutation_p.L74R|NSUN2_ENST00000539938.1_5'UTR|SRD5A1_ENST00000538824.1_5'Flank|SRD5A1_ENST00000274192.5_5'Flank|SRD5A1_ENST00000537411.1_5'Flank	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	74					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)	p.L74R(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						AGTGGCCGGGAGCGGCTCCCT	0.557																																							uc003jdu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(220-222)CTC>CGC		NOL1/NOP2/Sun domain family, member 2							93.0	107.0	102.0					5																	6632745		2203	4300	6503	SO:0001583	missense	54888					cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding	g.chr5:6632745A>C	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.221T>G	5.37:g.6632745A>C	ENSP00000264670:p.Leu74Arg					NSUN2_uc011cmk.1_Missense_Mutation_p.L74R|NSUN2_uc003jdv.2_5'UTR|SRD5A1_uc003jdw.2_5'Flank|SRD5A1_uc011cml.1_5'Flank|SRD5A1_uc011cmm.1_5'Flank	p.L74R	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN			2	286	-			74					A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	ENST00000264670.6	37	c.221T>G	CCDS3869.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.929595	0.92389	.	.	ENSG00000037474	ENST00000264670;ENST00000506139	T;T	0.70869	-0.52;0.68	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.87920	0.6299	H	0.94808	3.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.992	D	0.91134	0.4940	10	0.72032	D	0.01	-24.9227	14.0587	0.64786	1.0:0.0:0.0:0.0	.	74;74	B4DQW2;Q08J23	.;NSUN2_HUMAN	R	74	ENSP00000264670:L74R;ENSP00000420957:L74R	ENSP00000264670:L74R	L	-	2	0	NSUN2	6685745	1.000000	0.71417	0.999000	0.59377	0.943000	0.58893	8.321000	0.89997	1.803000	0.52742	0.533000	0.62120	CTC		0.557	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755		4	133	0	0	0	0.000248	0	4	133				
RANBP17	64901	broad.mit.edu	37	5	170610377	170610377	+	Missense_Mutation	SNP	T	T	G			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr5:170610377T>G	ENST00000523189.1	+	18	2145	c.1981T>G	c.(1981-1983)Ttc>Gtc	p.F661V	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	661					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.F661V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCTCAGCGACTTCAGGTGTCG	0.403			T	TRD@	ALL																																		uc003mba.2		NA		Dom	yes		5	5q34	64901	T	RAN binding protein 17			L	TRD@		ALL		1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1981-1983)TTC>GTC		RAN binding protein 17							112.0	100.0	104.0					5																	170610377		2203	4300	6503	SO:0001583	missense	64901				mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity	g.chr5:170610377T>G	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.1981T>G	5.37:g.170610377T>G	ENSP00000427975:p.Phe661Val					RANBP17_uc003mbb.2_5'UTR|RANBP17_uc003mbd.2_Missense_Mutation_p.F24V|RANBP17_uc010jjs.2_RNA|RANBP17_uc003mbc.2_Missense_Mutation_p.F24V	p.F661V	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		18	1997	+	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	661					Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	c.1981T>G	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.338243	0.41398	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.66280	-0.2	5.35	1.32	0.21799	Armadillo-type fold (1);	0.210235	0.33346	N	0.005012	T	0.30541	0.0768	N	0.03608	-0.345	0.32674	N	0.516428	B;B	0.09022	0.002;0.002	B;B	0.12156	0.007;0.007	T	0.17992	-1.0351	10	0.17832	T	0.49	-6.3734	5.9312	0.19140	0.0:0.4759:0.0:0.5241	.	661;661	Q546R4;Q9H2T7	.;RBP17_HUMAN	V	661;91	ENSP00000427975:F661V	ENSP00000427975:F661V	F	+	1	0	RANBP17	170542982	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	2.017000	0.40981	0.427000	0.26145	0.459000	0.35465	TTC		0.403	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897		29	70	0	0	0	0.008361	0	29	70				
BTN2A1	11120	broad.mit.edu	37	6	26466290	26466290	+	Splice_Site	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr6:26466290G>A	ENST00000312541.5	+	7	1204	c.956G>A	c.(955-957)cGa>cAa	p.R319Q	BTN2A1_ENST00000469185.1_Splice_Site_p.R319Q|BTN2A1_ENST00000541522.1_Splice_Site_p.R258Q|BTN2A1_ENST00000429381.1_Splice_Site_p.R319Q	NM_007049.3|NM_078476.2	NP_008980.1|NP_510961.1	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1	319	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)		p.R305Q(1)|p.R319Q(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(3)	27						TCCCTTGCAGGATGGAGAAGA	0.448																																							uc003nib.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(955-957)CGA>CAA		butyrophilin, subfamily 2, member A1 isoform 1							290.0	249.0	263.0					6																	26466290		2203	4300	6503	SO:0001630	splice_region_variant	11120				lipid metabolic process	integral to plasma membrane		g.chr6:26466290G>A	U90543	CCDS4613.1, CCDS47390.1, CCDS56404.1, CCDS56405.1	6p22.1	2014-01-14			ENSG00000112763	ENSG00000112763		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1136	protein-coding gene	gene with protein product		613590				9382921, 9149941	Standard	NM_007049		Approved	BT2.1, BTF1, BTN2.1	uc003nib.2	Q7KYR7	OTTHUMG00000014457	ENST00000312541.5:c.956-1G>A	6.37:g.26466290G>A						BTN2A1_uc003nic.1_Missense_Mutation_p.R319Q|BTN2A1_uc003nid.1_Missense_Mutation_p.R167Q|BTN2A1_uc011dko.1_Missense_Mutation_p.R258Q|BTN2A1_uc010jqk.1_Missense_Mutation_p.R79Q	p.R319Q	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN			7	1168	+			319			Cytoplasmic (Potential).|B30.2/SPRY.		B4DLP9|E9PGR4|O00475|P78408|Q59EN4|Q7KYQ7|Q7Z386|Q96AV7|Q9NU62	Missense_Mutation	SNP	ENST00000312541.5	37	c.956G>A	CCDS4613.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.24|14.24	2.476663|2.476663	0.44044|0.44044	.|.	.|.	ENSG00000112763|ENSG00000112763	ENST00000480218|ENST00000312541;ENST00000541522;ENST00000429381;ENST00000265424;ENST00000469185	.|T;T;T;T	.|0.76060	.|-0.51;1.08;-0.99;-0.99	3.18|3.18	0.266|0.266	0.15617|0.15617	.|Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	.|1.164090	.|0.06577	.|N	.|0.749545	T|T	0.39600|0.39600	0.1084|0.1084	L|L	0.36672|0.36672	1.1|1.1	0.28059|0.28059	N|N	0.933055|0.933055	.|B;P;B	.|0.36048	.|0.035;0.534;0.124	.|B;B;B	.|0.35470	.|0.04;0.203;0.021	T|T	0.21415|0.21415	-1.0246|-1.0246	5|9	.|.	.|.	.|.	.|.	2.7284|2.7284	0.05220|0.05220	0.2573:0.0:0.5196:0.2232|0.2573:0.0:0.5196:0.2232	.|.	.|258;319;319	.|B4DLP9;Q96AV7;Q7KYR7	.|.;.;BT2A1_HUMAN	N|Q	68|319;258;319;305;319	.|ENSP00000312158:R319Q;ENSP00000443909:R258Q;ENSP00000416945:R319Q;ENSP00000419043:R319Q	.|.	D|R	+|+	1|2	0|0	BTN2A1|BTN2A1	26574269|26574269	0.999000|0.999000	0.42202|0.42202	0.747000|0.747000	0.31113|0.31113	0.963000|0.963000	0.63663|0.63663	1.235000|1.235000	0.32671|0.32671	0.023000|0.023000	0.15187|0.15187	0.491000|0.491000	0.48974|0.48974	GAT|CGA		0.448	BTN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040122.2	NM_007049	Missense_Mutation	24	160	0	0	0	0.00333	0	24	160				
HLA-A	3105	broad.mit.edu	37	6	29911194	29911194	+	Nonsense_Mutation	SNP	C	C	T	rs41541518		TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr6:29911194C>T	ENST00000396634.1	+	5	834	c.493C>T	c.(493-495)Cag>Tag	p.Q165*	HLA-A_ENST00000376809.5_Nonsense_Mutation_p.Q165*|HLA-A_ENST00000376806.5_Nonsense_Mutation_p.Q165*|HLA-A_ENST00000376802.2_Nonsense_Mutation_p.Q165*			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	165	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.Q165*(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CATGGCGGCTCAGATCACCAA	0.652									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																													uc003nol.2		NA																	1	Substitution - Nonsense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2	GRCh37	CM004196	HLA-A	M	rs41541518	c.(493-495)CAG>TAG		major histocompatibility complex, class I, A							36.0	26.0	30.0					6																	29911194		1504	2704	4208	SO:0001587	stop_gained	3105	Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity	g.chr6:29911194C>T	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.493C>T	6.37:g.29911194C>T	ENSP00000379873:p.Gln165*	Multiple Myeloma(9;0.094)				HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_RNA|HLA-A_uc010jrq.2_Nonsense_Mutation_p.Q44*|HLA-A_uc003nok.2_Nonsense_Mutation_p.Q44*|HLA-A_uc003non.2_Nonsense_Mutation_p.Q165*|HLA-A_uc003noo.2_Nonsense_Mutation_p.Q165*|HLA-A_uc010jrr.2_Nonsense_Mutation_p.Q165*|HLA-A_uc003nom.2_Nonsense_Mutation_p.Q44*|HLA-A_uc010klp.2_Nonsense_Mutation_p.Q137*|HLA-A_uc011dmc.1_Nonsense_Mutation_p.Q44*|HLA-A_uc011dmd.1_Nonsense_Mutation_p.Q44*	p.Q165*	NM_002116	NP_002107	P30443	1A01_HUMAN			3	493	+			165			Extracellular (Potential).|Alpha-2.		O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Nonsense_Mutation	SNP	ENST00000396634.1	37	c.493C>T	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	27.3	4.816891	0.90790	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000376802	.	.	.	3.78	0.721	0.18219	.	1.042900	0.07754	U	0.948981	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.0477	0.25055	0.0:0.5654:0.3314:0.1032	rs41541518	.	.	.	X	165	.	ENSP00000365998:Q165X	Q	+	1	0	HLA-A	30019173	0.000000	0.05858	0.411000	0.26484	0.027000	0.11550	0.130000	0.15850	0.392000	0.25172	-0.334000	0.08254	CAG		0.652	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116		9	28	0	0	0	0.004482	0	9	28				
GNL1	2794	broad.mit.edu	37	6	30522868	30522868	+	Missense_Mutation	SNP	C	C	G			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr6:30522868C>G	ENST00000376621.3	-	3	1310	c.340G>C	c.(340-342)Gag>Cag	p.E114Q	PRR3_ENST00000376560.3_5'Flank|PRR3_ENST00000376557.3_5'Flank	NM_005275.3	NP_005266.2	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	114					cellular response to DNA damage stimulus (GO:0006974)|GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)|signal transduction (GO:0007165)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)	p.E114Q(1)		cervix(2)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						ATGTCCAGCTCCAACAACTCA	0.552																																							uc003nqh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(340-342)GAG>CAG		guanine nucleotide binding protein-like 1							160.0	154.0	156.0					6																	30522868		1511	2709	4220	SO:0001583	missense	2794				response to DNA damage stimulus|signal transduction|T cell mediated immunity	extracellular space|intracellular	GTP binding|structural molecule activity	g.chr6:30522868C>G		CCDS4680.1	6p21.3	2010-02-17			ENSG00000204590	ENSG00000204590			4413	protein-coding gene	gene with protein product		143024				8180467	Standard	NM_005275		Approved	HSR1	uc003nqh.3	P36915	OTTHUMG00000031137	ENST00000376621.3:c.340G>C	6.37:g.30522868C>G	ENSP00000365806:p.Glu114Gln					GNL1_uc011dmi.1_5'UTR|GNL1_uc011dmj.1_Missense_Mutation_p.E112Q|GNL1_uc011dmk.1_Intron|PRR3_uc003nqi.1_5'Flank|PRR3_uc003nqj.1_5'Flank	p.E114Q	NM_005275	NP_005266	P36915	GNL1_HUMAN			3	1368	-			114					B0S838|Q96CT5	Missense_Mutation	SNP	ENST00000376621.3	37	c.340G>C	CCDS4680.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.900794	0.92035	.	.	ENSG00000204590	ENST00000376621;ENST00000433809	T	0.49432	0.78	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.53094	0.1775	L	0.40543	1.245	0.80722	D	1	D;D	0.89917	1.0;0.97	D;P	0.81914	0.995;0.665	T	0.39210	-0.9625	10	0.33141	T	0.24	-20.1803	18.77	0.91888	0.0:1.0:0.0:0.0	.	112;114	B4DYK6;P36915	.;GNL1_HUMAN	Q	114;112	ENSP00000365806:E114Q	ENSP00000365806:E114Q	E	-	1	0	GNL1	30630847	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.368000	0.73104	2.813000	0.96785	0.655000	0.94253	GAG		0.552	GNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076241.2			14	97	0	0	0	0.001855	0	14	97				
GNL1	2794	broad.mit.edu	37	6	30522939	30522939	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr6:30522939C>T	ENST00000376621.3	-	3	1239	c.269G>A	c.(268-270)aGg>aAg	p.R90K	PRR3_ENST00000376560.3_5'Flank|PRR3_ENST00000376557.3_5'Flank	NM_005275.3	NP_005266.2	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	90					cellular response to DNA damage stimulus (GO:0006974)|GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)|signal transduction (GO:0007165)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)	p.R90K(1)		cervix(2)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						TACCTCCTCCCTGCTGTCTCT	0.537																																							uc003nqh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(268-270)AGG>AAG		guanine nucleotide binding protein-like 1							248.0	272.0	263.0					6																	30522939		1511	2709	4220	SO:0001583	missense	2794				response to DNA damage stimulus|signal transduction|T cell mediated immunity	extracellular space|intracellular	GTP binding|structural molecule activity	g.chr6:30522939C>T		CCDS4680.1	6p21.3	2010-02-17			ENSG00000204590	ENSG00000204590			4413	protein-coding gene	gene with protein product		143024				8180467	Standard	NM_005275		Approved	HSR1	uc003nqh.3	P36915	OTTHUMG00000031137	ENST00000376621.3:c.269G>A	6.37:g.30522939C>T	ENSP00000365806:p.Arg90Lys					GNL1_uc011dmi.1_5'UTR|GNL1_uc011dmj.1_Missense_Mutation_p.R88K|GNL1_uc011dmk.1_Intron|PRR3_uc003nqi.1_5'Flank|PRR3_uc003nqj.1_5'Flank	p.R90K	NM_005275	NP_005266	P36915	GNL1_HUMAN			3	1297	-			90					B0S838|Q96CT5	Missense_Mutation	SNP	ENST00000376621.3	37	c.269G>A	CCDS4680.1	.	.	.	.	.	.	.	.	.	.	C	6.861	0.528192	0.13127	.	.	ENSG00000204590	ENST00000376621;ENST00000433809	T	0.38401	1.14	5.61	5.61	0.85477	.	0.054430	0.64402	D	0.000001	T	0.04588	0.0125	N	0.02960	-0.455	0.35278	D	0.781072	B;B	0.15141	0.012;0.0	B;B	0.06405	0.002;0.001	T	0.29971	-0.9994	10	0.02654	T	1	-27.1416	8.9989	0.36069	0.0:0.8418:0.0:0.1582	.	88;90	B4DYK6;P36915	.;GNL1_HUMAN	K	90;88	ENSP00000365806:R90K	ENSP00000365806:R90K	R	-	2	0	GNL1	30630918	0.994000	0.37717	0.992000	0.48379	0.790000	0.44656	2.219000	0.42899	2.813000	0.96785	0.655000	0.94253	AGG		0.537	GNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076241.2			45	198	0	0	0	0.002222	0	45	198				
DNAH8	1769	broad.mit.edu	37	6	38840727	38840727	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr6:38840727G>A	ENST00000359357.3	+	49	6886	c.6632G>A	c.(6631-6633)tGg>tAg	p.W2211*	DNAH8_ENST00000449981.2_Nonsense_Mutation_p.W2428*|DNAH8_ENST00000441566.1_Nonsense_Mutation_p.W2175*			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2211	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.W2211*(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GATGCCATCTGGATTGAGAAC	0.358																																							uc003ooe.1		NA																	2	Substitution - Nonsense(2)		lung(2)	skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(6631-6633)TGG>TAG		dynein, axonemal, heavy polypeptide 8							72.0	72.0	72.0					6																	38840727		2203	4300	6503	SO:0001587	stop_gained	1769							g.chr6:38840727G>A	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.6632G>A	6.37:g.38840727G>A	ENSP00000352312:p.Trp2211*						p.W2211*	NM_001371	NP_001362					49	7232	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Nonsense_Mutation	SNP	ENST00000359357.3	37	c.6632G>A		.	.	.	.	.	.	.	.	.	.	G	49	16.017177	0.99852	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.0114	0.97452	0.0:0.0:1.0:0.0	.	.	.	.	X	2416;2416;2211;2175	.	ENSP00000333363:W2416X	W	+	2	0	DNAH8	38948705	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.843000	0.99491	2.745000	0.94114	0.655000	0.94253	TGG		0.358	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		35	77	0	0	0	0.002836	0	35	77				
WASF1	8936	broad.mit.edu	37	6	110424684	110424684	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr6:110424684G>C	ENST00000392589.1	-	9	1626	c.790C>G	c.(790-792)Ctg>Gtg	p.L264V	WASF1_ENST00000392588.1_Missense_Mutation_p.L264V|WASF1_ENST00000359451.2_Missense_Mutation_p.L264V|WASF1_ENST00000392587.2_Missense_Mutation_p.L264V|WASF1_ENST00000392586.1_Missense_Mutation_p.L264V	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	264					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)	p.L264V(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		GCTCTAGTCAGAAGCTCACTC	0.443																																							uc003ptv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(790-792)CTG>GTG		Wiskott-Aldrich syndrome protein family member							186.0	158.0	168.0					6																	110424684		2203	4300	6503	SO:0001583	missense	8936				actin filament polymerization|cellular component movement	actin cytoskeleton	actin binding	g.chr6:110424684G>C	D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.790C>G	6.37:g.110424684G>C	ENSP00000376368:p.Leu264Val					WASF1_uc003ptw.1_Missense_Mutation_p.L264V|WASF1_uc003ptx.1_Missense_Mutation_p.L264V|WASF1_uc003pty.1_Missense_Mutation_p.L264V	p.L264V	NM_003931	NP_003922	Q92558	WASF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)	9	1627	-		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)	264					E1P5F2|Q5SZK7	Missense_Mutation	SNP	ENST00000392589.1	37	c.790C>G	CCDS5080.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857469	0.51376	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	5.51	4.64	0.57946	.	0.069646	0.64402	D	0.000013	T	0.38692	0.1050	N	0.24115	0.695	0.50467	D	0.999879	D	0.63880	0.993	D	0.67548	0.952	T	0.23084	-1.0198	10	0.20046	T	0.44	.	14.6665	0.68913	0.0699:0.0:0.9301:0.0	.	264	Q92558	WASF1_HUMAN	V	264	ENSP00000376365:L264V;ENSP00000376366:L264V;ENSP00000376368:L264V;ENSP00000376367:L264V;ENSP00000352425:L264V	ENSP00000352425:L264V	L	-	1	2	WASF1	110531377	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.394000	0.79862	1.484000	0.48361	0.650000	0.86243	CTG		0.443	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041784.3	NM_003931		5	111	0	0	0	0.000602	0	5	111				
REV3L	5980	broad.mit.edu	37	6	111632428	111632428	+	Missense_Mutation	SNP	G	G	A	rs142379750		TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr6:111632428G>A	ENST00000358835.3	-	30	9093	c.8639C>T	c.(8638-8640)aCg>aTg	p.T2880M	RP5-1112D6.8_ENST00000607434.1_RNA|REV3L_ENST00000368802.3_Missense_Mutation_p.T2880M|REV3L_ENST00000462119.1_5'UTR|REV3L_ENST00000368805.1_Missense_Mutation_p.T2880M|REV3L_ENST00000435970.1_Missense_Mutation_p.T2802M			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2880					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.T2802M(1)|p.T2880M(1)		NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TATATCTCTCGTTTCAAATAG	0.333								DNA polymerases (catalytic subunits)																															uc003puy.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(2)|ovary(2)|skin(2)	6						c.(8638-8640)ACG>ATG	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	DNA polymerase zeta		G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	160.0	165.0	163.0		8639	5.5	1.0	6	dbSNP_134	163	0,8600		0,0,4300	no	missense	REV3L	NM_002912.3	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	2880/3131	111632428	1,13005	2203	4300	6503	SO:0001583	missense	5980				DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding	g.chr6:111632428G>A	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.8639C>T	6.37:g.111632428G>A	ENSP00000351697:p.Thr2880Met					REV3L_uc003pux.3_Missense_Mutation_p.T2802M|REV3L_uc003puz.3_Missense_Mutation_p.T2802M|REV3L_uc003pva.1_RNA|REV3L_uc003puw.3_5'Flank	p.T2880M	NM_002912	NP_002903	O60673	DPOLZ_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)	29	8962	-		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)	2880					O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	c.8639C>T	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411163	0.83340	2.27E-4	0.0	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	5.48	5.48	0.80851	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.238052	0.43579	D	0.000545	T	0.45397	0.1340	M	0.90595	3.13	0.46458	D	0.999057	D	0.89917	1.0	D	0.75020	0.985	T	0.56511	-0.7967	10	0.87932	D	0	-7.402	19.3434	0.94355	0.0:0.0:1.0:0.0	.	2880	O60673	DPOLZ_HUMAN	M	2880;2880;2880;2802	ENSP00000357792:T2880M;ENSP00000357795:T2880M;ENSP00000351697:T2880M;ENSP00000402003:T2802M	ENSP00000351697:T2880M	T	-	2	0	REV3L	111739121	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.787000	0.85759	2.580000	0.87095	0.557000	0.71058	ACG		0.333	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912		39	243	0	0	0	0.006999	0	39	243				
RSPH10B2	728194	broad.mit.edu	37	7	6803562	6803562	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr7:6803562G>A	ENST00000403107.1	+	5	790	c.403G>A	c.(403-405)Gac>Aac	p.D135N	RSPH10B2_ENST00000359718.3_5'UTR|RSPH10B2_ENST00000463354.2_3'UTR|RSPH10B2_ENST00000433859.2_Missense_Mutation_p.D135N|RSPH10B2_ENST00000404077.1_Missense_Mutation_p.D135N|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.D135N			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	135								p.D135N(2)		breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						GCTTCAGGGCGACTTTGTGAA	0.612																																							uc003sqw.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|pancreas(1)|skin(1)	3						c.(403-405)GAC>AAC		radial spoke head 10 homolog B							49.0	44.0	46.0					7																	6803562		2198	4286	6484	SO:0001583	missense	728194							g.chr7:6803562G>A		CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.403G>A	7.37:g.6803562G>A	ENSP00000384766:p.Asp135Asn					RSPH10B2_uc010ktk.1_Missense_Mutation_p.D135N|RSPH10B2_uc011jxc.1_5'UTR|RSPH10B2_uc010ktl.1_5'Flank	p.D135N	NM_173565	NP_775836	B2RC85	R10B2_HUMAN			6	674	+			135			MORN 3.		A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	ENST00000403107.1	37	c.403G>A	CCDS43552.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.956865	0.53293	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	3.4	3.4	0.38934	.	0.731763	0.12008	N	0.508191	T	0.52256	0.1723	L	0.47016	1.485	0.80722	D	1	D	0.58970	0.984	P	0.48840	0.592	T	0.46965	-0.9153	10	0.29301	T	0.29	.	12.5247	0.56079	0.0:0.0:1.0:0.0	.	135	B2RC85	R10B2_HUMAN	N	135	ENSP00000384766:D135N;ENSP00000386102:D135N;ENSP00000297186:D135N;ENSP00000416710:D135N	ENSP00000297186:D135N	D	+	1	0	RSPH10B2	6770087	1.000000	0.71417	0.999000	0.59377	0.155000	0.21991	4.367000	0.59498	1.763000	0.52060	0.382000	0.24955	GAC		0.612	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324184.4	NM_001099697		5	41	0	0	0	0.001984	0	5	41				
ANKMY2	57037	broad.mit.edu	37	7	16640525	16640525	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr7:16640525G>A	ENST00000306999.2	-	10	1430	c.1187C>T	c.(1186-1188)cCa>cTa	p.P396L		NM_020319.2	NP_064715.1	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	396						cilium (GO:0005929)	metal ion binding (GO:0046872)	p.P396L(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	23	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TTCAGCCTCTGGTTGCTCTTC	0.398																																							uc003sti.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1186-1188)CCA>CTA		ankyrin repeat and MYND domain containing 2							101.0	97.0	98.0					7																	16640525		2203	4300	6503	SO:0001583	missense	57037					cilium	zinc ion binding	g.chr7:16640525G>A	AK001740	CCDS5361.1	7p21	2013-01-10			ENSG00000106524	ENSG00000106524		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	25370	protein-coding gene	gene with protein product						12477932	Standard	NM_020319		Approved	DKFZP564O043, ZMYND20	uc003sti.3	Q8IV38	OTTHUMG00000090806	ENST00000306999.2:c.1187C>T	7.37:g.16640525G>A	ENSP00000303570:p.Pro396Leu					ANKMY2_uc010ktz.2_RNA	p.P396L	NM_020319	NP_064715	Q8IV38	ANKY2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)	10	1387	-	Lung NSC(10;0.103)|all_lung(11;0.204)		396					A4D124|Q659G1|Q96BL3	Missense_Mutation	SNP	ENST00000306999.2	37	c.1187C>T	CCDS5361.1	.	.	.	.	.	.	.	.	.	.	G	4.637	0.118491	0.08881	.	.	ENSG00000106524	ENST00000306999	T	0.71222	-0.55	5.4	3.49	0.39957	.	0.652897	0.15909	N	0.238684	T	0.53674	0.1811	N	0.24115	0.695	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.46665	-0.9175	10	0.51188	T	0.08	-6.8836	7.4092	0.27007	0.0899:0.0:0.7448:0.1653	.	396	Q8IV38	ANKY2_HUMAN	L	396	ENSP00000303570:P396L	ENSP00000303570:P396L	P	-	2	0	ANKMY2	16607050	0.012000	0.17670	0.635000	0.29338	0.706000	0.40770	1.158000	0.31737	1.415000	0.47037	0.655000	0.94253	CCA		0.398	ANKMY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207600.2	NM_020319		4	68	0	0	0	0.000248	0	4	68				
AC005013.5	0	broad.mit.edu	37	7	28996325	28996325	+	lincRNA	SNP	G	G	A	rs370254572		TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr7:28996325G>A	ENST00000436594.1	+	0	0				TRIL_ENST00000322982.3_RNA																							GCTCCTCCGCGAGACCTGCAG	0.721																																							uc003szt.2		NA																	0					0						c.(1336-1338)CTC>CTT		TLR4 interactor with leucine rich repeats							13.0	17.0	16.0					7																	28996325		1815	3954	5769			9865				inflammatory response|innate immune response|regulation of cytokine production involved in immune response|toll-like receptor 4 signaling pathway	lipopolysaccharide receptor complex	lipopolysaccharide binding	g.chr7:28996325G>A																													7.37:g.28996325G>A						uc003szu.1_5'Flank	p.L446L	NM_014817	NP_055632	Q7L0X0	TRIL_HUMAN			3	1705	-			446			Extracellular (Potential).			Silent	SNP	ENST00000436594.1	37	c.1338C>T																																																																																					0.721	AC005013.5-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000327953.3			5	24	0	0	0	0.000602	0	5	24				
WNT16	51384	broad.mit.edu	37	7	120969620	120969620	+	Splice_Site	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr7:120969620G>A	ENST00000222462.2	+	2	385		c.e2-1		WNT16_ENST00000361301.2_Splice_Site	NM_057168.1	NP_476509.1	Q9UBV4	WNT16_HUMAN	wingless-type MMTV integration site family, member 16						bone remodeling (GO:0046849)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|optic cup formation involved in camera-type eye development (GO:0003408)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|replicative senescence (GO:0090399)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.?(2)		breast(1)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)	18	all_neural(327;0.117)					GTGTCTTACAGGTGGTTGGGC	0.582																																							uc003vjw.2		NA																	2	Unknown(2)		lung(2)	lung(2)|ovary(2)|large_intestine(1)	5						c.e2-1		wingless-type MMTV integration site family,							80.0	95.0	90.0					7																	120969620		2200	4300	6500	SO:0001630	splice_region_variant	51384				anterior/posterior pattern formation|axis specification|axonogenesis|canonical Wnt receptor signaling pathway|keratinocyte differentiation|keratinocyte proliferation|negative regulation of cell death|optic cup formation involved in camera-type eye development|oxidative stress-induced premature senescence|positive regulation of gene expression|positive regulation of JNK cascade|positive regulation of phosphatidylinositol 3-kinase cascade|replicative senescence|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity	g.chr7:120969620G>A	AF152584	CCDS5780.1, CCDS5781.1	7q31	2008-07-18			ENSG00000002745	ENSG00000002745		"""Wingless-type MMTV integration sites"""	16267	protein-coding gene	gene with protein product		606267				10500199	Standard	NM_016087		Approved		uc003vjw.3	Q9UBV4	OTTHUMG00000156963	ENST00000222462.2:c.96-1G>A	7.37:g.120969620G>A						WNT16_uc003vjv.2_Splice_Site_p.W22_splice|WNT16_uc010lkl.2_5'Flank	p.M32_splice	NM_057168	NP_476509	Q9UBV4	WNT16_HUMAN			2	353	+	all_neural(327;0.117)							Q2M3G1|Q9Y5C0	Splice_Site	SNP	ENST00000222462.2	37	c.96_splice	CCDS5781.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139055	0.77775	.	.	ENSG00000002745	ENST00000361301;ENST00000222462	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3814	0.87406	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WNT16	120756856	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.413000	0.97351	2.415000	0.81967	0.655000	0.94253	.		0.582	WNT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346843.1	NM_057168	Intron	12	94	0	0	0	0.003163	0	12	94				
KEL	3792	broad.mit.edu	37	7	142640391	142640391	+	Silent	SNP	G	G	A	rs377071873		TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr7:142640391G>A	ENST00000355265.2	-	16	2217	c.1743C>T	c.(1741-1743)caC>caT	p.H581H	KEL_ENST00000479768.2_5'Flank	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	581					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.H581H(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GCAACAGCTCGTGGGCCATGA	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		19003	0.0		0.0	False		,,,				2504	0.001						uc003wcb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(1741-1743)CAC>CAT		Kell blood group, metallo-endopeptidase		G		1,4405	2.1+/-5.4	0,1,2202	55.0	50.0	52.0		1743	-7.9	0.0	7		52	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KEL	NM_000420.2		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		581/733	142640391	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	3792				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr7:142640391G>A	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1743C>T	7.37:g.142640391G>A							p.H581H	NM_000420	NP_000411	P23276	KELL_HUMAN			16	1953	-	Melanoma(164;0.059)		581			Extracellular (Potential).	Zinc; catalytic (By similarity).	B2RBV4|Q96RS8|Q99885	Silent	SNP	ENST00000355265.2	37	c.1743C>T	CCDS34766.1																																																																																				0.557	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		7	23	0	0	0	0.001984	0	7	23				
ARHGAP39	80728	broad.mit.edu	37	8	145773476	145773476	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr8:145773476C>T	ENST00000276826.5	-	4	1195	c.994G>A	c.(994-996)Gtg>Atg	p.V332M	ARHGAP39_ENST00000528810.1_5'Flank|ARHGAP39_ENST00000540274.1_Missense_Mutation_p.V332M|ARHGAP39_ENST00000377307.2_Missense_Mutation_p.V332M			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	332	Pro-rich.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.V332M(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						TCGAATTGCACGTCCATGGGG	0.706																																							uc003zdt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(994-996)GTG>ATG		KIAA1688 protein							21.0	26.0	24.0					8																	145773476		2024	4035	6059	SO:0001583	missense	80728				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity	g.chr8:145773476C>T		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.994G>A	8.37:g.145773476C>T	ENSP00000276826:p.Val332Met					ARHGAP39_uc011llk.1_Missense_Mutation_p.V332M|ARHGAP39_uc003zds.1_Missense_Mutation_p.V332M	p.V332M	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN			6	1549	-			332			Pro-rich.		B4E1I1	Missense_Mutation	SNP	ENST00000276826.5	37	c.994G>A		.	.	.	.	.	.	.	.	.	.	C	1.556	-0.538032	0.04082	.	.	ENSG00000147799	ENST00000276826;ENST00000377307;ENST00000540274	T;T;T	0.61040	0.14;0.43;0.14	5.37	2.24	0.28232	.	0.157679	0.53938	N	0.000042	T	0.19406	0.0466	N	0.01109	-1.01	0.26368	N	0.976932	B;B	0.12013	0.003;0.005	B;B	0.10450	0.002;0.005	T	0.33954	-0.9848	10	0.05351	T	0.99	-12.0724	6.2052	0.20598	0.0:0.3515:0.0:0.6485	.	332;332	Q9C0H5;Q9C0H5-2	RHG39_HUMAN;.	M	332	ENSP00000276826:V332M;ENSP00000366522:V332M;ENSP00000445075:V332M	ENSP00000276826:V332M	V	-	1	0	ARHGAP39	145744284	1.000000	0.71417	0.993000	0.49108	0.910000	0.53928	3.326000	0.52037	0.162000	0.19483	0.655000	0.94253	GTG		0.706	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382509.1			17	20	0	0	0	0.00499	0	17	20				
RASEF	158158	broad.mit.edu	37	9	85597694	85597694	+	Silent	SNP	T	T	C			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr9:85597694T>C	ENST00000376447.3	-	17	2381	c.2121A>G	c.(2119-2121)gaA>gaG	p.E707E		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	707					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)	p.E707E(1)		NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						TCTTTTTCACTTCTCTgagac	0.418																																							uc004amo.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						c.(2119-2121)GAA>GAG		RAS and EF-hand domain containing							254.0	234.0	241.0					9																	85597694		2203	4300	6503	SO:0001819	synonymous_variant	158158				protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding	g.chr9:85597694T>C	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.2121A>G	9.37:g.85597694T>C							p.E707E	NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN			17	2382	-			707					A6NC29|Q96N04	Silent	SNP	ENST00000376447.3	37	c.2121A>G	CCDS6662.1																																																																																				0.418	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573		3	78	0	0	0	0.004672	0	3	78				
ZNF483	158399	broad.mit.edu	37	9	114293154	114293154	+	Splice_Site	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr9:114293154G>A	ENST00000309235.5	+	3	570		c.e3-1		ZNF483_ENST00000355824.3_Splice_Site|ZNF483_ENST00000358151.4_Splice_Site	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						CCCTTTCCTAGATCCAGTCTC	0.333																																							uc004bff.2		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e3-1		zinc finger protein 483 isoform a							99.0	100.0	99.0					9																	114293154		2203	4300	6503	SO:0001630	splice_region_variant	158399				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:114293154G>A	AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.413-1G>A	9.37:g.114293154G>A						ZNF483_uc011lwq.1_Splice_Site_p.D138_splice|ZNF483_uc004bfg.2_Splice_Site_p.D138_splice	p.D138_splice	NM_133464	NP_597721	Q8TF39	ZN483_HUMAN			3	637	+								Q5VZN2|Q8NAE1	Splice_Site	SNP	ENST00000309235.5	37	c.413_splice	CCDS35106.1	.	.	.	.	.	.	.	.	.	.	G	9.670	1.146561	0.21288	.	.	ENSG00000173258	ENST00000358151;ENST00000355824;ENST00000309235	.	.	.	3.62	3.62	0.41486	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0855	0.48084	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF483	113332975	0.970000	0.33590	0.129000	0.21949	0.032000	0.12392	4.018000	0.57174	2.307000	0.77673	0.563000	0.77884	.		0.333	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	XM_088567	Intron	15	88	0	0	0	0.003163	0	15	88				
SLC46A2	57864	broad.mit.edu	37	9	115651960	115651960	+	Silent	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr9:115651960G>A	ENST00000374228.4	-	1	1233	c.1002C>T	c.(1000-1002)agC>agT	p.S334S		NM_033051.3	NP_149040.3	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	334					negative regulation of T cell apoptotic process (GO:0070233)|regulation of T cell differentiation (GO:0045580)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.S334S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(1)	18						CACCCAGGAAGCTGGTGATGA	0.557																																							uc004bgk.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1000-1002)AGC>AGT		solute carrier family 46, member 2							103.0	88.0	93.0					9																	115651960		2203	4300	6503	SO:0001819	synonymous_variant	57864					integral to membrane|plasma membrane	symporter activity	g.chr9:115651960G>A	AF242557	CCDS6786.1	9q32	2013-05-22	2007-03-29	2007-03-29	ENSG00000119457	ENSG00000119457		"""Solute carriers"""	16055	protein-coding gene	gene with protein product		608956	"""thymic stromal co-transporter"""	TSCOT		10978518, 12826694	Standard	NM_033051		Approved	Ly110	uc004bgk.3	Q9BY10	OTTHUMG00000020513	ENST00000374228.4:c.1002C>T	9.37:g.115651960G>A							p.S334S	NM_033051	NP_149040	Q9BY10	TSCOT_HUMAN			1	1234	-			334			Helical; Name=8; (Potential).		B1ALK1|Q86VT0|Q96NE2	Silent	SNP	ENST00000374228.4	37	c.1002C>T	CCDS6786.1																																																																																				0.557	SLC46A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053702.1	NM_033051		42	19	0	0	0	0.002222	0	42	19				
NLGN4X	57502	broad.mit.edu	37	X	5811410	5811410	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chrX:5811410C>T	ENST00000381095.3	-	6	2526	c.1899G>A	c.(1897-1899)tgG>tgA	p.W633*	NLGN4X_ENST00000381092.1_Nonsense_Mutation_p.W633*|NLGN4X_ENST00000275857.6_Nonsense_Mutation_p.W633*|NLGN4X_ENST00000538097.1_Nonsense_Mutation_p.W633*|NLGN4X_ENST00000381093.2_Nonsense_Mutation_p.W653*	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	633					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.W633*(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TGGTGGTTGGCCATATCTTGG	0.498																																							uc010ndh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)|large_intestine(1)|ovary(1)	4						c.(1897-1899)TGG>TGA		X-linked neuroligin 4 precursor							126.0	117.0	120.0					X																	5811410		2203	4291	6494	SO:0001587	stop_gained	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5811410C>T	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1899G>A	X.37:g.5811410C>T	ENSP00000370485:p.Trp633*					NLGN4X_uc004crp.2_Nonsense_Mutation_p.W653*|NLGN4X_uc004crq.2_Nonsense_Mutation_p.W633*|NLGN4X_uc010ndi.2_Nonsense_Mutation_p.W670*|NLGN4X_uc004crr.2_Nonsense_Mutation_p.W633*|NLGN4X_uc010ndj.2_Nonsense_Mutation_p.W633*	p.W633*	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN			6	2400	-			633			Extracellular (Potential).		Q6UX10|Q9ULG0	Nonsense_Mutation	SNP	ENST00000381095.3	37	c.1899G>A	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	C	39	7.882096	0.98542	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	.	.	.	4.0	4.0	0.46444	.	1.386960	0.05346	N	0.531084	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	14.5537	0.68086	0.0:1.0:0.0:0.0	.	.	.	.	X	633;653;633;633;633	.	ENSP00000275857:W633X	W	-	3	0	NLGN4X	5821410	1.000000	0.71417	0.971000	0.41717	0.106000	0.19336	6.722000	0.74735	1.594000	0.50039	0.513000	0.50165	TGG		0.498	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		26	724	0	0	0	0.003954	0	26	724				
EIF2S3	1968	broad.mit.edu	37	X	24094881	24094881	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chrX:24094881G>T	ENST00000253039.4	+	12	1651	c.1398G>T	c.(1396-1398)aaG>aaT	p.K466N		NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	466					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.K466N(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						TGACAATCAAGCCAACAGTAG	0.343																																							uc004dbc.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(1396-1398)AAG>AAT		eukaryotic translation initiation factor 2,							208.0	181.0	190.0					X																	24094881		2203	4300	6503	SO:0001583	missense	1968					cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity	g.chrX:24094881G>T	L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.1398G>T	X.37:g.24094881G>T	ENSP00000253039:p.Lys466Asn						p.K466N	NM_001415	NP_001406	P41091	IF2G_HUMAN			12	1419	+			466					B5BTZ4	Missense_Mutation	SNP	ENST00000253039.4	37	c.1398G>T	CCDS14210.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.158981	0.38119	.	.	ENSG00000130741	ENST00000253039	T	0.64803	-0.12	4.9	2.04	0.26737	.	0.055787	0.64402	U	0.000001	T	0.46889	0.1416	L	0.36672	1.1	0.42176	D	0.991662	B	0.06786	0.001	B	0.08055	0.003	T	0.36261	-0.9755	10	0.54805	T	0.06	.	6.4827	0.22071	0.2353:0.1326:0.6321:0.0	.	466	P41091	IF2G_HUMAN	N	466	ENSP00000253039:K466N	ENSP00000253039:K466N	K	+	3	2	EIF2S3	24004802	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.608000	0.46308	0.378000	0.24764	0.600000	0.82982	AAG		0.343	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056079.1	NM_001415		35	837	1	0	4.67007e-22	0.00874	6.40776e-22	35	837				
PORCN	64840	broad.mit.edu	37	X	48368171	48368171	+	Splice_Site	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chrX:48368171G>A	ENST00000537758.1	+	2	116		c.e2-1		AF196972.9_ENST00000445586.1_RNA|PORCN_ENST00000486272.1_Intron|PORCN_ENST00000361988.3_Splice_Site|PORCN_ENST00000326194.6_5'UTR|PORCN_ENST00000355961.4_Splice_Site|PORCN_ENST00000359882.4_Splice_Site|PORCN_ENST00000367574.4_5'UTR|PORCN_ENST00000355092.3_5'Flank			Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)						glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGCTTTGACAGATCTATCCAT	0.577																																							uc010nie.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.e2-1		porcupine isoform D							35.0	28.0	30.0					X																	48368171		2203	4300	6503	SO:0001630	splice_region_variant	64840				Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity	g.chrX:48368171G>A	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000537758.1:c.-37-1G>A	X.37:g.48368171G>A						PORCN_uc004djq.1_Missense_Mutation_p.R101K|PORCN_uc004djr.1_Splice_Site|PORCN_uc004djs.1_Splice_Site|PORCN_uc004djt.1_Splice_Site|PORCN_uc011mlx.1_5'UTR|PORCN_uc004dju.1_Splice_Site|PORCN_uc004djv.1_5'Flank|PORCN_uc004djw.1_5'Flank		NM_203475	NP_982301	Q9H237	PORCN_HUMAN			2	122	+								B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Splice_Site	SNP	ENST00000537758.1	37	c.-36_splice	CCDS14299.1																																																																																				0.577	PORCN-203	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022825	Intron	3	21	0	0	0	0.004672	0	3	21				
GPR174	84636	broad.mit.edu	37	X	78427197	78427197	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chrX:78427197G>A	ENST00000276077.1	+	1	729	c.693G>A	c.(691-693)atG>atA	p.M231I		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.M231I(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						CCTTGAAGATGATTCTAACCT	0.393										HNSCC(63;0.18)																													uc004edg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(691-693)ATG>ATA		putative purinergic receptor FKSG79							98.0	94.0	95.0					X																	78427197		2203	4300	6503	SO:0001583	missense	84636					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78427197G>A	AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.693G>A	X.37:g.78427197G>A	ENSP00000276077:p.Met231Ile	HNSCC(63;0.18)					p.M231I	NM_032553	NP_115942	Q9BXC1	GP174_HUMAN			1	729	+			231			Cytoplasmic (Potential).		Q2M3F7	Missense_Mutation	SNP	ENST00000276077.1	37	c.693G>A	CCDS14443.1	.	.	.	.	.	.	.	.	.	.	g	19.58	3.853812	0.71719	.	.	ENSG00000147138	ENST00000276077	T	0.39056	1.1	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61123	0.2322	L	0.61036	1.89	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.58691	-0.7592	10	0.31617	T	0.26	.	16.0106	0.80399	0.0:0.0:1.0:0.0	.	231	Q9BXC1	GP174_HUMAN	I	231	ENSP00000276077:M231I	ENSP00000276077:M231I	M	+	3	0	GPR174	78313853	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	9.568000	0.98166	2.085000	0.62840	0.488000	0.48403	ATG		0.393	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553		41	57	0	0	0	0.007835	0	41	57				
PLXNA3	55558	broad.mit.edu	37	X	153698805	153698805	+	Silent	SNP	G	G	C			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chrX:153698805G>C	ENST00000369682.3	+	30	5182	c.5007G>C	c.(5005-5007)gtG>gtC	p.V1669V	PLXNA3_ENST00000493546.1_3'UTR	NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1669					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)	p.V1669V(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGAAGTTCGTGGATGACCTCT	0.607																																							uc004flm.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(5005-5007)GTG>GTC		plexin A3 precursor							78.0	69.0	72.0					X																	153698805		2203	4300	6503	SO:0001819	synonymous_variant	55558				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity	g.chrX:153698805G>C	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.5007G>C	X.37:g.153698805G>C							p.V1669V	NM_017514	NP_059984	P51805	PLXA3_HUMAN			30	5180	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		1669			Cytoplasmic (Potential).		Q5HY36	Silent	SNP	ENST00000369682.3	37	c.5007G>C	CCDS14752.1																																																																																				0.607	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514		27	52	0	0	0	0.005443	0	27	52				
XPOT	11260	broad.mit.edu	37	12	64812755	64812755	+	Frame_Shift_Del	DEL	T	T	-			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr12:64812755delT	ENST00000332707.5	+	6	899	c.370delT	c.(370-372)tttfs	p.F126fs		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	126	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.F126fs*6(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		GTGGCCCAAGTTTTTTTTTGA	0.443																																							uc001ssb.2		NA																	1	Deletion - Frameshift(1)		large_intestine(1)	ovary(2)	2						c.(370-372)TTTfs		tRNA exportin							118.0	114.0	115.0					12																	64812755		2203	4300	6503	SO:0001589	frameshift_variant	11260				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding	g.chr12:64812755delT	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.370delT	12.37:g.64812755delT	ENSP00000327821:p.Phe126fs					XPOT_uc009zqm.1_Frame_Shift_Del_p.F34fs	p.F124fs	NM_007235	NP_009166	O43592	XPOT_HUMAN		GBM - Glioblastoma multiforme(28;0.0404)	6	796	+			124			Necessary for interaction with Ran, nuclear localization and nuclear import.		A6NLH1|O43784|Q8WUG2|Q9BVS7	Frame_Shift_Del	DEL	ENST00000332707.5	37	c.370delT	CCDS31852.1																																																																																				0.443	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235		7	478	NA	NA	NA	NA	NA	7	478	---	---	---	---
CEP89	84902	broad.mit.edu	37	19	33406382	33406382	+	Frame_Shift_Del	DEL	T	T	-			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr19:33406382delT	ENST00000305768.5	-	14	1514	c.1426delA	c.(1426-1428)accfs	p.T476fs		NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	476					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						TGGCCGTGGGTTTTTGCCTCC	0.443																																							uc002nty.2		NA																	0					0						c.(1426-1428)ACCfs		coiled-coil domain containing 123							76.0	70.0	72.0					19																	33406382		2203	4300	6503	SO:0001589	frameshift_variant	84902					centrosome|spindle pole		g.chr19:33406382delT	AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.1426delA	19.37:g.33406382delT	ENSP00000306105:p.Thr476fs					CCDC123_uc002ntx.2_Frame_Shift_Del_p.T229fs|CCDC123_uc010edg.2_RNA|CCDC123_uc002ntz.1_Frame_Shift_Del_p.T475fs	p.T476fs	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN			14	1515	-	Esophageal squamous(110;0.137)		476			Potential.		B9EGA6|Q8N5J8	Frame_Shift_Del	DEL	ENST00000305768.5	37	c.1426delA	CCDS32987.1																																																																																				0.443	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816		7	424	NA	NA	NA	NA	NA	7	424	---	---	---	---
WDR62	284403	broad.mit.edu	37	19	36583666	36583668	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	GCA	GCA	-	-	GCA	GCA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr19:36583666_36583668delGCA	ENST00000270301.7	+	19	2286_2288	c.2286_2288delGCA	c.(2284-2289)cggcag>cgg	p.Q766del	WDR62_ENST00000401500.2_In_Frame_Del_p.Q766del			O43379	WDR62_HUMAN	WD repeat domain 62	766					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TTGACCACCGGCAGCAGCAGCAG	0.616																																							uc002odc.2		NA																	0					0						c.(2284-2289)CGGCAG>CGG		WD repeat domain 62 isoform 2																																				SO:0001651	inframe_deletion	284403				cerebral cortex development	nucleus		g.chr19:36583666_36583668delGCA	BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.2286_2288delGCA	19.37:g.36583675_36583677delGCA	ENSP00000270301:p.Gln766del					WDR62_uc002odd.2_In_Frame_Del_p.Q766del	p.Q766del	NM_173636	NP_775907	O43379	WDR62_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.06)		19	2377_2379	+	Esophageal squamous(110;0.162)		766					Q63HP9|Q659D7|Q8NBF7|Q96AD9	In_Frame_Del	DEL	ENST00000270301.7	37	c.2286_2288delGCA	CCDS33001.1																																																																																				0.616	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1	NM_015671		9	647	NA	NA	NA	NA	NA	9	647	---	---	---	---
LYPD3	27076	broad.mit.edu	37	19	43969653	43969655	+	In_Frame_Del	DEL	AGC	AGC	-	rs141441894	byFrequency	TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	AGC	AGC	-	-	AGC	AGC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr19:43969653_43969655delAGC	ENST00000244333.3	-	1	157_159	c.69_71delGCT	c.(67-72)ctgctt>ctt	p.23_24LL>L		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	23					cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				ACCTCCGCGAAGCAGCAGCAGCA	0.675																																							uc002owl.1		NA																	0				pancreas(1)	1						c.(67-72)CTGCTT>CTT		GPI-anchored metastasis-associated protein																																				SO:0001651	inframe_deletion	27076					anchored to plasma membrane		g.chr19:43969653_43969655delAGC	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.69_71delGCT	19.37:g.43969662_43969664delAGC	ENSP00000244333:p.Leu24del					LYPD3_uc002owm.2_In_Frame_Del_p.23_24LL>L	p.23_24LL>L	NM_014400	NP_055215	O95274	LYPD3_HUMAN			1	177_179	-		Prostate(69;0.0153)	23_24					Q9UJ74	In_Frame_Del	DEL	ENST00000244333.3	37	c.69_71delGCT	CCDS12620.1																																																																																				0.675	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	NM_014400		9	244	NA	NA	NA	NA	NA	9	244	---	---	---	---
MET	4233	broad.mit.edu	37	7	116412042	116412045	+	Splice_Site	DEL	AGGT	AGGT	-			TCGA-50-6597-01A-11D-1855-08	TCGA-50-6597-10A-01D-1855-08	AGGT	AGGT	-	-	AGGT	AGGT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cd0aeed5-93a1-4287-8a88-fe6b7b5e3983	32788069-6806-4112-afe3-28e731a6d8db	g.chr7:116412042_116412045delAGGT	ENST00000318493.6	+	14	3268_3269	c.3081_3082delAGGT	c.(3079-3084)gaaggt>gagt	p.G1028fs	MET_ENST00000397752.3_Splice_Site_p.G1010fs			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.?(5)|p.982_1028del47(4)|p.L982_D1028del(3)|p.D981_D1028del(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CTTTTCCAGAAGGTATATTTCAGT	0.343			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		13	Unknown(7)|Deletion - In frame(6)	p.982_1028del47(4)|p.L982_D1028del(3)|p.?(3)|p.D981_D1028del(1)	lung(10)|stomach(2)|central_nervous_system(1)	upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.e14+1		met proto-oncogene isoform b precursor																																				SO:0001630	splice_region_variant	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116412042_116412045delAGGT	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3082+1AGGT>-	7.37:g.116412042_116412045delAGGT						MET_uc010lkh.2_Splice_Site_p.D1028_splice|MET_uc011knj.1_Splice_Site_p.D580_splice	p.D1010_splice	NM_000245	NP_000236	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		14	3215	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)						A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Splice_Site	DEL	ENST00000318493.6	37	c.3028_splice	CCDS47689.1																																																																																				0.343	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		Frame_Shift_Del	13	34	NA	NA	NA	NA	NA	13	34	---	---	---	---
