#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CFAP74	85452	broad.mit.edu	37	1	1920356	1920356	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:1920356C>T	ENST00000434971.2	-	3	156	c.124G>A	c.(124-126)Gag>Aag	p.E42K				Q69YW0	CA222_HUMAN		268								p.E42K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)	11	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ACGTCATCCTCAGCTTCCTGT	0.532																																							uc001aim.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(124-126)GAG>AAG		hypothetical protein LOC85452							53.0	56.0	55.0					1																	1920356		1850	4086	5936	SO:0001583	missense	85452							g.chr1:1920356C>T																												ENST00000434971.2:c.124G>A	1.37:g.1920356C>T	ENSP00000408078:p.Glu42Lys					KIAA1751_uc009vkz.1_Missense_Mutation_p.E42K|KIAA1751_uc001ain.1_Missense_Mutation_p.E42K	p.E42K	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)	3	280	-	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)	42						Missense_Mutation	SNP	ENST00000434971.2	37	c.124G>A		.	.	.	.	.	.	.	.	.	.	c	12.01	1.808471	0.31961	.	.	ENSG00000142609	ENST00000270720;ENST00000378590;ENST00000434971	T;T	0.61627	0.09;0.12	3.4	1.49	0.22878	.	.	.	.	.	T	0.37210	0.0995	L	0.27053	0.805	0.09310	N	1	B;B	0.33318	0.123;0.408	B;B	0.28139	0.063;0.086	T	0.17623	-1.0363	9	0.41790	T	0.15	.	4.8969	0.13755	0.0:0.6597:0.2184:0.1219	.	42;42	Q9C0B2-2;Q9C0B2	.;K1751_HUMAN	K	42;33;42	ENSP00000367853:E33K;ENSP00000408078:E42K	ENSP00000270720:E42K	E	-	1	0	C1orf222	1910216	0.007000	0.16637	0.002000	0.10522	0.011000	0.07611	1.255000	0.32909	0.445000	0.26639	0.632000	0.83419	GAG		0.532	C1orf222-201	KNOWN	basic	protein_coding	protein_coding				12	55	0	0	0	0.00499	0	12	55				
ID3	3399	broad.mit.edu	37	1	23885762	23885762	+	Silent	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:23885762C>T	ENST00000374561.5	-	1	523	c.156G>A	c.(154-156)cgG>cgA	p.R52R	ID3_ENST00000486541.1_5'UTR	NM_002167.4	NP_002158.3	Q02535	ID3_HUMAN	inhibitor of DNA binding 3, dominant negative helix-loop-helix protein	52	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				central nervous system development (GO:0007417)|epithelial cell differentiation (GO:0030855)|heart development (GO:0007507)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|notochord development (GO:0030903)|odontogenesis (GO:0042476)|positive regulation of apoptotic process (GO:0043065)|regulation of cell cycle (GO:0051726)|regulation of DNA replication (GO:0006275)|response to wounding (GO:0009611)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R52R(2)		central_nervous_system(1)|lung(3)	4		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00314)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;8.83e-25)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;6.5e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		GTACCAGTTCCCGCAGGCGGG	0.642																																							uc001bhh.3		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)	1						c.(154-156)CGG>CGA		inhibitor of DNA binding 3							49.0	52.0	51.0					1																	23885762		2203	4300	6503	SO:0001819	synonymous_variant	3399				negative regulation of sequence-specific DNA binding transcription factor activity		transcription corepressor activity	g.chr1:23885762C>T	X69111	CCDS237.1	1p36.13-p36.12	2013-05-21			ENSG00000117318	ENSG00000117318		"""Basic helix-loop-helix proteins"""	5362	protein-coding gene	gene with protein product		600277				1628620	Standard	NM_002167		Approved	HEIR-1, bHLHb25	uc001bhh.4	Q02535	OTTHUMG00000003229	ENST00000374561.5:c.156G>A	1.37:g.23885762C>T						ID3_uc001bhg.1_Silent_p.R52R	p.R52R	NM_002167	NP_002158	Q02535	ID3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;8.83e-25)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;6.5e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)	1	561	-		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00314)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)	52			Helix-loop-helix motif.		A8K1T8|O75641	Silent	SNP	ENST00000374561.5	37	c.156G>A	CCDS237.1																																																																																				0.642	ID3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008904.1	NM_002167		32	145	0	0	0	0.004289	0	32	145				
TSSK3	81629	broad.mit.edu	37	1	32829545	32829545	+	Silent	SNP	G	G	C	rs371546975		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:32829545G>C	ENST00000373534.3	+	2	1000	c.495G>C	c.(493-495)ctG>ctC	p.L165L	FAM229A_ENST00000415596.1_Intron|FAM229A_ENST00000432622.1_5'Flank	NM_052841.3	NP_443073.1	Q96PN8	TSSK3_HUMAN	testis-specific serine kinase 3	165	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.L165L(2)		NS(1)|large_intestine(6)|lung(5)|skin(2)|stomach(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.17)|Breast(348;0.212)				ACCGGGAGCTGAGCCAGACCT	0.572																																							uc001bvf.2		NA																	2	Substitution - coding silent(2)		lung(2)	stomach(1)	1						c.(493-495)CTG>CTC		testis-specific serine kinase 3							88.0	71.0	77.0					1																	32829545		2203	4300	6503	SO:0001819	synonymous_variant	81629				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr1:32829545G>C	AF296450	CCDS362.1	1p35-p34	2008-02-05	2005-03-10	2005-03-12	ENSG00000162526	ENSG00000162526			15473	protein-coding gene	gene with protein product		607660	"""serine/threonine kinase 22C (spermiogenesis associated)"""	STK22C		11597141	Standard	NM_052841		Approved	SPOGA3	uc001bvf.3	Q96PN8	OTTHUMG00000007585	ENST00000373534.3:c.495G>C	1.37:g.32829545G>C						uc001bve.1_5'Flank	p.L165L	NM_052841	NP_443073	Q96PN8	TSSK3_HUMAN			2	936	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.17)|Breast(348;0.212)	165			Protein kinase.		Q5TEE5	Silent	SNP	ENST00000373534.3	37	c.495G>C	CCDS362.1																																																																																				0.572	TSSK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020049.1			54	102	0	0	0	0.01441	0	54	102				
PIK3R3	8503	broad.mit.edu	37	1	46511639	46511639	+	Missense_Mutation	SNP	A	A	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:46511639A>G	ENST00000262741.5	-	9	1827	c.1138T>C	c.(1138-1140)Ttc>Ctc	p.F380L	PIK3R3_ENST00000340332.6_Missense_Mutation_p.F285L|PIK3R3_ENST00000372006.1_Missense_Mutation_p.F380L|PIK3R3_ENST00000354242.4_Missense_Mutation_p.F321L|PIK3R3_ENST00000540385.1_Missense_Mutation_p.F426L|PIK3R3_ENST00000423209.1_Missense_Mutation_p.F321L|PIK3R3_ENST00000488808.1_5'UTR|RP4-533D7.4_ENST00000450004.1_RNA|PIK3R3_ENST00000420542.1_Missense_Mutation_p.F380L	NM_003629.3	NP_003620.3	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)	380	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)	p.F380L(1)		endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	CGAATTAAGAATGCACCATCA	0.398																																							uc001cpb.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1138-1140)TTC>CTC		phosphoinositide-3-kinase, regulatory subunit 3							184.0	171.0	175.0					1																	46511639		2203	4300	6503	SO:0001583	missense	8503				insulin receptor signaling pathway|platelet activation|T cell costimulation		1-phosphatidylinositol-3-kinase activity|protein binding	g.chr1:46511639A>G	BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000262741.5:c.1138T>C	1.37:g.46511639A>G	ENSP00000262741:p.Phe380Leu					PIK3R3_uc009vyb.2_Missense_Mutation_p.F321L|PIK3R3_uc009vyc.2_Missense_Mutation_p.F397L|PIK3R3_uc001cpc.3_Missense_Mutation_p.F380L|PIK3R3_uc010olw.1_Missense_Mutation_p.F426L|PIK3R3_uc010olv.1_Missense_Mutation_p.F170L	p.F380L	NM_003629	NP_003620	Q92569	P55G_HUMAN			9	1894	-	Acute lymphoblastic leukemia(166;0.155)		380			SH2 2.		B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	Missense_Mutation	SNP	ENST00000262741.5	37	c.1138T>C	CCDS529.1	.	.	.	.	.	.	.	.	.	.	A	36	5.663592	0.96745	.	.	ENSG00000117461	ENST00000372006;ENST00000262741;ENST00000420542;ENST00000354242;ENST00000340332;ENST00000540385;ENST00000423209	D;D;D;D;D;D;D	0.96885	-4.16;-4.16;-4.16;-4.16;-4.16;-4.16;-4.16	6.08	6.08	0.98989	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.99155	0.9708	H	0.99675	4.695	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.97110	0.991;1.0;0.947;1.0	D	0.98735	1.0714	10	0.87932	D	0	-9.5529	16.6438	0.85155	1.0:0.0:0.0:0.0	.	426;413;321;380	F6TDL0;Q7Z3W2;Q92569-2;Q92569	.;.;.;P55G_HUMAN	L	380;380;380;321;285;426;321	ENSP00000361075:F380L;ENSP00000262741:F380L;ENSP00000412546:F380L;ENSP00000346188:F321L;ENSP00000342484:F285L;ENSP00000439913:F426L;ENSP00000391431:F321L	ENSP00000262741:F380L	F	-	1	0	PIK3R3	46284226	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.333000	0.79357	0.533000	0.62120	TTC		0.398	PIK3R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022171.1	NM_003629		30	132	0	0	0	0.013726	0	30	132				
MROH7	374977	broad.mit.edu	37	1	55175634	55175634	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:55175634G>A	ENST00000421030.2	+	24	4031	c.3746G>A	c.(3745-3747)aGa>aAa	p.R1249K	MROH7-TTC4_ENST00000414150.2_Intron|MROH7_ENST00000454855.2_Missense_Mutation_p.R767K|MROH7_ENST00000409996.1_Missense_Mutation_p.R817K	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	1249						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.R1246K(2)|p.R1249K(2)									GATAACTTGAGACATGACCCA	0.572																																							uc010ooe.1		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(3745-3747)AGA>AAA		hypothetical protein LOC374977							82.0	84.0	84.0					1																	55175634		2032	4192	6224	SO:0001583	missense	374977					integral to membrane	binding	g.chr1:55175634G>A	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.3746G>A	1.37:g.55175634G>A	ENSP00000396622:p.Arg1249Lys					C1orf175_uc001cxq.2_Intron|C1orf175_uc001cxs.2_RNA|C1orf175_uc010ood.1_Missense_Mutation_p.R767K|C1orf175_uc010oof.1_RNA|C1orf175_uc001cxr.1_RNA|C1orf175_uc009vzq.1_RNA|C1orf175_uc001cxt.1_RNA|C1orf175_uc009vzr.1_Missense_Mutation_p.R450K	p.R1249K	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN			24	4070	+			1249					A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	ENST00000421030.2	37	c.3746G>A	CCDS41342.2	.	.	.	.	.	.	.	.	.	.	g	18.52	3.641655	0.67244	.	.	ENSG00000184313	ENST00000421030;ENST00000409996;ENST00000454855;ENST00000371287	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.06	5.06	0.68205	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.45816	0.1361	L	0.57536	1.79	0.29943	N	0.820898	D;D	0.67145	0.996;0.974	D;D	0.75484	0.986;0.953	T	0.35450	-0.9788	9	0.02654	T	1	.	13.9175	0.63908	0.0:0.0:1.0:0.0	.	1249;1248	Q68CQ1;Q68CQ1-9	HEAT8_HUMAN;.	K	1249;817;767;318	ENSP00000396622:R1249K;ENSP00000387048:R817K;ENSP00000401130:R767K;ENSP00000360336:R318K	ENSP00000360336:R318K	R	+	2	0	HEATR8	54948222	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.188000	0.50958	2.335000	0.79485	0.586000	0.80456	AGA		0.572	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547		25	116	0	0	0	0.00632	0	25	116				
SRSF11	9295	broad.mit.edu	37	1	70687463	70687463	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:70687463G>C	ENST00000370950.3	+	2	226	c.144G>C	c.(142-144)caG>caC	p.Q48H	SRSF11_ENST00000405432.1_Missense_Mutation_p.Q48H|SRSF11_ENST00000454435.2_Missense_Mutation_p.Q48H|SRSF11_ENST00000370951.1_Missense_Mutation_p.Q48H|SRSF11_ENST00000436161.2_Missense_Mutation_p.Q48H|RP4-677H15.4_ENST00000422107.1_RNA			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11	48	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q48H(2)		large_intestine(3)|ovary(2)|skin(1)	6						GCTCTGAGCAGATGCGGACTC	0.647																																							uc001des.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(142-144)CAG>CAC		splicing factor, arginine/serine-rich 11							79.0	81.0	81.0					1																	70687463		2203	4300	6503	SO:0001583	missense	9295				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr1:70687463G>C	M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.144G>C	1.37:g.70687463G>C	ENSP00000359988:p.Gln48His					SFRS11_uc009wbi.2_Missense_Mutation_p.Q48H|SFRS11_uc009wbj.1_Missense_Mutation_p.Q48H|SFRS11_uc010oqo.1_Missense_Mutation_p.Q48H|SFRS11_uc001det.2_Missense_Mutation_p.Q48H|SFRS11_uc001deu.2_Missense_Mutation_p.Q48H	p.Q48H	NM_004768	NP_004759	Q05519	SRS11_HUMAN			2	268	+			48			RRM.		Q5T758|Q8IWE6	Missense_Mutation	SNP	ENST00000370950.3	37	c.144G>C	CCDS647.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.750831	0.89753	.	.	ENSG00000116754	ENST00000370951;ENST00000370950;ENST00000405432;ENST00000454435;ENST00000395136;ENST00000436161	T;T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29;2.29	5.29	5.29	0.74685	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.39384	0.1076	M	0.82132	2.575	0.80722	D	1	D;D;D;D;D;D	0.89917	0.996;1.0;0.996;0.996;0.996;0.996	D;D;D;D;D;D	0.91635	0.994;0.999;0.992;0.995;0.995;0.995	T	0.38394	-0.9663	10	0.72032	D	0.01	.	18.5283	0.90981	0.0:0.0:1.0:0.0	.	48;48;48;48;48;48	B4DTC1;B4DWT1;Q05BU6;Q6PJB9;Q8IWE6;Q05519	.;.;.;.;.;SRS11_HUMAN	H	48	ENSP00000359989:Q48H;ENSP00000359988:Q48H;ENSP00000384357:Q48H;ENSP00000411159:Q48H;ENSP00000378568:Q48H;ENSP00000405120:Q48H	ENSP00000359988:Q48H	Q	+	3	2	SRSF11	70460051	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.677000	0.68142	2.465000	0.83290	0.462000	0.41574	CAG		0.647	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025889.1	NM_004768		100	109	0	0	0	0.01441	0	100	109				
LRRC53	100144878	broad.mit.edu	37	1	74957833	74957833	+	Intron	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:74957833C>A	ENST00000294635.4	-	2	89				TNNI3K_ENST00000326637.3_Missense_Mutation_p.S745Y|TNNI3K_ENST00000370891.2_Missense_Mutation_p.S846Y|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.S859Y			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53							integral component of membrane (GO:0016021)		p.S745Y(1)		NS(1)|breast(1)|lung(2)	4						CCTTCTTCTTCTTCTGATTGC	0.478																																							uc001dgf.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						c.(2233-2235)TCT>TAT		TNNI3 interacting kinase isoform b							197.0	199.0	199.0					1																	74957833		2203	4300	6503	SO:0001627	intron_variant	51086					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding	g.chr1:74957833C>A			1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.26-8774G>T	1.37:g.74957833C>A						TNNI3K_uc001dge.1_Missense_Mutation_p.S846Y	p.S745Y	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN			23	2285	+			745			Poly-Ser.			Missense_Mutation	SNP	ENST00000294635.4	37	c.2234C>A		.	.	.	.	.	.	.	.	.	.	C	22.4	4.289012	0.80914	.	.	ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000557284;ENST00000370891;ENST00000326637	T;T;T	0.75589	-0.95;-0.95;-0.94	5.59	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.59473	0.2196	L	0.34521	1.04	0.53688	D	0.999977	P;P	0.49358	0.886;0.923	B;P	0.46110	0.345;0.504	T	0.67577	-0.5635	10	0.87932	D	0	.	14.265	0.66110	0.0:0.9285:0.0:0.0715	.	745;846	Q59H18;Q59H18-1	TNI3K_HUMAN;.	Y	846;846;745	ENSP00000450895:S846Y;ENSP00000359928:S846Y;ENSP00000322251:S745Y	ENSP00000322251:S745Y	S	+	2	0	RP11-653A5.2;AC093158.1	74730421	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	5.433000	0.66520	1.370000	0.46153	0.655000	0.94253	TCT		0.478	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000026515.2			63	281	1	0	1.31171e-36	0.01441	1.65485e-36	63	281				
LHX8	431707	broad.mit.edu	37	1	75608822	75608822	+	Missense_Mutation	SNP	T	T	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:75608822T>G	ENST00000294638.5	+	6	1073	c.409T>G	c.(409-411)Tct>Gct	p.S137A	LHX8_ENST00000356261.3_Missense_Mutation_p.S127A	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	137	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.S137A(2)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						AACTCGCTGCTCTCGATGTGG	0.443																																							uc001dgo.2		NA																	2	Substitution - Missense(2)	p.S137F(1)	lung(2)	ovary(3)	3						c.(409-411)TCT>GCT		LIM homeobox 8							98.0	93.0	95.0					1																	75608822		2203	4299	6502	SO:0001583	missense	431707					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:75608822T>G	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.409T>G	1.37:g.75608822T>G	ENSP00000294638:p.Ser137Ala					LHX8_uc001dgq.2_Missense_Mutation_p.S76A	p.S137A	NM_001001933	NP_001001933	Q68G74	LHX8_HUMAN			6	1073	+			137			LIM zinc-binding 2.		E9PGE3	Missense_Mutation	SNP	ENST00000294638.5	37	c.409T>G	CCDS30756.1	.	.	.	.	.	.	.	.	.	.	T	4.607	0.112893	0.08831	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.86297	-2.1;-2.1	5.3	5.3	0.74995	Zinc finger, LIM-type (5);	0.101236	0.64402	D	0.000002	T	0.51075	0.1653	N	0.02357	-0.585	0.53005	D	0.999961	B	0.18013	0.025	B	0.15052	0.012	T	0.58239	-0.7671	10	0.02654	T	1	.	15.5608	0.76244	0.0:0.0:0.0:1.0	.	137	Q68G74	LHX8_HUMAN	A	137;127	ENSP00000294638:S137A;ENSP00000348597:S127A	ENSP00000294638:S137A	S	+	1	0	LHX8	75381410	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.005000	0.40864	2.149000	0.67028	0.528000	0.53228	TCT		0.443	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933		17	61	0	0	0	0.010504	0	17	61				
CLCA2	9635	broad.mit.edu	37	1	86900422	86900422	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:86900422G>T	ENST00000370565.4	+	6	1128	c.966G>T	c.(964-966)atG>atT	p.M322I		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	322	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		CCAGCAAGATGGCAGAGGTAA	0.398																																					Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	uc001dlr.3		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(964-966)ATG>ATT		chloride channel accessory 2 precursor							111.0	94.0	99.0					1																	86900422		2203	4300	6503	SO:0001583	missense	9635				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:86900422G>T		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.966G>T	1.37:g.86900422G>T	ENSP00000359596:p.Met322Ile						p.M322I	NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN		all cancers(265;0.0233)|Epithelial(280;0.0452)	6	1128	+		Lung NSC(277;0.238)	322			VWFA.|Extracellular (Potential).		A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	37	c.966G>T	CCDS708.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350958	0.82132	.	.	ENSG00000137975	ENST00000370565	T	0.32023	1.47	6.17	6.17	0.99709	von Willebrand factor, type A (3);	0.042346	0.85682	D	0.000000	T	0.34629	0.0904	M	0.79123	2.44	0.48236	D	0.999618	P	0.47034	0.889	P	0.46758	0.526	T	0.19160	-1.0314	10	0.62326	D	0.03	-33.3429	14.969	0.71217	0.0693:0.0:0.9307:0.0	.	322	Q9UQC9	CLCA2_HUMAN	I	322	ENSP00000359596:M322I	ENSP00000359596:M322I	M	+	3	0	CLCA2	86673010	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.203000	0.65174	2.941000	0.99782	0.655000	0.94253	ATG		0.398	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536		5	131	1	0	0.000602214	0.000602	0.000620904	5	131				
CLCA4	22802	broad.mit.edu	37	1	87045236	87045236	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:87045236G>C	ENST00000370563.3	+	13	2364	c.2322G>C	c.(2320-2322)tgG>tgC	p.W774C	RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	774					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)	p.W774C(2)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		TTCTTACATGGACAGCACCAG	0.408																																							uc009wcs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(2320-2322)TGG>TGC		chloride channel accessory 4							132.0	118.0	122.0					1																	87045236		1902	4124	6026	SO:0001583	missense	22802					apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:87045236G>C	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.2322G>C	1.37:g.87045236G>C	ENSP00000359594:p.Trp774Cys					CLCA4_uc009wct.2_Missense_Mutation_p.W537C|CLCA4_uc009wcu.2_Missense_Mutation_p.W594C	p.W774C	NM_012128	NP_036260	Q14CN2	CLCA4_HUMAN		all cancers(265;0.0202)|Epithelial(280;0.0404)	13	2366	+		Lung NSC(277;0.238)	774					A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	ENST00000370563.3	37	c.2322G>C	CCDS41355.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432588	0.62844	.	.	ENSG00000016602	ENST00000370563	T	0.15603	2.41	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000001	T	0.46927	0.1418	M	0.91196	3.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.59101	-0.7517	10	0.87932	D	0	-6.7086	18.9783	0.92746	0.0:0.0:1.0:0.0	.	326;774	Q9NXP1;Q14CN2	.;CLCA4_HUMAN	C	774	ENSP00000359594:W774C	ENSP00000359594:W774C	W	+	3	0	CLCA4	86817824	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	6.820000	0.75267	2.567000	0.86603	0.563000	0.77884	TGG		0.408	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128		47	74	0	0	0	0.01441	0	47	74				
S1PR1	1901	broad.mit.edu	37	1	101705580	101705580	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:101705580G>T	ENST00000305352.6	+	2	1415	c.1040G>T	c.(1039-1041)gGc>gTc	p.G347V		NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	347					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.G347V(1)		NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						ATCATCGCCGGCATGGAATTC	0.552																																							uc001dud.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(1039-1041)GGC>GTC		sphingosine-1-phosphate receptor 1							73.0	78.0	76.0					1																	101705580		2201	4300	6501	SO:0001583	missense	1901				cell adhesion	integral to membrane	lysosphingolipid and lysophosphatidic acid receptor activity	g.chr1:101705580G>T	M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.1040G>T	1.37:g.101705580G>T	ENSP00000305416:p.Gly347Val					S1PR1_uc009weg.2_Missense_Mutation_p.G347V	p.G347V	NM_001400	NP_001391	P21453	S1PR1_HUMAN			2	1554	+			347			Cytoplasmic (By similarity).		D3DT66|Q9BYY4|Q9NYN8	Missense_Mutation	SNP	ENST00000305352.6	37	c.1040G>T	CCDS777.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.13|19.13	3.768647|3.768647	0.69878|0.69878	.|.	.|.	ENSG00000170989|ENSG00000170989	ENST00000424264|ENST00000305352	.|T	.|0.72835	.|-0.69	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.69450|0.69450	0.3112|0.3112	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|P	.|0.51449	.|0.945	.|P	.|0.52343	.|0.696	T|T	0.72040|0.72040	-0.4410|-0.4410	6|10	0.08837|0.54805	T|T	0.75|0.06	.|.	18.8225|18.8225	0.92103|0.92103	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|347	.|P21453	.|S1PR1_HUMAN	S|V	330|347	.|ENSP00000305416:G347V	ENSP00000413066:A330S|ENSP00000305416:G347V	A|G	+|+	1|2	0|0	S1PR1|S1PR1	101478168|101478168	1.000000|1.000000	0.71417|0.71417	0.138000|0.138000	0.22173|0.22173	0.809000|0.809000	0.45718|0.45718	9.869000|9.869000	0.99810|0.99810	2.436000|2.436000	0.82500|0.82500	0.305000|0.305000	0.20034|0.20034	GCA|GGC		0.552	S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029908.1	NM_001400		61	242	1	0	1.82294e-38	0.01441	2.30957e-38	61	242				
COL11A1	1301	broad.mit.edu	37	1	103364245	103364245	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:103364245G>A	ENST00000370096.3	-	56	4537	c.4225C>T	c.(4225-4227)Ctt>Ttt	p.L1409F	COL11A1_ENST00000512756.1_Missense_Mutation_p.L1293F|COL11A1_ENST00000353414.4_Missense_Mutation_p.L1370F|COL11A1_ENST00000358392.2_Missense_Mutation_p.L1421F	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1409	Collagen-like 6.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.L1409F(2)|p.L1421F(2)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ATGCCCCGAAGACCTTCTGGA	0.453																																							uc001dul.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(4225-4227)CTT>TTT		alpha 1 type XI collagen isoform A							46.0	49.0	48.0					1																	103364245		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103364245G>A	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4225C>T	1.37:g.103364245G>A	ENSP00000359114:p.Leu1409Phe					COL11A1_uc001duk.2_Missense_Mutation_p.L605F|COL11A1_uc001dum.2_Missense_Mutation_p.L1421F|COL11A1_uc001dun.2_Missense_Mutation_p.L1370F|COL11A1_uc009weh.2_Missense_Mutation_p.L1293F	p.L1409F	NM_001854	NP_001845	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	56	4543	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	1409			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.4225C>T	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626916	0.66901	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.94862	-3.54;-3.54;-3.54;-3.54	5.95	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.93993	0.8076	L	0.35593	1.075	0.53005	D	0.99996	D;D;D;D;D	0.76494	0.999;0.999;0.988;0.999;0.997	D;D;D;D;P	0.75020	0.958;0.929;0.979;0.985;0.899	D	0.94166	0.7419	10	0.62326	D	0.03	.	12.8773	0.57998	0.0745:0.0:0.9255:0.0	.	1293;1370;1421;1409;629	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	F	1409;1421;1370;629;1293	ENSP00000359114:L1409F;ENSP00000351163:L1421F;ENSP00000302551:L1370F;ENSP00000426533:L1293F	ENSP00000302551:L1370F	L	-	1	0	COL11A1	103136833	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.582000	0.74049	2.821000	0.97095	0.650000	0.86243	CTT		0.453	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		43	69	0	0	0	0.01441	0	43	69				
RBM15	64783	broad.mit.edu	37	1	110882847	110882847	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:110882847G>A	ENST00000369784.3	+	1	1720	c.820G>A	c.(820-822)Ggg>Agg	p.G274R	RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000487146.2_Missense_Mutation_p.G274R|RBM15_ENST00000602849.1_Missense_Mutation_p.G274R	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	274					negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G274R(1)		ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CAGTGTGGTCGGGGCCTCTGT	0.597			T	MKL1	acute megakaryocytic leukemia																																		uc001dzl.1		NA		Dom	yes		1	1p13	64783	T	RNA binding motif protein 15			L	MKL1		acute megakaryocytic leukemia		1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(820-822)GGG>AGG		RNA binding motif protein 15							67.0	75.0	72.0					1																	110882847		2203	4300	6503	SO:0001583	missense	64783				interspecies interaction between organisms	nucleus	nucleotide binding|protein binding|RNA binding	g.chr1:110882847G>A	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.820G>A	1.37:g.110882847G>A	ENSP00000358799:p.Gly274Arg					RBM15_uc001dzm.1_Missense_Mutation_p.G274R|uc001dzj.2_5'Flank	p.G274R	NM_022768	NP_073605	Q96T37	RBM15_HUMAN		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)	1	903	+		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)	274					A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	ENST00000369784.3	37	c.820G>A	CCDS822.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.805874	0.31961	.	.	ENSG00000162775	ENST00000369784	T	0.17370	2.28	4.88	4.88	0.63580	.	0.000000	0.45867	D	0.000331	T	0.02083	0.0065	N	0.08118	0	0.20074	N	0.999935	B;B	0.32350	0.034;0.366	B;B	0.15870	0.013;0.014	T	0.37934	-0.9684	10	0.16896	T	0.51	-10.0624	9.0404	0.36314	0.0986:0.0:0.9014:0.0	.	274;274	Q96T37-3;Q96T37	.;RBM15_HUMAN	R	274	ENSP00000358799:G274R	ENSP00000358799:G274R	G	+	1	0	RBM15	110684370	1.000000	0.71417	0.614000	0.29051	0.978000	0.69477	6.330000	0.72925	2.531000	0.85337	0.563000	0.77884	GGG		0.597	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768		54	178	0	0	0	0.01441	0	54	178				
MAN1A2	10905	broad.mit.edu	37	1	117944871	117944871	+	Silent	SNP	A	A	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:117944871A>C	ENST00000356554.3	+	2	1101	c.366A>C	c.(364-366)gcA>gcC	p.A122A	MAN1A2_ENST00000482811.1_Intron	NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	122					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.A122A(2)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		TGGAAGAAGCAAAAGAAAAAT	0.373																																					Ovarian(33;199 881 8228 13687 31538)	Ovarian(33;199 881 8228 13687 31538)	uc001ehd.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(364-366)GCA>GCC		mannosidase, alpha, class 1A, member 2							63.0	68.0	66.0					1																	117944871		2201	4300	6501	SO:0001819	synonymous_variant	10905				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity	g.chr1:117944871A>C	AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.366A>C	1.37:g.117944871A>C						MAN1A2_uc009whg.1_Intron	p.A122A	NM_006699	NP_006690	O60476	MA1A2_HUMAN		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)	2	1087	+	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)	122			Lumenal (Potential).		Q9H510	Silent	SNP	ENST00000356554.3	37	c.366A>C	CCDS895.1																																																																																				0.373	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033593.1	NM_006699		10	34	0	0	0	0.006214	0	10	34				
FLG	2312	broad.mit.edu	37	1	152284211	152284211	+	Missense_Mutation	SNP	G	G	A	rs201961522		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:152284211G>A	ENST00000368799.1	-	3	3186	c.3151C>T	c.(3151-3153)Cgc>Tgc	p.R1051C	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1051	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTTGTCTGCGCGGAATGCCT	0.562									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(3151-3153)CGC>TGC		filaggrin							401.0	396.0	398.0					1																	152284211		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152284211G>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3151C>T	1.37:g.152284211G>A	ENSP00000357789:p.Arg1051Cys					uc001ezv.2_5'Flank	p.R1051C	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	3187	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1051			Filaggrin 6.|Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.3151C>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	7.000	0.554773	0.13436	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.04275	3.66	3.85	1.9	0.25705	.	.	.	.	.	T	0.03305	0.0096	L	0.54323	1.7	0.09310	N	1	D	0.63880	0.993	P	0.52343	0.696	T	0.37361	-0.9709	9	0.54805	T	0.06	.	4.3004	0.10922	0.1218:0.0:0.6539:0.2244	.	1051	P20930	FILA_HUMAN	C	1051;258	ENSP00000357789:R1051C	ENSP00000357789:R1051C	R	-	1	0	FLG	150550835	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.196000	0.09532	0.286000	0.22352	0.299000	0.19835	CGC		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		338	489	0	0	0	0.01441	0	338	489				
KPRP	448834	broad.mit.edu	37	1	152733114	152733114	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:152733114C>G	ENST00000606109.1	+	1	1078	c.1050C>G	c.(1048-1050)atC>atG	p.I350M	KPRP_ENST00000368773.1_Missense_Mutation_p.I350M			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	350	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.I350M(2)		NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCCTCCCATCAGACGCCGCT	0.652																																							uc001fal.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(1048-1050)ATC>ATG		keratinocyte proline-rich protein							44.0	48.0	46.0					1																	152733114		2203	4300	6503	SO:0001583	missense	448834					cytoplasm		g.chr1:152733114C>G	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1050C>G	1.37:g.152733114C>G	ENSP00000475216:p.Ile350Met						p.I350M	NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	1108	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		350			Pro-rich.			Missense_Mutation	SNP	ENST00000606109.1	37	c.1050C>G	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.601379	0.46423	.	.	ENSG00000203786	ENST00000368773	T	0.13901	2.55	5.3	2.21	0.28008	.	0.134432	0.34110	N	0.004248	T	0.08492	0.0211	L	0.32530	0.975	0.20489	N	0.999891	D	0.64830	0.994	P	0.61592	0.891	T	0.10636	-1.0621	10	0.66056	D	0.02	-3.9791	5.1366	0.14937	0.3598:0.5361:0.0:0.1041	.	350	Q5T749	KPRP_HUMAN	M	350	ENSP00000357762:I350M	ENSP00000357762:I350M	I	+	3	3	KPRP	150999738	0.054000	0.20591	0.529000	0.27951	0.739000	0.42172	-0.149000	0.10204	0.239000	0.21243	0.462000	0.41574	ATC		0.652	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231		35	100	0	0	0	0.004878	0	35	100				
DCST1	149095	broad.mit.edu	37	1	155015885	155015885	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:155015885G>A	ENST00000295542.1	+	10	1168	c.1072G>A	c.(1072-1074)Gag>Aag	p.E358K	RP11-307C12.11_ENST00000452962.1_RNA|DCST1_ENST00000392480.1_Missense_Mutation_p.E358K|DCST1_ENST00000368419.2_Missense_Mutation_p.E358K|DCST1_ENST00000423025.2_Missense_Mutation_p.E333K	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	358						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.E358K(2)		breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			CGTGAGCACCGAGGTGCGGGA	0.667																																							uc001fgn.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(1072-1074)GAG>AAG		DC-STAMP domain containing 1 isoform 1							65.0	61.0	63.0					1																	155015885		2203	4300	6503	SO:0001583	missense	149095					integral to membrane	zinc ion binding	g.chr1:155015885G>A	AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.1072G>A	1.37:g.155015885G>A	ENSP00000295542:p.Glu358Lys					DCST1_uc010per.1_Missense_Mutation_p.E383K|DCST1_uc010pes.1_Missense_Mutation_p.E333K	p.E358K	NM_152494	NP_689707	Q5T197	DCST1_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.000434)		10	1168	+	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		358			Extracellular (Potential).		B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	ENST00000295542.1	37	c.1072G>A	CCDS1083.1	.	.	.	.	.	.	.	.	.	.	g	16.82	3.228104	0.58777	.	.	ENSG00000163357	ENST00000295542;ENST00000392480;ENST00000423025;ENST00000368419	T;T;T;T	0.24350	1.87;1.86;1.89;1.86	4.23	4.23	0.50019	.	0.434585	0.22258	N	0.062453	T	0.29458	0.0734	M	0.70595	2.14	0.37433	D	0.914091	D;D;D	0.76494	0.999;0.998;0.999	P;P;P	0.57548	0.758;0.716;0.823	T	0.04693	-1.0933	10	0.26408	T	0.33	-18.4532	12.0196	0.53336	0.0:0.0:1.0:0.0	.	333;383;358	E9PHV3;E9PJX3;Q5T197	.;.;DCST1_HUMAN	K	358;358;333;358	ENSP00000295542:E358K;ENSP00000376271:E358K;ENSP00000387369:E333K;ENSP00000357404:E358K	ENSP00000295542:E358K	E	+	1	0	DCST1	153282509	1.000000	0.71417	0.945000	0.38365	0.197000	0.23852	4.919000	0.63383	2.195000	0.70347	0.479000	0.44913	GAG		0.667	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099006.1	NM_152494		27	109	0	0	0	0.00632	0	27	109				
PIGM	93183	broad.mit.edu	37	1	160001137	160001137	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:160001137C>G	ENST00000368090.2	-	1	646	c.393G>C	c.(391-393)tgG>tgC	p.W131C		NM_145167.2	NP_660150.1	Q9H3S5	PIGM_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class M	131					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)	p.W131C(2)		kidney(1)|large_intestine(4)|lung(9)|ovary(2)|skin(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGTTAAGAAGCCAAAAGACAC	0.562																																							uc001fuv.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(391-393)TGG>TGC		phosphatidylinositol glycan anchor biosynthesis,							39.0	45.0	43.0					1																	160001137		2203	4300	6503	SO:0001583	missense	93183				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane		g.chr1:160001137C>G	AB028127	CCDS1192.1	1q23.2	2013-02-26	2006-06-28		ENSG00000143315	ENSG00000143315		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	18858	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 1"", ""DPM:GlcN-(acyl-)PI mannosyltransferase"", ""dol-P-Man dependent GPI mannosyltransferase"""	610273	"""phosphatidylinositol glycan, class M"""			11226175	Standard	NM_145167		Approved	GPI-MT-I	uc001fuv.1	Q9H3S5	OTTHUMG00000024081	ENST00000368090.2:c.393G>C	1.37:g.160001137C>G	ENSP00000357069:p.Trp131Cys						p.W131C	NM_145167	NP_660150	Q9H3S5	PIGM_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		1	647	-	all_hematologic(112;0.093)		131			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000368090.2	37	c.393G>C	CCDS1192.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.467678	0.84533	.	.	ENSG00000143315	ENST00000368090	T	0.60424	0.19	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.80904	0.4713	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85196	0.1012	9	.	.	.	-7.7681	16.9624	0.86275	0.0:1.0:0.0:0.0	.	131	Q9H3S5	PIGM_HUMAN	C	131	ENSP00000357069:W131C	.	W	-	3	0	PIGM	158267761	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.033000	0.76504	2.873000	0.98535	0.561000	0.74099	TGG		0.562	PIGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060643.2	NM_145167		12	22	0	0	0	0.004007	0	12	22				
FMO3	2328	broad.mit.edu	37	1	171083381	171083381	+	Missense_Mutation	SNP	A	A	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:171083381A>C	ENST00000367755.4	+	7	1173	c.1062A>C	c.(1060-1062)aaA>aaC	p.K354N	FMO3_ENST00000542847.1_Missense_Mutation_p.K334N|FMO3_ENST00000392085.2_Missense_Mutation_p.K354N|FMO3_ENST00000538429.1_Missense_Mutation_p.K291N	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	354					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)	p.K354N(2)		endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	TTTTATTTAAAGGAGTATTTC	0.443																																							uc001ghi.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1060-1062)AAA>AAC		flavin containing monooxygenase 3							88.0	87.0	88.0					1																	171083381		2203	4300	6503	SO:0001583	missense	2328				xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity	g.chr1:171083381A>C	BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.1062A>C	1.37:g.171083381A>C	ENSP00000356729:p.Lys354Asn					FMO3_uc001ghh.2_Missense_Mutation_p.K354N|FMO3_uc010pmb.1_Missense_Mutation_p.K334N|FMO3_uc010pmc.1_Missense_Mutation_p.K291N	p.K354N	NM_001002294	NP_001002294	P31513	FMO3_HUMAN			7	1173	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		354					B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	ENST00000367755.4	37	c.1062A>C	CCDS1292.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.597762	0.46318	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.80259	0.4590	M	0.92169	3.28	0.52501	D	0.999953	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.996	D	0.85249	0.1043	10	0.62326	D	0.03	-16.9086	14.5383	0.67976	1.0:0.0:0.0:0.0	.	291;334;354	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	N	354;354;334;291	ENSP00000356729:K354N;ENSP00000375935:K354N;ENSP00000444073:K334N;ENSP00000439500:K291N	ENSP00000356729:K354N	K	+	3	2	FMO3	169350005	0.481000	0.25941	1.000000	0.80357	0.232000	0.25224	0.977000	0.29475	1.952000	0.56665	0.528000	0.53228	AAA		0.443	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894		26	81	0	0	0	0.003954	0	26	81				
TNN	63923	broad.mit.edu	37	1	175049473	175049473	+	Missense_Mutation	SNP	G	G	T	rs367714075		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:175049473G>T	ENST00000239462.4	+	4	1072	c.959G>T	c.(958-960)gGt>gTt	p.G320V		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	320	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.G320V(2)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GAGATTCTTGGTTTGCTGCCT	0.537																																							uc001gkl.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(958-960)GGT>GTT		tenascin N precursor							123.0	116.0	119.0					1																	175049473		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175049473G>T	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.959G>T	1.37:g.175049473G>T	ENSP00000239462:p.Gly320Val					TNN_uc010pmx.1_Missense_Mutation_p.G320V	p.G320V	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	4	1072	+		Breast(1374;0.000962)	320			Fibronectin type-III 1.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.959G>T	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281620	0.23392	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.59638	0.25	5.69	0.646	0.17789	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.098718	0.64402	D	0.000001	T	0.75361	0.3839	M	0.89715	3.055	0.23204	N	0.998126	D;P	0.58620	0.983;0.845	D;P	0.65684	0.937;0.835	T	0.67783	-0.5581	10	0.87932	D	0	.	10.4289	0.44395	0.322:0.0:0.678:0.0	.	320;320	B3KXB6;Q9UQP3	.;TENN_HUMAN	V	320	ENSP00000239462:G320V	ENSP00000239462:G320V	G	+	2	0	TNN	173316096	0.994000	0.37717	0.000000	0.03702	0.062000	0.15995	2.670000	0.46833	0.088000	0.17205	-0.808000	0.03180	GGT		0.537	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		39	136	1	0	2.40579e-17	0.00623	2.79896e-17	39	136				
NFASC	23114	broad.mit.edu	37	1	204948557	204948557	+	Silent	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:204948557C>A	ENST00000401399.1	+	18	2245	c.2046C>A	c.(2044-2046)ccC>ccA	p.P682P	NFASC_ENST00000367171.4_Silent_p.P667P|NFASC_ENST00000367170.4_Silent_p.P682P|NFASC_ENST00000338515.6_Silent_p.P682P|NFASC_ENST00000367172.4_Silent_p.P682P|NFASC_ENST00000513543.1_Silent_p.P678P|NFASC_ENST00000539706.1_Silent_p.P678P|NFASC_ENST00000360049.4_Silent_p.P678P|NFASC_ENST00000404907.1_Silent_p.P678P|NFASC_ENST00000339876.6_Silent_p.P682P|NFASC_ENST00000338586.6_Silent_p.P682P|NFASC_ENST00000404076.1_Silent_p.P661P|NFASC_ENST00000367169.4_Silent_p.P682P			O94856	NFASC_HUMAN	neurofascin	682	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.P678P(3)|p.P682P(3)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCAAGTACCCCGGCAGCGTTA	0.572																																							uc001hbj.2		NA																	6	Substitution - coding silent(6)		lung(4)|endometrium(2)	ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(2044-2046)CCC>CCA		neurofascin isoform 1 precursor							105.0	103.0	103.0					1																	204948557		2203	4300	6503	SO:0001819	synonymous_variant	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204948557C>A	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.2046C>A	1.37:g.204948557C>A						NFASC_uc010pra.1_Silent_p.P678P|NFASC_uc001hbi.2_Silent_p.P678P|NFASC_uc010prb.1_Silent_p.P693P|NFASC_uc010prc.1_Silent_p.P249P|NFASC_uc001hbk.1_Silent_p.P488P|NFASC_uc001hbl.1_5'Flank	p.P682P	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		19	2374	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		682			Extracellular (Potential).|Fibronectin type-III 1.		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Silent	SNP	ENST00000401399.1	37	c.2046C>A	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	C	0.960	-0.703545	0.03255	.	.	ENSG00000163531	ENST00000367173	T	0.60040	0.22	5.43	0.461	0.16689	.	0.382752	0.22265	N	0.062346	T	0.51075	0.1653	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45527	-0.9255	7	0.51188	T	0.08	.	0.7637	0.01011	0.4593:0.1208:0.2102:0.2096	.	.	.	.	Q	652	ENSP00000356141:P652Q	ENSP00000356141:P652Q	P	+	2	0	NFASC	203215180	0.000000	0.05858	0.984000	0.44739	0.013000	0.08279	-2.110000	0.01334	-0.168000	0.10853	-1.193000	0.01689	CCG		0.572	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388		44	216	1	0	5.78141e-17	0.013114	6.70017e-17	44	216				
EPRS	2058	broad.mit.edu	37	1	220156531	220156531	+	Splice_Site	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:220156531C>T	ENST00000366923.3	-	22	3569	c.3300G>A	c.(3298-3300)gaG>gaA	p.E1100E		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1100	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)	p.E1100E(1)		breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	GCTCACTTACCTCTGGGGCAA	0.343																																							uc001hly.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(3298-3300)GAG>GAA		glutamyl-prolyl tRNA synthetase	L-Glutamic Acid(DB00142)|L-Proline(DB00172)						66.0	72.0	70.0					1																	220156531		2203	4300	6503	SO:0001630	splice_region_variant	2058				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding	g.chr1:220156531C>T	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.3300+1G>A	1.37:g.220156531C>T							p.E1100E	NM_004446	NP_004437	P07814	SYEP_HUMAN		GBM - Glioblastoma multiforme(131;0.0735)	22	3570	-			1100			Prolyl-tRNA synthetase.		A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Silent	SNP	ENST00000366923.3	37	c.3300G>A	CCDS31027.1																																																																																				0.343	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	Silent	46	54	0	0	0	0.013114	0	46	54				
EPRS	2058	broad.mit.edu	37	1	220170591	220170591	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:220170591C>A	ENST00000366923.3	-	18	2544	c.2275G>T	c.(2275-2277)Gtt>Ttt	p.V759F		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	759	Glutamate--tRNA ligase.|WHEP-TRS 1.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)	p.V759F(1)		breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TCTCCTTGAACAGCCACTCTA	0.388																																							uc001hly.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2275-2277)GTT>TTT		glutamyl-prolyl tRNA synthetase	L-Glutamic Acid(DB00142)|L-Proline(DB00172)						82.0	86.0	85.0					1																	220170591		2203	4300	6503	SO:0001583	missense	2058				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding	g.chr1:220170591C>A	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.2275G>T	1.37:g.220170591C>A	ENSP00000355890:p.Val759Phe					EPRS_uc010puf.1_Missense_Mutation_p.V510F|EPRS_uc001hlz.1_Missense_Mutation_p.V766F	p.V759F	NM_004446	NP_004437	P07814	SYEP_HUMAN		GBM - Glioblastoma multiforme(131;0.0735)	18	2545	-			759			WHEP-TRS 1.|Glutamyl-tRNA synthetase.		A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	c.2275G>T	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638191	0.47153	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	T	0.29655	1.56	5.62	0.331	0.15933	WHEP-TRS (2);S15/NS1, RNA-binding (2);	0.492495	0.22937	N	0.053840	T	0.17280	0.0415	N	0.14661	0.345	0.20403	N	0.999909	P;B;B	0.39071	0.658;0.283;0.056	B;B;B	0.41691	0.364;0.226;0.279	T	0.11155	-1.0599	10	0.62326	D	0.03	6.0E-4	5.8906	0.18911	0.1232:0.6079:0.0:0.2689	.	783;766;759	E7EMN0;Q3KQZ8;P07814	.;.;SYEP_HUMAN	F	759;766;783	ENSP00000355890:V759F	ENSP00000355890:V759F	V	-	1	0	EPRS	218237214	0.109000	0.22037	0.011000	0.14972	0.976000	0.68499	0.229000	0.17833	0.073000	0.16731	-0.140000	0.14226	GTT		0.388	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446		34	36	1	0	3.90053e-15	0.012213	4.45136e-15	34	36				
TP53BP2	7159	broad.mit.edu	37	1	223971971	223971971	+	Missense_Mutation	SNP	G	G	C	rs201272472		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:223971971G>C	ENST00000343537.7	-	17	3500	c.3209C>G	c.(3208-3210)gCg>gGg	p.A1070G	TP53BP2_ENST00000391879.2_Missense_Mutation_p.A303G|TP53BP2_ENST00000391878.2_Missense_Mutation_p.A941G|TP53BP2_ENST00000498843.1_5'UTR	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	1064	Mediates interaction with APC2.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)	p.A941V(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		ATCCCAAAGCGCATAAATGAC	0.403																																							uc010pvb.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)|lung(1)	3						c.(3208-3210)GCG>GGG		tumor protein p53 binding protein, 2 isoform 1							162.0	153.0	156.0					1																	223971971		2203	4300	6503	SO:0001583	missense	7159				apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity	g.chr1:223971971G>C	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.3209C>G	1.37:g.223971971G>C	ENSP00000341957:p.Ala1070Gly					TP53BP2_uc001hod.2_Missense_Mutation_p.A941G|TP53BP2_uc010puz.1_Missense_Mutation_p.A303G|TP53BP2_uc010pva.1_Missense_Mutation_p.A709G	p.A1070G	NM_001031685	NP_001026855	Q13625	ASPP2_HUMAN		GBM - Glioblastoma multiforme(131;0.0958)	17	3501	-			1064			Mediates interaction with APC2.|SH3.		B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	37	c.3209C>G	CCDS44319.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700641	0.48307	.	.	ENSG00000143514	ENST00000391878;ENST00000343537;ENST00000391879	T;T;T	0.81247	-1.47;-1.47;-1.47	5.97	5.97	0.96955	Src homology-3 domain (4);Spectrin alpha chain, SH3 domain (1);	0.210382	0.48286	D	0.000190	T	0.81983	0.4938	M	0.78049	2.395	0.43179	D	0.994993	B;B	0.16396	0.017;0.013	B;B	0.22880	0.023;0.042	T	0.78420	-0.2211	10	0.54805	T	0.06	.	15.7056	0.77577	0.0:0.2385:0.7615:0.0	.	1070;1064	B4DG66;Q13625	.;ASPP2_HUMAN	G	941;1070;303	ENSP00000375750:A941G;ENSP00000341957:A1070G;ENSP00000375751:A303G	ENSP00000341957:A1070G	A	-	2	0	TP53BP2	222038594	0.996000	0.38824	0.748000	0.31131	0.984000	0.73092	2.305000	0.43664	2.833000	0.97629	0.585000	0.79938	GCG		0.403	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426		3	120	0	0	0	0.004672	0	3	120				
URB2	9816	broad.mit.edu	37	1	229794951	229794952	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:229794951_229794952GC>AT	ENST00000258243.2	+	10	4618_4619	c.4482_4483GC>AT	c.(4480-4485)caGCcg>caATcg	p.P1495S		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1495						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.P1495S(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						CCTCGCTGCAGCCGGGAATGAG	0.505																																							uc001hts.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(4480-4485)CAGCCG>CAATCG		URB2 ribosome biogenesis 2 homolog																																				SO:0001583	missense	9816					nucleolus		g.chr1:229794951_229794952GC>AT	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	Exception_encountered	1.37:g.229794951_229794952delinsAT	ENSP00000258243:p.Pro1495Ser					URB2_uc009xfd.1_Missense_Mutation_p.P1495S	p.P1495S	NM_014777	NP_055592	Q14146	URB2_HUMAN			10	4618_4619	+			1495					Q5VYC9	Missense_Mutation	DNP	ENST00000258243.2	37	c.4482_4483GC>AT	CCDS31052.1																																																																																				0.505	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777		6	331	0	0	0	0.004672	0	6	331				
PCNXL2	80003	broad.mit.edu	37	1	233134066	233134066	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:233134066T>C	ENST00000258229.9	-	32	5956	c.5722A>G	c.(5722-5724)Agc>Ggc	p.S1908G	PCNXL2_ENST00000344698.2_Missense_Mutation_p.S560G	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1908						integral component of membrane (GO:0016021)		p.S1908G(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TGTTCTGCGCTGCTCTCCTGG	0.632																																							uc001hvl.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|pancreas(1)	2						c.(5722-5724)AGC>GGC		pecanex-like 2							46.0	48.0	47.0					1																	233134066		2047	4206	6253	SO:0001583	missense	80003					integral to membrane		g.chr1:233134066T>C	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.5722A>G	1.37:g.233134066T>C	ENSP00000258229:p.Ser1908Gly					PCNXL2_uc001hvk.1_Missense_Mutation_p.S560G|PCNXL2_uc001hvm.1_RNA	p.S1908G	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN			32	5957	-		all_cancers(173;0.0347)|Prostate(94;0.137)	1908					O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	c.5722A>G	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.742415	0.49151	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	T;T	0.23754	1.89;3.04	5.57	3.27	0.37495	.	0.108661	0.64402	D	0.000006	T	0.39886	0.1095	M	0.65975	2.015	0.80722	D	1	D;D	0.69078	0.997;0.989	P;P	0.58721	0.779;0.844	T	0.12941	-1.0528	10	0.59425	D	0.04	.	8.5144	0.33237	0.0:0.1512:0.0:0.8488	.	1908;560	A6NKB5;A6NKB5-3	PCX2_HUMAN;.	G	560;1908	ENSP00000340759:S560G;ENSP00000258229:S1908G	ENSP00000258229:S1908G	S	-	1	0	PCNXL2	231200689	1.000000	0.71417	0.619000	0.29118	0.069000	0.16628	1.886000	0.39688	0.418000	0.25898	0.460000	0.39030	AGC		0.632	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801		12	56	0	0	0	0.010729	0	12	56				
NID1	4811	broad.mit.edu	37	1	236205495	236205495	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:236205495C>A	ENST00000264187.6	-	4	932	c.850G>T	c.(850-852)Gaa>Taa	p.E284*	NID1_ENST00000366595.3_Nonsense_Mutation_p.E284*	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	284					basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)	p.E284*(1)		breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GCCCCATCTTCAGTTCCGAGG	0.567																																							uc001hxo.2		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(1)|pancreas(1)	2						c.(850-852)GAA>TAA		nidogen 1 precursor	Becaplermin(DB00102)|Urokinase(DB00013)						230.0	213.0	219.0					1																	236205495		2203	4300	6503	SO:0001587	stop_gained	4811				cell-matrix adhesion	basement membrane	calcium ion binding	g.chr1:236205495C>A	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.850G>T	1.37:g.236205495C>A	ENSP00000264187:p.Glu284*					NID1_uc009xgd.2_Nonsense_Mutation_p.E284*	p.E284*	NM_002508	NP_002499	P14543	NID1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		4	952	-	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	284					Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Nonsense_Mutation	SNP	ENST00000264187.6	37	c.850G>T	CCDS1608.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.363268	0.82353	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	.	.	.	4.43	2.49	0.30216	.	0.729179	0.13500	N	0.383347	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	5.0626	0.14564	0.207:0.6874:0.0:0.1056	.	.	.	.	X	284	.	ENSP00000264187:E284X	E	-	1	0	NID1	234272118	0.172000	0.23043	0.003000	0.11579	0.007000	0.05969	0.723000	0.25939	0.754000	0.32968	0.563000	0.77884	GAA		0.567	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508		101	381	1	0	1.09905e-38	0.01441	1.39836e-38	101	381				
RYR2	6262	broad.mit.edu	37	1	237995884	237995884	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:237995884G>T	ENST00000366574.2	+	105	15158	c.14841G>T	c.(14839-14841)agG>agT	p.R4947S	RYR2_ENST00000360064.6_Missense_Mutation_p.R4953S|RYR2_ENST00000542537.1_Missense_Mutation_p.R4931S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4947					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.R4945S(2)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATCAAGAAAGGTGTTGGGAAT	0.388																																							uc001hyl.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(14839-14841)AGG>AGT		cardiac muscle ryanodine receptor							92.0	89.0	90.0					1																	237995884		1859	4127	5986	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237995884G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14841G>T	1.37:g.237995884G>T	ENSP00000355533:p.Arg4947Ser					RYR2_uc010pyb.1_3'UTR	p.R4947S	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		105	14961	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4947					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.14841G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177703	0.57692	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96992	-4.2;-4.16;-4.19	5.16	0.917	0.19380	.	0.000000	0.56097	D	0.000025	D	0.97259	0.9104	M	0.77616	2.38	0.80722	D	1	D	0.57899	0.981	D	0.69824	0.966	D	0.96230	0.9167	10	0.87932	D	0	-17.2433	9.8514	0.41059	0.5243:0.0:0.4757:0.0	.	4947	Q92736	RYR2_HUMAN	S	4947;4953;4931	ENSP00000355533:R4947S;ENSP00000353174:R4953S;ENSP00000443798:R4931S	ENSP00000353174:R4953S	R	+	3	2	RYR2	236062507	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	-1.616000	0.02053	0.267000	0.21916	0.655000	0.94253	AGG		0.388	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		17	21	1	0	8.34094e-07	0.008871	8.75067e-07	17	21				
CUBN	8029	broad.mit.edu	37	10	16982170	16982170	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:16982170G>A	ENST00000377833.4	-	37	5474	c.5409C>T	c.(5407-5409)gcC>gcT	p.A1803A		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1803	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGTGACCCGTGGCATTTCCTT	0.438																																							uc001ioo.2		NA																	0				ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(5407-5409)GCC>GCT		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						175.0	180.0	179.0					10																	16982170		2203	4300	6503	SO:0001819	synonymous_variant	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16982170G>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5409C>T	10.37:g.16982170G>A							p.A1803A	NM_001081	NP_001072	O60494	CUBN_HUMAN			37	5461	-			1803			CUB 12.		B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	c.5409C>T	CCDS7113.1																																																																																				0.438	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		79	304	0	0	0	0.01441	0	79	304				
NSUN6	221078	broad.mit.edu	37	10	18937479	18937479	+	Silent	SNP	C	C	T	rs369325065		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:18937479C>T	ENST00000377304.4	-	2	589	c.171G>A	c.(169-171)gtG>gtA	p.V57V	RP11-139J15.7_ENST00000606425.1_Silent_p.V45V	NM_182543.2	NP_872349.1	Q8TEA1	NSUN6_HUMAN	NOP2/Sun domain family, member 6	57							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.V57V(2)		endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15						AATGTGTATTCACTCTGACAG	0.338																																							uc010qcp.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(169-171)GTG>GTA		NOL1/NOP2/Sun domain family, member 6		C		0,4406		0,0,2203	209.0	196.0	200.0		171	1.8	1.0	10		200	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	NSUN6	NM_182543.2		0,1,6501	TT,TC,CC		0.0116,0.0,0.0077		57/470	18937479	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	221078						methyltransferase activity|RNA binding	g.chr10:18937479C>T	BC035778	CCDS7130.1	10p13	2014-06-23	2009-11-23	2004-08-26	ENSG00000241058	ENSG00000241058		"""NOP2/Sun domain containing"""	23529	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 6"", ""NOL1/NOP2/Sun domain family, member 6"", ""ARL5B antisense RNA 1"""	NOPD1, ARL5B-AS1			Standard	XM_005252394		Approved	FLJ23743	uc010qcp.1	Q8TEA1	OTTHUMG00000017767	ENST00000377304.4:c.171G>A	10.37:g.18937479C>T							p.V57V	NM_182543	NP_872349	Q8TEA1	NSUN6_HUMAN			2	589	-			57					B0YJ54	Silent	SNP	ENST00000377304.4	37	c.171G>A	CCDS7130.1																																																																																				0.338	NSUN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047083.1	NM_182543		11	51	0	0	0	0.010729	0	11	51				
MAPK8	5599	broad.mit.edu	37	10	49642948	49642948	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:49642948C>G	ENST00000374189.1	+	12	1341	c.1160C>G	c.(1159-1161)tCt>tGt	p.S387C	MAPK8_ENST00000360332.3_Missense_Mutation_p.S387C|MAPK8_ENST00000374182.3_3'UTR|MAPK8_ENST00000459755.1_3'UTR			P45983	MK08_HUMAN	mitogen-activated protein kinase 8	387					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nitric oxide (GO:0071732)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|programmed necrotic cell death (GO:0097300)|regulation of histone deacetylation (GO:0031063)|regulation of protein localization (GO:0032880)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to cadmium ion (GO:0046686)|response to stress (GO:0006950)|response to UV (GO:0009411)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|JUN kinase activity (GO:0004705)|protein serine/threonine kinase activity (GO:0004674)	p.S387C(1)		breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	34		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		ATCAATGGCTCTCAGCATCCA	0.483																																							uc009xnz.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8						c.(1159-1161)TCT>TGT		mitogen-activated protein kinase 8 isoform JNK1							218.0	175.0	190.0					10																	49642948		2203	4300	6503	SO:0001583	missense	5599				activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding	g.chr10:49642948C>G	L26318	CCDS7223.1, CCDS7224.1, CCDS7225.1, CCDS7226.1, CCDS60527.1	10q11	2011-06-09			ENSG00000107643	ENSG00000107643	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6881	protein-coding gene	gene with protein product	"""JUN N-terminal kinase"""	601158		PRKM8		8137421, 8654373	Standard	NM_002750		Approved	JNK, JNK1, SAPK1	uc001jgp.3	P45983	OTTHUMG00000018172	ENST00000374189.1:c.1160C>G	10.37:g.49642948C>G	ENSP00000363304:p.Ser387Cys					MAPK8_uc001jgl.2_3'UTR|MAPK8_uc001jgm.2_Missense_Mutation_p.S387C|MAPK8_uc001jgo.2_3'UTR|MAPK8_uc009xoa.2_3'UTR|MAPK8_uc001jgn.2_Missense_Mutation_p.S387C|MAPK8_uc010qgk.1_3'UTR|MAPK8_uc001jgp.2_Missense_Mutation_p.S387C|MAPK8_uc001jgq.2_3'UTR	p.S387C	NM_139047	NP_620635	P45983	MK08_HUMAN		Epithelial(53;3.46e-65)|Lung(62;0.125)	12	1384	+		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)	387					B5BTZ5|B7ZLV4|D3DX88|D3DX92|Q15709|Q15712|Q15713|Q308M2	Missense_Mutation	SNP	ENST00000374189.1	37	c.1160C>G	CCDS7224.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899127	0.52227	.	.	ENSG00000107643	ENST00000374189;ENST00000360332;ENST00000374176	T;T;T	0.75704	-0.96;-0.96;-0.95	5.51	2.63	0.31362	.	0.320971	0.33959	N	0.004382	T	0.70736	0.3258	L	0.47716	1.5	0.80722	D	1	P;D	0.55172	0.928;0.97	P;P	0.48840	0.469;0.592	T	0.69903	-0.5019	10	0.87932	D	0	.	8.975	0.35930	0.0:0.7428:0.1227:0.1345	.	387;387	P45983;A1L4K2	MK08_HUMAN;.	C	387	ENSP00000363304:S387C;ENSP00000353483:S387C;ENSP00000363291:S387C	ENSP00000353483:S387C	S	+	2	0	MAPK8	49312954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.026000	0.70873	0.364000	0.24374	0.591000	0.81541	TCT		0.483	MAPK8-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047931.1			47	131	0	0	0	0.011902	0	47	131				
HHEX	3087	broad.mit.edu	37	10	94452138	94452138	+	Silent	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:94452138C>G	ENST00000282728.5	+	2	2174	c.375C>G	c.(373-375)ctC>ctG	p.L125L	HHEX_ENST00000472590.2_5'UTR|HHEX_ENST00000492654.2_5'UTR	NM_002729.4	NP_002720.1	Q03014	HHEX_HUMAN	hematopoietically expressed homeobox	125	Pro-rich.				anterior/posterior pattern specification (GO:0009952)|B cell differentiation (GO:0030183)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|DNA conformation change (GO:0071103)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|forebrain morphogenesis (GO:0048853)|gall bladder development (GO:0061010)|hepatic duct development (GO:0061011)|hepatoblast differentiation (GO:0061017)|hepatocyte differentiation (GO:0070365)|in utero embryonic development (GO:0001701)|interkinetic nuclear migration (GO:0022027)|mRNA export from nucleus (GO:0006406)|multicellular organism growth (GO:0035264)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|pancreas development (GO:0031016)|poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|primary lung bud formation (GO:0060431)|primitive streak formation (GO:0090009)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|eukaryotic initiation factor 4E binding (GO:0008190)|protein homodimerization activity (GO:0042803)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.L125L(2)		kidney(2)|large_intestine(2)|lung(5)|ovary(1)	10						AACCTCTACTCTGGAGCCCCT	0.617																																							uc001kid.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(373-375)CTC>CTG		hematopoietically expressed homeobox							45.0	54.0	51.0					10																	94452138		2203	4300	6503	SO:0001819	synonymous_variant	3087				anterior/posterior pattern formation|B cell differentiation|cell cycle|DNA conformation change|negative regulation of angiogenesis|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of vascular endothelial growth factor receptor signaling pathway|poly(A)+ mRNA export from nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|protein localization to nucleus|Wnt receptor signaling pathway	cytoplasm|nucleus|protein-DNA complex	DNA bending activity|eukaryotic initiation factor 4E binding|protein homodimerization activity|repressing transcription factor binding|sequence-specific DNA binding|TBP-class protein binding|transcription regulatory region DNA binding	g.chr10:94452138C>G	Z21533	CCDS7423.1	10q23.33	2011-06-20	2007-02-15		ENSG00000152804	ENSG00000152804		"""Homeoboxes / ANTP class : NKL subclass"""	4901	protein-coding gene	gene with protein product		604420		PRHX		8096636, 8103988	Standard	NM_002729		Approved	HEX, HOX11L-PEN	uc001kid.3	Q03014	OTTHUMG00000018762	ENST00000282728.5:c.375C>G	10.37:g.94452138C>G							p.L125L	NM_002729	NP_002720	Q03014	HHEX_HUMAN			2	438	+			125			Pro-rich.		B1AQ17|Q96CE9	Silent	SNP	ENST00000282728.5	37	c.375C>G	CCDS7423.1																																																																																				0.617	HHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049402.2			64	84	0	0	0	0.01441	0	64	84				
HHEX	3087	broad.mit.edu	37	10	94452163	94452163	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:94452163C>G	ENST00000282728.5	+	2	2199	c.400C>G	c.(400-402)Ctg>Gtg	p.L134V	HHEX_ENST00000472590.2_5'UTR|HHEX_ENST00000492654.2_5'UTR	NM_002729.4	NP_002720.1	Q03014	HHEX_HUMAN	hematopoietically expressed homeobox	134					anterior/posterior pattern specification (GO:0009952)|B cell differentiation (GO:0030183)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|DNA conformation change (GO:0071103)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|forebrain morphogenesis (GO:0048853)|gall bladder development (GO:0061010)|hepatic duct development (GO:0061011)|hepatoblast differentiation (GO:0061017)|hepatocyte differentiation (GO:0070365)|in utero embryonic development (GO:0001701)|interkinetic nuclear migration (GO:0022027)|mRNA export from nucleus (GO:0006406)|multicellular organism growth (GO:0035264)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|pancreas development (GO:0031016)|poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|primary lung bud formation (GO:0060431)|primitive streak formation (GO:0090009)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|eukaryotic initiation factor 4E binding (GO:0008190)|protein homodimerization activity (GO:0042803)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.L134V(1)		kidney(2)|large_intestine(2)|lung(5)|ovary(1)	10						GCAGAGGCCTCTGCATAAAAG	0.602																																							uc001kid.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(400-402)CTG>GTG		hematopoietically expressed homeobox							48.0	56.0	53.0					10																	94452163		2203	4300	6503	SO:0001583	missense	3087				anterior/posterior pattern formation|B cell differentiation|cell cycle|DNA conformation change|negative regulation of angiogenesis|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of vascular endothelial growth factor receptor signaling pathway|poly(A)+ mRNA export from nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|protein localization to nucleus|Wnt receptor signaling pathway	cytoplasm|nucleus|protein-DNA complex	DNA bending activity|eukaryotic initiation factor 4E binding|protein homodimerization activity|repressing transcription factor binding|sequence-specific DNA binding|TBP-class protein binding|transcription regulatory region DNA binding	g.chr10:94452163C>G	Z21533	CCDS7423.1	10q23.33	2011-06-20	2007-02-15		ENSG00000152804	ENSG00000152804		"""Homeoboxes / ANTP class : NKL subclass"""	4901	protein-coding gene	gene with protein product		604420		PRHX		8096636, 8103988	Standard	NM_002729		Approved	HEX, HOX11L-PEN	uc001kid.3	Q03014	OTTHUMG00000018762	ENST00000282728.5:c.400C>G	10.37:g.94452163C>G	ENSP00000282728:p.Leu134Val						p.L134V	NM_002729	NP_002720	Q03014	HHEX_HUMAN			2	463	+			134					B1AQ17|Q96CE9	Missense_Mutation	SNP	ENST00000282728.5	37	c.400C>G	CCDS7423.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811393	0.90707	.	.	ENSG00000152804	ENST00000282728	D	0.95724	-3.79	5.58	5.58	0.84498	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.64402	D	0.000001	D	0.97256	0.9103	M	0.77103	2.36	0.80722	D	1	D	0.63046	0.992	P	0.60886	0.88	D	0.96249	0.9182	10	0.33141	T	0.24	-6.0713	19.563	0.95380	0.0:1.0:0.0:0.0	.	134	Q03014	HHEX_HUMAN	V	134	ENSP00000282728:L134V	ENSP00000282728:L134V	L	+	1	2	HHEX	94442143	0.637000	0.27216	1.000000	0.80357	0.997000	0.91878	1.238000	0.32707	2.630000	0.89119	0.561000	0.74099	CTG		0.602	HHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049402.2			65	80	0	0	0	0.01441	0	65	80				
LGI1	9211	broad.mit.edu	37	10	95549856	95549856	+	Splice_Site	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:95549856G>T	ENST00000371418.4	+	5	692	c.432G>T	c.(430-432)ttG>ttT	p.L144F	LGI1_ENST00000542308.1_Splice_Site_p.L96F|LGI1_ENST00000371413.3_Splice_Site_p.L144F	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	144					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)	p.L144F(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				TTTTTTCCAGGAGCCTTGCAA	0.338																																							uc001kjc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(430-432)TTG>TTT		leucine-rich, glioma inactivated 1 precursor							36.0	39.0	38.0					10																	95549856		2202	4297	6499	SO:0001630	splice_region_variant	9211				axon guidance|cell proliferation|positive regulation of cell growth|positive regulation of synaptic transmission	cell junction|extracellular space|synapse	receptor binding	g.chr10:95549856G>T	AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.432-1G>T	10.37:g.95549856G>T						LGI1_uc010qnv.1_Missense_Mutation_p.L96F|LGI1_uc001kjd.3_Missense_Mutation_p.L144F|LGI1_uc009xui.2_RNA|LGI1_uc001kje.2_RNA	p.L144F	NM_005097	NP_005088	O95970	LGI1_HUMAN			5	768	+		Colorectal(252;0.124)	144			LRR 3.		A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	ENST00000371418.4	37	c.432G>T	CCDS7431.1	.	.	.	.	.	.	.	.	.	.	G	19.50	3.839028	0.71373	.	.	ENSG00000108231	ENST00000542308;ENST00000371418;ENST00000371413	T;T;T	0.81415	-1.49;-1.49;-1.49	5.14	5.14	0.70334	.	0.000000	0.64402	D	0.000002	D	0.91516	0.7321	M	0.89414	3.03	0.23708	N	0.997051	D;D;D	0.89917	1.0;0.994;0.997	D;D;D	0.91635	0.999;0.983;0.995	D	0.85499	0.1190	9	.	.	.	.	18.8053	0.92034	0.0:0.0:1.0:0.0	.	96;144;144	O95970-3;O95970-2;O95970	.;.;LGI1_HUMAN	F	96;144;144	ENSP00000440763:L96F;ENSP00000360472:L144F;ENSP00000360467:L144F	.	L	+	3	2	LGI1	95539846	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.448000	0.73469	2.669000	0.90835	0.655000	0.94253	TTG		0.338	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049445.1	NM_005097	Missense_Mutation	9	33	1	0	2.17888e-05	0.006214	2.26998e-05	9	33				
SORCS1	114815	broad.mit.edu	37	10	108434855	108434855	+	Missense_Mutation	SNP	A	A	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:108434855A>C	ENST00000263054.6	-	14	1899	c.1892T>G	c.(1891-1893)tTt>tGt	p.F631C	SORCS1_ENST00000344440.6_Missense_Mutation_p.F631C|SORCS1_ENST00000369698.1_Missense_Mutation_p.F166C	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	631					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.F631C(2)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CCCATCCACAAAAAGTGGAAT	0.398																																							uc001kym.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(1891-1893)TTT>TGT		SORCS receptor 1 isoform a							125.0	119.0	121.0					10																	108434855		2203	4300	6503	SO:0001583	missense	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108434855A>C	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1892T>G	10.37:g.108434855A>C	ENSP00000263054:p.Phe631Cys					SORCS1_uc001kyl.2_Missense_Mutation_p.F631C|SORCS1_uc009xxs.2_Missense_Mutation_p.F631C|SORCS1_uc001kyn.1_Missense_Mutation_p.F631C|SORCS1_uc001kyo.2_Missense_Mutation_p.F631C	p.F631C	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	14	1900	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	631			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	c.1892T>G	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	A	19.78	3.890451	0.72524	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.35236	1.32;1.32;1.32	5.92	5.92	0.95590	VPS10 (1);	0.109207	0.64402	D	0.000003	T	0.64394	0.2594	M	0.83483	2.645	0.46149	D	0.998893	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.984;0.996;0.993;0.984;0.993	T	0.67795	-0.5578	9	.	.	.	-19.8054	16.3631	0.83280	1.0:0.0:0.0:0.0	.	631;631;631;631;631	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	C	166;631;631	ENSP00000358712:F166C;ENSP00000263054:F631C;ENSP00000345964:F631C	.	F	-	2	0	SORCS1	108424845	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.834000	0.62774	2.266000	0.75297	0.533000	0.62120	TTT		0.398	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		49	78	0	0	0	0.01441	0	49	78				
KCNK18	338567	broad.mit.edu	37	10	118969302	118969302	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:118969302C>A	ENST00000334549.1	+	3	647	c.647C>A	c.(646-648)aCa>aAa	p.T216K		NM_181840.1	NP_862823.1	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	216					cellular response to pH (GO:0071467)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)	p.T216K(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	41		Colorectal(252;0.19)		all cancers(201;0.0211)		AAACTTGGCACATGTCCTTCA	0.527																																							uc010qsr.1		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)	1						c.(646-648)ACA>AAA		potassium channel, subfamily K, member 18							78.0	79.0	78.0					10																	118969302		2203	4300	6503	SO:0001583	missense	338567					integral to membrane|plasma membrane		g.chr10:118969302C>A	AB087138	CCDS7598.1	10q26.11	2012-03-07			ENSG00000186795	ENSG00000186795		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	19439	protein-coding gene	gene with protein product	"""TWIK related spinal cord K+ channel"""	613655				16382106	Standard	NM_181840		Approved	K2p18.1, TRESK-2, TRESK2, TRESK, TRIK	uc010qsr.2	Q7Z418	OTTHUMG00000019120	ENST00000334549.1:c.647C>A	10.37:g.118969302C>A	ENSP00000334650:p.Thr216Lys						p.T216K	NM_181840	NP_862823	Q7Z418	KCNKI_HUMAN		all cancers(201;0.0211)	3	647	+		Colorectal(252;0.19)	216			Cytoplasmic (Potential).		Q5SQQ8	Missense_Mutation	SNP	ENST00000334549.1	37	c.647C>A	CCDS7598.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.548949	0.00926	.	.	ENSG00000186795	ENST00000334549	T	0.13089	2.62	4.51	-9.02	0.00741	.	1.835210	0.02402	N	0.080771	T	0.03915	0.0110	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23762	-1.0179	10	0.05959	T	0.93	.	4.445	0.11593	0.2646:0.3258:0.3301:0.0795	.	216	Q7Z418	KCNKI_HUMAN	K	216	ENSP00000334650:T216K	ENSP00000334650:T216K	T	+	2	0	KCNK18	118959292	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.842000	0.01681	-3.458000	0.00159	-1.109000	0.02080	ACA		0.527	KCNK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050562.2	NM_181840		48	130	1	0	3.16986e-14	0.01441	3.57656e-14	48	130				
PDZD8	118987	broad.mit.edu	37	10	119043731	119043731	+	Missense_Mutation	SNP	T	T	G	rs573768933		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:119043731T>G	ENST00000334464.5	-	5	2752	c.2513A>C	c.(2512-2514)gAa>gCa	p.E838A	PDZD8_ENST00000482496.1_5'Flank	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	838					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)	p.E838A(1)		kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		GTGTTTGTTTTCTGTTAAACC	0.383																																							uc001lde.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2512-2514)GAA>GCA		PDZ domain containing 8							57.0	58.0	57.0					10																	119043731		2203	4300	6503	SO:0001583	missense	118987				intracellular signal transduction		metal ion binding	g.chr10:119043731T>G	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.2513A>C	10.37:g.119043731T>G	ENSP00000334642:p.Glu838Ala						p.E838A	NM_173791	NP_776152	Q8NEN9	PDZD8_HUMAN		all cancers(201;0.0121)	5	2712	-		Colorectal(252;0.19)	838					Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	c.2513A>C	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	T	14.06	2.424013	0.43020	.	.	ENSG00000165650	ENST00000334464	D	0.83250	-1.7	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.86192	0.5874	L	0.34521	1.04	0.52099	D	0.999948	D	0.76494	0.999	D	0.80764	0.994	D	0.85146	0.0983	10	0.33141	T	0.24	-18.596	15.8301	0.78743	0.0:0.0:0.0:1.0	.	838	Q8NEN9	PDZD8_HUMAN	A	838	ENSP00000334642:E838A	ENSP00000334642:E838A	E	-	2	0	PDZD8	119033721	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.186000	0.72026	2.140000	0.66376	0.460000	0.39030	GAA		0.383	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791		38	77	0	0	0	0.004289	0	38	77				
CTBP2	1488	broad.mit.edu	37	10	126683170	126683170	+	Silent	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:126683170C>A	ENST00000337195.5	-	7	1047	c.648G>T	c.(646-648)ggG>ggT	p.G216G	CTBP2_ENST00000309035.6_Silent_p.G756G|CTBP2_ENST00000334808.6_Silent_p.G284G|CTBP2_ENST00000531469.1_Silent_p.G216G|CTBP2_ENST00000411419.2_Silent_p.G216G|CTBP2_ENST00000494626.2_Silent_p.G216G	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2	216					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)	p.G756G(1)|p.G216G(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		ACCGCTCGATCCCATCCTGCA	0.557																																							uc009yak.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(646-648)GGG>GGT		C-terminal binding protein 2 isoform 1							69.0	69.0	69.0					10																	126683170		2203	4300	6503	SO:0001819	synonymous_variant	1488				negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding	g.chr10:126683170C>A	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.648G>T	10.37:g.126683170C>A						CTBP2_uc009yal.2_Silent_p.G216G|CTBP2_uc001lif.3_Silent_p.G216G|CTBP2_uc001lih.3_Silent_p.G216G|CTBP2_uc001lid.3_Silent_p.G284G|CTBP2_uc001lie.3_Silent_p.G756G	p.G216G	NM_001329	NP_001320	P56545	CTBP2_HUMAN		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)	7	935	-		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)	216					A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	ENST00000337195.5	37	c.648G>T	CCDS7643.1																																																																																				0.557	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914		21	136	1	0	3.01185e-09	0.003954	3.25106e-09	21	136				
EBF3	253738	broad.mit.edu	37	10	131646712	131646712	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:131646712G>A	ENST00000355311.5	-	11	1144	c.1072C>T	c.(1072-1074)Cag>Tag	p.Q358*	EBF3_ENST00000368648.3_Nonsense_Mutation_p.Q349*			Q9H4W6	COE3_HUMAN	early B-cell factor 3	358					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q349*(3)|p.Q358*(3)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		TGCAACCTCTGAAAGCCGTAA	0.468																																							uc001lki.1		NA																	6	Substitution - Nonsense(6)		lung(4)|large_intestine(2)	central_nervous_system(1)|pancreas(1)	2						c.(1045-1047)CAG>TAG		early B-cell factor 3							166.0	154.0	158.0					10																	131646712		2203	4300	6503	SO:0001587	stop_gained	253738				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding	g.chr10:131646712G>A		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.1072C>T	10.37:g.131646712G>A	ENSP00000347463:p.Gln358*						p.Q349*	NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;0.00513)	11	1104	-		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)	358					A0AUY1|Q5T6H9|Q9H4W5	Nonsense_Mutation	SNP	ENST00000355311.5	37	c.1045C>T		.	.	.	.	.	.	.	.	.	.	G	37	6.270420	0.97431	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.9271	20.0887	0.97806	0.0:0.0:1.0:0.0	.	.	.	.	X	358;349	.	ENSP00000347463:Q358X	Q	-	1	0	EBF3	131536702	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.809000	0.99208	2.825000	0.97269	0.655000	0.94253	CAG		0.468	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463		53	191	0	0	0	0.01441	0	53	191				
GPR123	84435	broad.mit.edu	37	10	134896297	134896297	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr10:134896297G>A	ENST00000607359.1	+	7	1309	c.1309G>A	c.(1309-1311)Gtg>Atg	p.V437M	RP13-439H18.4_ENST00000444433.1_RNA			Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	0					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V437M(1)|p.V437L(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		GCCTGGATGCGTGTGCCAGGG	0.672																																							uc001llw.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1309-1311)GTG>ATG		RecName: Full=Probable G-protein coupled receptor 123;							21.0	26.0	25.0					10																	134896297		1566	3578	5144	SO:0001583	missense	84435					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:134896297G>A	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000607359.1:c.1309G>A	10.37:g.134896297G>A	ENSP00000475778:p.Val437Met						p.V437M			Q86SQ6	GP123_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)	7	1309	+		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)	Error:Variant_position_missing_in_Q86SQ6_after_alignment					A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	ENST00000607359.1	37	c.1309G>A		.	.	.	.	.	.	.	.	.	.	G	3.265	-0.150380	0.06585	.	.	ENSG00000197177	ENST00000368577;ENST00000392609	.	.	.	1.22	-2.44	0.06502	.	.	.	.	.	T	0.24699	0.0599	.	.	.	0.31099	N	0.710612	B	0.11235	0.004	B	0.04013	0.001	T	0.27123	-1.0083	6	0.87932	D	0	.	0.325	0.00309	0.2299:0.2891:0.2601:0.221	.	437	Q86SQ6-1	.	M	437	.	ENSP00000357566:V437M	V	+	1	0	GPR123	134746287	0.001000	0.12720	0.000000	0.03702	0.062000	0.15995	0.025000	0.13577	-1.010000	0.03396	-0.700000	0.03674	GTG		0.672	GPR123-004	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316904.2			8	28	0	0	0	0.004482	0	8	28				
OR51Q1	390061	broad.mit.edu	37	11	5444131	5444131	+	Missense_Mutation	SNP	C	C	A	rs372480233		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:5444131C>A	ENST00000300778.4	+	1	791	c.701C>A	c.(700-702)gCt>gAt	p.A234D	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A234D(2)		endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCCACCTGGGCTGAGCGACTC	0.483																																							uc010qzd.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(700-702)GCT>GAT		olfactory receptor, family 51, subfamily Q,							132.0	112.0	119.0					11																	5444131		2201	4297	6498	SO:0001583	missense	390061				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5444131C>A	AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.701C>A	11.37:g.5444131C>A	ENSP00000300778:p.Ala234Asp					HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	p.A234D	NM_001004757	NP_001004757	Q8NH59	O51Q1_HUMAN		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	701	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	234			Cytoplasmic (Potential).		B2RNN1	Missense_Mutation	SNP	ENST00000300778.4	37	c.701C>A	CCDS31381.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.475892	0.26511	.	.	ENSG00000167360	ENST00000300778	T	0.00091	8.74	5.0	-0.359	0.12571	GPCR, rhodopsin-like superfamily (1);	1.399010	0.04352	N	0.355799	T	0.00144	0.0004	N	0.03930	-0.32	0.09310	N	1	P	0.49307	0.922	P	0.55713	0.782	T	0.43621	-0.9380	10	0.56958	D	0.05	.	3.9975	0.09564	0.2456:0.4559:0.0:0.2986	.	234	Q8NH59	O51Q1_HUMAN	D	234	ENSP00000300778:A234D	ENSP00000300778:A234D	A	+	2	0	OR51Q1	5400707	0.000000	0.05858	0.067000	0.19924	0.077000	0.17291	-1.667000	0.01961	0.067000	0.16545	0.380000	0.24917	GCT		0.483	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143373.1	NM_001004757		96	131	1	0	1.69331e-39	0.01441	2.16368e-39	96	131				
OR56A3	390083	broad.mit.edu	37	11	5969183	5969183	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:5969183C>A	ENST00000329564.6	+	1	614	c.607C>A	c.(607-609)Caa>Aaa	p.Q203K	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q203K(2)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCACCTTTACCAATTTGCTGG	0.478																																							uc010qzt.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(607-609)CAA>AAA		olfactory receptor, family 56, subfamily A,							143.0	140.0	141.0					11																	5969183		2139	4278	6417	SO:0001583	missense	390083				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5969183C>A		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.607C>A	11.37:g.5969183C>A	ENSP00000331572:p.Gln203Lys						p.Q203K	NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	607	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	203			Helical; Name=5; (Potential).		A6NN77|Q6IFF7	Missense_Mutation	SNP	ENST00000329564.6	37	c.607C>A	CCDS41614.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.984719	0.35036	.	.	ENSG00000184478	ENST00000329564	T	0.00058	8.79	5.13	5.13	0.70059	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000024	T	0.00524	0.0017	M	0.85197	2.74	0.31627	N	0.649512	D	0.71674	0.998	D	0.91635	0.999	T	0.40001	-0.9586	10	0.87932	D	0	-13.6018	12.2714	0.54708	0.0:0.7289:0.2711:0.0	.	203	Q8NH54	O56A3_HUMAN	K	203	ENSP00000331572:Q203K	ENSP00000331572:Q203K	Q	+	1	0	OR56A3	5925759	0.000000	0.05858	0.893000	0.35052	0.060000	0.15804	0.065000	0.14466	2.687000	0.91594	0.650000	0.86243	CAA		0.478	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	NM_001003443		31	210	1	0	4.74835e-14	0.010818	5.33744e-14	31	210				
USP47	55031	broad.mit.edu	37	11	11941942	11941942	+	Silent	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:11941942C>T	ENST00000399455.2	+	11	1299	c.1179C>T	c.(1177-1179)ttC>ttT	p.F393F	USP47_ENST00000539466.1_5'UTR|USP47_ENST00000527733.1_Silent_p.F373F|USP47_ENST00000339865.5_Silent_p.F305F	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	393	USP.				base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)	p.F305F(2)		breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		TGAAAAGATTCGATTTTGATT	0.358																																							uc001mjq.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|skin(1)	2						c.(1177-1179)TTC>TTT		ubiquitin specific protease 47							108.0	102.0	104.0					11																	11941942		1825	4076	5901	SO:0001819	synonymous_variant	55031				base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding	g.chr11:11941942C>T	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.1179C>T	11.37:g.11941942C>T						USP47_uc001mjr.2_Silent_p.F305F|USP47_uc001mjs.2_Silent_p.F373F	p.F393F	NM_017944	NP_060414	Q96K76	UBP47_HUMAN		Epithelial(150;0.000339)	11	1942	+			393					B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Silent	SNP	ENST00000399455.2	37	c.1179C>T																																																																																					0.358	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944		16	59	0	0	0	0.00499	0	16	59				
LDHC	3948	broad.mit.edu	37	11	18456297	18456297	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:18456297G>C	ENST00000541669.1	+	5	540	c.429G>C	c.(427-429)ttG>ttC	p.L143F	LDHC_ENST00000546146.1_Missense_Mutation_p.L85F|LDHC_ENST00000280704.4_Missense_Mutation_p.L143F|LDHC_ENST00000535809.1_Missense_Mutation_p.L143F|LDHC_ENST00000544105.1_Missense_Mutation_p.L143F|LDHC_ENST00000536880.1_Missense_Mutation_p.L129F|LDHC_ENST00000537486.1_Intron			P07864	LDHC_HUMAN	lactate dehydrogenase C	143					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)	p.L143F(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGGATATTTTGACATATATAG	0.308																																							uc001mon.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(427-429)TTG>TTC		L-lactate dehydrogenase C	NADH(DB00157)						106.0	112.0	110.0					11																	18456297		2199	4293	6492	SO:0001583	missense	3948				glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity	g.chr11:18456297G>C	AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.429G>C	11.37:g.18456297G>C	ENSP00000437783:p.Leu143Phe					LDHC_uc001mom.3_Missense_Mutation_p.L143F|LDHC_uc009yhp.2_Missense_Mutation_p.L143F|LDHC_uc001moo.3_Missense_Mutation_p.L27F|LDHC_uc009yhq.2_RNA|LDHC_uc009yhr.2_Missense_Mutation_p.L27F	p.L143F	NM_017448	NP_059144	P07864	LDHC_HUMAN			5	541	+			143					D3DQY4|Q6GSG8|Q7Z7J4	Missense_Mutation	SNP	ENST00000541669.1	37	c.429G>C	CCDS7840.1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.336343	0.24253	.	.	ENSG00000166796	ENST00000541669;ENST00000280704;ENST00000546146;ENST00000536880;ENST00000544105;ENST00000535809	D;D;D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23;-3.23;-3.23	4.66	4.66	0.58398	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.000000	0.64402	D	0.000003	D	0.98021	0.9348	H	0.97214	3.96	0.80722	D	1	D;D;D	0.89917	1.0;0.985;1.0	D;P;D	0.91635	0.999;0.8;0.994	D	0.99490	1.0950	10	0.72032	D	0.01	-7.0976	17.7425	0.88411	0.0:0.0:1.0:0.0	.	143;143;143	F5H155;G3XAP5;P07864	.;.;LDHC_HUMAN	F	143;143;85;129;143;143	ENSP00000437783:L143F;ENSP00000280704:L143F;ENSP00000443414:L85F;ENSP00000439555:L129F;ENSP00000439060:L143F;ENSP00000443997:L143F	ENSP00000280704:L143F	L	+	3	2	LDHC	18412873	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	4.433000	0.59929	2.441000	0.82636	0.650000	0.86243	TTG		0.308	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1	NM_017448		29	152	0	0	0	0.012213	0	29	152				
MRGPRX2	117194	broad.mit.edu	37	11	19077532	19077532	+	Missense_Mutation	SNP	G	G	A	rs60756581	byFrequency	TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:19077532G>A	ENST00000329773.2	-	2	505	c.418C>T	c.(418-420)Cgc>Tgc	p.R140C		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	140					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)	p.R140C(2)		NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						CTGGGGCGGCGGCAGCGATAC	0.607													G|||	11	0.00219649	0.0083	0.0	5008	,	,		18503	0.0		0.0	False		,,,				2504	0.0				GBM(198;1966 2199 4849 37227 49954)	GBM(198;1966 2199 4849 37227 49954)	uc001mph.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(418-420)CGC>TGC		MAS-related GPR, member X2		G	CYS/ARG	30,4368		0,30,2169	63.0	60.0	61.0		418	2.4	0.0	11	dbSNP_129	61	0,8586		0,0,4293	no	missense	MRGPRX2	NM_054030.2	180	0,30,6462	AA,AG,GG		0.0,0.6821,0.2311	probably-damaging	140/331	19077532	30,12954	2199	4293	6492	SO:0001583	missense	117194				sensory perception of pain|sleep	plasma membrane	G-protein coupled receptor activity|neuropeptide binding	g.chr11:19077532G>A		CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.418C>T	11.37:g.19077532G>A	ENSP00000333800:p.Arg140Cys						p.R140C	NM_054030	NP_473371	Q96LB1	MRGX2_HUMAN			2	506	-			140			Cytoplasmic (Potential).		B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Missense_Mutation	SNP	ENST00000329773.2	37	c.418C>T	CCDS7847.1	7	0.003205128205128205	7	0.014227642276422764	0	0.0	0	0.0	0	0.0	.	18.84	3.709155	0.68615	0.006821	0.0	ENSG00000183695	ENST00000329773	T	0.73469	-0.75	5.26	2.36	0.29203	GPCR, rhodopsin-like superfamily (1);	1.021590	0.07797	N	0.955916	T	0.61751	0.2372	L	0.59912	1.85	0.09310	N	1	P	0.43431	0.807	B	0.40506	0.331	T	0.57533	-0.7795	10	0.87932	D	0	.	4.2208	0.10556	0.2486:0.0:0.5914:0.16	rs60756581	140	Q96LB1	MRGX2_HUMAN	C	140	ENSP00000333800:R140C	ENSP00000333800:R140C	R	-	1	0	MRGPRX2	19034108	0.107000	0.21998	0.001000	0.08648	0.957000	0.61999	2.283000	0.43470	0.460000	0.27045	0.655000	0.94253	CGC		0.607	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387819.1	NM_054030		22	91	0	0	0	0.00333	0	22	91				
LUZP2	338645	broad.mit.edu	37	11	25004819	25004819	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:25004819G>T	ENST00000336930.6	+	9	811	c.745G>T	c.(745-747)Gat>Tat	p.D249Y	LUZP2_ENST00000533227.1_Missense_Mutation_p.D163Y			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	249						extracellular region (GO:0005576)		p.D249Y(2)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						TAAGCTTCCAGATGCAGCGGC	0.428																																							uc001mqs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(745-747)GAT>TAT		leucine zipper protein 2 precursor							119.0	106.0	111.0					11																	25004819		2203	4300	6503	SO:0001583	missense	338645					extracellular region		g.chr11:25004819G>T	AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.745G>T	11.37:g.25004819G>T	ENSP00000336817:p.Asp249Tyr					LUZP2_uc009yif.2_Missense_Mutation_p.D163Y|LUZP2_uc009yig.2_Missense_Mutation_p.D207Y	p.D249Y	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN			9	979	+			249					A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	ENST00000336930.6	37	c.745G>T	CCDS31446.1	.	.	.	.	.	.	.	.	.	.	G	0.124	-1.121852	0.01785	.	.	ENSG00000187398	ENST00000336930;ENST00000533227	T;T	0.31510	1.49;1.9	5.53	1.09	0.20402	.	1.196000	0.06005	N	0.648564	T	0.12305	0.0299	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.001	T	0.27434	-1.0074	10	0.02654	T	1	0.2809	3.0836	0.06271	0.297:0.0:0.3905:0.3125	.	163;249	E9PN53;Q86TE4	.;LUZP2_HUMAN	Y	249;163	ENSP00000336817:D249Y;ENSP00000432952:D163Y	ENSP00000336817:D249Y	D	+	1	0	LUZP2	24961395	0.963000	0.33076	0.000000	0.03702	0.083000	0.17756	1.597000	0.36729	0.247000	0.21414	-0.143000	0.13931	GAT		0.428	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909		14	77	1	0	8.60227e-14	0.004007	9.59731e-14	14	77				
LRRC4C	57689	broad.mit.edu	37	11	40136580	40136580	+	Silent	SNP	T	T	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:40136580T>A	ENST00000278198.2	-	2	3226	c.1263A>T	c.(1261-1263)acA>acT	p.T421T	LRRC4C_ENST00000530763.1_Silent_p.T421T|LRRC4C_ENST00000528697.1_Silent_p.T421T|LRRC4C_ENST00000527150.1_Silent_p.T421T			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	421	Ig-like C2-type.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.T421T(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TGTACATGCCTGTATCTTGCA	0.438																																							uc001mxa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(3)|central_nervous_system(1)	8						c.(1261-1263)ACA>ACT		netrin-G1 ligand precursor							198.0	172.0	181.0					11																	40136580		2203	4300	6503	SO:0001819	synonymous_variant	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136580T>A	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1263A>T	11.37:g.40136580T>A						LRRC4C_uc001mxc.1_Silent_p.T417T|LRRC4C_uc001mxd.1_Silent_p.T417T|LRRC4C_uc001mxb.1_Silent_p.T417T	p.T421T	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN			2	3227	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	421			Ig-like C2-type.		A8K0T1|Q7L0N3	Silent	SNP	ENST00000278198.2	37	c.1263A>T	CCDS31464.1																																																																																				0.438	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		91	224	0	0	0	0.01441	0	91	224				
OR4C3	256144	broad.mit.edu	37	11	48346987	48346987	+	Silent	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:48346987C>G	ENST00000319856.4	+	1	516	c.495C>G	c.(493-495)ctC>ctG	p.L165L		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						CCAGGCATCTCTGTGCCATGC	0.537																																							uc010rhv.1		NA																	0				skin(1)	1						c.(493-495)CTC>CTG		olfactory receptor, family 4, subfamily C,							143.0	137.0	139.0					11																	48346987		2201	4298	6499	SO:0001819	synonymous_variant	256144				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48346987C>G	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.495C>G	11.37:g.48346987C>G							p.L165L	NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN			1	495	+			138			Helical; Name=4; (Potential).		B2RNF2|Q6IFB3	Silent	SNP	ENST00000319856.4	37	c.495C>G	CCDS31489.1																																																																																				0.537	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1	NM_001004702		81	152	0	0	0	0.01441	0	81	152				
OR4C11	219429	broad.mit.edu	37	11	55371624	55371624	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:55371624C>A	ENST00000302231.4	-	1	250	c.226G>T	c.(226-228)Gcc>Tcc	p.A76S		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A76S(2)		endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						AATCTAGGGGCTGTGGAAGTT	0.398																																							uc010rii.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(226-228)GCC>TCC		olfactory receptor, family 4, subfamily C,							80.0	76.0	77.0					11																	55371624		2177	4003	6180	SO:0001583	missense	219429				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55371624C>A	AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.226G>T	11.37:g.55371624C>A	ENSP00000306651:p.Ala76Ser						p.A76S	NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN			1	226	-			76			Helical; Name=2; (Potential).		B9EIL4|Q8NGL8	Missense_Mutation	SNP	ENST00000302231.4	37	c.226G>T	CCDS31503.1	.	.	.	.	.	.	.	.	.	.	C	4.282	0.051453	0.08291	.	.	ENSG00000172188	ENST00000302231	T	0.02032	4.49	4.34	3.42	0.39159	GPCR, rhodopsin-like superfamily (1);	0.135912	0.33553	U	0.004795	T	0.02380	0.0073	L	0.40543	1.245	0.09310	N	1	P	0.38300	0.626	B	0.36186	0.219	T	0.48031	-0.9070	10	0.29301	T	0.29	.	10.2097	0.43134	0.0:0.9003:0.0:0.0997	.	76	Q6IEV9	OR4CB_HUMAN	S	76	ENSP00000306651:A76S	ENSP00000306651:A76S	A	-	1	0	OR4C11	55128200	0.000000	0.05858	0.176000	0.23000	0.069000	0.16628	-1.954000	0.01525	1.181000	0.42912	0.478000	0.44815	GCC		0.398	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700		36	20	1	0	6.90743e-12	0.003755	7.53767e-12	36	20				
OR5L2	26338	broad.mit.edu	37	11	55595383	55595383	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:55595383C>A	ENST00000378397.1	+	1	689	c.689C>A	c.(688-690)tCt>tAt	p.S230Y		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				AAGATACACTCTGCAGAGAGC	0.493										HNSCC(27;0.073)																													uc001nhy.1		NA																	0				ovary(1)	1						c.(688-690)TCT>TAT		olfactory receptor, family 5, subfamily L,							184.0	155.0	165.0					11																	55595383		2200	4296	6496	SO:0001583	missense	26338				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55595383C>A	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.689C>A	11.37:g.55595383C>A	ENSP00000367650:p.Ser230Tyr	HNSCC(27;0.073)					p.S230Y	NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN			1	689	+		all_epithelial(135;0.208)	230			Cytoplasmic (Potential).		Q6IF66|Q96RB2	Missense_Mutation	SNP	ENST00000378397.1	37	c.689C>A	CCDS31511.1	.	.	.	.	.	.	.	.	.	.	.	10.99	1.506524	0.26949	.	.	ENSG00000205030	ENST00000378397	T	0.00337	8.05	5.24	5.24	0.73138	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000080	T	0.01353	0.0044	H	0.97186	3.955	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.20338	-1.0278	10	0.87932	D	0	-34.6134	12.2873	0.54798	0.0:0.9169:0.0:0.0831	.	230	Q8NGL0	OR5L2_HUMAN	Y	230	ENSP00000367650:S230Y	ENSP00000367650:S230Y	S	+	2	0	OR5L2	55351959	0.000000	0.05858	0.770000	0.31555	0.001000	0.01503	0.986000	0.29590	2.617000	0.88574	0.632000	0.83419	TCT		0.493	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739		59	126	1	0	1.67886e-27	0.01441	2.06576e-27	59	126				
TNKS1BP1	85456	broad.mit.edu	37	11	57080108	57080108	+	Missense_Mutation	SNP	A	A	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:57080108A>G	ENST00000532437.1	-	4	2365	c.2054T>C	c.(2053-2055)cTg>cCg	p.L685P	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.L685P|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	685	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.L685P(2)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GAGGTCGTCCAGCCAGCGGGA	0.647																																							uc001njr.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(2053-2055)CTG>CCG		tankyrase 1-binding protein 1							53.0	56.0	55.0					11																	57080108		2201	4296	6497	SO:0001583	missense	85456				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding	g.chr11:57080108A>G	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.2054T>C	11.37:g.57080108A>G	ENSP00000437271:p.Leu685Pro					TNKS1BP1_uc001njs.2_Missense_Mutation_p.L685P|TNKS1BP1_uc009ymd.1_Missense_Mutation_p.L136P	p.L685P	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN			4	2366	-		all_epithelial(135;0.21)	685			Pro-rich.|Acidic.		A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	c.2054T>C	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	A	16.17	3.047791	0.55110	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.60672	0.17;0.17	3.52	3.52	0.40303	.	0.000000	0.30676	N	0.009106	T	0.63224	0.2493	L	0.32530	0.975	0.58432	D	0.999995	D	0.89917	1.0	D	0.87578	0.998	T	0.64516	-0.6389	10	0.56958	D	0.05	-9.7735	10.4357	0.44435	1.0:0.0:0.0:0.0	.	685	Q9C0C2	TB182_HUMAN	P	685	ENSP00000350990:L685P;ENSP00000437271:L685P	ENSP00000350990:L685P	L	-	2	0	TNKS1BP1	56836684	1.000000	0.71417	0.989000	0.46669	0.479000	0.33129	5.114000	0.64648	1.484000	0.48361	0.374000	0.22700	CTG		0.647	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396		47	78	0	0	0	0.01441	0	47	78				
MS4A15	219995	broad.mit.edu	37	11	60543133	60543133	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:60543133C>T	ENST00000405633.3	+	7	747	c.668C>T	c.(667-669)gCa>gTa	p.A223V	MS4A15_ENST00000528170.1_Missense_Mutation_p.A182V|MS4A15_ENST00000337911.4_Missense_Mutation_p.A130V	NM_001098835.1	NP_001092305.1	Q8N5U1	M4A15_HUMAN	membrane-spanning 4-domains, subfamily A, member 15	223						integral component of membrane (GO:0016021)				breast(1)|large_intestine(2)|lung(3)	6						CCCAGCCCGGCAGCCTCTGCG	0.587											OREG0020991	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc009ynf.1		NA																	0				lung(1)	1						c.(667-669)GCA>GTA		membrane-spanning 4-domains, subfamily A, member							113.0	120.0	117.0					11																	60543133		2203	4300	6503	SO:0001583	missense	219995					integral to membrane	receptor activity	g.chr11:60543133C>T	AY584608	CCDS7991.1, CCDS44617.1, CCDS60802.1	11q12.2	2008-03-25							28573	protein-coding gene	gene with protein product							Standard	NM_001098835		Approved		uc009ynf.1	Q8N5U1		ENST00000405633.3:c.668C>T	11.37:g.60543133C>T	ENSP00000386022:p.Ala223Val		OREG0020991	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1046	MS4A15_uc001npx.2_Missense_Mutation_p.A130V|MS4A15_uc001npy.2_RNA|MS4A15_uc009yng.1_Missense_Mutation_p.A182V	p.A223V	NM_001098835	NP_001092305	Q8N5U1	M4A15_HUMAN			7	888	+			223					A9UJY6|A9UJY7|F2Z2J5	Missense_Mutation	SNP	ENST00000405633.3	37	c.668C>T	CCDS44617.1	.	.	.	.	.	.	.	.	.	.	C	6.825	0.521408	0.13005	.	.	ENSG00000166961	ENST00000528170;ENST00000337911;ENST00000405633	T;T;T	0.14266	2.52;2.52;2.92	5.25	5.25	0.73442	.	0.381500	0.25645	N	0.029254	T	0.29223	0.0727	L	0.53249	1.67	0.21762	N	0.999553	D;P	0.69078	0.997;0.657	D;B	0.75020	0.985;0.197	T	0.14839	-1.0458	10	0.16420	T	0.52	-8.1544	14.3436	0.66643	0.0:1.0:0.0:0.0	.	182;223	F2Z2J5;Q8N5U1	.;M4A15_HUMAN	V	182;130;223	ENSP00000434165:A182V;ENSP00000338692:A130V;ENSP00000386022:A223V	ENSP00000338692:A130V	A	+	2	0	MS4A15	60299709	0.997000	0.39634	0.194000	0.23346	0.058000	0.15608	2.468000	0.45102	2.435000	0.82474	0.643000	0.83706	GCA		0.587	MS4A15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395618.1			64	204	0	0	0	0.01441	0	64	204				
PLCB3	5331	broad.mit.edu	37	11	64029532	64029532	+	Silent	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:64029532C>T	ENST00000540288.1	+	17	2125	c.2022C>T	c.(2020-2022)ctC>ctT	p.L674L	PLCB3_ENST00000279230.6_Silent_p.L674L|PLCB3_ENST00000325234.5_Silent_p.L607L	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	674	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.L674L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						TTGTTGCGCTCAACTTCCAGA	0.607																																							uc001nzb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(2020-2022)CTC>CTT		phospholipase C beta 3							142.0	122.0	129.0					11																	64029532		2201	4297	6498	SO:0001819	synonymous_variant	5331				intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr11:64029532C>T	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.2022C>T	11.37:g.64029532C>T						PLCB3_uc009ypg.1_Silent_p.L674L|PLCB3_uc009yph.1_Silent_p.L607L|PLCB3_uc009ypi.2_Silent_p.L674L	p.L674L	NM_000932	NP_000923	Q01970	PLCB3_HUMAN			17	2022	+			674			PI-PLC Y-box.		A5PKZ6|G5E960|Q8N1A4	Silent	SNP	ENST00000540288.1	37	c.2022C>T	CCDS8064.1																																																																																				0.607	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1			37	88	0	0	0	0.006999	0	37	88				
VPS51	738	broad.mit.edu	37	11	64875899	64875899	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:64875899C>T	ENST00000279281.3	+	5	1048	c.956C>T	c.(955-957)gCg>gTg	p.A319V	AP003068.9_ENST00000528887.1_RNA|VPS51_ENST00000527646.1_3'UTR	NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)	319					autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											TGCCAGGTGGCGGCGGCCTAC	0.697																																							uc001ocr.1		NA																	0					0						c.(955-957)GCG>GTG		chromosome 11 open reading frame 2							17.0	22.0	20.0					11																	64875899		2192	4287	6479	SO:0001583	missense	738				lipid transport|protein transport	Golgi apparatus|integral to membrane		g.chr11:64875899C>T	AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.956C>T	11.37:g.64875899C>T	ENSP00000279281:p.Ala319Val					C11orf2_uc001ocs.1_Missense_Mutation_p.A195V	p.A319V	NM_013265	NP_037397	Q9UID3	FFR_HUMAN			5	996	+			319					Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Missense_Mutation	SNP	ENST00000279281.3	37	c.956C>T	CCDS8093.1	.	.	.	.	.	.	.	.	.	.	C	5.104	0.204733	0.09704	.	.	ENSG00000149823	ENST00000279281;ENST00000534557	T;T	0.78126	-1.15;-1.15	4.22	3.3	0.37823	Cullin repeat-like-containing domain (1);	0.177245	0.50627	D	0.000113	T	0.57446	0.2054	N	0.16098	0.37	0.40506	D	0.980698	B	0.06786	0.001	B	0.06405	0.002	T	0.52852	-0.8520	9	.	.	.	-10.7925	9.7532	0.40487	0.0:0.8949:0.0:0.1051	.	319	Q9UID3	FFR_HUMAN	V	319;233	ENSP00000279281:A319V;ENSP00000435691:A233V	.	A	+	2	0	C11orf2	64632475	0.990000	0.36364	0.939000	0.37840	0.953000	0.61014	2.442000	0.44873	2.350000	0.79820	0.549000	0.68633	GCG		0.697	VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385217.1	NM_013265		3	47	0	0	0	0.009096	0	3	47				
SPDYC	387778	broad.mit.edu	37	11	64940248	64940248	+	Missense_Mutation	SNP	C	C	T	rs372669084		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:64940248C>T	ENST00000377185.2	+	6	692	c.610C>T	c.(610-612)Cgc>Tgc	p.R204C	AP003068.18_ENST00000534819.1_RNA	NM_001008778.1	NP_001008778.1			speedy/RINGO cell cycle regulator family member C									p.R204C(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)	16						GGTCCCTGTTCGCCTTCCCCG	0.652																																							uc010rnz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(610-612)CGC>TGC		speedy C		C	CYS/ARG	1,4401	2.1+/-5.4	0,1,2200	47.0	51.0	50.0		610	-4.3	0.0	11		50	0,8594		0,0,4297	no	missense	SPDYC	NM_001008778.1	180	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	204/294	64940248	1,12995	2201	4297	6498	SO:0001583	missense	387778				cell cycle	nucleus	protein kinase binding	g.chr11:64940248C>T	AY820305	CCDS31606.1	11q13.1	2013-05-08	2013-05-08		ENSG00000204710	ENSG00000204710		"""Speedy homologs"""	32681	protein-coding gene	gene with protein product		614030	"""speedy homolog C (Xenopus laevis)"""			15611625	Standard	NM_001008778		Approved	Ringo2	uc010rnz.2	Q5MJ68	OTTHUMG00000165611	ENST00000377185.2:c.610C>T	11.37:g.64940248C>T	ENSP00000366390:p.Arg204Cys						p.R204C	NM_001008778	NP_001008778	Q5MJ68	SPDYC_HUMAN			6	610	+			204						Missense_Mutation	SNP	ENST00000377185.2	37	c.610C>T	CCDS31606.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.998839	0.35226	2.27E-4	0.0	ENSG00000204710	ENST00000377185	.	.	.	5.5	-4.28	0.03732	.	3.005050	0.01254	N	0.008964	T	0.20210	0.0486	N	0.19112	0.55	0.09310	N	1	B	0.16802	0.019	B	0.06405	0.002	T	0.10132	-1.0643	9	0.38643	T	0.18	.	2.2438	0.04026	0.1014:0.285:0.219:0.3946	.	204	Q5MJ68	SPDYC_HUMAN	C	204	.	ENSP00000366390:R204C	R	+	1	0	SPDYC	64696824	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.519000	0.06260	-0.562000	0.06086	-0.126000	0.14955	CGC		0.652	SPDYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385299.1	NM_001008778		54	87	0	0	0	0.01441	0	54	87				
LTBP3	4054	broad.mit.edu	37	11	65318931	65318931	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:65318931C>G	ENST00000301873.5	-	10	1831	c.1563G>C	c.(1561-1563)gaG>gaC	p.E521D	LTBP3_ENST00000322147.4_Missense_Mutation_p.E521D|LTBP3_ENST00000536982.1_Missense_Mutation_p.E147D|LTBP3_ENST00000532932.1_5'Flank	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	521					bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)	p.E521D(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						GCACTGACCTCTCCTCACTCA	0.637																																							uc001oej.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|lung(1)	3						c.(1561-1563)GAG>GAC		latent transforming growth factor beta binding							76.0	57.0	64.0					11																	65318931		2201	4297	6498	SO:0001583	missense	4054					extracellular region	calcium ion binding|growth factor binding	g.chr11:65318931C>G	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.1563G>C	11.37:g.65318931C>G	ENSP00000301873:p.Glu521Asp					LTBP3_uc001oeh.2_5'Flank|LTBP3_uc010roi.1_Missense_Mutation_p.E404D|LTBP3_uc001oei.2_Missense_Mutation_p.E521D|LTBP3_uc010roj.1_Missense_Mutation_p.E222D|LTBP3_uc010rok.1_Missense_Mutation_p.E432D	p.E521D	NM_001130144	NP_001123616	Q9NS15	LTBP3_HUMAN			10	1832	-			521					O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	ENST00000301873.5	37	c.1563G>C	CCDS44647.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.97|10.97	1.502356|1.502356	0.26949|0.26949	.|.	.|.	ENSG00000168056|ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000536982;ENST00000530866|ENST00000526927	T;D;T;T|T	0.81499|0.80304	-1.43;-1.5;-1.37;-1.4|-1.36	4.56|4.56	2.67|2.67	0.31697|0.31697	.|.	0.582602|0.582602	0.15439|0.15439	N|N	0.262281|0.262281	T|T	0.69780|0.69780	0.3149|0.3149	L|L	0.40543|0.40543	1.245|1.245	0.27964|0.27964	N|N	0.936659|0.936659	B;P;B;B;P|.	0.41848|.	0.293;0.634;0.094;0.231;0.763|.	B;B;B;B;B|.	0.39840|.	0.039;0.167;0.026;0.081;0.311|.	T|T	0.55742|0.55742	-0.8093|-0.8093	10|8	0.25751|0.10636	T|T	0.34|0.68	.|.	7.0846|7.0846	0.25249|0.25249	0.0:0.7903:0.0:0.2097|0.0:0.7903:0.0:0.2097	.|.	432;147;404;521;521|.	E9PKW1;F5GWC4;B9EG76;Q9NS15;Q9NS15-2|.	.;.;.;LTBP3_HUMAN;.|.	D|Q	521;521;147;432|172	ENSP00000326647:E521D;ENSP00000301873:E521D;ENSP00000441912:E147D;ENSP00000435276:E432D|ENSP00000431219:E172Q	ENSP00000301873:E521D|ENSP00000431219:E172Q	E|E	-|-	3|1	2|0	LTBP3|LTBP3	65075507|65075507	1.000000|1.000000	0.71417|0.71417	0.866000|0.866000	0.34008|0.34008	0.987000|0.987000	0.75469|0.75469	1.130000|1.130000	0.31393|0.31393	0.535000|0.535000	0.28714|0.28714	0.505000|0.505000	0.49811|0.49811	GAG|GAG		0.637	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070		25	79	0	0	0	0.005443	0	25	79				
GPR152	390212	broad.mit.edu	37	11	67219321	67219321	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:67219321G>T	ENST00000312457.2	-	1	879	c.875C>A	c.(874-876)cCc>cAc	p.P292H	CABP4_ENST00000438189.2_5'Flank	NM_206997.1	NP_996880.1	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P292H(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			GCAGAGGAAGGGGCTGAGGCA	0.652																																					Pancreas(102;800 1581 2723 7382 33622)	Pancreas(102;800 1581 2723 7382 33622)	uc001olm.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(874-876)CCC>CAC		G protein-coupled receptor 152							67.0	62.0	64.0					11																	67219321		2200	4295	6495	SO:0001583	missense	390212					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:67219321G>T	AY255600	CCDS8165.1	11q13.2	2013-09-20			ENSG00000175514	ENSG00000175514		"""GPCR / Class A : Orphans"""	23622	protein-coding gene	gene with protein product						12679517	Standard	NM_206997		Approved	PGR5	uc001olm.3	Q8TDT2	OTTHUMG00000168032	ENST00000312457.2:c.875C>A	11.37:g.67219321G>T	ENSP00000310255:p.Pro292His					uc009yrw.1_5'Flank|CABP4_uc001oln.2_5'Flank	p.P292H	NM_206997	NP_996880	Q8TDT2	GP152_HUMAN	BRCA - Breast invasive adenocarcinoma(15;8.18e-06)		1	880	-			292			Helical; Name=7; (Potential).		Q0VD88|Q86SM0	Missense_Mutation	SNP	ENST00000312457.2	37	c.875C>A	CCDS8165.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679621	0.47886	.	.	ENSG00000175514	ENST00000312457	D	0.98807	-5.15	4.67	4.67	0.58626	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41605	D	0.000853	D	0.98735	0.9575	L	0.57536	1.79	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.99655	1.0992	10	0.87932	D	0	.	15.1094	0.72343	0.0:0.0:1.0:0.0	.	292	Q8TDT2	GP152_HUMAN	H	292	ENSP00000310255:P292H	ENSP00000310255:P292H	P	-	2	0	GPR152	66975897	1.000000	0.71417	0.983000	0.44433	0.017000	0.09413	7.171000	0.77595	2.403000	0.81681	0.561000	0.74099	CCC		0.652	GPR152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397623.1			27	88	1	0	9.58827e-17	0.01441	1.10691e-16	27	88				
LRP5	4041	broad.mit.edu	37	11	68115636	68115636	+	Missense_Mutation	SNP	A	A	G	rs371729974		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:68115636A>G	ENST00000294304.7	+	2	519	c.413A>G	c.(412-414)aAt>aGt	p.N138S		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	138	Beta-propeller 1.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.N138S(1)		autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCCAACCTCAATGGCACATCC	0.647																																							uc001ont.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						c.(412-414)AAT>AGT		low density lipoprotein receptor-related protein		A	SER/ASN	2,4398	4.2+/-10.8	0,2,2198	94.0	90.0	91.0		413	2.5	0.3	11		91	0,8588		0,0,4294	no	missense	LRP5	NM_002335.2	46	0,2,6492	GG,GA,AA		0.0,0.0455,0.0154	benign	138/1616	68115636	2,12986	2200	4294	6494	SO:0001583	missense	4041				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity	g.chr11:68115636A>G	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.413A>G	11.37:g.68115636A>G	ENSP00000294304:p.Asn138Ser					LRP5_uc009ysg.2_5'UTR	p.N138S	NM_002335	NP_002326	O75197	LRP5_HUMAN			2	488	+			138			Beta-propeller 1.|LDL-receptor class B 2.|Extracellular (Potential).		Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	c.413A>G	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	A	11.55	1.671250	0.29693	4.55E-4	0.0	ENSG00000162337	ENST00000294304	D	0.89415	-2.51	3.71	2.55	0.30701	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.51477	U	0.000087	D	0.87172	0.6111	L	0.58428	1.81	0.41139	D	0.985941	B	0.32862	0.387	B	0.39771	0.309	D	0.84572	0.0656	10	0.59425	D	0.04	.	9.5772	0.39465	0.8431:0.0:0.0:0.1569	.	138	O75197	LRP5_HUMAN	S	138	ENSP00000294304:N138S	ENSP00000294304:N138S	N	+	2	0	LRP5	67872212	1.000000	0.71417	0.287000	0.24848	0.155000	0.21991	9.024000	0.93689	0.581000	0.29539	0.459000	0.35465	AAT		0.647	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335		112	190	0	0	0	0.01441	0	112	190				
C11orf30	56946	broad.mit.edu	37	11	76227233	76227233	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:76227233C>T	ENST00000529032.1	+	10	1561	c.1561C>T	c.(1561-1563)Cgg>Tgg	p.R521W	C11orf30_ENST00000524490.1_Missense_Mutation_p.R437W|C11orf30_ENST00000343878.3_Missense_Mutation_p.R521W|C11orf30_ENST00000533248.1_Missense_Mutation_p.R535W|C11orf30_ENST00000334736.3_Missense_Mutation_p.R521W|C11orf30_ENST00000524767.1_Missense_Mutation_p.R536W|C11orf30_ENST00000525919.1_Missense_Mutation_p.R522W|C11orf30_ENST00000525038.1_Missense_Mutation_p.R536W			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	521	Thr-rich.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.R521W(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						ATCCATTGGTCGGATGGCTGC	0.473																																							uc001oxl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|skin(1)	6						c.(1561-1563)CGG>TGG		EMSY protein							115.0	111.0	113.0					11																	76227233		2200	4292	6492	SO:0001583	missense	56946				chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr11:76227233C>T	AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.1561C>T	11.37:g.76227233C>T	ENSP00000432327:p.Arg521Trp					C11orf30_uc001oxm.2_Missense_Mutation_p.R437W|C11orf30_uc010rsb.1_Missense_Mutation_p.R536W|C11orf30_uc010rsc.1_Missense_Mutation_p.R536W|C11orf30_uc001oxn.2_Missense_Mutation_p.R522W|C11orf30_uc010rsd.1_Missense_Mutation_p.R535W	p.R521W	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN			11	1704	+			521			Thr-rich.		B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	c.1561C>T	CCDS8244.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159942	0.57368	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000533972;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032;ENST00000531998	.	.	.	5.38	5.38	0.77491	.	0.118092	0.56097	D	0.000023	T	0.67021	0.2849	L	0.27053	0.805	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.79784	0.985;0.985;0.985;0.993;0.99;0.993	T	0.70575	-0.4834	9	0.66056	D	0.02	-8.4169	19.1179	0.93350	0.0:1.0:0.0:0.0	.	535;536;536;522;437;521	B7ZKT8;B7ZKU2;B7ZKU0;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;EMSY_HUMAN	W	437;521;521;90;536;535;522;536;521;63	.	ENSP00000334130:R521W	R	+	1	2	C11orf30	75904881	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.618000	0.67722	2.508000	0.84585	0.557000	0.71058	CGG		0.473	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193		37	128	0	0	0	0.004878	0	37	128				
MYO7A	4647	broad.mit.edu	37	11	76871264	76871264	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:76871264G>C	ENST00000409709.3	+	11	1408	c.1136G>C	c.(1135-1137)gGg>gCg	p.G379A	MYO7A_ENST00000409893.1_Missense_Mutation_p.G379A|MYO7A_ENST00000409619.2_Missense_Mutation_p.G368A|MYO7A_ENST00000458637.2_Missense_Mutation_p.G379A	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	379	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)	p.G379A(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						ATCACCCGCGGGGAGACGGTG	0.667																																							uc001oyb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(1135-1137)GGG>GCG		myosin VIIA isoform 1							25.0	35.0	31.0					11																	76871264		2106	4186	6292	SO:0001583	missense	4647				actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr11:76871264G>C	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.1136G>C	11.37:g.76871264G>C	ENSP00000386331:p.Gly379Ala					MYO7A_uc010rsl.1_Missense_Mutation_p.G379A|MYO7A_uc010rsm.1_Missense_Mutation_p.G368A|MYO7A_uc001oyc.2_Missense_Mutation_p.G379A	p.G379A	NM_000260	NP_000251	Q13402	MYO7A_HUMAN			11	1408	+			379			Myosin head-like.		B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	c.1136G>C	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	g	24.7	4.564481	0.86439	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	5.11	5.11	0.69529	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93697	0.7986	M	0.82433	2.59	0.80722	D	1	D;P;D	0.61697	0.973;0.933;0.99	D;P;D	0.67900	0.923;0.836;0.954	D	0.94311	0.7545	10	0.62326	D	0.03	.	18.5314	0.90993	0.0:0.0:1.0:0.0	.	379;379;379	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	A	379;379;379;368;378;378;301;378	ENSP00000386331:G379A;ENSP00000386689:G379A;ENSP00000392185:G379A;ENSP00000386635:G368A	ENSP00000345075:G301A	G	+	2	0	MYO7A	76548912	1.000000	0.71417	0.967000	0.41034	0.928000	0.56348	7.825000	0.86693	2.357000	0.79964	0.586000	0.80456	GGG		0.667	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260		5	4	0	0	0	0.000602	0	5	4				
TENM4	26011	broad.mit.edu	37	11	78399268	78399268	+	Silent	SNP	G	G	A	rs191934567		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:78399268G>A	ENST00000278550.7	-	29	5553	c.5091C>T	c.(5089-5091)taC>taT	p.Y1697Y		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1697					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CAAAGCTGTCGTACCTGGAAA	0.502													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20926	0.0		0.0	False		,,,				2504	0.0						uc001ozl.3		NA																	0				ovary(2)|pancreas(2)	4						c.(5089-5091)TAC>TAT		odz, odd Oz/ten-m homolog 4							157.0	157.0	157.0					11																	78399268		2047	4184	6231	SO:0001819	synonymous_variant	26011				signal transduction	integral to membrane		g.chr11:78399268G>A	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5091C>T	11.37:g.78399268G>A						ODZ4_uc009yvb.1_Silent_p.Y281Y	p.Y1697Y	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN			29	5554	-			1697			YD 4.|Extracellular (Potential).		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	c.5091C>T	CCDS44688.1																																																																																				0.502	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			108	225	0	0	0	0.01441	0	108	225				
CEP57	9702	broad.mit.edu	37	11	95546154	95546154	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:95546154G>C	ENST00000325542.5	+	3	499	c.261G>C	c.(259-261)agG>agC	p.R87S	CEP57_ENST00000541150.1_Missense_Mutation_p.R78S|CEP57_ENST00000538658.1_Missense_Mutation_p.R87S|CEP57_ENST00000537677.1_Missense_Mutation_p.R60S|CEP57_ENST00000325486.5_Missense_Mutation_p.R87S|CEP57_ENST00000536587.1_3'UTR	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	87	centrosome localization domain (CLD). {ECO:0000250}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)	p.R87S(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AACTTGAGAGGATTCAGGCAG	0.368									Mosaic Variegated Aneuploidy Syndrome																														uc001pfp.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(259-261)AGG>AGC		translokin							88.0	89.0	89.0					11																	95546154		2201	4298	6499	SO:0001583	missense	9702	Mosaic_Variegated_Aneuploidy_Syndrome	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	fibroblast growth factor receptor signaling pathway|G2/M transition of mitotic cell cycle|protein import into nucleus, translocation|spermatid development	centrosome|cytosol|Golgi apparatus|microtubule|nucleus	fibroblast growth factor binding|protein homodimerization activity	g.chr11:95546154G>C	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.261G>C	11.37:g.95546154G>C	ENSP00000317902:p.Arg87Ser					CEP57_uc001pfo.1_Missense_Mutation_p.R87S|CEP57_uc010ruh.1_Missense_Mutation_p.R78S|CEP57_uc010rui.1_Missense_Mutation_p.R87S|CEP57_uc009ywn.1_5'UTR|CEP57_uc001pfq.1_Missense_Mutation_p.R87S|CEP57_uc001pfr.1_5'UTR	p.R87S	NM_014679	NP_055494	Q86XR8	CEP57_HUMAN			3	482	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	87			Potential.|centrosome localization domain (CLD) (By similarity).		A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	ENST00000325542.5	37	c.261G>C	CCDS8304.1	.	.	.	.	.	.	.	.	.	.	G	19.02	3.746588	0.69418	.	.	ENSG00000166037	ENST00000537677;ENST00000325542;ENST00000325486;ENST00000544522;ENST00000541365;ENST00000538658;ENST00000541150	T;T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6;0.6	5.98	2.07	0.26955	.	0.000000	0.85682	D	0.000000	T	0.67277	0.2876	M	0.73217	2.22	0.41598	D	0.988837	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.992;0.998;0.996	T	0.66532	-0.5900	10	0.87932	D	0	-2.6514	9.4793	0.38891	0.3276:0.0:0.6724:0.0	.	78;87;87;87	F5H5F7;Q86XR8-2;Q86XR8;Q86XR8-3	.;.;CEP57_HUMAN;.	S	60;87;87;78;60;87;78	ENSP00000441392:R60S;ENSP00000317902:R87S;ENSP00000317487:R87S;ENSP00000438065:R78S;ENSP00000445821:R60S;ENSP00000445706:R87S;ENSP00000443436:R78S	ENSP00000317487:R87S	R	+	3	2	CEP57	95185802	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	0.616000	0.24344	0.136000	0.18733	-0.229000	0.12294	AGG		0.368	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395983.1	NM_014679		26	124	0	0	0	0.00333	0	26	124				
EXPH5	23086	broad.mit.edu	37	11	108380461	108380461	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:108380461C>T	ENST00000265843.4	-	6	5883	c.5773G>A	c.(5773-5775)Gat>Aat	p.D1925N	EXPH5_ENST00000428840.1_Missense_Mutation_p.D1849N|EXPH5_ENST00000525344.1_Missense_Mutation_p.D1918N|EXPH5_ENST00000443411.1_Missense_Mutation_p.D1737N	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1925					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)	p.D1925N(2)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTCCTCAAATCATCTTTTAGG	0.408																																							uc001pkk.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)	5						c.(5773-5775)GAT>AAT		exophilin 5 isoform a							73.0	75.0	75.0					11																	108380461		2201	4298	6499	SO:0001583	missense	23086				intracellular protein transport		Rab GTPase binding	g.chr11:108380461C>T		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.5773G>A	11.37:g.108380461C>T	ENSP00000265843:p.Asp1925Asn					EXPH5_uc010rvy.1_Missense_Mutation_p.D1737N|EXPH5_uc010rvz.1_Missense_Mutation_p.D1769N|EXPH5_uc010rwa.1_Missense_Mutation_p.D1849N	p.D1925N	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)	6	5884	-		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)	1925					Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	c.5773G>A	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.508612	0.44660	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	6.03	4.17	0.49024	.	0.494031	0.20443	N	0.092257	T	0.51261	0.1664	M	0.64997	1.995	0.09310	N	1	P	0.46142	0.873	P	0.47346	0.544	T	0.46233	-0.9206	10	0.59425	D	0.04	-0.4606	10.7851	0.46401	0.0:0.7484:0.0:0.2516	.	1925	Q8NEV8	EXPH5_HUMAN	N	1925;1849;1737;1918;755	ENSP00000265843:D1925N;ENSP00000391966:D1849N;ENSP00000411390:D1737N;ENSP00000432546:D1918N	ENSP00000265843:D1925N	D	-	1	0	EXPH5	107885671	0.982000	0.34865	0.049000	0.19019	0.284000	0.27059	2.123000	0.41996	0.885000	0.36088	0.655000	0.94253	GAT		0.408	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065		47	64	0	0	0	0.010771	0	47	64				
DRD2	1813	broad.mit.edu	37	11	113286252	113286252	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:113286252G>T	ENST00000362072.3	-	5	958	c.614C>A	c.(613-615)aCc>aAc	p.T205N	DRD2_ENST00000355319.2_Missense_Mutation_p.T205N|DRD2_ENST00000346454.3_Missense_Mutation_p.T205N|DRD2_ENST00000544518.1_Missense_Mutation_p.T204N|DRD2_ENST00000535984.1_5'UTR|DRD2_ENST00000542968.1_Missense_Mutation_p.T205N|DRD2_ENST00000538967.1_Missense_Mutation_p.T205N	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	205					activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)	p.T205N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GACCAGCAGGGTGACAATGAA	0.592																																							uc001pnz.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(613-615)ACC>AAC		dopamine receptor D2 isoform long	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)						193.0	155.0	168.0					11																	113286252		2201	4296	6497	SO:0001583	missense	1813				activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding	g.chr11:113286252G>T	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.614C>A	11.37:g.113286252G>T	ENSP00000354859:p.Thr205Asn					DRD2_uc010rwv.1_Missense_Mutation_p.T204N|DRD2_uc001poa.3_Missense_Mutation_p.T205N|DRD2_uc001pob.3_Missense_Mutation_p.T205N|DRD2_uc009yyr.1_Missense_Mutation_p.T205N	p.T205N	NM_000795	NP_000786	P14416	DRD2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	4	935	-		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)	205			Helical; Name=5; (By similarity).		Q9NZR3|Q9UPA9	Missense_Mutation	SNP	ENST00000362072.3	37	c.614C>A	CCDS8361.1	.	.	.	.	.	.	.	.	.	.	G	34	5.398463	0.96030	.	.	ENSG00000149295	ENST00000355319;ENST00000346454;ENST00000362072;ENST00000544518;ENST00000542968;ENST00000538967	T;T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13;1.13	5.67	5.67	0.87782	GPCR, rhodopsin-like superfamily (1);	0.042498	0.85682	D	0.000000	T	0.75302	0.3831	M	0.94021	3.485	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;0.999	T	0.81506	-0.0902	10	0.72032	D	0.01	.	19.7629	0.96329	0.0:0.0:1.0:0.0	.	204;205;205;205	F8VUV1;P14416-3;P14416-2;P14416	.;.;.;DRD2_HUMAN	N	205;205;205;204;205;205	ENSP00000347474:T205N;ENSP00000278597:T205N;ENSP00000354859:T205N;ENSP00000441068:T204N;ENSP00000442172:T205N;ENSP00000438215:T205N	ENSP00000278597:T205N	T	-	2	0	DRD2	112791462	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.666000	0.90696	0.561000	0.74099	ACC		0.592	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795		72	125	1	0	1.79293e-35	0.01441	2.24304e-35	72	125				
DDX6	1656	broad.mit.edu	37	11	118635968	118635968	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr11:118635968T>A	ENST00000526070.2	-	6	955	c.595A>T	c.(595-597)Acc>Tcc	p.T199S	DDX6_ENST00000534980.1_Missense_Mutation_p.T199S|DDX6_ENST00000264018.4_Missense_Mutation_p.T199S	NM_001257191.1	NP_001244120.1	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 6	199	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cytoplasmic mRNA processing body assembly (GO:0033962)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	13	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		CCTCCTGTGGTTGCCATCACT	0.423			T	IGH@	B-NHL																																		uc001pub.2		NA		Dom	yes		11	11q23.3	1656	T	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6			L	IGH@		B-NHL		0				ovary(1)	1						c.(595-597)ACC>TCC		DEAD (Asp-Glu-Ala-Asp) box polypeptide 6							339.0	330.0	333.0					11																	118635968		1907	4118	6025	SO:0001583	missense	1656				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|RNA-induced silencing complex|stress granule	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|RNA helicase activity	g.chr11:118635968T>A	D17532	CCDS44751.1	11q23.3	2012-02-23	2012-02-23		ENSG00000110367	ENSG00000110367		"""DEAD-boxes"""	2747	protein-coding gene	gene with protein product		600326	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA helicase, 54kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 6"""	HLR2		1579499, 11839790	Standard	NM_004397		Approved	RCK	uc001pub.2	P26196	OTTHUMG00000166411	ENST00000526070.2:c.595A>T	11.37:g.118635968T>A	ENSP00000433704:p.Thr199Ser					DDX6_uc001puc.2_Missense_Mutation_p.T199S	p.T199S	NM_004397	NP_004388	P26196	DDX6_HUMAN		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)	6	956	-	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)	199			Helicase ATP-binding.		Q5D048	Missense_Mutation	SNP	ENST00000526070.2	37	c.595A>T	CCDS44751.1	.	.	.	.	.	.	.	.	.	.	T	17.35	3.366859	0.61513	.	.	ENSG00000110367	ENST00000264018;ENST00000534980;ENST00000526070	T;T;T	0.14766	2.48;2.48;2.48	5.7	5.7	0.88788	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.13798	0.0334	L	0.35644	1.08	0.80722	D	1	B	0.21821	0.061	B	0.23716	0.048	T	0.05517	-1.0880	10	0.32370	T	0.25	.	15.6892	0.77436	0.0:0.0:0.0:1.0	.	199	P26196	DDX6_HUMAN	S	199	ENSP00000264018:T199S;ENSP00000442266:T199S;ENSP00000433704:T199S	ENSP00000264018:T199S	T	-	1	0	DDX6	118141178	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.030000	0.88816	2.177000	0.69029	0.524000	0.50904	ACC		0.423	DDX6-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000389647.2	NM_004397		189	359	0	0	0	0.01441	0	189	359				
FOXM1	2305	broad.mit.edu	37	12	2977850	2977850	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:2977850A>T	ENST00000359843.3	-	4	793	c.725T>A	c.(724-726)aTg>aAg	p.M242K	FOXM1_ENST00000342628.2_Missense_Mutation_p.M242K|FOXM1_ENST00000361953.3_Missense_Mutation_p.M242K|FOXM1_ENST00000537018.1_5'UTR	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	242					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.M242K(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			TATCATGGCCATGTAAGAGTA	0.498																																							uc001qlf.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(724-726)ATG>AAG		forkhead box M1 isoform 2							197.0	165.0	176.0					12																	2977850		2203	4300	6503	SO:0001583	missense	2305				cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding	g.chr12:2977850A>T	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.725T>A	12.37:g.2977850A>T	ENSP00000352901:p.Met242Lys					FOXM1_uc001qle.2_Missense_Mutation_p.M242K|FOXM1_uc001qlg.2_Missense_Mutation_p.M242K|FOXM1_uc009zea.2_Missense_Mutation_p.M241K|FOXM1_uc009zeb.2_Missense_Mutation_p.M241K	p.M242K	NM_021953	NP_068772	Q08050	FOXM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000622)		4	990	-			242			Fork-head.		O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	ENST00000359843.3	37	c.725T>A	CCDS8515.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.870308	0.91587	.	.	ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843	D;D;D	0.95205	-3.64;-3.64;-3.64	5.66	5.66	0.87406	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.071560	0.85682	D	0.000000	D	0.95059	0.8400	L	0.28694	0.88	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.75020	0.985;0.985;0.974;0.985;0.974	D	0.95881	0.8899	10	0.87932	D	0	.	15.0814	0.72117	1.0:0.0:0.0:0.0	.	241;242;242;242;242	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3	.;.;.;FOXM1_HUMAN;.	K	242	ENSP00000342307:M242K;ENSP00000354492:M242K;ENSP00000352901:M242K	ENSP00000342307:M242K	M	-	2	0	FOXM1	2848111	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.159000	0.77483	2.147000	0.66899	0.533000	0.62120	ATG		0.498	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398272.1	NM_021953		95	250	0	0	0	0.01441	0	95	250				
PARP11	57097	broad.mit.edu	37	12	3938098	3938098	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:3938098G>A	ENST00000228820.4	-	3	390	c.246C>T	c.(244-246)ttC>ttT	p.F82F	PARP11_ENST00000447133.3_Intron|PARP11_ENST00000397096.2_Silent_p.F75F|PARP11_ENST00000427057.2_Intron	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	75	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.F75F(2)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			TCTTGTAGCTGAATTTGGAAG	0.358																																							uc001qmk.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(223-225)TTC>TTT		poly (ADP-ribose) polymerase family, member 11							107.0	101.0	103.0					12																	3938098		2203	4300	6503	SO:0001819	synonymous_variant	57097						NAD+ ADP-ribosyltransferase activity	g.chr12:3938098G>A	AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.246C>T	12.37:g.3938098G>A						PARP11_uc001qml.2_Silent_p.F82F|PARP11_uc009zef.2_RNA|PARP11_uc001qmm.2_Intron|PARP11_uc001qmn.2_Intron	p.F75F	NM_020367	NP_065100	Q9NR21	PAR11_HUMAN	all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)		2	280	-			75			WWE.		B4DRQ0|Q68DS1|Q8N5Y9	Silent	SNP	ENST00000228820.4	37	c.225C>T	CCDS8523.2																																																																																				0.358	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344213.1			11	80	0	0	0	0.008291	0	11	80				
ABCD2	225	broad.mit.edu	37	12	40013068	40013068	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:40013068C>G	ENST00000308666.3	-	1	485	c.350G>C	c.(349-351)aGa>aCa	p.R117T		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	117	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.|Interaction with PEX19.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)	p.R117T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						AAGAAAGGTTCTTGAGATTAG	0.413																																							uc001rmb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						c.(349-351)AGA>ACA		ATP-binding cassette, sub-family D, member 2							78.0	80.0	79.0					12																	40013068		2203	4300	6503	SO:0001583	missense	225				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding	g.chr12:40013068C>G	U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.350G>C	12.37:g.40013068C>G	ENSP00000310688:p.Arg117Thr						p.R117T	NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN			1	776	-			117			ABC transmembrane type-1.|Interaction with PEX19.|Helical; (Potential).		B2RAM3|Q13210|Q2M3H9	Missense_Mutation	SNP	ENST00000308666.3	37	c.350G>C	CCDS8734.1	.	.	.	.	.	.	.	.	.	.	C	19.87	3.907887	0.72868	.	.	ENSG00000173208	ENST00000308666	D	0.99735	-6.58	4.83	4.83	0.62350	ABC transporter, N-terminal (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.85682	D	0.000000	D	0.99837	0.9926	H	0.96720	3.87	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.96640	0.9473	9	.	.	.	-19.1669	18.1418	0.89642	0.0:1.0:0.0:0.0	.	117	Q9UBJ2	ABCD2_HUMAN	T	117	ENSP00000310688:R117T	.	R	-	2	0	ABCD2	38299335	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.182000	0.77689	2.507000	0.84556	0.655000	0.94253	AGA		0.413	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164		69	79	0	0	0	0.01441	0	69	79				
KRT74	121391	broad.mit.edu	37	12	52967174	52967174	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:52967174C>T	ENST00000305620.2	-	1	435	c.388G>A	c.(388-390)Gac>Aac	p.D130N	KRT74_ENST00000549343.1_Missense_Mutation_p.D130N	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	130	Head.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)	p.D130N(2)		kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		ATCTCAGGGTCCAGCTCCACG	0.602																																							uc001sap.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(388-390)GAC>AAC		keratin 6 irs4							109.0	107.0	108.0					12																	52967174		2203	4300	6503	SO:0001583	missense	121391					keratin filament	structural molecule activity	g.chr12:52967174C>T	BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.388G>A	12.37:g.52967174C>T	ENSP00000307240:p.Asp130Asn						p.D130N	NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.191)	1	436	-			130			Head.		B5MD61|Q86Y45	Missense_Mutation	SNP	ENST00000305620.2	37	c.388G>A	CCDS8832.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.791782	0.90453	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	T;T	0.78364	-1.17;-1.17	4.39	3.5	0.40072	.	0.000000	0.37483	N	0.002071	D	0.90442	0.7007	H	0.94771	3.58	0.44261	D	0.997118	D	0.89917	1.0	D	0.91635	0.999	D	0.92411	0.5937	10	0.72032	D	0.01	.	13.0975	0.59202	0.0:0.92:0.0:0.08	.	130	Q7RTS7	K2C74_HUMAN	N	130	ENSP00000447447:D130N;ENSP00000307240:D130N	ENSP00000307240:D130N	D	-	1	0	KRT74	51253441	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.877000	0.63086	1.149000	0.42402	0.555000	0.69702	GAC		0.602	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405324.1	NM_175053		38	231	0	0	0	0.00874	0	38	231				
OR6C70	390327	broad.mit.edu	37	12	55863582	55863582	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:55863582G>T	ENST00000327335.4	-	1	340	c.341C>A	c.(340-342)gCt>gAt	p.A114D	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA	NM_001005499.1	NP_001005499.1	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C, member 70	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	18						GGACAGAGCAGCTAGAAGGAA	0.393																																							uc010spn.1		NA																	0				skin(1)	1						c.(340-342)GCT>GAT		olfactory receptor, family 6, subfamily C,							75.0	76.0	76.0					12																	55863582		2203	4300	6503	SO:0001583	missense	390327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55863582G>T		CCDS31825.1	12q13.2	2013-09-23			ENSG00000184954	ENSG00000184954		"""GPCR / Class A : Olfactory receptors"""	31299	protein-coding gene	gene with protein product							Standard	NM_001005499		Approved		uc010spn.2	A6NIJ9	OTTHUMG00000171127	ENST00000327335.4:c.341C>A	12.37:g.55863582G>T	ENSP00000329153:p.Ala114Asp						p.A114D	NM_001005499	NP_001005499	A6NIJ9	O6C70_HUMAN			1	341	-			114			Helical; Name=3; (Potential).			Missense_Mutation	SNP	ENST00000327335.4	37	c.341C>A	CCDS31825.1	.	.	.	.	.	.	.	.	.	.	G	9.461	1.093079	0.20471	.	.	ENSG00000184954	ENST00000327335	T	0.00485	7.07	3.84	2.95	0.34219	GPCR, rhodopsin-like superfamily (1);	0.269330	0.25875	N	0.027725	T	0.02119	0.0066	H	0.96576	3.845	0.09310	N	1	D	0.58620	0.983	D	0.63192	0.912	T	0.10200	-1.0640	10	0.87932	D	0	.	11.3536	0.49602	0.0916:0.0:0.9084:0.0	.	114	A6NIJ9	O6C70_HUMAN	D	114	ENSP00000329153:A114D	ENSP00000329153:A114D	A	-	2	0	OR6C70	54149849	0.011000	0.17503	0.007000	0.13788	0.005000	0.04900	1.320000	0.33666	0.963000	0.38082	0.655000	0.94253	GCT		0.393	OR6C70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411820.1			30	45	1	0	2.4375e-19	0.007291	2.89211e-19	30	45				
BAZ2A	11176	broad.mit.edu	37	12	56999683	56999683	+	Silent	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:56999683C>T	ENST00000551812.1	-	13	2623	c.2430G>A	c.(2428-2430)cgG>cgA	p.R810R	BAZ2A_ENST00000179765.5_Silent_p.R778R|BAZ2A_ENST00000549884.1_Silent_p.R808R|BAZ2A_ENST00000379441.3_Silent_p.R780R	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	810					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R810R(4)|p.R846R(2)		breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GCTGCCTCTGCCGTTCCTCCA	0.517																																							uc001slq.1		NA																	6	Substitution - coding silent(6)		lung(6)		0						c.(2428-2430)CGG>CGA		bromodomain adjacent to zinc finger domain, 2A							52.0	51.0	51.0					12																	56999683		1957	4158	6115	SO:0001819	synonymous_variant	11176				chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding	g.chr12:56999683C>T	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.2430G>A	12.37:g.56999683C>T						BAZ2A_uc001slp.1_Silent_p.R808R|BAZ2A_uc009zov.1_5'Flank|BAZ2A_uc009zow.1_Silent_p.R778R	p.R810R	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN			13	2624	-			810					B3KN66|O00536|O15030|Q68DI8|Q96H26	Silent	SNP	ENST00000551812.1	37	c.2430G>A	CCDS44924.1																																																																																				0.517	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449		8	15	0	0	0	0.006214	0	8	15				
SRGAP1	57522	broad.mit.edu	37	12	64521497	64521497	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:64521497T>A	ENST00000355086.3	+	20	3057	c.2533T>A	c.(2533-2535)Tta>Ata	p.L845I	SRGAP1_ENST00000543397.1_Missense_Mutation_p.L782I|SRGAP1_ENST00000357825.3_Missense_Mutation_p.L822I	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	845					axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.L845I(2)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TGACGGCTATTTAGCCAGGTA	0.597																																							uc010ssp.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(2)	4						c.(2533-2535)TTA>ATA		SLIT-ROBO Rho GTPase activating protein 1							64.0	55.0	58.0					12																	64521497		2203	4300	6503	SO:0001583	missense	57522				axon guidance	cytosol		g.chr12:64521497T>A	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.2533T>A	12.37:g.64521497T>A	ENSP00000347198:p.Leu845Ile					SRGAP1_uc001srv.2_Missense_Mutation_p.L782I	p.L845I	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)	20	2589	+			845					Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	37	c.2533T>A	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	T	10.71	1.426700	0.25726	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.19938	3.1;2.7;2.11	5.46	4.32	0.51571	Src homology-3 domain (1);	0.000000	0.28821	U	0.014040	T	0.10809	0.0264	N	0.11000	0.08	0.37395	D	0.912601	B;B	0.02656	0.0;0.0	B;B	0.09377	0.003;0.004	T	0.16424	-1.0403	9	.	.	.	.	11.263	0.49093	0.0:0.0715:0.0:0.9285	.	845;782	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	I	845;822;782	ENSP00000347198:L845I;ENSP00000350480:L822I;ENSP00000437948:L782I	.	L	+	1	2	SRGAP1	62807764	1.000000	0.71417	0.872000	0.34217	0.039000	0.13416	1.130000	0.31393	1.023000	0.39654	0.528000	0.53228	TTA		0.597	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1			21	117	0	0	0	0.010504	0	21	117				
SLC6A15	55117	broad.mit.edu	37	12	85266387	85266387	+	Silent	SNP	T	T	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:85266387T>A	ENST00000266682.5	-	8	1837	c.1296A>T	c.(1294-1296)ctA>ctT	p.L432L	SLC6A15_ENST00000551388.1_5'Flank|SLC6A15_ENST00000552192.1_Silent_p.L325L|SLC6A15_ENST00000309283.7_Silent_p.L140L	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	432					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)	p.L432L(2)		kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						TAACTTTATTTAGCTCTTCTT	0.328																																							uc001szv.2		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(2)|ovary(1)	3						c.(1294-1296)CTA>CTT		solute carrier family 6, member 15 isoform 1							53.0	56.0	55.0					12																	85266387		2202	4299	6501	SO:0001819	synonymous_variant	55117				cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity	g.chr12:85266387T>A	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.1296A>T	12.37:g.85266387T>A						SLC6A15_uc010sul.1_Silent_p.L325L|SLC6A15_uc001szw.1_Silent_p.L140L	p.L432L	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN			8	1789	-			432			Extracellular (Potential).		A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Silent	SNP	ENST00000266682.5	37	c.1296A>T	CCDS9026.1																																																																																				0.328	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767		9	60	0	0	0	0.004482	0	9	60				
EID3	493861	broad.mit.edu	37	12	104698247	104698247	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:104698247C>A	ENST00000527879.1	+	1	731	c.535C>A	c.(535-537)Cgt>Agt	p.R179S	TXNRD1_ENST00000354940.6_Intron|TXNRD1_ENST00000378070.4_Intron|TXNRD1_ENST00000525566.1_Intron|TXNRD1_ENST00000526691.1_Intron|TXNRD1_ENST00000524698.1_Intron|TXNRD1_ENST00000388854.3_Intron|TXNRD1_ENST00000542918.1_Intron|TXNRD1_ENST00000540716.1_Intron|TXNRD1_ENST00000526390.1_Intron|TXNRD1_ENST00000503506.2_Intron|TXNRD1_ENST00000429002.2_Intron|TXNRD1_ENST00000397736.2_Intron|TXNRD1_ENST00000529546.1_Intron	NM_001008394.2	NP_001008395.1			EP300 interacting inhibitor of differentiation 3									p.R179S(1)		large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						CAAGCTAGAACGTTCTGCACC	0.428																																							uc001tkw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(535-537)CGT>AGT		EP300 interacting inhibitor of differentiation							148.0	146.0	146.0					12																	104698247		1909	4127	6036	SO:0001583	missense	493861				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus		g.chr12:104698247C>A	BC027612	CCDS53822.1	12q23.3	2006-11-24				ENSG00000255150			32961	protein-coding gene	gene with protein product		612986				15987788, 15752197	Standard	NM_001008394		Approved	FLJ25832, NSMCE4B, NSE4B	uc001tkw.3	Q8N140		ENST00000527879.1:c.535C>A	12.37:g.104698247C>A	ENSP00000435619:p.Arg179Ser					TXNRD1_uc010swk.1_Intron|TXNRD1_uc010swl.1_Intron|TXNRD1_uc010swm.1_Intron|TXNRD1_uc010swn.1_Intron|TXNRD1_uc010swo.1_Intron|TXNRD1_uc010swp.1_Intron|TXNRD1_uc010swq.1_Intron|TXNRD1_uc001tku.2_Intron|TXNRD1_uc001tko.1_Intron|TXNRD1_uc001tkp.1_Intron|TXNRD1_uc001tkv.1_Intron	p.R179S	NM_001008394	NP_001008395	Q8N140	EID3_HUMAN			1	699	+			179						Missense_Mutation	SNP	ENST00000527879.1	37	c.535C>A	CCDS53822.1	.	.	.	.	.	.	.	.	.	.	C	5.515	0.279979	0.10458	.	.	ENSG00000255150	ENST00000527879	T	0.43688	0.94	4.94	0.685	0.18009	.	.	.	.	.	T	0.18593	0.0446	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.28106	-1.0054	9	0.10377	T	0.69	.	4.0814	0.09927	0.0:0.5203:0.1708:0.3089	.	179	Q8N140	EID3_HUMAN	S	179	ENSP00000435619:R179S	ENSP00000435619:R179S	R	+	1	0	EID3	103222377	0.000000	0.05858	0.000000	0.03702	0.100000	0.18952	0.057000	0.14279	0.026000	0.15269	0.555000	0.69702	CGT		0.428	EID3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387034.1	NM_001008394		39	239	1	0	1.67305e-13	0.00623	1.85963e-13	39	239				
RASAL1	8437	broad.mit.edu	37	12	113559391	113559391	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:113559391C>G	ENST00000261729.5	-	6	666	c.351G>C	c.(349-351)caG>caC	p.Q117H	RASAL1_ENST00000546530.1_Missense_Mutation_p.Q117H|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000446861.3_Missense_Mutation_p.Q117H|RASAL1_ENST00000548055.1_Missense_Mutation_p.Q117H			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	117					intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)	p.Q117H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						AGATCTCACCCTGCACTTCTG	0.562																																							uc001tum.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(349-351)CAG>CAC		RAS protein activator like 1							114.0	85.0	95.0					12																	113559391		2203	4300	6503	SO:0001583	missense	8437				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity	g.chr12:113559391C>G	AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.351G>C	12.37:g.113559391C>G	ENSP00000261729:p.Gln117His					RASAL1_uc010syp.1_Missense_Mutation_p.Q117H|RASAL1_uc001tul.2_Missense_Mutation_p.Q117H|RASAL1_uc001tun.1_Missense_Mutation_p.Q117H|RASAL1_uc010syq.1_Missense_Mutation_p.Q117H|RASAL1_uc001tuo.3_Missense_Mutation_p.Q117H|RASAL1_uc010syr.1_Missense_Mutation_p.Q117H	p.Q117H	NM_004658	NP_004649	O95294	RASL1_HUMAN			6	644	-			117					B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	c.351G>C	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.761195	0.49468	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39	5.43	2.61	0.31194	C2 calcium/lipid-binding domain, CaLB (2);	0.120946	0.56097	D	0.000025	D	0.86285	0.5896	M	0.71036	2.16	0.33652	D	0.608629	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D	0.80764	0.987;0.987;0.994;0.987;0.982;0.984;0.991	D	0.87908	0.2695	10	0.66056	D	0.02	.	8.047	0.30555	0.0:0.6086:0.0:0.3914	.	117;117;117;129;117;117;117	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	H	117	ENSP00000450244:Q117H;ENSP00000261729:Q117H;ENSP00000395920:Q117H;ENSP00000448510:Q117H	ENSP00000261729:Q117H	Q	-	3	2	RASAL1	112043774	1.000000	0.71417	1.000000	0.80357	0.496000	0.33645	1.275000	0.33144	0.677000	0.31305	0.655000	0.94253	CAG		0.562	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		99	105	0	0	0	0.01441	0	99	105				
FBXW8	26259	broad.mit.edu	37	12	117426577	117426577	+	Missense_Mutation	SNP	T	T	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:117426577T>G	ENST00000309909.5	+	7	1224	c.1142T>G	c.(1141-1143)cTt>cGt	p.L381R	RP11-231I16.1_ENST00000548738.1_RNA|FBXW8_ENST00000455858.2_Missense_Mutation_p.L315R			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	381					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)				endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		AGAACCCTCCTTTACGCCCAC	0.547																																							uc001twg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(1141-1143)CTT>CGT		F-box and WD repeat domain containing 8 isoform							119.0	121.0	121.0					12																	117426577		2203	4300	6503	SO:0001583	missense	26259						protein binding	g.chr12:117426577T>G	AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.1142T>G	12.37:g.117426577T>G	ENSP00000310686:p.Leu381Arg					FBXW8_uc001twf.1_Missense_Mutation_p.L315R|FBXW8_uc009zwp.1_RNA	p.L381R	NM_153348	NP_699179	Q8N3Y1	FBXW8_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0353)	7	1224	+	all_neural(191;0.117)|Medulloblastoma(191;0.163)		381					Q9UK95	Missense_Mutation	SNP	ENST00000309909.5	37	c.1142T>G	CCDS9182.1	.	.	.	.	.	.	.	.	.	.	T	5.443	0.266784	0.10294	.	.	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.10960	2.88;2.82	5.9	4.76	0.60689	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.051946	0.85682	D	0.000000	T	0.06508	0.0167	N	0.08118	0	0.30093	N	0.808163	B;B	0.25105	0.072;0.118	B;B	0.28553	0.091;0.031	T	0.18304	-1.0341	10	0.27082	T	0.32	-11.3309	12.2468	0.54574	0.868:0.0:0.0:0.132	.	381;315	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	R	381;315;315	ENSP00000310686:L381R;ENSP00000389144:L315R	ENSP00000310686:L381R	L	+	2	0	FBXW8	115910960	0.997000	0.39634	0.698000	0.30274	0.097000	0.18754	4.631000	0.61304	1.050000	0.40346	-0.339000	0.08088	CTT		0.547	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403561.1	NM_012174		8	403	0	0	0	0.00308	0	8	403				
VPS33A	65082	broad.mit.edu	37	12	122748723	122748723	+	Silent	SNP	T	T	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:122748723T>A	ENST00000267199.4	-	2	238	c.126A>T	c.(124-126)ctA>ctT	p.L42L	RP11-512M8.5_ENST00000535844.1_Silent_p.L42L|VPS33A_ENST00000451053.2_Silent_p.L42L|VPS33A_ENST00000542310.1_5'UTR	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	42					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)		p.L42L(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		AGGGTCCAGTTAGGTATTCAT	0.343																																							uc001ucd.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(124-126)CTA>CTT		vacuolar protein sorting 33A							129.0	131.0	130.0					12																	122748723		2203	4299	6502	SO:0001819	synonymous_variant	65082				lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding	g.chr12:122748723T>A	AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.126A>T	12.37:g.122748723T>A						VPS33A_uc001ucc.2_RNA|VPS33A_uc001uce.2_Silent_p.L42L	p.L42L	NM_022916	NP_075067	Q96AX1	VP33A_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)	2	239	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		42					Q547V4|Q9H5Q0	Silent	SNP	ENST00000267199.4	37	c.126A>T	CCDS9231.1																																																																																				0.343	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401607.2			49	208	0	0	0	0.01441	0	49	208				
POLE	5426	broad.mit.edu	37	12	133219516	133219516	+	Missense_Mutation	SNP	T	T	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:133219516T>G	ENST00000320574.5	-	36	4661	c.4618A>C	c.(4618-4620)Aag>Cag	p.K1540Q	POLE_ENST00000434528.3_5'Flank|POLE_ENST00000535270.1_Missense_Mutation_p.K1513Q	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1540					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GGGCCCACCTTCTCCAGGAGG	0.627								DNA polymerases (catalytic subunits)																															uc001uks.1		NA																	0				ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8						c.(4618-4620)AAG>CAG	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	DNA-directed DNA polymerase epsilon							64.0	62.0	63.0					12																	133219516		2203	4300	6503	SO:0001583	missense	5426				base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding	g.chr12:133219516T>G		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4618A>C	12.37:g.133219516T>G	ENSP00000322570:p.Lys1540Gln					POLE_uc001ukq.1_5'Flank|POLE_uc001ukr.1_Missense_Mutation_p.K344Q|POLE_uc010tbq.1_RNA	p.K1540Q	NM_006231	NP_006222	Q07864	DPOE1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	36	4662	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)	1540					Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	c.4618A>C	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	T	12.76	2.035198	0.35893	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.24151	1.87;1.87;1.87	5.82	4.66	0.58398	DNA polymerase epsilon, catalytic subunit A, C-terminal (1);	0.268827	0.47455	N	0.000223	T	0.18964	0.0455	L	0.28556	0.865	0.36151	D	0.847482	B	0.06786	0.001	B	0.13407	0.009	T	0.11542	-1.0583	10	0.18276	T	0.48	.	13.3183	0.60419	0.0:0.0:0.1317:0.8683	.	1540	Q07864	DPOE1_HUMAN	Q	1540;1551;1513	ENSP00000322570:K1540Q;ENSP00000406383:K1551Q;ENSP00000445753:K1513Q	ENSP00000322570:K1540Q	K	-	1	0	POLE	131729589	1.000000	0.71417	0.849000	0.33467	0.755000	0.42902	6.306000	0.72810	1.008000	0.39264	0.533000	0.62120	AAG		0.627	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231		68	69	0	0	0	0.01441	0	68	69				
ZMYM2	7750	broad.mit.edu	37	13	20608525	20608525	+	Missense_Mutation	SNP	G	G	C	rs535395618		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr13:20608525G>C	ENST00000382874.2	+	12	2290	c.2100G>C	c.(2098-2100)aaG>aaC	p.K700N	ZMYM2_ENST00000382883.3_Missense_Mutation_p.K182N|ZMYM2_ENST00000382871.2_Missense_Mutation_p.K700N|ZMYM2_ENST00000382869.3_Missense_Mutation_p.K700N	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	700					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.K700N(4)		large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		CTGGCGTTAAGAGACCTTTCT	0.343													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20133	0.0		0.0	False		,,,				2504	0.0						uc001umr.2		NA																	4	Substitution - Missense(4)		lung(4)	lung(3)|ovary(2)|prostate(1)	6						c.(2098-2100)AAG>AAC		zinc finger protein 198							132.0	127.0	129.0					13																	20608525		1857	4105	5962	SO:0001583	missense	7750				regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding	g.chr13:20608525G>C	AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.2100G>C	13.37:g.20608525G>C	ENSP00000372327:p.Lys700Asn					ZMYM2_uc001ums.2_Missense_Mutation_p.K700N|ZMYM2_uc001umt.2_Missense_Mutation_p.K700N|ZMYM2_uc010tco.1_RNA|ZMYM2_uc001umv.2_Missense_Mutation_p.K80N|ZMYM2_uc001umw.2_Missense_Mutation_p.K153N	p.K700N	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)	12	2398	+		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)	700					A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	37	c.2100G>C	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553111	0.65425	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382883;ENST00000382870	T;T;T;T	0.46063	2.13;2.13;2.13;0.88	5.67	4.82	0.62117	TRASH (1);	0.000000	0.85682	D	0.000000	T	0.43831	0.1265	N	0.22421	0.69	0.51767	D	0.999939	D	0.71674	0.998	D	0.76071	0.987	T	0.16630	-1.0396	10	0.21540	T	0.41	-23.3396	8.2396	0.31652	0.2151:0.0:0.7849:0.0	.	700	Q9UBW7	ZMYM2_HUMAN	N	700;700;700;700;182;80	ENSP00000372322:K700N;ENSP00000372327:K700N;ENSP00000372324:K700N;ENSP00000372336:K182N	ENSP00000372322:K700N	K	+	3	2	ZMYM2	19506525	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.836000	0.48183	2.665000	0.90641	0.655000	0.94253	AAG		0.343	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453		35	84	0	0	0	0.004878	0	35	84				
LATS2	26524	broad.mit.edu	37	13	21557918	21557918	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr13:21557918G>C	ENST00000382592.4	-	5	2332	c.1927C>G	c.(1927-1929)Cag>Gag	p.Q643E	LATS2_ENST00000542899.1_Missense_Mutation_p.Q643E	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2									p.Q643E(4)		breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		TTCCGCATCTGCTCCTGCTCA	0.458																																							uc009zzs.2		NA																	4	Substitution - Missense(4)		lung(4)	lung(3)|central_nervous_system(3)|ovary(2)|breast(1)|pancreas(1)	10						c.(1927-1929)CAG>GAG		LATS, large tumor suppressor, homolog 2							69.0	74.0	72.0					13																	21557918		2203	4300	6503	SO:0001583	missense	26524				cell division|G1/S transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|intracellular protein kinase cascade|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus|spindle pole	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr13:21557918G>C	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.1927C>G	13.37:g.21557918G>C	ENSP00000372035:p.Gln643Glu					LATS2_uc001unr.3_Missense_Mutation_p.Q643E	p.Q643E	NM_014572	NP_055387	Q9NRM7	LATS2_HUMAN		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)	5	2292	-		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)	643						Missense_Mutation	SNP	ENST00000382592.4	37	c.1927C>G	CCDS9294.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278187	0.59758	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.35236	1.32;1.32	5.19	5.19	0.71726	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000002	T	0.32406	0.0828	L	0.33624	1.015	0.80722	D	1	B	0.33212	0.402	B	0.33690	0.168	T	0.06303	-1.0834	10	0.36615	T	0.2	.	18.9571	0.92662	0.0:0.0:1.0:0.0	.	643	Q9NRM7	LATS2_HUMAN	E	643	ENSP00000372035:Q643E;ENSP00000441817:Q643E	ENSP00000372035:Q643E	Q	-	1	0	LATS2	20455918	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.202000	0.95026	2.709000	0.92574	0.555000	0.69702	CAG		0.458	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1			17	64	0	0	0	0.007413	0	17	64				
FGF9	2254	broad.mit.edu	37	13	22255205	22255205	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr13:22255205C>A	ENST00000382353.5	+	2	832	c.302C>A	c.(301-303)gCa>gAa	p.A101E		NM_002010.2	NP_002001.1	P31371	FGF9_HUMAN	fibroblast growth factor 9	101					angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic digestive tract development (GO:0048566)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein import into nucleus (GO:0006606)|regulation of timing of cell differentiation (GO:0048505)|signal transduction (GO:0007165)|substantia nigra development (GO:0021762)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)	p.A101E(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|skin(2)	9		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		ATCAGTATAGCAGTGGGCCTG	0.517																																					Melanoma(195;1939 2127 12623 13963 52730)	Melanoma(195;1939 2127 12623 13963 52730)	uc001uog.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(301-303)GCA>GAA		fibroblast growth factor 9 precursor							133.0	125.0	128.0					13																	22255205		2203	4300	6503	SO:0001583	missense	2254				cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|male gonad development|positive regulation of cell division	extracellular space	growth factor activity|heparin binding	g.chr13:22255205C>A	D14838	CCDS9298.1	13q11-q12	2014-01-30	2013-06-18		ENSG00000102678	ENSG00000102678		"""Endogenous ligands"""	3687	protein-coding gene	gene with protein product	"""glia-activating factor"""	600921	"""fibroblast growth factor 9 (glia-activating factor)"""			8321227	Standard	NM_002010		Approved		uc001uog.2	P31371	OTTHUMG00000017412	ENST00000382353.5:c.302C>A	13.37:g.22255205C>A	ENSP00000371790:p.Ala101Glu						p.A101E	NM_002010	NP_002001	P31371	FGF9_HUMAN		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)	2	1139	+		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)	101					A8K427|Q3SY32	Missense_Mutation	SNP	ENST00000382353.5	37	c.302C>A	CCDS9298.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.292534	0.80914	.	.	ENSG00000102678	ENST00000382353	T	0.66815	-0.23	5.62	5.62	0.85841	.	0.157646	0.43416	D	0.000572	T	0.65943	0.2740	L	0.39633	1.23	0.80722	D	1	B	0.30870	0.298	B	0.37731	0.257	T	0.63532	-0.6616	10	0.46703	T	0.11	.	19.635	0.95728	0.0:1.0:0.0:0.0	.	101	P31371	FGF9_HUMAN	E	101	ENSP00000371790:A101E	ENSP00000371790:A101E	A	+	2	0	FGF9	21153205	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	7.391000	0.79828	2.804000	0.96469	0.655000	0.94253	GCA		0.517	FGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046002.2			27	22	1	0	2.61193e-14	0.009535	2.95821e-14	27	22				
PCDH17	27253	broad.mit.edu	37	13	58208543	58208543	+	Silent	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr13:58208543G>T	ENST00000377918.3	+	1	1889	c.1863G>T	c.(1861-1863)ggG>ggT	p.G621G		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	621	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GCGAGAGCGGGCGTCTCACCT	0.657																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	0				ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(1861-1863)GGG>GGT		protocadherin 17 precursor							54.0	52.0	53.0					13																	58208543		2202	4299	6501	SO:0001819	synonymous_variant	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58208543G>T	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1863G>T	13.37:g.58208543G>T						PCDH17_uc010aec.1_Silent_p.G621G	p.G621G	NM_001040429	NP_001035519	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	1	2755	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	621			Extracellular (Potential).|Cadherin 6.		A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	ENST00000377918.3	37	c.1863G>T	CCDS31986.1																																																																																				0.657	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		10	162	1	0	4.3838e-07	0.001855	4.64807e-07	10	162				
MYCBP2	23077	broad.mit.edu	37	13	77847609	77847609	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr13:77847609G>C	ENST00000544440.2	-	5	846	c.829C>G	c.(829-831)Cag>Gag	p.Q277E	MYCBP2_ENST00000357337.6_Missense_Mutation_p.Q277E|MYCBP2_ENST00000407578.2_Missense_Mutation_p.Q315E|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase									p.Q277E(4)|p.Q315E(2)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TGAAATACCTGAATAGTTTGG	0.398																																							uc001vkf.2		NA																	6	Substitution - Missense(6)		lung(6)	ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14						c.(829-831)CAG>GAG		MYC binding protein 2							79.0	77.0	78.0					13																	77847609		2203	4300	6503	SO:0001583	missense	23077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding	g.chr13:77847609G>C	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.829C>G	13.37:g.77847609G>C	ENSP00000444596:p.Gln277Glu					MYCBP2_uc010aev.2_5'UTR	p.Q277E	NM_015057	NP_055872	O75592	MYCB2_HUMAN		GBM - Glioblastoma multiforme(99;0.109)	6	920	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)	277						Missense_Mutation	SNP	ENST00000544440.2	37	c.829C>G		.	.	.	.	.	.	.	.	.	.	G	19.09	3.759206	0.69763	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.47528	0.84;0.84;0.84	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.58481	0.2125	L	0.57536	1.79	0.80722	D	1	P	0.40332	0.713	P	0.48654	0.585	T	0.60342	-0.7282	10	0.59425	D	0.04	.	19.0105	0.92871	0.0:0.0:1.0:0.0	.	277	O75592	MYCB2_HUMAN	E	277;315;277	ENSP00000349892:Q277E;ENSP00000384288:Q315E;ENSP00000444596:Q277E	ENSP00000349892:Q277E	Q	-	1	0	MYCBP2	76745610	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.855000	0.99526	2.487000	0.83934	0.573000	0.79308	CAG		0.398	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		14	45	0	0	0	0.00499	0	14	45				
SLITRK5	26050	broad.mit.edu	37	13	88328774	88328774	+	Silent	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr13:88328774G>T	ENST00000325089.6	+	2	1350	c.1131G>T	c.(1129-1131)gcG>gcT	p.A377A	SLITRK5_ENST00000400028.3_Silent_p.A136A	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	377	LRRNT.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.A377A(2)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GTCCCACCGCGTGCTCTTGCA	0.577																																							uc001vln.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|pancreas(2)|central_nervous_system(1)	5						c.(1129-1131)GCG>GCT		SLIT and NTRK-like family, member 5 precursor							73.0	64.0	67.0					13																	88328774		2203	4300	6503	SO:0001819	synonymous_variant	26050					integral to membrane		g.chr13:88328774G>T	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1131G>T	13.37:g.88328774G>T						SLITRK5_uc010tic.1_Silent_p.A136A	p.A377A	NM_015567	NP_056382	O94991	SLIK5_HUMAN			2	1350	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		377			Extracellular (Potential).|LRRNT.		B3KNB8|B4DSH5|Q5VT81	Silent	SNP	ENST00000325089.6	37	c.1131G>T	CCDS9465.1																																																																																				0.577	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3			61	84	1	0	3.74213e-36	0.01441	4.70124e-36	61	84				
GPC5	2262	broad.mit.edu	37	13	93518680	93518680	+	Silent	SNP	C	C	T	rs561902215	byFrequency	TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr13:93518680C>T	ENST00000377067.3	+	8	2079	c.1707C>T	c.(1705-1707)ccC>ccT	p.P569P		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	569					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.P569P(2)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TGTTACTTCCCGGGATTTGGT	0.433													C|||	7	0.00139776	0.0	0.0	5008	,	,		18812	0.0		0.0	False		,,,				2504	0.0072						uc010tif.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5						c.(1705-1707)CCC>CCT		glypican 5 precursor							364.0	274.0	304.0					13																	93518680		2203	4300	6503	SO:0001819	synonymous_variant	2262					anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding	g.chr13:93518680C>T	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1707C>T	13.37:g.93518680C>T							p.P569P	NM_004466	NP_004457	P78333	GPC5_HUMAN			8	2073	+	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)	569					B2R726|O60436|Q9BX27	Silent	SNP	ENST00000377067.3	37	c.1707C>T	CCDS9468.1																																																																																				0.433	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466		24	88	0	0	0	0.00278	0	24	88				
TEP1	7011	broad.mit.edu	37	14	20846397	20846397	+	Splice_Site	SNP	T	T	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr14:20846397T>A	ENST00000262715.5	-	39	5549		c.e39-2		TEP1_ENST00000556935.1_Splice_Site|TEP1_ENST00000545983.1_Splice_Site	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1						RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)	p.?(1)		NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CCCCAGGTCCTACACAGGGAG	0.582																																							uc001vxe.2		NA																	1	Unknown(1)		lung(1)	ovary(5)	5						c.e39-1		telomerase-associated protein 1							42.0	51.0	48.0					14																	20846397		2203	4300	6503	SO:0001630	splice_region_variant	7011				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding	g.chr14:20846397T>A		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.5509-2A>T	14.37:g.20846397T>A						TEP1_uc010ahk.2_Splice_Site_p.D1180_splice|TEP1_uc010tlf.1_Splice_Site|TEP1_uc010tlg.1_Splice_Site_p.D1729_splice|TEP1_uc010tlh.1_Splice_Site_p.D175_splice	p.D1837_splice	NM_007110	NP_009041	Q99973	TEP1_HUMAN	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)	39	5549	-	all_cancers(95;0.00123)	all_lung(585;0.235)						A0AUV9	Splice_Site	SNP	ENST00000262715.5	37	c.5509_splice	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	T	8.594	0.885274	0.17540	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935;ENST00000545983	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0956	0.59190	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TEP1	19916237	0.997000	0.39634	0.916000	0.36221	0.044000	0.14063	4.064000	0.57506	2.086000	0.62901	0.455000	0.32223	.		0.582	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	Intron	60	34	0	0	0	0.01441	0	60	34				
HNRNPC	3183	broad.mit.edu	37	14	21699132	21699132	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr14:21699132G>A	ENST00000320084.7	-	3	580	c.341C>T	c.(340-342)cCg>cTg	p.P114L	HNRNPC_ENST00000554969.1_Intron|HNRNPC_ENST00000553300.1_Intron|HNRNPC_ENST00000556513.1_Missense_Mutation_p.P114L|HNRNPC_ENST00000553753.1_Intron|HNRNPC_ENST00000556628.1_Intron|HNRNPC_ENST00000556142.1_Missense_Mutation_p.P114L|HNRNPC_ENST00000554455.1_Missense_Mutation_p.P114L|HNRNPC_ENST00000420743.2_Missense_Mutation_p.P114L|HNRNPC_ENST00000556897.1_Intron|HNRNPC_ENST00000557201.1_Missense_Mutation_p.P114L|HNRNPC_ENST00000336053.6_Intron|HNRNPC_ENST00000555309.1_Missense_Mutation_p.P114L|HNRNPC_ENST00000555914.1_Intron|HNRNPC_ENST00000555883.1_Intron|HNRNPC_ENST00000449098.1_Intron|HNRNPC_ENST00000430246.2_Intron	NM_001077442.1	NP_001070910.1	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C (C1/C2)	114					3'-UTR-mediated mRNA stabilization (GO:0070935)|ATP-dependent chromatin remodeling (GO:0043044)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|spliceosomal complex (GO:0005681)	identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleosomal DNA binding (GO:0031492)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)	p.P114L(1)		breast(1)|liver(1)|lung(6)|skin(1)	9	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		TAGAGGGGACGGAGAAGGGTG	0.478																																					NSCLC(108;607 2244 12726 38757)	NSCLC(108;607 2244 12726 38757)	uc001vzy.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(340-342)CCG>CTG		heterogeneous nuclear ribonucleoprotein C							121.0	128.0	126.0					14																	21699132		2185	4289	6474	SO:0001583	missense	3183					catalytic step 2 spliceosome|nucleoplasm	identical protein binding|nucleotide binding|RNA binding	g.chr14:21699132G>A		CCDS41915.1, CCDS45079.1	14q11.2	2013-06-12		2007-08-16	ENSG00000092199	ENSG00000092199		"""RNA binding motif (RRM) containing"""	5035	protein-coding gene	gene with protein product		164020		HNRPC		3457372	Standard	NM_031314		Approved	hnRNPC	uc001waa.3	P07910	OTTHUMG00000170757	ENST00000320084.7:c.341C>T	14.37:g.21699132G>A	ENSP00000319690:p.Pro114Leu					HNRNPC_uc001vzw.2_Intron|HNRNPC_uc001wad.2_Intron|HNRNPC_uc001vzx.2_Intron|HNRNPC_uc001vzz.2_Intron|HNRNPC_uc001waa.2_Missense_Mutation_p.P114L|HNRNPC_uc010ail.2_Missense_Mutation_p.P114L|HNRNPC_uc010tlq.1_RNA|HNRNPC_uc001wab.2_Intron|HNRNPC_uc001wac.2_Intron|HNRNPC_uc010tlr.1_5'Flank|HNRNPC_uc001waf.2_Intron|HNRNPC_uc001wae.2_Intron	p.P114L	NM_031314	NP_112604	P07910	HNRPC_HUMAN	Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)	4	585	-	all_cancers(95;0.00176)		114					D3DS19|D3DS22|P22628|Q53EX2|Q59FD3|Q5FWE8|Q86SF8|Q86U45|Q96HK7|Q96HM4|Q96IY5|Q9BTS3	Missense_Mutation	SNP	ENST00000320084.7	37	c.341C>T	CCDS41915.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775665	0.49786	.	.	ENSG00000092199	ENST00000320084;ENST00000556142;ENST00000554455;ENST00000555309;ENST00000452166;ENST00000556513;ENST00000557201;ENST00000420743;ENST00000445284;ENST00000555215;ENST00000555137	T;T;T;T;T;T;T;T;T	0.16897	2.91;2.78;2.91;2.97;2.78;2.91;2.91;2.31;2.32	5.98	5.98	0.97165	.	0.180207	0.22461	U	0.059759	T	0.24236	0.0587	N	0.14661	0.345	0.80722	D	1	D	0.58620	0.983	D	0.65010	0.931	T	0.05305	-1.0893	10	0.23302	T	0.38	.	17.3729	0.87383	0.0:0.0:1.0:0.0	.	114	P07910	HNRPC_HUMAN	L	114	ENSP00000319690:P114L;ENSP00000451187:P114L;ENSP00000451291:P114L;ENSP00000450790:P114L;ENSP00000452214:P114L;ENSP00000452276:P114L;ENSP00000404848:P114L;ENSP00000452213:P114L;ENSP00000452185:P114L	ENSP00000319690:P114L	P	-	2	0	HNRNPC	20768972	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.185000	0.50934	2.847000	0.97988	0.591000	0.81541	CCG		0.478	HNRNPC-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410235.1			19	168	0	0	0	0.007413	0	19	168				
MDGA2	161357	broad.mit.edu	37	14	47566113	47566113	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr14:47566113A>T	ENST00000399232.2	-	6	1296	c.932T>A	c.(931-933)aTt>aAt	p.I311N	MDGA2_ENST00000426342.1_Missense_Mutation_p.I82N|MDGA2_ENST00000439988.3_Missense_Mutation_p.I380N|MDGA2_ENST00000357362.3_Missense_Mutation_p.I82N	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	311	Ig-like 3.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						ATTATTGGCAATGCAGCTGTA	0.433																																							uc001wwj.3		NA																	0				ovary(4)|large_intestine(1)|pancreas(1)	6						c.(931-933)ATT>AAT		MAM domain containing 1 isoform 1							148.0	140.0	142.0					14																	47566113		1917	4133	6050	SO:0001583	missense	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47566113A>T	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.932T>A	14.37:g.47566113A>T	ENSP00000382178:p.Ile311Asn					MDGA2_uc001wwi.3_Missense_Mutation_p.I82N|MDGA2_uc010ani.2_Translation_Start_Site	p.I311N	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN			6	1128	-			311			Ig-like 3.		F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37	c.932T>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.81|16.81	3.225322|3.225322	0.58668|0.58668	.|.	.|.	ENSG00000139915|ENSG00000139915	ENST00000554762|ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	.|T;T;T;T	.|0.12361	.|2.69;2.69;2.69;2.69	5.41|5.41	5.41|5.41	0.78517|0.78517	.|Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	.|0.112837	.|0.36303	.|U	.|0.002664	T|T	0.19208|0.19208	0.0461|0.0461	L|L	0.53617|0.53617	1.68|1.68	0.80722|0.80722	D|D	1|1	.|P	.|0.38565	.|0.637	.|B	.|0.41412	.|0.356	T|T	0.00970|0.00970	-1.1496|-1.1496	5|10	.|0.56958	.|D	.|0.05	.|.	14.5399|14.5399	0.67984|0.67984	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|311	.|Q7Z553	.|MDGA2_HUMAN	Q|N	85|311;82;380;82	.|ENSP00000400011:I311N;ENSP00000405456:I82N;ENSP00000382178:I380N;ENSP00000349925:I82N	.|ENSP00000349925:I82N	H|I	-|-	3|2	2|0	MDGA2|MDGA2	46635863|46635863	1.000000|1.000000	0.71417|0.71417	0.961000|0.961000	0.40146|0.40146	0.982000|0.982000	0.71751|0.71751	8.577000|8.577000	0.90773|0.90773	2.178000|2.178000	0.69098|0.69098	0.477000|0.477000	0.44152|0.44152	CAT|ATT		0.433	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		14	404	0	0	0	0.00245	0	14	404				
SAV1	60485	broad.mit.edu	37	14	51132088	51132088	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr14:51132088G>C	ENST00000324679.4	-	2	707	c.344C>G	c.(343-345)tCa>tGa	p.S115*	RP11-248J18.2_ENST00000602954.1_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	115					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					CGTTACAAATGACTGAGAAGA	0.393																																							uc001wyg.1		NA																	0				breast(1)	1						c.(343-345)TCA>TGA		WW45 protein							26.0	23.0	24.0					14																	51132088		2201	4284	6485	SO:0001587	stop_gained	60485				hippo signaling cascade	cytoplasm|nucleus	identical protein binding	g.chr14:51132088G>C	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.344C>G	14.37:g.51132088G>C	ENSP00000324729:p.Ser115*					SAV1_uc001wyh.1_Nonsense_Mutation_p.S115*	p.S115*	NM_021818	NP_068590	Q9H4B6	SAV1_HUMAN			3	505	-	all_epithelial(31;0.000611)|Breast(41;0.0333)		115					A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Nonsense_Mutation	SNP	ENST00000324679.4	37	c.344C>G	CCDS9701.1	.	.	.	.	.	.	.	.	.	.	G	39	7.462050	0.98299	.	.	ENSG00000151748	ENST00000555720;ENST00000324679;ENST00000535862	.	.	.	5.38	4.44	0.53790	.	0.112623	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-8.5135	16.8391	0.85963	0.0:0.1396:0.8604:0.0	.	.	.	.	X	47;115;82	.	ENSP00000324729:S115X	S	-	2	0	SAV1	50201838	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	7.369000	0.79578	2.514000	0.84764	0.563000	0.77884	TCA		0.393	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1			3	84	0	0	0	0.000602	0	3	84				
TMEM260	54916	broad.mit.edu	37	14	57099793	57099793	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr14:57099793C>T	ENST00000261556.6	+	13	1750	c.1628C>T	c.(1627-1629)tCt>tTt	p.S543F	TMEM260_ENST00000536419.1_Missense_Mutation_p.S77F|TMEM260_ENST00000538838.1_3'UTR|RP11-1085N6.2_ENST00000553800.1_RNA|RP11-1085N6.2_ENST00000555924.1_RNA	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	543						integral component of membrane (GO:0016021)											CCATGGGGGTCTTGTGACAAA	0.368																																							uc001xcm.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(1627-1629)TCT>TTT		hypothetical protein LOC54916							73.0	78.0	76.0					14																	57099793		2203	4300	6503	SO:0001583	missense	54916					integral to membrane		g.chr14:57099793C>T	AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.1628C>T	14.37:g.57099793C>T	ENSP00000261556:p.Ser543Phe					C14orf101_uc001xcj.2_RNA|C14orf101_uc001xcl.1_RNA|C14orf101_uc001xcn.2_RNA|C14orf101_uc010trf.1_Missense_Mutation_p.S76F|C14orf101_uc001xco.2_Missense_Mutation_p.S76F	p.S543F	NM_017799	NP_060269	Q9NX78	CN101_HUMAN		OV - Ovarian serous cystadenocarcinoma(311;0.226)	13	1750	+			543					A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	ENST00000261556.6	37	c.1628C>T	CCDS9727.2	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969839	0.74246	.	.	ENSG00000070269	ENST00000261556;ENST00000536419	T;T	0.45668	1.54;0.89	5.57	5.57	0.84162	.	0.184581	0.48767	D	0.000171	T	0.43366	0.1244	L	0.44542	1.39	0.37348	D	0.910661	P	0.49961	0.93	P	0.48030	0.564	T	0.30679	-0.9970	10	0.09590	T	0.72	-9.1467	19.5481	0.95308	0.0:1.0:0.0:0.0	.	543	Q9NX78	CN101_HUMAN	F	543;77	ENSP00000261556:S543F;ENSP00000438742:S77F	ENSP00000261556:S543F	S	+	2	0	C14orf101	56169546	0.958000	0.32768	1.000000	0.80357	0.998000	0.95712	2.711000	0.47177	2.612000	0.88384	0.650000	0.86243	TCT		0.368	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799		19	47	0	0	0	0.010504	0	19	47				
C14orf159	80017	broad.mit.edu	37	14	91691111	91691111	+	Silent	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr14:91691111G>T	ENST00000523771.1	+	14	2388	c.1785G>T	c.(1783-1785)ctG>ctT	p.L595L	C14orf159_ENST00000520328.1_Silent_p.L543L|C14orf159_ENST00000523816.1_Silent_p.L595L|C14orf159_ENST00000412671.2_Silent_p.L600L|C14orf159_ENST00000518868.1_Silent_p.L600L|C14orf159_ENST00000256324.10_Silent_p.L600L|C14orf159_ENST00000525393.2_Silent_p.L471L|C14orf159_ENST00000428926.2_Silent_p.L595L|C14orf159_ENST00000521077.2_Silent_p.L560L|C14orf159_ENST00000522322.1_Silent_p.L595L|C14orf159_ENST00000523576.1_3'UTR			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	595						mitochondrion (GO:0005739)		p.L595L(2)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		TGGATGGGCTGCCCTTCCACA	0.572																																							uc001xzb.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(2)|ovary(1)	3						c.(1783-1785)CTG>CTT		hypothetical protein LOC80017 isoform a							89.0	67.0	74.0					14																	91691111		2203	4300	6503	SO:0001819	synonymous_variant	80017					mitochondrion		g.chr14:91691111G>T	AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.1785G>T	14.37:g.91691111G>T						C14orf159_uc001xyx.2_Silent_p.L543L|C14orf159_uc001xyw.2_Silent_p.L600L|C14orf159_uc001xzc.2_Silent_p.L595L|C14orf159_uc001xza.2_Silent_p.L600L|C14orf159_uc001xyv.2_Silent_p.L560L|C14orf159_uc001xyz.2_Silent_p.L471L|C14orf159_uc001xze.2_Silent_p.L595L	p.L595L	NM_001102366	NP_001095836	Q7Z3D6	CN159_HUMAN		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)	16	2553	+		all_cancers(154;0.0191)|all_epithelial(191;0.241)	595					B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Silent	SNP	ENST00000523771.1	37	c.1785G>T	CCDS32141.1																																																																																				0.572	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381273.1	NM_024952		39	18	1	0	8.16277e-20	0.006999	9.72378e-20	39	18				
RIN3	79890	broad.mit.edu	37	14	93118640	93118640	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr14:93118640C>T	ENST00000216487.7	+	6	1405	c.1246C>T	c.(1246-1248)Caa>Taa	p.Q416*	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	416	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.Q416*(1)		endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				CCTGCCTCCCCAAGGGACCTC	0.657																																							uc001yap.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(2)|ovary(1)	3						c.(1246-1248)CAA>TAA		Ras and Rab interactor 3							45.0	51.0	49.0					14																	93118640		2203	4300	6503	SO:0001587	stop_gained	79890				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding	g.chr14:93118640C>T	BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.1246C>T	14.37:g.93118640C>T	ENSP00000216487:p.Gln416*					RIN3_uc010auk.2_Nonsense_Mutation_p.Q78*|RIN3_uc001yaq.2_Nonsense_Mutation_p.Q341*|RIN3_uc001yar.1_Nonsense_Mutation_p.Q78*|RIN3_uc001yas.1_Nonsense_Mutation_p.Q78*	p.Q416*	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN			6	1398	+		all_cancers(154;0.0701)	416			Pro-rich.		Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Nonsense_Mutation	SNP	ENST00000216487.7	37	c.1246C>T	CCDS32144.1	.	.	.	.	.	.	.	.	.	.	C	36	5.631142	0.96682	.	.	ENSG00000100599	ENST00000216487;ENST00000428147	.	.	.	4.22	3.25	0.37280	.	2.588190	0.02279	N	0.069270	.	.	.	.	.	.	0.40158	D	0.977037	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-1.9625	8.3968	0.32561	0.1815:0.6641:0.1544:0.0	.	.	.	.	X	416;340	.	ENSP00000216487:Q416X	Q	+	1	0	RIN3	92188393	0.000000	0.05858	0.820000	0.32676	0.524000	0.34500	0.422000	0.21296	1.922000	0.55676	0.313000	0.20887	CAA		0.657	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412269.1			23	68	0	0	0	0.003954	0	23	68				
OCA2	4948	broad.mit.edu	37	15	28202874	28202874	+	Missense_Mutation	SNP	C	C	A	rs371550945		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:28202874C>A	ENST00000354638.3	-	16	1799	c.1644G>T	c.(1642-1644)aaG>aaT	p.K548N	OCA2_ENST00000353809.5_Missense_Mutation_p.K524N|OCA2_ENST00000382996.2_Missense_Mutation_p.K548N	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	548					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.K548N(2)|p.K548K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GAATCTCGTGCTTCAGTTCTG	0.612									Oculocutaneous Albinism																														uc001zbh.3		NA																	3	Substitution - Missense(2)|Substitution - coding silent(1)		lung(3)	ovary(3)|breast(1)|pancreas(1)	5						c.(1642-1644)AAG>AAT		oculocutaneous albinism II							28.0	28.0	28.0					15																	28202874		2202	4300	6502	SO:0001583	missense	4948	Oculocutaneous_Albinism	Familial Cancer Database		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding	g.chr15:28202874C>A		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1644G>T	15.37:g.28202874C>A	ENSP00000346659:p.Lys548Asn					OCA2_uc010ayv.2_Missense_Mutation_p.K524N	p.K548N	NM_000275	NP_000266	Q04671	P_HUMAN		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)	16	1754	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	548			Cytoplasmic (Potential).		Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	c.1644G>T	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.904294	0.72868	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	D;D;D	0.91295	-2.82;-2.63;-2.8	5.8	4.7	0.59300	Divalent ion symporter (1);	0.000000	0.85682	D	0.000000	D	0.92760	0.7698	L	0.55481	1.735	0.48762	D	0.999702	D;D	0.89917	0.998;1.0	D;D	0.85130	0.963;0.997	D	0.92107	0.5693	10	0.72032	D	0.01	-30.7866	8.8635	0.35272	0.0:0.8277:0.0:0.1723	.	524;548	Q04671-2;Q04671	.;P_HUMAN	N	548;524;548	ENSP00000346659:K548N;ENSP00000261276:K524N;ENSP00000372457:K548N	ENSP00000261276:K524N	K	-	3	2	OCA2	25876469	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	1.124000	0.31320	2.746000	0.94184	0.591000	0.81541	AAG		0.612	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275		34	56	1	0	1.414e-09	0.003755	1.53183e-09	34	56				
OCA2	4948	broad.mit.edu	37	15	28211923	28211923	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:28211923A>T	ENST00000354638.3	-	15	1704	c.1549T>A	c.(1549-1551)Tgc>Agc	p.C517S	OCA2_ENST00000353809.5_Missense_Mutation_p.C493S|OCA2_ENST00000382996.2_Missense_Mutation_p.C517S	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	517					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.C517S(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		AGAACAAGGCAAATCCCAATG	0.493									Oculocutaneous Albinism																														uc001zbh.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(1)|pancreas(1)	5						c.(1549-1551)TGC>AGC		oculocutaneous albinism II							108.0	87.0	94.0					15																	28211923		2203	4300	6503	SO:0001583	missense	4948	Oculocutaneous_Albinism	Familial Cancer Database		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding	g.chr15:28211923A>T		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1549T>A	15.37:g.28211923A>T	ENSP00000346659:p.Cys517Ser					OCA2_uc010ayv.2_Missense_Mutation_p.C493S	p.C517S	NM_000275	NP_000266	Q04671	P_HUMAN		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)	15	1659	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	517			Helical; (Potential).		Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	c.1549T>A	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.953967	0.34471	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	D;D;D	0.91124	-2.79;-2.79;-2.79	5.18	2.84	0.33178	Divalent ion symporter (1);	0.092160	0.85682	N	0.000000	D	0.82314	0.5010	N	0.25890	0.77	0.42555	D	0.993124	B;B	0.21520	0.008;0.057	B;B	0.23150	0.008;0.044	T	0.73439	-0.3982	10	0.45353	T	0.12	-11.3875	7.1285	0.25486	0.7019:0.1524:0.0:0.1456	.	493;517	Q04671-2;Q04671	.;P_HUMAN	S	517;493;517	ENSP00000346659:C517S;ENSP00000261276:C493S;ENSP00000372457:C517S	ENSP00000261276:C493S	C	-	1	0	OCA2	25885518	1.000000	0.71417	0.894000	0.35097	0.010000	0.07245	5.202000	0.65169	0.371000	0.24564	-1.156000	0.01807	TGC		0.493	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275		20	47	0	0	0	0.012319	0	20	47				
RYR3	6263	broad.mit.edu	37	15	33991970	33991970	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:33991970G>A	ENST00000389232.4	+	41	6385	c.6315G>A	c.(6313-6315)cgG>cgA	p.R2105R	RYR3_ENST00000415757.3_Silent_p.R2105R	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2105	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.R2105R(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GAATTAGCCGGCAAAATCAGA	0.433																																							uc001zhi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(6313-6315)CGG>CGA		ryanodine receptor 3							115.0	106.0	109.0					15																	33991970		1906	4138	6044	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33991970G>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.6315G>A	15.37:g.33991970G>A						RYR3_uc010bar.2_Silent_p.R2105R	p.R2105R	NM_001036	NP_001027	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	41	6385	+		all_lung(180;7.18e-09)	2105			4 X approximate repeats.|Cytoplasmic (By similarity).		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.6315G>A	CCDS45210.1																																																																																				0.433	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			3	58	0	0	0	0.004672	0	3	58				
SLC12A6	9990	broad.mit.edu	37	15	34551102	34551102	+	Missense_Mutation	SNP	C	C	T	rs200361670		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:34551102C>T	ENST00000354181.3	-	5	947	c.455G>A	c.(454-456)cGc>cAc	p.R152H	SLC12A6_ENST00000451844.2_Missense_Mutation_p.R13H|SLC12A6_ENST00000558589.1_Missense_Mutation_p.R143H|SLC12A6_ENST00000560164.1_Missense_Mutation_p.R13H|SLC12A6_ENST00000397702.2_Missense_Mutation_p.R93H|RP11-1084A12.2_ENST00000559867.1_RNA|SLC12A6_ENST00000458406.2_Missense_Mutation_p.R93H|SLC12A6_ENST00000558667.1_Missense_Mutation_p.R152H|SLC12A6_ENST00000560611.1_Missense_Mutation_p.R152H|SLC12A6_ENST00000290209.5_Missense_Mutation_p.R101H|SLC12A6_ENST00000397707.2_Missense_Mutation_p.R137H			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	152					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	ATTGGCCATGCGGTTGAGGAG	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		18986	0.0		0.0	False		,,,				2504	0.001						uc001zhw.2		NA																	0				central_nervous_system(5)|ovary(1)|skin(1)	7						c.(454-456)CGC>CAC		solute carrier family 12, member 6 isoform a	Potassium Chloride(DB00761)						202.0	188.0	193.0					15																	34551102		2201	4298	6499	SO:0001583	missense	9990				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity	g.chr15:34551102C>T	AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.455G>A	15.37:g.34551102C>T	ENSP00000346112:p.Arg152His					SLC12A6_uc001zhv.2_Missense_Mutation_p.R101H|SLC12A6_uc001zhx.2_Missense_Mutation_p.R137H|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Missense_Mutation_p.R93H|SLC12A6_uc001zib.2_Missense_Mutation_p.R143H|SLC12A6_uc001zic.2_Missense_Mutation_p.R152H|SLC12A6_uc010bau.2_Missense_Mutation_p.R152H|SLC12A6_uc001zid.2_Missense_Mutation_p.R93H|SLC12A6_uc001zhu.2_Missense_Mutation_p.R13H	p.R152H	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	4	619	-		all_lung(180;2.78e-08)	152			Cytoplasmic (Potential).		A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	c.455G>A	CCDS58352.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.010349	0.93346	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	D;D;D;D;D;T	0.84730	-1.78;-1.8;-1.89;-1.78;-1.78;-1.39	4.82	4.82	0.62117	.	0.000000	0.64402	D	0.000001	D	0.83839	0.5341	L	0.27053	0.805	0.80722	D	1	D;D;B;P	0.64830	0.994;0.994;0.143;0.932	P;P;B;B	0.53006	0.703;0.715;0.011;0.416	D	0.85218	0.1025	10	0.49607	T	0.09	.	16.8355	0.85956	0.0:1.0:0.0:0.0	.	137;152;101;13	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	H	101;137;143;93;93;13	ENSP00000290209:R101H;ENSP00000380819:R137H;ENSP00000346112:R143H;ENSP00000380814:R93H;ENSP00000387725:R93H;ENSP00000390199:R13H	ENSP00000290209:R101H	R	-	2	0	SLC12A6	32338394	0.993000	0.37304	0.997000	0.53966	0.787000	0.44495	2.320000	0.43797	2.508000	0.84585	0.655000	0.94253	CGC		0.458	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1	NM_005135		4	220	0	0	0	0.009096	0	4	220				
DLL4	54567	broad.mit.edu	37	15	41222861	41222861	+	Silent	SNP	A	A	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:41222861A>T	ENST00000249749.5	+	3	651	c.375A>T	c.(373-375)ccA>ccT	p.P125P		NM_019074.3	NP_061947.1	Q9NR61	DLL4_HUMAN	delta-like 4 (Drosophila)	125					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac atrium morphogenesis (GO:0003209)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|dorsal aorta morphogenesis (GO:0035912)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of neural retina development (GO:0061074)|regulation of neurogenesis (GO:0050767)|signal transduction (GO:0007165)|ventral spinal cord interneuron fate commitment (GO:0060579)|ventricular trabecula myocardium morphogenesis (GO:0003222)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)	p.P125P(1)		breast(3)|large_intestine(1)	4		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GGCACGCGCCAGGAGACGACC	0.652											OREG0023070	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001zng.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)	2						c.(373-375)CCA>CCT		delta-like 4 protein precursor							43.0	43.0	43.0					15																	41222861		1973	4147	6120	SO:0001819	synonymous_variant	54567				blood circulation|cell communication|cell differentiation|Notch receptor processing|Notch signaling pathway	integral to membrane|plasma membrane	calcium ion binding|Notch binding	g.chr15:41222861A>T	AF253468	CCDS45232.1	15q14	2008-07-03	2001-12-03			ENSG00000128917			2910	protein-coding gene	gene with protein product		605185	"""delta-like 4 homolog (Drosophila)"""			10837024	Standard	NM_019074		Approved		uc001zng.2	Q9NR61		ENST00000249749.5:c.375A>T	15.37:g.41222861A>T			OREG0023070	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	899		p.P125P	NM_019074	NP_061947	Q9NR61	DLL4_HUMAN		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)	3	695	+		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)	125			Extracellular (Potential).		Q3KP23|Q9NQT9	Silent	SNP	ENST00000249749.5	37	c.375A>T	CCDS45232.1																																																																																				0.652	DLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418859.1			11	25	0	0	0	0.013537	0	11	25				
CAPN3	825	broad.mit.edu	37	15	42702827	42702827	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:42702827C>G	ENST00000397163.3	+	21	2445	c.2226C>G	c.(2224-2226)atC>atG	p.I742M	CAPN3_ENST00000569136.1_Missense_Mutation_p.I77M|CAPN3_ENST00000562199.1_3'UTR|CAPN3_ENST00000561817.1_Missense_Mutation_p.I77M|CAPN3_ENST00000356316.3_Missense_Mutation_p.I649M|CAPN3_ENST00000397204.4_Missense_Mutation_p.I77M|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000349748.3_Missense_Mutation_p.I650M|CAPN3_ENST00000318023.7_Missense_Mutation_p.I736M|CAPN3_ENST00000397200.4_Missense_Mutation_p.I230M|CAPN3_ENST00000337571.4_Missense_Mutation_p.I77M|CAPN3_ENST00000357568.3_Missense_Mutation_p.I736M	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	742	Domain IV.|EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.I649M(2)|p.I736M(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		CCGGCACCATCAACAGCTACG	0.512																																							uc001zpn.1		NA																	4	Substitution - Missense(4)		lung(4)	central_nervous_system(1)	1						c.(2224-2226)ATC>ATG		calpain 3 isoform a							68.0	62.0	64.0					15																	42702827		2203	4299	6502	SO:0001583	missense	825				muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity	g.chr15:42702827C>G	X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.2226C>G	15.37:g.42702827C>G	ENSP00000380349:p.Ile742Met					CAPN3_uc001zpk.1_Missense_Mutation_p.I509M|CAPN3_uc001zpl.1_Missense_Mutation_p.I649M|CAPN3_uc010udf.1_Missense_Mutation_p.I655M|CAPN3_uc010udg.1_Missense_Mutation_p.I607M|CAPN3_uc001zpo.1_Missense_Mutation_p.I736M|CAPN3_uc001zpp.1_Missense_Mutation_p.I650M|CAPN3_uc001zpq.1_Missense_Mutation_p.I230M|CAPN3_uc010bcv.1_Missense_Mutation_p.I77M|CAPN3_uc001zpr.1_Missense_Mutation_p.I77M|CAPN3_uc001zps.1_Missense_Mutation_p.I77M|CAPN3_uc001zpt.1_Missense_Mutation_p.I77M	p.I742M	NM_000070	NP_000061	P20807	CAN3_HUMAN		GBM - Glioblastoma multiforme(94;7.36e-07)	21	2532	+		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)	742			EF-hand 3.|2 (Probable).|Domain IV.		A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	ENST00000397163.3	37	c.2226C>G	CCDS45245.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.801630	0.31869	.	.	ENSG00000092529	ENST00000356316;ENST00000337522;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023;ENST00000397200;ENST00000337571;ENST00000397204	T;T;T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.14;-1.14	4.54	2.58	0.30949	EF-hand-like domain (1);	0.000000	0.85682	U	0.000000	T	0.81777	0.4894	M	0.71920	2.185	0.58432	D	0.999999	D;D;D;D;D;D;B	0.76494	0.999;0.999;0.965;0.997;0.997;0.999;0.126	D;D;D;D;D;D;B	0.79784	0.988;0.993;0.985;0.975;0.975;0.993;0.305	T	0.80023	-0.1556	10	0.02654	T	1	.	9.135	0.36868	0.0:0.7377:0.0:0.2623	.	607;655;77;650;736;742;649	C6EVS4;C6EVS3;A4FTZ9;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;.;CAN3_HUMAN;.	M	649;230;742;736;650;736;230;77;77	ENSP00000348667:I649M;ENSP00000380349:I742M;ENSP00000350181:I736M;ENSP00000183936:I650M;ENSP00000326281:I736M;ENSP00000380384:I230M;ENSP00000336840:I77M;ENSP00000380387:I77M	ENSP00000326281:I736M	I	+	3	3	CAPN3	40490119	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.081000	0.30791	0.501000	0.28013	-0.339000	0.08088	ATC		0.512	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421075.1			15	30	0	0	0	0.00245	0	15	30				
CEP152	22995	broad.mit.edu	37	15	49048414	49048414	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:49048414G>A	ENST00000380950.2	-	20	3218	c.3031C>T	c.(3031-3033)Cag>Tag	p.Q1011*	CEP152_ENST00000399334.3_Nonsense_Mutation_p.Q1011*|CEP152_ENST00000325747.5_Nonsense_Mutation_p.Q918*	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1011					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)	p.Q1011*(2)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		GTCTCCTTCTGAAGAAGTAGT	0.393																																							uc001zwy.2		NA																	2	Substitution - Nonsense(2)		lung(2)	lung(2)	2						c.(3031-3033)CAG>TAG		centrosomal protein 152kDa							132.0	119.0	123.0					15																	49048414		1845	4090	5935	SO:0001587	stop_gained	22995				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding	g.chr15:49048414G>A	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.3031C>T	15.37:g.49048414G>A	ENSP00000370337:p.Gln1011*					CEP152_uc001zwz.2_Nonsense_Mutation_p.Q1011*|CEP152_uc001zxa.1_Nonsense_Mutation_p.Q918*	p.Q1011*	NM_014985	NP_055800	O94986	CE152_HUMAN		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)	20	3065	-		all_lung(180;0.0428)	1011					E7ER66|Q17RV1|Q6NTA0	Nonsense_Mutation	SNP	ENST00000380950.2	37	c.3031C>T	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	G	42	9.343378	0.99143	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	.	.	.	5.39	5.39	0.77823	.	0.062520	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-6.4284	19.5039	0.95106	0.0:0.0:1.0:0.0	.	.	.	.	X	1011;918;1011	.	ENSP00000321000:Q918X	Q	-	1	0	CEP152	46835706	1.000000	0.71417	0.994000	0.49952	0.863000	0.49368	7.070000	0.76763	2.675000	0.91044	0.591000	0.81541	CAG		0.393	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985		35	62	0	0	0	0.003271	0	35	62				
UNC13C	440279	broad.mit.edu	37	15	54305729	54305729	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:54305729G>A	ENST00000260323.11	+	1	629	c.629G>A	c.(628-630)aGa>aAa	p.R210K	UNC13C_ENST00000545554.1_Missense_Mutation_p.R210K|UNC13C_ENST00000537900.1_Missense_Mutation_p.R210K	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	210					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.R210K(4)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGGGGAATAAGAAGTAAGTCT	0.438																																							uc002ack.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(5)|pancreas(2)	7						c.(628-630)AGA>AAA		unc-13 homolog C							90.0	89.0	89.0					15																	54305729		1841	4092	5933	SO:0001583	missense	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54305729G>A	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.629G>A	15.37:g.54305729G>A	ENSP00000260323:p.Arg210Lys						p.R210K	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	1	629	+			210					Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	c.629G>A	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047174	0.75846	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.85013	-1.93;-1.93;-1.93	4.97	4.97	0.65823	.	.	.	.	.	T	0.77955	0.4208	L	0.27053	0.805	0.37982	D	0.933638	B	0.25521	0.128	B	0.22386	0.039	T	0.75780	-0.3197	9	0.30854	T	0.27	.	17.243	0.87019	0.0:0.0:1.0:0.0	.	210	Q8NB66	UN13C_HUMAN	K	210	ENSP00000260323:R210K;ENSP00000438156:R210K;ENSP00000442569:R210K	ENSP00000260323:R210K	R	+	2	0	UNC13C	52093021	1.000000	0.71417	0.936000	0.37596	0.889000	0.51656	7.796000	0.85898	2.281000	0.76405	0.650000	0.86243	AGA		0.438	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		39	150	0	0	0	0.006999	0	39	150				
PRTG	283659	broad.mit.edu	37	15	55965800	55965800	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:55965800G>T	ENST00000389286.4	-	10	1668	c.1621C>A	c.(1621-1623)Cca>Aca	p.P541T		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		TATTTGGCTGGGATTGGCAGC	0.498																																							uc002adg.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(1621-1623)CCA>ACA		protogenin precursor							98.0	102.0	101.0					15																	55965800		1887	4102	5989	SO:0001583	missense	283659				multicellular organismal development	integral to membrane		g.chr15:55965800G>T	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.1621C>A	15.37:g.55965800G>T	ENSP00000373937:p.Pro541Thr					PRTG_uc002adh.2_Missense_Mutation_p.P43T	p.P541T	NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN		all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)	10	1669	-			541			Fibronectin type-III 2.			Missense_Mutation	SNP	ENST00000389286.4	37	c.1621C>A	CCDS42040.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259661	0.80246	.	.	ENSG00000166450	ENST00000389286	T	0.74632	-0.86	4.92	4.92	0.64577	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.060854	0.64402	D	0.000002	D	0.85890	0.5802	M	0.88181	2.935	0.80722	D	1	D	0.67145	0.996	D	0.65323	0.934	D	0.87388	0.2361	10	0.56958	D	0.05	-11.7352	11.044	0.47849	0.0852:0.0:0.9148:0.0	.	541	Q2VWP7	PRTG_HUMAN	T	541	ENSP00000373937:P541T	ENSP00000373937:P541T	P	-	1	0	PRTG	53753092	1.000000	0.71417	0.998000	0.56505	0.887000	0.51463	5.889000	0.69766	2.428000	0.82296	0.655000	0.94253	CCA		0.498	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814		60	130	1	0	6.0678e-26	0.01441	7.43554e-26	60	130				
VPS13C	54832	broad.mit.edu	37	15	62254661	62254661	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:62254661T>A	ENST00000261517.5	-	34	3585	c.3512A>T	c.(3511-3513)tAt>tTt	p.Y1171F	VPS13C_ENST00000395896.4_Missense_Mutation_p.Y1171F|VPS13C_ENST00000249837.3_Missense_Mutation_p.Y1128F|VPS13C_ENST00000395898.3_Missense_Mutation_p.Y1128F	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.Y1171F(2)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						CATGTCAGTATACAAATCCCC	0.368																																							uc002agz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(3511-3513)TAT>TTT		vacuolar protein sorting 13C protein isoform 2A							182.0	188.0	186.0					15																	62254661		2203	4300	6503	SO:0001583	missense	54832				protein localization			g.chr15:62254661T>A	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.3512A>T	15.37:g.62254661T>A	ENSP00000261517:p.Tyr1171Phe					VPS13C_uc002aha.2_Missense_Mutation_p.Y1128F|VPS13C_uc002ahb.1_Missense_Mutation_p.Y1171F|VPS13C_uc002ahc.1_Missense_Mutation_p.Y1128F	p.Y1171F	NM_020821	NP_065872	Q709C8	VP13C_HUMAN			34	3586	-			1171						Missense_Mutation	SNP	ENST00000261517.5	37	c.3512A>T	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.384633	0.82792	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.42131	0.98;0.98;0.98	5.79	5.79	0.91817	.	0.000000	0.64402	D	0.000001	T	0.59729	0.2215	M	0.76170	2.325	0.54753	D	0.999989	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.87578	0.979;0.998;0.98;0.994	T	0.58429	-0.7638	10	0.13470	T	0.59	.	11.2452	0.48993	0.1365:0.0:0.0:0.8635	.	1128;1171;1128;1171	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	F	1128;1171;1171;1171	ENSP00000249837:Y1128F;ENSP00000261517:Y1171F;ENSP00000379233:Y1171F	ENSP00000249837:Y1128F	Y	-	2	0	VPS13C	60041953	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.662000	0.83803	2.209000	0.71365	0.459000	0.35465	TAT		0.368	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684		85	169	0	0	0	0.01441	0	85	169				
HERC1	8925	broad.mit.edu	37	15	64045267	64045267	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:64045267C>A	ENST00000443617.2	-	8	1879	c.1792G>T	c.(1792-1794)Gat>Tat	p.D598Y		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	598					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.D598Y(4)		NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CTGTTGGTATCACCATGACCA	0.343																																							uc002amp.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						c.(1792-1794)GAT>TAT		hect domain and RCC1-like domain 1							62.0	59.0	60.0					15																	64045267		1839	4090	5929	SO:0001583	missense	8925				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity	g.chr15:64045267C>A	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.1792G>T	15.37:g.64045267C>A	ENSP00000390158:p.Asp598Tyr					HERC1_uc010uil.1_Intron|HERC1_uc010bgt.1_Missense_Mutation_p.D598Y	p.D598Y	NM_003922	NP_003913	Q15751	HERC1_HUMAN			8	1940	-			598			RCC1 5.		Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	c.1792G>T	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.748652	0.89753	.	.	ENSG00000103657	ENST00000443617	D	0.85702	-2.02	5.41	5.41	0.78517	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	U	0.000000	D	0.92237	0.7538	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	D	0.92579	0.6073	10	0.87932	D	0	.	19.5699	0.95407	0.0:1.0:0.0:0.0	.	598;598	C9JUT5;Q15751	.;HERC1_HUMAN	Y	598	ENSP00000390158:D598Y	ENSP00000390158:D598Y	D	-	1	0	HERC1	61832320	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.776000	0.85560	2.707000	0.92482	0.650000	0.86243	GAT		0.343	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922		10	53	1	0	7.48243e-07	0.006214	7.90546e-07	10	53				
CILP	8483	broad.mit.edu	37	15	65489559	65489559	+	Missense_Mutation	SNP	C	C	T	rs200825053		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:65489559C>T	ENST00000261883.4	-	9	3231	c.3065G>A	c.(3064-3066)cGc>cAc	p.R1022H		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	1022					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.R1022H(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						CACCAGGGTGCGGTCCACACG	0.592																																							uc002aon.2		NA																	1	Substitution - Missense(1)		prostate(1)	ovary(4)|pancreas(2)|skin(1)	7						c.(3064-3066)CGC>CAC		cartilage intermediate layer protein							103.0	70.0	81.0					15																	65489559		2202	4299	6501	SO:0001583	missense	8483				negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix		g.chr15:65489559C>T	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.3065G>A	15.37:g.65489559C>T	ENSP00000261883:p.Arg1022His						p.R1022H	NM_003613	NP_003604	O75339	CILP1_HUMAN			9	3246	-			1022					B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	c.3065G>A	CCDS10203.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166182	0.78339	.	.	ENSG00000138615	ENST00000261883	T	0.11277	2.79	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.36413	0.0966	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.08472	-1.0720	10	0.72032	D	0.01	-3.9489	18.4768	0.90795	0.0:1.0:0.0:0.0	.	1022	O75339	CILP1_HUMAN	H	1022	ENSP00000261883:R1022H	ENSP00000261883:R1022H	R	-	2	0	CILP	63276612	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.795000	0.85887	2.608000	0.88229	0.655000	0.94253	CGC		0.592	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613		5	168	0	0	0	0.000602	0	5	168				
SKOR1	390598	broad.mit.edu	37	15	68119495	68119495	+	Silent	SNP	C	C	G	rs556233670	byFrequency	TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:68119495C>G	ENST00000380035.2	+	2	1387	c.1329C>G	c.(1327-1329)gcC>gcG	p.A443A	SKOR1_ENST00000389002.1_Silent_p.A399A|SKOR1_ENST00000341418.5_Intron|SKOR1_ENST00000554240.1_Silent_p.A404A|SKOR1_ENST00000554054.1_Silent_p.A415A			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	443					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)	p.A443A(1)|p.A399A(1)		endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						gcccgggagccagccacttgc	0.786																																							uc002aqy.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1195-1197)GCC>GCG		transcriptional corepressor Corl1							3.0	4.0	4.0					15																	68119495		879	2112	2991	SO:0001819	synonymous_variant	390598				negative regulation of BMP signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|dendrite|neuronal cell body|nucleus	nucleotide binding|SMAD binding|transcription repressor activity	g.chr15:68119495C>G		CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.1329C>G	15.37:g.68119495C>G							p.A399A	NM_001031807	NP_001026977	P84550	SKOR1_HUMAN			3	1197	+			443					A6NIP4|A6NJY0|Q2VWA5	Silent	SNP	ENST00000380035.2	37	c.1197C>G																																																																																					0.786	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000410832.1	NM_001031807		2	1	0	0	0	0.004672	0	2	1				
RPP25	54913	broad.mit.edu	37	15	75248342	75248342	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:75248342C>T	ENST00000322177.5	-	1	1463	c.583G>A	c.(583-585)Gag>Aag	p.E195K	RPP25_ENST00000499788.2_Missense_Mutation_p.E195K	NM_017793.2	NP_060263.2	Q9BUL9	RPP25_HUMAN	ribonuclease P/MRP 25kDa subunit	195					tRNA processing (GO:0008033)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)	p.E195K(1)		breast(1)|lung(1)	2						GTCTGATCCTCGTCCGCAACC	0.662																																							uc002azj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(583-585)GAG>AAG		ribonuclease P 25kDa subunit							20.0	22.0	22.0					15																	75248342		2197	4295	6492	SO:0001583	missense	54913				tRNA processing	nucleus	protein binding|ribonuclease P activity|RNA binding	g.chr15:75248342C>T	AY034074	CCDS10274.1	15q24.2	2012-05-21	2007-06-26		ENSG00000178718	ENSG00000178718			30361	protein-coding gene	gene with protein product	"""RNase P protein subunit p25"""		"""ribonuclease P 25kDa subunit"""			12003489	Standard	NM_017793		Approved	FLJ20374	uc002azj.1	Q9BUL9	OTTHUMG00000142822	ENST00000322177.5:c.583G>A	15.37:g.75248342C>T	ENSP00000317691:p.Glu195Lys						p.E195K	NM_017793	NP_060263	Q9BUL9	RPP25_HUMAN			1	1434	-			195					D3DW70|Q9NX88	Missense_Mutation	SNP	ENST00000322177.5	37	c.583G>A	CCDS10274.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.577779	0.45902	.	.	ENSG00000178718	ENST00000322177;ENST00000499788	.	.	.	5.33	2.44	0.29823	.	0.388370	0.23000	N	0.053088	T	0.31482	0.0798	L	0.51422	1.61	0.09310	N	1	B	0.19200	0.034	B	0.14578	0.011	T	0.23691	-1.0181	9	0.45353	T	0.12	.	4.0982	0.10002	0.1551:0.5351:0.0:0.3097	.	195	Q9BUL9	RPP25_HUMAN	K	195	.	ENSP00000317691:E195K	E	-	1	0	RPP25	73035395	0.636000	0.27207	0.003000	0.11579	0.003000	0.03518	1.547000	0.36190	0.336000	0.23639	-0.894000	0.02916	GAG		0.662	RPP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286413.1	NM_017793		9	50	0	0	0	0.006214	0	9	50				
TSPAN3	10099	broad.mit.edu	37	15	77348204	77348204	+	Splice_Site	SNP	A	A	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:77348204A>T	ENST00000267970.4	-	3	530	c.257T>A	c.(256-258)tTt>tAt	p.F86Y	TSPAN3_ENST00000561277.1_De_novo_Start_OutOfFrame|TSPAN3_ENST00000346495.2_Intron|TSPAN3_ENST00000558394.1_Intron|TSPAN3_ENST00000424443.3_Splice_Site_p.F22Y|TSPAN3_ENST00000558745.1_De_novo_Start_OutOfFrame|TSPAN3_ENST00000559494.1_Intron	NM_001168412.1|NM_005724.5|NM_198902.2	NP_001161884.1|NP_005715.1|NP_944492.1	O60637	TSN3_HUMAN	tetraspanin 3	86						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.F86Y(2)		kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	10				all cancers(203;1.14e-19)		GATGATGACAAACTGTAAGAA	0.289																																							uc002bcj.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(256-258)TTT>TAT		transmembrane 4 superfamily member 8 isoform 1							81.0	78.0	79.0					15																	77348204		2196	4292	6488	SO:0001630	splice_region_variant	10099					integral to membrane		g.chr15:77348204A>T		CCDS10292.1, CCDS10293.1, CCDS53963.1	15q23	2013-02-14	2005-03-21	2005-03-21	ENSG00000140391	ENSG00000140391		"""Tetraspanins"""	17752	protein-coding gene	gene with protein product		613134	"""transmembrane 4 superfamily member 8"""	TM4SF8			Standard	NM_005724		Approved	TM4-A, TSPAN-3	uc002bcj.3	O60637	OTTHUMG00000143728	ENST00000267970.4:c.256-1T>A	15.37:g.77348204A>T						TSPAN3_uc002bck.2_Intron|TSPAN3_uc010ump.1_Missense_Mutation_p.F22Y|TSPAN3_uc010bkx.2_Intron	p.F86Y	NM_005724	NP_005715	O60637	TSN3_HUMAN		all cancers(203;1.14e-19)	3	474	-			86			Helical; (Potential).		A6NEH4|B3KQQ2|B4DP19|Q9BW22|Q9NVX9	Missense_Mutation	SNP	ENST00000267970.4	37	c.257T>A	CCDS10292.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.803999	0.90623	.	.	ENSG00000140391	ENST00000267970;ENST00000424443;ENST00000423920	T;T	0.75938	-0.98;-0.98	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.80226	0.4584	L	0.49778	1.585	0.80722	D	1	P;D	0.65815	0.761;0.995	B;D	0.70227	0.399;0.968	T	0.75966	-0.3131	10	0.17369	T	0.5	.	12.3792	0.55297	0.9331:0.0:0.0669:0.0	.	22;86	B4DP19;O60637	.;TSN3_HUMAN	Y	86;22;48	ENSP00000267970:F86Y;ENSP00000407243:F22Y	ENSP00000267970:F86Y	F	-	2	0	TSPAN3	75135259	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.155000	0.77445	2.302000	0.77476	0.533000	0.62120	TTT		0.289	TSPAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289792.3	NM_005724	Missense_Mutation	41	86	0	0	0	0.007835	0	41	86				
ADAMTS7	11173	broad.mit.edu	37	15	79066595	79066595	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:79066595C>T	ENST00000388820.4	-	13	2134	c.1924G>A	c.(1924-1926)Gag>Aag	p.E642K	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	642	Cys-rich.			E -> K (in Ref. 1; AAD56358). {ECO:0000305}.	cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CGCAGCTTCTCGGCAAAGTAC	0.627																																							uc002bej.3		NA																	0					0						c.(1924-1926)GAG>AAG		ADAM metallopeptidase with thrombospondin type 1							16.0	14.0	14.0					15																	79066595		2085	4008	6093	SO:0001583	missense	11173				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:79066595C>T	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1924G>A	15.37:g.79066595C>T	ENSP00000373472:p.Glu642Lys					ADAMTS7_uc010und.1_Intron|ADAMTS7_uc002bek.1_Missense_Mutation_p.E642K	p.E642K	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN			13	2135	-			642	E -> K (in Ref. 1; AAD56358).		Cys-rich.		Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	c.1924G>A	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.238533	0.79800	.	.	ENSG00000136378	ENST00000388820	T	0.03524	3.9	4.17	4.17	0.49024	.	0.061023	0.64402	D	0.000006	T	0.07728	0.0194	L	0.53671	1.685	0.50467	D	0.999875	P;D	0.67145	0.602;0.996	B;P	0.49047	0.1;0.599	T	0.45264	-0.9273	10	0.26408	T	0.33	.	15.5528	0.76167	0.0:1.0:0.0:0.0	.	642;642	A8MQ00;Q9UKP4	.;ATS7_HUMAN	K	642	ENSP00000373472:E642K	ENSP00000373472:E642K	E	-	1	0	ADAMTS7	76853650	1.000000	0.71417	0.929000	0.37066	0.136000	0.21042	5.528000	0.67129	2.300000	0.77407	0.484000	0.47621	GAG		0.627	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		3	20	0	0	0	0.009096	0	3	20				
KLHL25	64410	broad.mit.edu	37	15	86311732	86311732	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr15:86311732G>T	ENST00000337975.5	-	2	1584	c.1310C>A	c.(1309-1311)gCc>gAc	p.A437D	MIR1276_ENST00000408707.1_RNA|KLHL25_ENST00000559131.1_Intron|KLHL25_ENST00000536947.1_Missense_Mutation_p.A437D	NM_022480.3	NP_071925.2	Q9H0H3	KLH25_HUMAN	kelch-like family member 25	437					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of translational initiation (GO:0006446)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)		p.A437D(2)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	25						CACCACTGCGGCATTGCTGAC	0.587																																							uc002bly.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1309-1311)GCC>GAC		BTB/POZ KELCH domain protein							72.0	65.0	67.0					15																	86311732		2202	4299	6501	SO:0001583	missense	64410					cytoplasm		g.chr15:86311732G>T		CCDS10339.1	15q25.3	2013-02-22	2013-02-22		ENSG00000183655	ENSG00000183655		"""Kelch-like"", ""BTB/POZ domain containing"""	25732	protein-coding gene	gene with protein product	"""ectodermal-neural cortex 2"""		"""kelch-like 25 (Drosophila)"""				Standard	XM_006720635		Approved	FLJ12587, ENC2, ENC-2	uc002bly.3	Q9H0H3	OTTHUMG00000148672	ENST00000337975.5:c.1310C>A	15.37:g.86311732G>T	ENSP00000336800:p.Ala437Asp						p.A437D	NM_022480	NP_071925	Q9H0H3	ENC2_HUMAN			2	1513	-			437			Kelch 3.		B2RDH2|B3KRT7	Missense_Mutation	SNP	ENST00000337975.5	37	c.1310C>A	CCDS10339.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.531994	0.45073	.	.	ENSG00000183655	ENST00000337975;ENST00000538153;ENST00000536947	T;T	0.68479	-0.33;-0.33	5.56	5.56	0.83823	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.85978	0.5823	M	0.91300	3.195	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.88642	0.3176	10	0.72032	D	0.01	.	18.5088	0.90909	0.0:0.0:1.0:0.0	.	437	Q9H0H3	ENC2_HUMAN	D	437;406;437	ENSP00000336800:A437D;ENSP00000444739:A437D	ENSP00000336800:A437D	A	-	2	0	KLHL25	84112736	1.000000	0.71417	0.564000	0.28396	0.049000	0.14656	9.869000	0.99810	2.619000	0.88677	0.462000	0.41574	GCC		0.587	KLHL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309023.1	NM_022480		32	130	1	0	5.60225e-13	0.009535	6.20397e-13	32	130				
KIAA0430	9665	broad.mit.edu	37	16	15705448	15705448	+	Splice_Site	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr16:15705448C>A	ENST00000396368.3	-	18	3824		c.e18+1		KIAA0430_ENST00000540441.2_Splice_Site|CTB-193M12.1_ENST00000549756.1_RNA|KIAA0430_ENST00000548025.1_Splice_Site|KIAA0430_ENST00000344181.3_Splice_Site|KIAA0430_ENST00000602337.1_Splice_Site|KIAA0430_ENST00000551742.1_Splice_Site	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.?(2)		breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						CATCAACTCACCAGTGATAAG	0.368																																							uc002ddr.2		NA																	2	Unknown(2)		ovary(1)|lung(1)		0						c.e18+1		limkain b1							61.0	56.0	58.0					16																	15705448		1819	4085	5904	SO:0001630	splice_region_variant	9665					peroxisome	nucleotide binding|RNA binding	g.chr16:15705448C>A	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.3617+1G>T	16.37:g.15705448C>A						KIAA0430_uc002ddq.2_Splice_Site_p.W1040_splice|KIAA0430_uc010uzv.1_Splice_Site_p.W1202_splice|KIAA0430_uc010uzw.1_Splice_Site_p.W1205_splice	p.W1206_splice	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN			18	3810	-								A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Splice_Site	SNP	ENST00000396368.3	37	c.3617_splice	CCDS10562.2	.	.	.	.	.	.	.	.	.	.	C	29.2	4.987488	0.93106	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	6.15	6.15	0.99193	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8269	0.96621	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0430	15612949	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.073000	0.76784	2.932000	0.99384	0.643000	0.83706	.		0.368	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647	Intron	31	52	1	0	7.16026e-08	0.012213	7.64613e-08	31	52				
ITPRIPL2	162073	broad.mit.edu	37	16	19126881	19126881	+	Silent	SNP	A	A	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr16:19126881A>T	ENST00000381440.3	+	1	1628	c.1098A>T	c.(1096-1098)gcA>gcT	p.A366A	CTD-2349B8.1_ENST00000564808.2_Intron	NM_001034841.3	NP_001030013.1	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 2	366						integral component of membrane (GO:0016021)		p.A366A(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						AGGAACGGGCAGCTCCAGGTG	0.667																																							uc002dfu.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(1096-1098)GCA>GCT		inositol 1,4,5-triphosphate receptor interacting							39.0	46.0	44.0					16																	19126881		2197	4300	6497	SO:0001819	synonymous_variant	162073					integral to membrane		g.chr16:19126881A>T		CCDS32395.1	16p12.3	2011-04-28	2011-04-28		ENSG00000205730	ENSG00000205730			27257	protein-coding gene	gene with protein product			"""inositol 1,4,5-triphosphate receptor interacting protein-like 2"""				Standard	NM_001034841		Approved	FLJ22994, MGC126798, MGC126800, LOC162073	uc002dfu.4	Q3MIP1		ENST00000381440.3:c.1098A>T	16.37:g.19126881A>T						ITPRIPL2_uc002dft.2_Silent_p.A62A	p.A366A	NM_001034841	NP_001030013	Q3MIP1	IPIL2_HUMAN			1	1628	+			366			Cytoplasmic (Potential).			Silent	SNP	ENST00000381440.3	37	c.1098A>T	CCDS32395.1																																																																																				0.667	ITPRIPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435827.3	NM_001034841		30	112	0	0	0	0.009535	0	30	112				
SH2B1	25970	broad.mit.edu	37	16	28878061	28878061	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr16:28878061G>C	ENST00000322610.8	+	4	1085	c.646G>C	c.(646-648)Gat>Cat	p.D216H	SH2B1_ENST00000359285.5_Missense_Mutation_p.D216H|SH2B1_ENST00000337120.5_Missense_Mutation_p.D216H|SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000395532.4_Missense_Mutation_p.D216H|SH2B1_ENST00000545570.1_Intron|SH2B1_ENST00000538342.1_Intron			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	216	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation). {ECO:0000250}.|Required for NGF signaling. {ECO:0000250}.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.D216H(2)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						ACTGGTCAGTGATGGAACGTC	0.622																																							uc002dri.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(646-648)GAT>CAT		SH2B adaptor protein 1 isoform 1							41.0	42.0	42.0					16																	28878061		2197	4300	6497	SO:0001583	missense	25970				blood coagulation|intracellular signal transduction	cytosol|membrane|nucleus	signal transducer activity	g.chr16:28878061G>C	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.646G>C	16.37:g.28878061G>C	ENSP00000321221:p.Asp216His					uc010vct.1_Intron|SH2B1_uc010vdc.1_Intron|SH2B1_uc002drj.2_Missense_Mutation_p.D216H|SH2B1_uc002drk.2_Missense_Mutation_p.D216H|SH2B1_uc002drl.2_Missense_Mutation_p.D216H|SH2B1_uc010vdd.1_Intron|SH2B1_uc010vde.1_Missense_Mutation_p.D216H|SH2B1_uc002drm.2_Missense_Mutation_p.D216H	p.D216H	NM_001145795	NP_001139267	Q9NRF2	SH2B1_HUMAN			4	1085	+			216			Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation) (By similarity).|Required for NGF signaling (By similarity).		A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	37	c.646G>C	CCDS53996.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.282134	0.23392	.	.	ENSG00000178188	ENST00000322610;ENST00000359285;ENST00000395532;ENST00000337120	T;T;T;T	0.49139	0.79;0.8;0.8;0.8	3.95	2.96	0.34315	.	0.255913	0.25472	N	0.030438	T	0.27098	0.0664	N	0.08118	0	0.09310	N	1	P;P;P	0.49447	0.924;0.924;0.875	P;B;B	0.44772	0.46;0.366;0.271	T	0.06058	-1.0848	10	0.38643	T	0.18	-24.9339	7.5901	0.28017	0.123:0.0:0.877:0.0	.	216;216;216	Q9NRF2-2;Q9NRF2-3;Q9NRF2	.;.;SH2B1_HUMAN	H	216	ENSP00000321221:D216H;ENSP00000352232:D216H;ENSP00000378903:D216H;ENSP00000337163:D216H	ENSP00000321221:D216H	D	+	1	0	SH2B1	28785562	0.996000	0.38824	0.202000	0.23494	0.288000	0.27193	2.692000	0.47018	2.055000	0.61198	0.455000	0.32223	GAT		0.622	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503		37	49	0	0	0	0.004878	0	37	49				
CES1P1	51716	broad.mit.edu	37	16	55806422	55806422	+	RNA	SNP	T	T	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr16:55806422T>A	ENST00000571348.1	+	0	724					NR_003276.2		Q9UKY3	CES1P_HUMAN	carboxylesterase 1 pseudogene 1						anatomical structure morphogenesis (GO:0009653)|metabolic process (GO:0008152)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)										GAGGAGAAAGTGTCTCTGTTC	0.557																																							uc002eik.2		NA																	0					0						c.(271-273)AGT>AGA		RecName: Full=Inactive carboxylesterase 4; AltName: Full=Placental carboxylesterase 3;          Short=PCE-3; Flags: Precursor;																																						51716							g.chr16:55806422T>A	AF106005		16q12.2	2013-07-10	2010-10-12	2010-10-12	ENSG00000228695	ENSG00000228695			18546	pseudogene	pseudogene			"""carboxylesterase 4-like"", ""carboxylesterase 4, pseudogene"""	CES4		10452915, 20931200	Standard	NR_003276		Approved	PCE-3, CESR, CES1A3	uc010cce.3	Q9UKY3	OTTHUMG00000154668		16.37:g.55806422T>A						CES4_uc010cce.2_Missense_Mutation_p.S91R	p.S91R	NR_003276						5	724	+								A2RRL8|B9ZVS2	Missense_Mutation	SNP	ENST00000571348.1	37	c.273T>A																																																																																					0.557	CES1P1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000440035.1	NR_003276		6	25	0	0	0	0.001168	0	6	25				
CES1	1066	broad.mit.edu	37	16	55866969	55866969	+	De_novo_Start_InFrame	SNP	G	G	A	rs12149368	byFrequency	TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr16:55866969G>A	ENST00000361503.4	-	0	129				CES1_ENST00000422046.2_De_novo_Start_InFrame|CES1_ENST00000360526.3_De_novo_Start_InFrame			P23141	EST1_HUMAN	carboxylesterase 1						epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	GAGCCACATCGTGGAAGGGCG	0.602																																					NSCLC(162;1801 2756 42904 52896)	NSCLC(162;1801 2756 42904 52896)	uc002eim.2		NA																	0					0						c.(-3-1)CACGA>CATGA		carboxylesterase 1 isoform b precursor	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)						70.0	56.0	61.0					16																	55866969		2155	4188	6343			1066				response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity	g.chr16:55866969G>A	BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141			16.37:g.55866969G>A						CES1_uc002eil.2_Translation_Start_Site|CES1_uc002ein.2_Translation_Start_Site		NM_001025194	NP_001020365	P23141	EST1_HUMAN		all cancers(182;0.13)|Epithelial(162;0.137)	1	107	-								A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Translation_Start_Site	SNP	ENST00000361503.4	37	c.-1C>T	CCDS45488.1																																																																																				0.602	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266		20	83	0	0	0	0.00632	0	20	83				
TEPP	374739	broad.mit.edu	37	16	58011792	58011792	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr16:58011792G>A	ENST00000441824.2	+	2	274	c.237G>A	c.(235-237)ctG>ctA	p.L79L	TEPP_ENST00000290871.5_Silent_p.L79L|TEPP_ENST00000569996.1_Intron	NM_199456.2	NP_955535.2	Q6URK8	TEPP_HUMAN	testis, prostate and placenta expressed	79						extracellular region (GO:0005576)		p.L79L(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	8						CGGCCATCCTGCTTCCCATGG	0.657																																							uc002emw.3		NA																	1	Substitution - coding silent(1)		lung(1)	kidney(1)|central_nervous_system(1)|skin(1)	3						c.(235-237)CTG>CTA		testis/prostate/placenta-expressed protein							96.0	86.0	89.0					16																	58011792		2198	4300	6498	SO:0001819	synonymous_variant	374739					extracellular region		g.chr16:58011792G>A	BC104458	CCDS10790.1, CCDS45496.1	16q13	2009-04-20			ENSG00000159648	ENSG00000159648			33745	protein-coding gene	gene with protein product		610264				14652002	Standard	NM_199456		Approved		uc002emv.4	Q6URK8	OTTHUMG00000133463	ENST00000441824.2:c.237G>A	16.37:g.58011792G>A						TEPP_uc002emv.3_Silent_p.L79L	p.L79L	NM_199456	NP_955535	Q6URK8	TEPP_HUMAN			2	274	+			79					Q6URK7	Silent	SNP	ENST00000441824.2	37	c.237G>A	CCDS45496.1																																																																																				0.657	TEPP-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000431966.1	NM_199456		132	208	0	0	0	0.01441	0	132	208				
KCTD19	146212	broad.mit.edu	37	16	67338379	67338379	+	Silent	SNP	T	T	C	rs200897769		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr16:67338379T>C	ENST00000304372.5	-	3	451	c.396A>G	c.(394-396)acA>acG	p.T132T	KCTD19_ENST00000562860.1_Intron	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	132					protein homooligomerization (GO:0051260)			p.T132T(1)		endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		TACACTTCCATGTACGCCAGT	0.478													T|||	1	0.000199681	0.0	0.0014	5008	,	,		20991	0.0		0.0	False		,,,				2504	0.0						uc002esu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(394-396)ACA>ACG		potassium channel tetramerisation domain		T		0,3932		0,0,1966	169.0	164.0	166.0		396	-11.7	0.4	16		166	6,8290		0,6,4142	no	coding-synonymous	KCTD19	NM_001100915.1		0,6,6108	CC,CT,TT		0.0723,0.0,0.0491		132/927	67338379	6,12222	1966	4148	6114	SO:0001819	synonymous_variant	146212					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr16:67338379T>C	AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.396A>G	16.37:g.67338379T>C						KCTD19_uc002est.2_5'UTR|KCTD19_uc010vjj.1_5'UTR	p.T132T	NM_001100915	NP_001094385	Q17RG1	KCD19_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)	3	447	-		Ovarian(137;0.192)	132					B4DZ49|Q8N804	Silent	SNP	ENST00000304372.5	37	c.396A>G	CCDS42179.1																																																																																				0.478	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	XM_085367		91	143	0	0	0	0.01441	0	91	143				
CENPN	55839	broad.mit.edu	37	16	81050942	81050942	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr16:81050942C>G	ENST00000305850.5	+	4	1019	c.229C>G	c.(229-231)Cat>Gat	p.H77D	CENPN_ENST00000439957.3_Intron|RP11-303E16.3_ENST00000562315.1_RNA|CENPN_ENST00000428963.2_Missense_Mutation_p.H77D|CMC2_ENST00000565914.1_Intron|CENPN_ENST00000299572.5_Missense_Mutation_p.H77D|CENPN_ENST00000569461.1_Intron|CENPN_ENST00000393335.3_Missense_Mutation_p.H77D	NM_001100624.2|NM_001270474.1	NP_001094094.2|NP_001257403.1	Q96H22	CENPN_HUMAN	centromere protein N	77					CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.H77D(3)		breast(1)|large_intestine(5)|lung(4)	10						TATGCAATTTCATCAGCACCA	0.333																																							uc002ffx.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(229-231)CAT>GAT		centromere protein N isoform 2							100.0	105.0	104.0					16																	81050942		2202	4300	6502	SO:0001583	missense	55839				CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm		g.chr16:81050942C>G	AK026313	CCDS10931.1, CCDS42199.1, CCDS42200.1, CCDS58482.1, CCDS58483.1	16q23.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000166451	ENSG00000166451			30873	protein-coding gene	gene with protein product		611509	"""chromosome 16 open reading frame 60"""	C16orf60		16622419	Standard	NM_001100625		Approved	FLJ13607, FLJ22660, BM039	uc002ffy.4	Q96H22	OTTHUMG00000137628	ENST00000305850.5:c.229C>G	16.37:g.81050942C>G	ENSP00000305608:p.His77Asp					CENPN_uc002ffw.3_Missense_Mutation_p.H77D|CENPN_uc010vnl.1_Missense_Mutation_p.H77D|CENPN_uc010vnm.1_Intron|CENPN_uc002ffy.3_Missense_Mutation_p.H77D	p.H77D	NM_001100624	NP_001094094	Q96H22	CENPN_HUMAN			4	1019	+			77					A8MZE6|B3KN53|B4DJD1|B4DPY7|C9JJM5|D3DUK8|E7ES30|E7ETS3|Q9NZ83	Missense_Mutation	SNP	ENST00000305850.5	37	c.229C>G	CCDS42200.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410167	0.25465	.	.	ENSG00000166451	ENST00000305850;ENST00000299572;ENST00000393335;ENST00000428963	T;T;T;T	0.24538	1.85;1.85;1.85;1.85	5.58	3.42	0.39159	.	0.699082	0.14676	N	0.305035	T	0.27278	0.0669	L	0.57536	1.79	0.09310	N	1	P;P;P;P	0.52692	0.93;0.955;0.912;0.944	B;P;B;P	0.47470	0.411;0.483;0.334;0.548	T	0.12863	-1.0531	10	0.38643	T	0.18	-8.7926	4.3755	0.11269	0.0:0.5511:0.0:0.4489	.	77;77;77;77	E7ES30;A8MZE6;Q96H22;Q96H22-2	.;.;CENPN_HUMAN;.	D	77	ENSP00000305608:H77D;ENSP00000299572:H77D;ENSP00000377007:H77D;ENSP00000393991:H77D	ENSP00000299572:H77D	H	+	1	0	CENPN	79608443	0.873000	0.30073	0.801000	0.32222	0.276000	0.26787	2.114000	0.41911	1.370000	0.46153	0.591000	0.81541	CAT		0.333	CENPN-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269051.1	NM_018455		65	102	0	0	0	0.01441	0	65	102				
ATMIN	23300	broad.mit.edu	37	16	81069732	81069732	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr16:81069732G>T	ENST00000299575.4	+	1	281	c.257G>T	c.(256-258)tGc>tTc	p.C86F	RP11-303E16.3_ENST00000561808.1_RNA|RP11-303E16.3_ENST00000566390.1_RNA|ATMIN_ENST00000564241.1_5'Flank	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor	86					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)	p.C86F(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						AACATCCTGTGCACCGTGCGC	0.736																																							uc002ffz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(256-258)TGC>TTC		ATM interactor							12.0	12.0	12.0					16																	81069732		1987	4012	5999	SO:0001583	missense	23300				response to DNA damage stimulus	nucleus	zinc ion binding	g.chr16:81069732G>T	BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.257G>T	16.37:g.81069732G>T	ENSP00000299575:p.Cys86Phe					ATMIN_uc002fga.2_5'Flank|ATMIN_uc010vnn.1_5'Flank	p.C86F	NM_015251	NP_056066	O43313	ATMIN_HUMAN			1	275	+			86			C2H2-type 1.		A8K4H8|Q68DC9	Missense_Mutation	SNP	ENST00000299575.4	37	c.257G>T	CCDS32494.1	.	.	.	.	.	.	.	.	.	.	g	29.6	5.021137	0.93462	.	.	ENSG00000166454	ENST00000299575	T	0.63096	-0.02	4.02	4.02	0.46733	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.058006	0.64402	U	0.000001	T	0.65554	0.2702	L	0.46157	1.445	0.80722	D	1	P	0.50943	0.94	P	0.50440	0.641	T	0.72137	-0.4381	10	0.87932	D	0	-6.2006	16.6098	0.84880	0.0:0.0:1.0:0.0	.	86	O43313	ATMIN_HUMAN	F	86	ENSP00000299575:C86F	ENSP00000299575:C86F	C	+	2	0	ATMIN	79627233	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	7.799000	0.85936	1.959000	0.56917	0.430000	0.28490	TGC		0.736	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432140.1	NM_015251		8	32	1	0	0.000157383	0.00308	0.000162829	8	32				
TP53	7157	broad.mit.edu	37	17	7578433	7578433	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr17:7578433G>C	ENST00000269305.4	-	5	686	c.497C>G	c.(496-498)tCa>tGa	p.S166*	TP53_ENST00000413465.2_Nonsense_Mutation_p.S166*|TP53_ENST00000455263.2_Nonsense_Mutation_p.S166*|TP53_ENST00000359597.4_Nonsense_Mutation_p.S166*|TP53_ENST00000445888.2_Nonsense_Mutation_p.S166*|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Nonsense_Mutation_p.S166*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	166	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation).|S -> G (in a sporadic cancer; somatic mutation).|S -> L (in sporadic cancers; somatic mutation).|S -> P (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S166*(25)|p.0?(8)|p.S166L(4)|p.Q167fs*14(4)|p.S34*(2)|p.S73*(2)|p.K164fs*3(2)|p.V157_C176del20(1)|p.Y163fs*1(1)|p.P151_V173del23(1)|p.Q165_S166insYKQ(1)|p.Q165_M169delQSQHM(1)|p.Y163fs*14(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.S166G(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATGTGCTGTGACTGCTTGTA	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		56	Substitution - Nonsense(29)|Whole gene deletion(8)|Deletion - Frameshift(5)|Substitution - Missense(5)|Deletion - In frame(4)|Insertion - Frameshift(4)|Insertion - In frame(1)	p.S166*(19)|p.0?(7)|p.S166P(5)|p.S166L(4)|p.Q167fs*14(4)|p.S166A(2)|p.S166fs*15(2)|p.S166S(2)|p.K164fs*3(2)|p.V157_C176del20(1)|p.Y163fs*1(1)|p.P151_V173del23(1)|p.K164_P219del(1)|p.S166T(1)|p.Q165_S166insYKQ(1)|p.Q165_M169delQSQHM(1)|p.Y163fs*14(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.S166G(1)|p.Q165_S166insXXX(1)	lung(18)|breast(7)|upper_aerodigestive_tract(4)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|large_intestine(3)|central_nervous_system(3)|oesophagus(3)|liver(3)|stomach(2)|urinary_tract(2)|ovary(2)|skin(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(496-498)TCA>TGA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							54.0	54.0	54.0					17																	7578433		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578433G>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.497C>G	17.37:g.7578433G>C	ENSP00000269305:p.Ser166*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Nonsense_Mutation_p.S166*|TP53_uc002gih.2_Nonsense_Mutation_p.S166*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.S34*|TP53_uc010cng.1_Nonsense_Mutation_p.S34*|TP53_uc002gii.1_Nonsense_Mutation_p.S34*|TP53_uc010cnh.1_Nonsense_Mutation_p.S166*|TP53_uc010cni.1_Nonsense_Mutation_p.S166*|TP53_uc002gij.2_Nonsense_Mutation_p.S166*|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Nonsense_Mutation_p.S73*|TP53_uc002gio.2_Nonsense_Mutation_p.S34*|TP53_uc010vug.1_Nonsense_Mutation_p.S127*	p.S166*	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	691	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	166		S -> T (in sporadic cancers; somatic mutation).|S -> L (in sporadic cancers; somatic mutation).|S -> A (in sporadic cancers; somatic mutation).|S -> P (in sporadic cancers; somatic mutation).|S -> G (in a sporadic cancer; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.497C>G	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.661170	0.47572	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.59	4.63	0.57726	.	0.284727	0.34002	N	0.004360	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-10.3004	12.6801	0.56916	0.0803:0.0:0.9197:0.0	.	.	.	.	X	166;166;166;166;166;166;155;73;34;73;34	.	ENSP00000269305:S166X	S	-	2	0	TP53	7519158	0.909000	0.30893	0.776000	0.31678	0.112000	0.19704	4.756000	0.62205	1.513000	0.48852	0.655000	0.94253	TCA		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		66	47	0	0	0	0.01441	0	66	47				
LIG3	3980	broad.mit.edu	37	17	33329065	33329065	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr17:33329065G>A	ENST00000378526.4	+	18	2749	c.2616G>A	c.(2614-2616)aaG>aaA	p.K872K	LIG3_ENST00000262327.5_Silent_p.K872K	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	872					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)	p.K872K(1)|p.K785K(1)		endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	CCCCCAGCAAGCCCTCAGCCA	0.572								Other BER factors																															uc002hik.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(3)|lung(2)|ovary(2)|large_intestine(1)|pancreas(1)	9						c.(2614-2616)AAG>AAA	Other_BER_factors	ligase III, DNA, ATP-dependent isoform alpha	Bleomycin(DB00290)						48.0	43.0	45.0					17																	33329065		2203	4300	6503	SO:0001819	synonymous_variant	3980				base-excision repair|cell division|DNA ligation involved in DNA repair|DNA replication|reciprocal meiotic recombination|spermatogenesis	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|protein binding|zinc ion binding	g.chr17:33329065G>A		CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.2616G>A	17.37:g.33329065G>A						LIG3_uc002hij.2_Silent_p.K872K	p.K872K	NM_013975	NP_039269	P49916	DNLI3_HUMAN			18	2724	+		Ovarian(249;0.17)	872					Q16714|Q6NVK3	Silent	SNP	ENST00000378526.4	37	c.2616G>A	CCDS11284.2																																																																																				0.572	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250330.3	NM_013975		9	103	0	0	0	0.004482	0	9	103				
HOXB3	3213	broad.mit.edu	37	17	46628504	46628504	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr17:46628504C>T	ENST00000470495.1	-	2	1935	c.488G>A	c.(487-489)gGa>gAa	p.G163E	HOXB3_ENST00000485909.2_Missense_Mutation_p.G31E|HOXB3_ENST00000472863.1_Missense_Mutation_p.G90E|HOXB3_ENST00000476342.1_Missense_Mutation_p.G163E|HOXB3_ENST00000311626.4_Missense_Mutation_p.G163E|HOXB3_ENST00000498678.1_Missense_Mutation_p.G163E|HOXB3_ENST00000490677.1_Missense_Mutation_p.G29E|HOXB-AS1_ENST00000508688.1_RNA|HOXB3_ENST00000460160.1_Missense_Mutation_p.G31E|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000489475.1_Missense_Mutation_p.G90E|HOXB-AS1_ENST00000435312.1_RNA|HOXB-AS1_ENST00000502764.2_RNA			P14651	HXB3_HUMAN	homeobox B3	163	Gly-rich.				angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G163E(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						accactgcctccgccgccgcc	0.711																																							uc002inn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(487-489)GGA>GAA		homeobox B3							7.0	11.0	9.0					17																	46628504		1048	2345	3393	SO:0001583	missense	3213				angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46628504C>T		CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.488G>A	17.37:g.46628504C>T	ENSP00000417207:p.Gly163Glu					HOXB3_uc010wlm.1_Missense_Mutation_p.G90E|HOXB3_uc010dbf.2_Missense_Mutation_p.G163E|HOXB3_uc010dbg.2_Missense_Mutation_p.G163E|HOXB3_uc002ino.2_Missense_Mutation_p.G163E|HOXB3_uc010wlk.1_Missense_Mutation_p.G31E|HOXB3_uc010wll.1_Missense_Mutation_p.G90E	p.G163E	NM_002146	NP_002137	P14651	HXB3_HUMAN			2	888	-			163			Gly-rich.		A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Missense_Mutation	SNP	ENST00000470495.1	37	c.488G>A	CCDS11528.1	.	.	.	.	.	.	.	.	.	.	C	0.740	-0.776873	0.02929	.	.	ENSG00000120093	ENST00000470495;ENST00000472863;ENST00000311626;ENST00000498678;ENST00000490677;ENST00000460160;ENST00000485909;ENST00000489475;ENST00000476342;ENST00000471459	D;D;D;D;D;D;D;D;D;T	0.98717	-5.09;-5.06;-5.09;-5.09;-3.98;-5.06;-5.06;-5.06;-5.09;1.38	3.54	1.34	0.21922	.	0.386006	0.16137	U	0.227884	D	0.94155	0.8125	N	0.22421	0.69	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	D	0.86408	0.1746	10	0.13108	T	0.6	.	5.941	0.19194	0.2203:0.5657:0.214:0.0	.	163	P14651	HXB3_HUMAN	E	163;90;163;163;29;31;31;90;163;90	ENSP00000417207:G163E;ENSP00000419676:G90E;ENSP00000308252:G163E;ENSP00000420595:G163E;ENSP00000449977:G29E;ENSP00000418035:G31E;ENSP00000438747:G31E;ENSP00000418729:G90E;ENSP00000418892:G163E;ENSP00000417400:G90E	ENSP00000308252:G163E	G	-	2	0	HOXB3	43983503	0.642000	0.27260	0.003000	0.11579	0.087000	0.18053	0.878000	0.28126	0.243000	0.21327	0.563000	0.77884	GGA		0.711	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358261.1			5	9	0	0	0	0.001168	0	5	9				
INTS2	57508	broad.mit.edu	37	17	59988888	59988888	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr17:59988888C>G	ENST00000444766.3	-	7	1046	c.971G>C	c.(970-972)gGa>gCa	p.G324A	INTS2_ENST00000251334.6_Missense_Mutation_p.G316A	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	324					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)		p.G324A(2)		NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						CACCTGCTGTCCATTTCGGAT	0.388																																							uc002izn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)|pancreas(1)	3						c.(970-972)GGA>GCA		integrator complex subunit 2							77.0	71.0	73.0					17																	59988888		1841	4093	5934	SO:0001583	missense	57508				snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding	g.chr17:59988888C>G	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.971G>C	17.37:g.59988888C>G	ENSP00000414237:p.Gly324Ala					INTS2_uc002izm.2_Missense_Mutation_p.G316A	p.G324A	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN			7	1047	-			324					Q9ULD3	Missense_Mutation	SNP	ENST00000444766.3	37	c.971G>C	CCDS45750.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.974257	0.74246	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.49432	0.78	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.38054	0.1026	L	0.33245	0.995	0.80722	D	1	B	0.32573	0.376	B	0.29598	0.104	T	0.16188	-1.0411	9	.	.	.	-13.3873	18.304	0.90174	0.0:1.0:0.0:0.0	.	324	Q9H0H0	INT2_HUMAN	A	324;323	ENSP00000414237:G324A	.	G	-	2	0	INTS2	57343670	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.330000	0.79161	0.655000	0.94253	GGA		0.388	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748		26	30	0	0	0	0.004656	0	26	30				
DDX42	11325	broad.mit.edu	37	17	61869884	61869884	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr17:61869884G>A	ENST00000578681.1	+	4	935	c.334G>A	c.(334-336)Gat>Aat	p.D112N	DDX42_ENST00000389924.2_Missense_Mutation_p.D112N|DDX42_ENST00000583590.1_Missense_Mutation_p.D112N|DDX42_ENST00000359353.5_De_novo_Start_OutOfFrame|DDX42_ENST00000457800.2_Missense_Mutation_p.D112N	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	112					protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.D112N(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						TTCTGACAGCGATGATGATCC	0.398																																							uc002jbu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|large_intestine(1)	5						c.(334-336)GAT>AAT		DEAD box polypeptide 42 protein							114.0	105.0	108.0					17																	61869884		2203	4300	6503	SO:0001583	missense	11325				protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding	g.chr17:61869884G>A	BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.334G>A	17.37:g.61869884G>A	ENSP00000464050:p.Asp112Asn					DDX42_uc002jbv.2_Missense_Mutation_p.D112N|DDX42_uc002jbw.1_5'UTR	p.D112N	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN			4	591	+			112					A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	ENST00000578681.1	37	c.334G>A	CCDS32704.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.616543	0.66672	.	.	ENSG00000198231	ENST00000389924;ENST00000457800	T;T	0.23950	1.88;1.88	5.32	5.32	0.75619	.	0.655883	0.16012	N	0.233752	T	0.25975	0.0633	L	0.52905	1.665	0.80722	D	1	P	0.41710	0.76	B	0.31191	0.125	T	0.21484	-1.0244	10	0.87932	D	0	-21.0763	18.1634	0.89717	0.0:0.0:1.0:0.0	.	112	Q86XP3	DDX42_HUMAN	N	112	ENSP00000374574:D112N;ENSP00000390121:D112N	ENSP00000374574:D112N	D	+	1	0	DDX42	59223616	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.623000	0.98386	2.769000	0.95229	0.491000	0.48974	GAT		0.398	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372		15	101	0	0	0	0.012319	0	15	101				
ABCA8	10351	broad.mit.edu	37	17	66933233	66933233	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr17:66933233C>G	ENST00000269080.2	-	4	462	c.325G>C	c.(325-327)Gat>Cat	p.D109H	ABCA8_ENST00000586539.1_Missense_Mutation_p.D109H|ABCA8_ENST00000430352.2_Missense_Mutation_p.D109H	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	109					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.D109H(2)		breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					CTTTCCTCATCTGGCAGTCCC	0.338																																							uc002jhp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(325-327)GAT>CAT		ATP-binding cassette, sub-family A member 8							90.0	91.0	91.0					17																	66933233		2203	4300	6503	SO:0001583	missense	10351					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr17:66933233C>G	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.325G>C	17.37:g.66933233C>G	ENSP00000269080:p.Asp109His					ABCA8_uc002jhq.2_Missense_Mutation_p.D109H|ABCA8_uc010wqq.1_Missense_Mutation_p.D109H|ABCA8_uc010wqr.1_Missense_Mutation_p.D48H|ABCA8_uc002jhr.2_Missense_Mutation_p.D109H|ABCA8_uc002jhs.2_Missense_Mutation_p.D109H|ABCA8_uc002jht.2_Missense_Mutation_p.D109H	p.D109H	NM_007168	NP_009099	O94911	ABCA8_HUMAN			4	504	-	Breast(10;4.56e-13)		109					A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	c.325G>C	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.727538	0.30593	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225;ENST00000428549	D;D	0.89343	-2.5;-2.5	4.69	3.72	0.42706	.	0.119606	0.36854	N	0.002377	D	0.92522	0.7625	M	0.75615	2.305	0.27728	N	0.944902	D;D;D;D;D	0.71674	0.998;0.998;0.997;0.993;0.997	D;D;D;P;D	0.68943	0.955;0.961;0.961;0.885;0.93	D	0.86308	0.1684	10	0.72032	D	0.01	.	8.8453	0.35166	0.0:0.8973:0.0:0.1027	.	48;109;109;109;109	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	H	109;109;48;109	ENSP00000269080:D109H;ENSP00000402814:D109H	ENSP00000269080:D109H	D	-	1	0	ABCA8	64444828	0.008000	0.16893	0.846000	0.33378	0.013000	0.08279	0.310000	0.19356	1.325000	0.45301	0.650000	0.86243	GAT		0.338	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168		21	29	0	0	0	0.008871	0	21	29				
DNAI2	64446	broad.mit.edu	37	17	72295931	72295931	+	Missense_Mutation	SNP	T	T	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr17:72295931T>G	ENST00000311014.6	+	7	866	c.799T>G	c.(799-801)Tat>Gat	p.Y267D	DNAI2_ENST00000307504.5_Missense_Mutation_p.Y124D|DNAI2_ENST00000579490.1_Missense_Mutation_p.Y324D|DNAI2_ENST00000446837.2_Missense_Mutation_p.Y267D|DNAI2_ENST00000582036.1_Missense_Mutation_p.Y267D			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	267					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.Y267D(2)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AGACCCTGTGTATGGCACCAT	0.607									Kartagener syndrome																														uc002jkf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(799-801)TAT>GAT		dynein, axonemal, intermediate polypeptide 2							73.0	56.0	62.0					17																	72295931		2203	4300	6503	SO:0001583	missense	64446	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity	g.chr17:72295931T>G	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.799T>G	17.37:g.72295931T>G	ENSP00000308312:p.Tyr267Asp					DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA	p.Y267D	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN			7	898	+			267			WD 3.		C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	37	c.799T>G	CCDS11697.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.106459	0.77096	.	.	ENSG00000171595	ENST00000311014;ENST00000307504;ENST00000446837	T;T;T	0.70986	-0.53;-0.53;-0.53	5.03	5.03	0.67393	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.056393	0.64402	D	0.000001	D	0.84000	0.5376	M	0.84585	2.705	0.58432	D	0.999998	D	0.57899	0.981	D	0.65773	0.938	D	0.85144	0.0982	10	0.41790	T	0.15	-33.8505	14.4819	0.67590	0.0:0.0:0.0:1.0	.	267	Q9GZS0	DNAI2_HUMAN	D	267;124;267	ENSP00000308312:Y267D;ENSP00000302929:Y124D;ENSP00000400252:Y267D	ENSP00000302929:Y124D	Y	+	1	0	DNAI2	69807526	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	7.685000	0.84117	1.897000	0.54924	0.363000	0.22086	TAT		0.607	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036		38	50	0	0	0	0.006999	0	38	50				
SAP30BP	29115	broad.mit.edu	37	17	73689542	73689542	+	Missense_Mutation	SNP	G	G	C	rs150596591	byFrequency	TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr17:73689542G>C	ENST00000584667.1	+	4	544	c.287G>C	c.(286-288)cGa>cCa	p.R96P	SAP30BP_ENST00000579864.1_3'UTR|SAP30BP_ENST00000355423.3_Missense_Mutation_p.R80P	NM_013260.6	NP_037392.1			SAP30 binding protein									p.R96P(2)		kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)	17	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCAGAAAAGCGAGACCCCCAG	0.552																																							uc002jpe.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(286-288)CGA>CCA		transcriptional regulator protein							56.0	57.0	56.0					17																	73689542		2203	4300	6503	SO:0001583	missense	29115				apoptosis|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding	g.chr17:73689542G>C	AY082382	CCDS11726.1	17q25.1	2006-01-05				ENSG00000161526			30785	protein-coding gene	gene with protein product		610218				15496587	Standard	NM_013260		Approved	HCNGP, HTRG, HTRP	uc002jpe.3	Q9UHR5		ENST00000584667.1:c.287G>C	17.37:g.73689542G>C	ENSP00000462116:p.Arg96Pro					SAP30BP_uc002jpc.1_RNA|SAP30BP_uc010wsf.1_RNA|SAP30BP_uc010wsg.1_RNA|SAP30BP_uc002jpf.2_Missense_Mutation_p.R80P	p.R96P	NM_013260	NP_037392	Q9UHR5	S30BP_HUMAN	all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)		4	341	+	all_cancers(13;6.42e-08)		96						Missense_Mutation	SNP	ENST00000584667.1	37	c.287G>C	CCDS11726.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.332327	0.60853	.	.	ENSG00000161526	ENST00000355423;ENST00000542343;ENST00000293208	.	.	.	5.39	5.39	0.77823	.	0.113638	0.64402	D	0.000014	T	0.58509	0.2127	L	0.50333	1.59	0.54753	D	0.99998	B;B	0.24186	0.099;0.06	B;B	0.17979	0.02;0.009	T	0.55062	-0.8199	9	0.39692	T	0.17	0.0855	17.9556	0.89068	0.0:0.0:1.0:0.0	.	80;96	Q9UHR5-2;Q9UHR5	.;S30BP_HUMAN	P	96;96;80	.	ENSP00000293208:R80P	R	+	2	0	SAP30BP	71201137	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.171000	0.71926	2.537000	0.85549	0.655000	0.94253	CGA		0.552	SAP30BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448227.1	NM_013260		17	73	0	0	0	0.008871	0	17	73				
ST6GALNAC1	55808	broad.mit.edu	37	17	74622174	74622174	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr17:74622174G>A	ENST00000156626.7	-	7	1618	c.1419C>T	c.(1417-1419)caC>caT	p.H473H	ST6GALNAC1_ENST00000590878.1_5'Flank	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	473					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)	p.H473H(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						CCTGGGGTCTGTGCCTGTGGT	0.547																																							uc002jsh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1417-1419)CAC>CAT		sialyltransferase 7A							121.0	117.0	119.0					17																	74622174		2203	4300	6503	SO:0001819	synonymous_variant	55808				protein glycosylation	integral to Golgi membrane	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity	g.chr17:74622174G>A	Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.1419C>T	17.37:g.74622174G>A						ST6GALNAC1_uc002jsi.2_Silent_p.H341H|ST6GALNAC1_uc002jsj.2_RNA	p.H473H	NM_018414	NP_060884	Q9NSC7	SIA7A_HUMAN			7	1593	-			473			Lumenal (Potential).		Q6UW90|Q9NSC6	Silent	SNP	ENST00000156626.7	37	c.1419C>T	CCDS11748.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.026384	0.35701	.	.	ENSG00000070526	ENST00000359088	.	.	.	5.28	-0.816	0.10839	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-5.5983	4.3295	0.11057	0.0709:0.2773:0.1923:0.4596	.	.	.	.	X	439	.	ENSP00000351991:Q439X	Q	-	1	0	ST6GALNAC1	72133769	0.000000	0.05858	0.047000	0.18901	0.001000	0.01503	-0.292000	0.08332	0.028000	0.15324	-1.113000	0.02065	CAG		0.547	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450974.1	NM_018414		61	227	0	0	0	0.01441	0	61	227				
PCSK4	54760	broad.mit.edu	37	19	1483662	1483662	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:1483662G>A	ENST00000300954.5	-	11	1439	c.1378C>T	c.(1378-1380)Cag>Tag	p.Q460*	CTB-25B13.6_ENST00000585643.1_RNA	NM_017573.3	NP_060043.2			proprotein convertase subtilisin/kexin type 4									p.Q460*(1)		cervix(2)|endometrium(2)|kidney(1)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCGGCTCTGGACCCGGACG	0.697																																							uc002ltb.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1378-1380)CAG>TAG		proprotein convertase subtilisin/kexin type 4							7.0	8.0	8.0					19																	1483662		2049	4064	6113	SO:0001587	stop_gained	54760				proteolysis	integral to membrane	serine-type endopeptidase activity	g.chr19:1483662G>A	AK057235	CCDS12069.2	19p13.3	2008-02-05			ENSG00000115257	ENSG00000115257			8746	protein-coding gene	gene with protein product		600487				7782070	Standard	XM_005259586		Approved	PC4, SPC5, DKFZp434B217, MGC34749	uc002ltb.1	Q6UW60	OTTHUMG00000128541	ENST00000300954.5:c.1378C>T	19.37:g.1483662G>A	ENSP00000300954:p.Gln460*					PCSK4_uc002lsz.2_5'UTR|PCSK4_uc002lta.2_Nonsense_Mutation_p.Q272*	p.Q460*	NM_017573	NP_060043	Q6UW60	PCSK4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	11	1440	-		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)	460						Nonsense_Mutation	SNP	ENST00000300954.5	37	c.1378C>T	CCDS12069.2	.	.	.	.	.	.	.	.	.	.	-	38	7.165032	0.98107	.	.	ENSG00000115257	ENST00000300954;ENST00000441747	.	.	.	2.9	-1.33	0.09172	.	0.764517	0.10827	U	0.629824	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	8.1474	0.31119	0.0:0.3839:0.5088:0.1073	.	.	.	.	X	460;272	.	ENSP00000300954:Q460X	Q	-	1	0	PCSK4	1434662	0.000000	0.05858	0.000000	0.03702	0.257000	0.26127	-0.445000	0.06845	-0.068000	0.12953	0.274000	0.19336	CAG		0.697	PCSK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449703.1	NM_017573		9	7	0	0	0	0.004007	0	9	7				
KEAP1	9817	broad.mit.edu	37	19	10600446	10600446	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:10600446C>T	ENST00000171111.5	-	4	1956	c.1409G>A	c.(1408-1410)cGt>cAt	p.R470H	KEAP1_ENST00000393623.2_Missense_Mutation_p.R470H|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	470					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	ATAAAGGAGACGATTGAGGAC	0.562																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(1408-1410)CGT>CAT		kelch-like ECH-associated protein 1							75.0	62.0	66.0					19																	10600446		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10600446C>T	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1409G>A	19.37:g.10600446C>T	ENSP00000171111:p.Arg470His					KEAP1_uc002mop.1_Missense_Mutation_p.R188H|KEAP1_uc002mor.1_Missense_Mutation_p.R470H	p.R470H	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		4	1565	-			470			Kelch 3.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.1409G>A	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	17.98	3.520859	0.64747	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.77229	-1.08;-1.08	5.79	5.79	0.91817	Kelch-type beta propeller (1);	0.055235	0.64402	D	0.000001	D	0.85212	0.5645	L	0.49699	1.58	0.80722	D	1	D	0.89917	1.0	D	0.69824	0.966	D	0.85636	0.1273	10	0.66056	D	0.02	.	17.5827	0.87973	0.0:1.0:0.0:0.0	.	470	Q14145	KEAP1_HUMAN	H	470	ENSP00000171111:R470H;ENSP00000377245:R470H	ENSP00000171111:R470H	R	-	2	0	KEAP1	10461446	1.000000	0.71417	0.985000	0.45067	0.137000	0.21094	5.775000	0.68915	2.752000	0.94435	0.558000	0.71614	CGT		0.562	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		25	21	0	0	0	0.00278	0	25	21				
RTBDN	83546	broad.mit.edu	37	19	12939476	12939476	+	Silent	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:12939476C>T	ENST00000458671.2	-	4	512	c.360G>A	c.(358-360)caG>caA	p.Q120Q	RTBDN_ENST00000589272.1_Silent_p.Q152Q|CTD-2265O21.3_ENST00000588469.1_RNA|RTBDN_ENST00000393233.2_Missense_Mutation_p.R79K|RTBDN_ENST00000322912.5_Silent_p.Q152Q|RTBDN_ENST00000592204.1_Silent_p.Q130Q	NM_001080997.2	NP_001074466.1	Q9BSG5	RTBDN_HUMAN	retbindin	120						extracellular region (GO:0005576)		p.Q152Q(1)		kidney(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12						CCTACCAGGCCTGGCAGAGCT	0.647																																							uc002mvi.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(358-360)CAG>CAA		retbindin isoform 1							32.0	34.0	34.0					19																	12939476		2202	4298	6500	SO:0001819	synonymous_variant	83546					extracellular region		g.chr19:12939476C>T	AY028917	CCDS12283.1, CCDS45994.1, CCDS59355.1, CCDS59356.1	19p13	2006-03-22				ENSG00000132026			30310	protein-coding gene	gene with protein product		609553				12107411	Standard	NM_001080997		Approved	FLJ36353	uc002mvj.4	Q9BSG5		ENST00000458671.2:c.360G>A	19.37:g.12939476C>T						RTBDN_uc002mvh.1_Silent_p.Q152Q|RTBDN_uc002mvj.2_Silent_p.Q152Q	p.Q120Q	NM_001080997	NP_001074466	Q9BSG5	RTBDN_HUMAN			4	490	-			120					F1T0I8|Q9BWT5	Silent	SNP	ENST00000458671.2	37	c.360G>A	CCDS45994.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308342	0.60305	.	.	ENSG00000132026	ENST00000393233	T	0.38077	1.16	4.32	0.613	0.17597	.	.	.	.	.	T	0.23688	0.0573	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	T	0.27400	-1.0075	6	0.23302	T	0.38	-19.1654	5.983	0.19417	0.2412:0.4498:0.3091:0.0	.	.	.	.	K	79	ENSP00000376925:R79K	ENSP00000376925:R79K	R	-	2	0	RTBDN	12800476	0.003000	0.15002	0.920000	0.36463	0.950000	0.60333	-0.284000	0.08422	0.459000	0.27016	0.655000	0.94253	AGG		0.647	RTBDN-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451513.1	NM_031429		20	55	0	0	0	0.003954	0	20	55				
SLC27A1	376497	broad.mit.edu	37	19	17612097	17612097	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:17612097C>A	ENST00000252595.7	+	11	1749	c.1652C>A	c.(1651-1653)gCa>gAa	p.A551E	SLC27A1_ENST00000442725.1_Missense_Mutation_p.A551E|CTD-3131K8.2_ENST00000596643.1_lincRNA|SLC27A1_ENST00000598424.1_Missense_Mutation_p.A372E|SLC27A1_ENST00000598848.1_Intron	NM_198580.1	NP_940982.1	Q6PCB7	S27A1_HUMAN	solute carrier family 27 (fatty acid transporter), member 1	551					adiponectin-activated signaling pathway (GO:0033211)|cardiolipin biosynthetic process (GO:0032049)|cellular lipid metabolic process (GO:0044255)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|negative regulation of phospholipid biosynthetic process (GO:0071072)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phosphatidylglycerol biosynthetic process (GO:0006655)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylserine biosynthetic process (GO:0006659)|positive regulation of heat generation (GO:0031652)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to cold (GO:0009409)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.A551E(4)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						GAGGGTAAGGCAGGGATGGCG	0.642																																							uc002ngu.1		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(1651-1653)GCA>GAA		solute carrier family 27, member 1							41.0	43.0	42.0					19																	17612097		2203	4300	6503	SO:0001583	missense	376497				cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding	g.chr19:17612097C>A	BC059399	CCDS32953.1	19p13.11	2013-07-15			ENSG00000130304	ENSG00000130304		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10995	protein-coding gene	gene with protein product		600691				10873384	Standard	NM_198580		Approved	FATP1, FATP, MGC71751, FLJ00336, ACSVL5	uc002ngu.1	Q6PCB7	OTTHUMG00000182878	ENST00000252595.7:c.1652C>A	19.37:g.17612097C>A	ENSP00000252595:p.Ala551Glu					SLC27A1_uc010xpp.1_Missense_Mutation_p.A372E|SLC27A1_uc002ngv.1_Missense_Mutation_p.A153E	p.A551E	NM_198580	NP_940982	Q6PCB7	S27A1_HUMAN			11	1702	+			551			Cytoplasmic (Potential).		A6NIH2|B7Z662	Missense_Mutation	SNP	ENST00000252595.7	37	c.1652C>A	CCDS32953.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380039	0.61845	.	.	ENSG00000130304	ENST00000442725;ENST00000252595	T;T	0.50277	0.75;0.75	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.75715	0.3887	H	0.97131	3.945	0.80722	D	1	D;D	0.64830	0.988;0.994	P;P	0.58873	0.847;0.847	D	0.85180	0.1003	10	0.87932	D	0	-18.5523	15.0241	0.71653	0.0:1.0:0.0:0.0	.	372;551	B7Z662;Q6PCB7	.;S27A1_HUMAN	E	551	ENSP00000413424:A551E;ENSP00000252595:A551E	ENSP00000252595:A551E	A	+	2	0	SLC27A1	17473097	1.000000	0.71417	0.729000	0.30791	0.289000	0.27227	7.381000	0.79718	2.129000	0.65627	0.561000	0.74099	GCA		0.642	SLC27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464145.1	NM_198580		40	18	1	0	2.47872e-24	0.010771	3.02506e-24	40	18				
ZNF208	7757	broad.mit.edu	37	19	22154332	22154332	+	Silent	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:22154332G>T	ENST00000397126.4	-	4	3652	c.3504C>A	c.(3502-3504)ccC>ccA	p.P1168P	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1168					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.P1040P(4)|p.P1168P(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CACATTTGTAGGGTTTCTCTA	0.363																																							uc002nqp.2		NA																	6	Substitution - coding silent(6)		lung(6)	ovary(5)|skin(2)	7						c.(3118-3120)CCC>CCA		zinc finger protein 208							31.0	33.0	32.0					19																	22154332		2077	4204	6281	SO:0001819	synonymous_variant	7757							g.chr19:22154332G>T	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3504C>A	19.37:g.22154332G>T						ZNF208_uc002nqo.1_Intron	p.P1040P	NM_007153	NP_009084					6	3269	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Silent	SNP	ENST00000397126.4	37	c.3120C>A	CCDS54240.1																																																																																				0.363	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		20	16	1	0	3.51602e-12	0.008871	3.85088e-12	20	16				
ZNF566	84924	broad.mit.edu	37	19	36967453	36967453	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:36967453G>A	ENST00000434377.2	-	2	88	c.7C>T	c.(7-9)Cag>Tag	p.Q3*	ZNF566_ENST00000424129.2_Nonsense_Mutation_p.Q3*|ZNF566_ENST00000493391.1_5'UTR|ZNF566_ENST00000392170.2_Nonsense_Mutation_p.Q3*|ZNF566_ENST00000472909.2_5'UTR|ZNF566_ENST00000454319.1_Nonsense_Mutation_p.Q3*	NM_032838.4	NP_116227.1	Q969W8	ZN566_HUMAN	zinc finger protein 566	3					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q3*(2)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24	Esophageal squamous(110;0.162)					TATCTCACCTGAGCCATGGCT	0.398																																							uc002oea.3		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(7-9)CAG>TAG		zinc finger protein 566 isoform 1							116.0	96.0	103.0					19																	36967453		2203	4300	6503	SO:0001587	stop_gained	84924				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:36967453G>A	AK074497	CCDS12494.1, CCDS46061.1, CCDS74346.1	19q13.12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25919	protein-coding gene	gene with protein product						12477932	Standard	NM_001145343		Approved	FLJ14779, MGC12515	uc010xtf.2	Q969W8		ENST00000434377.2:c.7C>T	19.37:g.36967453G>A	ENSP00000415520:p.Gln3*					ZNF566_uc010xte.1_Nonsense_Mutation_p.Q3*|ZNF566_uc010xtf.1_Nonsense_Mutation_p.Q3*|ZNF566_uc002oeb.3_Nonsense_Mutation_p.Q3*|ZNF566_uc002oec.3_5'UTR|ZNF566_uc010xtg.1_5'UTR	p.Q3*	NM_032838	NP_116227	Q969W8	ZN566_HUMAN			2	89	-	Esophageal squamous(110;0.162)		3					B7ZL95|Q2M3J1	Nonsense_Mutation	SNP	ENST00000434377.2	37	c.7C>T	CCDS12494.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985212	0.74474	.	.	ENSG00000186017	ENST00000454319;ENST00000434377;ENST00000392170;ENST00000424129;ENST00000452939;ENST00000427002	.	.	.	3.42	2.34	0.29019	.	0.237937	0.21986	N	0.066227	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	7.9832	0.30196	0.0:0.0:0.7568:0.2432	.	.	.	.	X	3	.	ENSP00000376010:Q3X	Q	-	1	0	ZNF566	41659293	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.607000	0.36836	0.983000	0.38602	0.650000	0.86243	CAG		0.398	ZNF566-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000341054.1	NM_032838		13	66	0	0	0	0.001855	0	13	66				
IFNL3	282617	broad.mit.edu	37	19	39734751	39734751	+	Missense_Mutation	SNP	A	A	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:39734751A>G	ENST00000413851.2	-	3	343	c.305T>C	c.(304-306)cTg>cCg	p.L102P		NM_172139.2	NP_742151.2	Q8IZI9	IFNL3_HUMAN	interferon, lambda 3	102					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of viral genome replication (GO:0045071)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)		p.L102P(1)									CAGAACCTTCAGCGTCAGGGC	0.652																																							uc010xut.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(304-306)CTG>CCG		interleukin 28B							45.0	50.0	48.0					19																	39734751		2203	4300	6503	SO:0001583	missense	282617				response to virus	extracellular space	cytokine activity	g.chr19:39734751A>G	AY129149	CCDS12530.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000197110	ENSG00000197110		"""Interferons"""	18365	protein-coding gene	gene with protein product		607402	"""interleukin 28B"", ""interleukin 28B (interferon, lambda 3)"""	IL28B			Standard	NM_172139		Approved	IL-28B, IL28C	uc010xut.2	Q8IZI9	OTTHUMG00000182805	ENST00000413851.2:c.305T>C	19.37:g.39734751A>G	ENSP00000409000:p.Leu102Pro					IL28B_uc010xuu.1_Missense_Mutation_p.L102P	p.L102P	NM_172139	NP_742151	Q8IZI9	IL28B_HUMAN	Epithelial(26;1.55e-27)|all cancers(26;1.41e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)		3	309	-	all_cancers(60;2.81e-07)|all_lung(34;7.81e-08)|Lung NSC(34;9.29e-08)|all_epithelial(25;3.9e-07)|Ovarian(47;0.0315)		102					A2BDE1|Q6VN56|Q7Z4J3|Q8IWL6	Missense_Mutation	SNP	ENST00000413851.2	37	c.305T>C	CCDS12530.1	.	.	.	.	.	.	.	.	.	.	A	10.98	1.504170	0.26949	.	.	ENSG00000197110	ENST00000413851	T	0.46451	0.87	3.21	2.13	0.27403	.	0.481200	0.17914	N	0.157725	T	0.61986	0.2391	M	0.86178	2.8	0.26146	N	0.98021	D	0.89917	1.0	D	0.91635	0.999	T	0.52094	-0.8621	10	0.87932	D	0	-7.6449	5.4915	0.16779	0.7525:0.0:0.0:0.2475	.	102	Q8IZI9	IL28B_HUMAN	P	102	ENSP00000409000:L102P	ENSP00000409000:L102P	L	-	2	0	IL28B	44426591	0.120000	0.22244	0.013000	0.15412	0.544000	0.35116	1.842000	0.39250	0.398000	0.25338	0.172000	0.16884	CTG		0.652	IFNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463832.1	NM_172139		29	79	0	0	0	0.012213	0	29	79				
SHKBP1	92799	broad.mit.edu	37	19	41086690	41086690	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:41086690G>T	ENST00000291842.5	+	9	741	c.692G>T	c.(691-693)aGc>aTc	p.S231I	SHKBP1_ENST00000600733.1_Missense_Mutation_p.S231I	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	231					protein homooligomerization (GO:0051260)			p.S231I(1)		breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GTGTTTTCCAGCCCCCGCCTG	0.632																																							uc002oob.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(691-693)AGC>ATC		SH3KBP1 binding protein 1							86.0	90.0	88.0					19																	41086690		2203	4300	6503	SO:0001583	missense	92799					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr19:41086690G>T	AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.692G>T	19.37:g.41086690G>T	ENSP00000291842:p.Ser231Ile					SHKBP1_uc002ooc.2_Missense_Mutation_p.S231I|SHKBP1_uc002ood.2_Missense_Mutation_p.S231I|SHKBP1_uc010xvl.1_Missense_Mutation_p.S154I|SHKBP1_uc002ooe.2_Missense_Mutation_p.S68I|SHKBP1_uc002oof.2_Missense_Mutation_p.S68I|SHKBP1_uc010xvm.1_Missense_Mutation_p.S68I|SHKBP1_uc010xvn.1_Missense_Mutation_p.S109I	p.S231I	NM_138392	NP_612401	Q8TBC3	SHKB1_HUMAN	Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)		9	741	+			231					Q8N2I6|Q8WY93|Q96IB8	Missense_Mutation	SNP	ENST00000291842.5	37	c.692G>T	CCDS12560.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161542	0.78226	.	.	ENSG00000160410	ENST00000291842;ENST00000446701	T	0.05258	3.47	4.58	4.58	0.56647	WD40 repeat-like-containing domain (1);	0.107942	0.64402	D	0.000015	T	0.28366	0.0701	M	0.82823	2.61	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.997;0.997;1.0;0.999;0.995	D;D;D;D;D;D;D	0.85130	0.994;0.992;0.994;0.994;0.997;0.994;0.986	T	0.06006	-1.0851	10	0.87932	D	0	-7.8236	16.2926	0.82758	0.0:0.0:1.0:0.0	.	109;68;154;68;231;231;231	B4DLI0;B4DUW2;B4DUV2;B3KVX8;Q8TBC3-2;B2R6W9;Q8TBC3	.;.;.;.;.;.;SHKB1_HUMAN	I	231;68	ENSP00000291842:S231I	ENSP00000291842:S231I	S	+	2	0	SHKBP1	45778530	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	6.718000	0.74713	2.385000	0.81259	0.455000	0.32223	AGC		0.632	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	NM_138392		73	143	1	0	2.43199e-30	0.01441	3.02985e-30	73	143				
ZNF283	284349	broad.mit.edu	37	19	44351558	44351558	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:44351558G>C	ENST00000324461.7	+	7	1102	c.805G>C	c.(805-807)Ggg>Cgg	p.G269R	ZNF283_ENST00000588797.1_Missense_Mutation_p.G130R	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	269					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G269R(1)		endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				TAAGGAATGTGGGAAGACCTT	0.403																																							uc002oxr.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(805-807)GGG>CGG		zinc finger protein 283							60.0	68.0	66.0					19																	44351558		2201	4298	6499	SO:0001583	missense	284349				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44351558G>C	AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		ENST00000324461.7:c.805G>C	19.37:g.44351558G>C	ENSP00000327314:p.Gly269Arg					ZNF283_uc002oxp.3_Missense_Mutation_p.G130R	p.G269R	NM_181845	NP_862828	Q8N7M2	ZN283_HUMAN			7	1073	+		Prostate(69;0.0352)	269			C2H2-type 3.		B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Missense_Mutation	SNP	ENST00000324461.7	37	c.805G>C	CCDS46097.1	.	.	.	.	.	.	.	.	.	.	g	17.49	3.403808	0.62288	.	.	ENSG00000167637	ENST00000324461	T	0.01484	4.84	3.37	3.37	0.38596	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11665	0.0284	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01844	-1.1262	9	0.66056	D	0.02	.	14.0297	0.64609	0.0:0.0:1.0:0.0	.	269	Q8N7M2	ZN283_HUMAN	R	269	ENSP00000327314:G269R	ENSP00000327314:G269R	G	+	1	0	ZNF283	49043398	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.783000	0.55409	1.895000	0.54865	0.563000	0.77884	GGG		0.403	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459909.1	NM_181845		8	65	0	0	0	0.00308	0	8	65				
FBXO46	23403	broad.mit.edu	37	19	46216187	46216187	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:46216187G>C	ENST00000317683.3	-	2	700	c.567C>G	c.(565-567)agC>agG	p.S189R		NM_001080469.1	NP_001073938.1	Q6PJ61	FBX46_HUMAN	F-box protein 46	189								p.S189R(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	15		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)		GTCGTGGGTAGCTCTGCAGGG	0.697																																							uc002pcy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(565-567)AGC>AGG		F-box protein 46							11.0	15.0	13.0					19																	46216187		2006	4149	6155	SO:0001583	missense	23403						protein binding	g.chr19:46216187G>C	BC021978	CCDS46116.1	19q13.3	2008-02-05	2004-06-15	2004-06-16		ENSG00000177051		"""F-boxes /  ""other"""""	25069	protein-coding gene	gene with protein product		609117	"""F-box only protein 34-like"""	FBXO34L		9585442	Standard	NM_001080469		Approved	20D7-FC4, Fbx46	uc002pcz.3	Q6PJ61		ENST00000317683.3:c.567C>G	19.37:g.46216187G>C	ENSP00000410007:p.Ser189Arg					FBXO46_uc002pcz.2_Missense_Mutation_p.S189R	p.S189R	NM_001080469	NP_001073938	Q6PJ61	FBX46_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)	2	692	-		Ovarian(192;0.179)|all_neural(266;0.224)	189						Missense_Mutation	SNP	ENST00000317683.3	37	c.567C>G	CCDS46116.1	.	.	.	.	.	.	.	.	.	.	G	6.687	0.495442	0.12762	.	.	ENSG00000177051	ENST00000317683	.	.	.	4.25	2.05	0.26809	.	.	.	.	.	T	0.25680	0.0625	L	0.27053	0.805	0.21325	N	0.999723	B	0.16603	0.018	B	0.16289	0.015	T	0.23904	-1.0175	8	0.54805	T	0.06	-6.7994	2.271	0.04091	0.1116:0.1955:0.4921:0.2009	.	189	Q6PJ61	FBX46_HUMAN	R	189	.	ENSP00000410007:S189R	S	-	3	2	FBXO46	50908027	1.000000	0.71417	0.456000	0.27044	0.287000	0.27160	3.321000	0.51999	0.395000	0.25257	0.563000	0.77884	AGC		0.697	FBXO46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459661.1	XM_371179		5	16	0	0	0	0.000602	0	5	16				
RSPH6A	81492	broad.mit.edu	37	19	46305469	46305469	+	Silent	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:46305469C>A	ENST00000221538.3	-	4	1849	c.1707G>T	c.(1705-1707)ctG>ctT	p.L569L	RSPH6A_ENST00000600188.1_Silent_p.L305L|RSPH6A_ENST00000597055.1_Silent_p.L569L	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	569	Glu-rich.					intracellular (GO:0005622)		p.L569L(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						cctcctcccccaggtcctcct	0.627																																							uc002pdm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1705-1707)CTG>CTT		radial spokehead-like 1							100.0	66.0	77.0					19																	46305469		2203	4299	6502	SO:0001819	synonymous_variant	81492					intracellular		g.chr19:46305469C>A	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1707G>T	19.37:g.46305469C>A						RSPH6A_uc002pdl.2_Silent_p.L305L	p.L569L	NM_030785	NP_110412	Q9H0K4	RSH6A_HUMAN			4	1850	-			569			Glu-rich.		Q53FE2|Q6PEZ9	Silent	SNP	ENST00000221538.3	37	c.1707G>T	CCDS12675.1																																																																																				0.627	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1			13	10	1	0	2.68362e-12	0.013537	2.95001e-12	13	10				
SLC6A16	28968	broad.mit.edu	37	19	49812634	49812634	+	Missense_Mutation	SNP	A	A	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:49812634A>C	ENST00000335875.4	-	6	1152	c.911T>G	c.(910-912)aTc>aGc	p.I304S	MIR4324_ENST00000584846.1_RNA|SLC6A16_ENST00000454748.3_Missense_Mutation_p.I304S	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	304					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)	p.I304S(2)		NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		ACCGACAATGATGAAACAGGG	0.493																																							uc002pmz.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)|kidney(1)	4						c.(910-912)ATC>AGC		solute carrier family 6, member 16							74.0	74.0	74.0					19																	49812634		1938	4133	6071	SO:0001583	missense	28968					integral to membrane|intracellular	neurotransmitter:sodium symporter activity	g.chr19:49812634A>C	AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.911T>G	19.37:g.49812634A>C	ENSP00000338627:p.Ile304Ser					SLC6A16_uc002pna.2_Missense_Mutation_p.I304S|hsa-mir-4324|MI0015854_5'Flank	p.I304S	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)	6	1145	-		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)	304			Helical; Name=5; (Potential).		Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	ENST00000335875.4	37	c.911T>G	CCDS42590.1	.	.	.	.	.	.	.	.	.	.	A	18.88	3.717030	0.68844	.	.	ENSG00000063127	ENST00000335875;ENST00000454748	T;T	0.76316	-1.01;-1.01	4.37	4.37	0.52481	.	0.063056	0.64402	D	0.000006	D	0.86243	0.5886	M	0.79805	2.47	0.36813	D	0.885977	D;D	0.69078	0.997;0.994	D;D	0.63793	0.918;0.912	D	0.90124	0.4201	10	0.87932	D	0	.	12.1828	0.54221	1.0:0.0:0.0:0.0	.	304;304	Q8IYV4;Q9GZN6	.;S6A16_HUMAN	S	304	ENSP00000338627:I304S;ENSP00000404022:I304S	ENSP00000338627:I304S	I	-	2	0	SLC6A16	54504446	1.000000	0.71417	0.471000	0.27229	0.004000	0.04260	5.142000	0.64820	2.197000	0.70478	0.459000	0.35465	ATC		0.493	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465503.2	NM_014037		11	81	0	0	0	0.00245	0	11	81				
KLK14	43847	broad.mit.edu	37	19	51581323	51581323	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:51581323C>T	ENST00000156499.2	-	7	963	c.745G>A	c.(745-747)Gtc>Atc	p.V249I	KLK14_ENST00000391802.1_Missense_Mutation_p.V249I			Q9P0G3	KLK14_HUMAN	kallikrein-related peptidase 14	249	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis morphogenesis (GO:0048730)|fertilization (GO:0009566)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|proteolysis (GO:0006508)|seminal clot liquefaction (GO:0070684)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)	p.V233I(2)|p.V249I(2)		kidney(4)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	11		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00422)		TTGGTGTAGACACCGGGGTAG	0.622																																					GBM(117;2161 2172 2448 22911)	GBM(117;2161 2172 2448 22911)	uc002pvs.1		NA																	4	Substitution - Missense(4)		lung(4)	skin(1)	1						c.(745-747)GTC>ATC		kallikrein 14 preproprotein							76.0	82.0	80.0					19																	51581323		2108	4229	6337	SO:0001583	missense	43847				epidermis morphogenesis|fertilization|negative regulation of G-protein coupled receptor protein signaling pathway|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis|seminal clot liquefaction	extracellular space	serine-type endopeptidase activity	g.chr19:51581323C>T	AF283670	CCDS12823.2	19q13.3-q13.4	2008-02-05	2006-10-27		ENSG00000129437	ENSG00000129437		"""Kallikreins"""	6362	protein-coding gene	gene with protein product		606135	"""kallikrein 14"""			16800724, 16800723	Standard	XM_006723224		Approved	KLK-L6	uc002pvs.1	Q9P0G3	OTTHUMG00000143721	ENST00000156499.2:c.745G>A	19.37:g.51581323C>T	ENSP00000156499:p.Val249Ile						p.V249I	NM_022046	NP_071329	Q9P0G3	KLK14_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00422)	7	964	-		all_neural(266;0.0199)	249			Peptidase S1.		A7UNK5|Q1RMZ2|Q6B089	Missense_Mutation	SNP	ENST00000156499.2	37	c.745G>A	CCDS12823.2	.	.	.	.	.	.	.	.	.	.	c	25.1	4.603448	0.87157	.	.	ENSG00000129437	ENST00000156499;ENST00000391802	D;D	0.90732	-2.72;-2.72	4.64	4.64	0.57946	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.93458	0.7913	L	0.51422	1.61	0.36987	D	0.894581	D	0.76494	0.999	D	0.85130	0.997	D	0.95314	0.8414	9	0.62326	D	0.03	.	15.0173	0.71597	0.0:1.0:0.0:0.0	.	249	Q9P0G3	KLK14_HUMAN	I	249	ENSP00000156499:V249I;ENSP00000375678:V249I	ENSP00000156499:V249I	V	-	1	0	KLK14	56273135	1.000000	0.71417	0.910000	0.35882	0.612000	0.37316	4.393000	0.59665	2.134000	0.65973	0.651000	0.88453	GTC		0.622	KLK14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289774.2	NM_022046		21	156	0	0	0	0.00333	0	21	156				
ZNF611	81856	broad.mit.edu	37	19	53208732	53208732	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:53208732C>G	ENST00000319783.1	-	7	1892	c.1576G>C	c.(1576-1578)Gag>Cag	p.E526Q	ZNF611_ENST00000602162.1_Missense_Mutation_p.E457Q|ZNF611_ENST00000453741.2_Missense_Mutation_p.E457Q|ZNF611_ENST00000602046.1_5'Flank|ZNF611_ENST00000543227.1_Missense_Mutation_p.E526Q|ZNF611_ENST00000595798.1_Missense_Mutation_p.E457Q|ZNF611_ENST00000540744.1_Missense_Mutation_p.E526Q	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	526					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E526Q(2)		breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		TTATGTGTCTCAAGGCTTGAT	0.358																																							uc002pzz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1576-1578)GAG>CAG		zinc finger protein 611 isoform a							139.0	137.0	138.0					19																	53208732		2203	4300	6503	SO:0001583	missense	81856				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53208732C>G	AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.1576G>C	19.37:g.53208732C>G	ENSP00000322427:p.Glu526Gln					ZNF611_uc010eqc.2_Missense_Mutation_p.E456Q|ZNF611_uc010ydo.1_Missense_Mutation_p.E456Q|ZNF611_uc010ydr.1_Missense_Mutation_p.E457Q|ZNF611_uc010ydp.1_Missense_Mutation_p.E526Q|ZNF611_uc010ydq.1_Missense_Mutation_p.E526Q|ZNF611_uc002qaa.3_Missense_Mutation_p.E456Q	p.E526Q	NM_030972	NP_112234	Q8N823	ZN611_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)	7	1893	-			526			C2H2-type 11.		B3KRD5|Q69YG9	Missense_Mutation	SNP	ENST00000319783.1	37	c.1576G>C	CCDS12855.1	.	.	.	.	.	.	.	.	.	.	.	11.03	1.518851	0.27211	.	.	ENSG00000213020	ENST00000543227;ENST00000540744;ENST00000453741;ENST00000319783	T;T;T;T	0.35973	1.28;1.28;1.28;1.28	1.58	-3.16	0.05217	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19846	0.0477	N	0.12502	0.225	0.09310	N	1	P	0.41188	0.741	P	0.44597	0.454	T	0.13019	-1.0525	9	0.41790	T	0.15	.	3.731	0.08493	0.0:0.3975:0.1961:0.4064	.	526	Q8N823	ZN611_HUMAN	Q	526;526;457;526	ENSP00000437616:E526Q;ENSP00000439211:E526Q;ENSP00000443505:E457Q;ENSP00000322427:E526Q	ENSP00000322427:E526Q	E	-	1	0	ZNF611	57900544	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-2.806000	0.00758	-0.999000	0.03442	0.313000	0.20887	GAG		0.358	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337612.1	NM_030972		109	196	0	0	0	0.01441	0	109	196				
ZNF160	90338	broad.mit.edu	37	19	53589517	53589517	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:53589517G>T	ENST00000429604.1	-	4	428	c.13C>A	c.(13-15)Cag>Aag	p.Q5K	ZNF160_ENST00000418871.1_Missense_Mutation_p.Q5K|ZNF160_ENST00000599729.1_5'Flank|ZNF160_ENST00000355147.5_Missense_Mutation_p.Q5K|ZNF160_ENST00000599056.1_Missense_Mutation_p.Q5K	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	5					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q5K(2)|p.Q5E(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		CACTTTACCTGAGTAAGGGCC	0.428																																							uc010eqk.2		NA																	3	Substitution - Missense(3)		lung(2)|cervix(1)	central_nervous_system(1)	1						c.(13-15)CAG>AAG		zinc finger protein 160							159.0	129.0	139.0					19																	53589517		2203	4300	6503	SO:0001583	missense	90338				hemopoiesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53589517G>T	X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.13C>A	19.37:g.53589517G>T	ENSP00000406201:p.Gln5Lys					ZNF160_uc002qaq.3_Missense_Mutation_p.Q5K|ZNF160_uc002qar.3_Missense_Mutation_p.Q5K|ZNF160_uc002qas.3_Missense_Mutation_p.Q5K	p.Q5K	NM_001102603	NP_001096073	Q9HCG1	ZN160_HUMAN		GBM - Glioblastoma multiforme(134;0.02)	4	429	-			5					Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	ENST00000429604.1	37	c.13C>A	CCDS12859.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.763286	0.31228	.	.	ENSG00000170949	ENST00000429604;ENST00000418871;ENST00000355147	T;T;T	0.00922	5.54;5.54;5.54	2.32	2.32	0.28847	Krueppel-associated box (1);	.	.	.	.	T	0.01627	0.0052	M	0.67517	2.055	0.09310	N	0.999996	P;B	0.37824	0.609;0.118	B;B	0.43386	0.418;0.037	T	0.33445	-0.9868	9	0.09084	T	0.74	.	8.2325	0.31605	0.0:0.0:1.0:0.0	.	5;5	Q9BVY9;Q9HCG1	.;ZN160_HUMAN	K	5	ENSP00000406201:Q5K;ENSP00000409597:Q5K;ENSP00000347273:Q5K	ENSP00000347273:Q5K	Q	-	1	0	ZNF160	58281329	0.466000	0.25823	0.546000	0.28166	0.034000	0.12701	0.777000	0.26718	1.616000	0.50265	0.655000	0.94253	CAG		0.428	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463994.2	NM_033288		38	84	1	0	2.87052e-16	0.005524	3.3011e-16	38	84				
VSTM1	284415	broad.mit.edu	37	19	54545619	54545619	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr19:54545619G>A	ENST00000338372.2	-	5	574	c.399C>T	c.(397-399)acC>acT	p.T133T	VSTM1_ENST00000366170.2_Silent_p.T45T|VSTM1_ENST00000425006.2_3'UTR|VSTM1_ENST00000376626.1_Intron	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	133					immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.T133T(2)		breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		AGATGGTTCTGGTGTCTGGAG	0.537																																							uc002qcw.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(397-399)ACC>ACT		V-set and transmembrane domain containing 1							79.0	62.0	68.0					19																	54545619		2203	4300	6503	SO:0001819	synonymous_variant	284415					integral to membrane		g.chr19:54545619G>A	AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.399C>T	19.37:g.54545619G>A						VSTM1_uc010erb.2_RNA|VSTM1_uc002qcx.3_Intron	p.T133T	NM_198481	NP_940883	Q6UX27	VSTM1_HUMAN		GBM - Glioblastoma multiforme(134;0.165)	5	575	-	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)		133					B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Silent	SNP	ENST00000338372.2	37	c.399C>T	CCDS12872.1																																																																																				0.537	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139358.3	NM_198481		16	47	0	0	0	0.00499	0	16	47				
MSH2	4436	broad.mit.edu	37	2	47709956	47709956	+	Silent	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:47709956G>C	ENST00000233146.2	+	16	2896	c.2673G>C	c.(2671-2673)gtG>gtC	p.V891V	MSH2_ENST00000406134.1_Intron|MSH2_ENST00000461394.1_Intron|MSH2_ENST00000543555.1_Silent_p.V825V	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	891					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.V891V(2)|p.0?(2)|p.?(2)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TGTCCAAGGTGAAACAAATGC	0.313			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc002rvy.1		NA	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	D|Mis|N|F|S	mutS homolog 2 (E. coli)			E		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		6	Whole gene deletion(2)|Substitution - coding silent(2)|Unknown(2)	p.?(2)	haematopoietic_and_lymphoid_tissue(3)|lung(2)|prostate(1)	large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55						c.(2671-2673)GTG>GTC	MMR	mutS homolog 2							50.0	48.0	49.0					2																	47709956		2203	4294	6497	SO:0001819	synonymous_variant	4436	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding	g.chr2:47709956G>C	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.2673G>C	2.37:g.47709956G>C						MSH2_uc010yoh.1_Silent_p.V825V|MSH2_uc002rvz.2_Intron|MSH2_uc010fbg.2_Silent_p.V701V	p.V891V	NM_000251	NP_000242	P43246	MSH2_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		16	2741	+		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	891					B4E2Z2|O75488	Silent	SNP	ENST00000233146.2	37	c.2673G>C	CCDS1834.1																																																																																				0.313	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250805.3			11	42	0	0	0	0.010729	0	11	42				
ZNF638	27332	broad.mit.edu	37	2	71631126	71631126	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:71631126G>A	ENST00000409544.1	+	17	3586	c.2956G>A	c.(2956-2958)Gag>Aag	p.E986K	ZNF638_ENST00000264447.4_Missense_Mutation_p.E986K|ZNF638_ENST00000355812.3_Missense_Mutation_p.E986K	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	986					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E986K(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TATAAAAGATGAGGTAAATCA	0.328																																							uc002shx.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(2956-2958)GAG>AAG		zinc finger protein 638							121.0	138.0	133.0					2																	71631126		2203	4298	6501	SO:0001583	missense	27332				RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr2:71631126G>A	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.2956G>A	2.37:g.71631126G>A	ENSP00000386433:p.Glu986Lys					ZNF638_uc010yqw.1_Missense_Mutation_p.E565K|ZNF638_uc002shy.2_Missense_Mutation_p.E986K|ZNF638_uc002shz.2_Missense_Mutation_p.E986K|ZNF638_uc002sia.2_Missense_Mutation_p.E986K|ZNF638_uc002sib.1_Missense_Mutation_p.E986K|ZNF638_uc010fed.2_RNA|ZNF638_uc002sic.2_Missense_Mutation_p.E83K	p.E986K	NM_014497	NP_055312	Q14966	ZN638_HUMAN			17	3275	+			986					B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	c.2956G>A	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288449	0.80914	.	.	ENSG00000075292	ENST00000394137;ENST00000355812;ENST00000264447;ENST00000409544	T;T;T	0.57107	0.42;1.43;1.43	5.12	4.23	0.50019	.	0.000000	0.49305	D	0.000141	T	0.61337	0.2339	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.69078	0.997;0.99;0.979;0.997	D;D;D;D	0.73380	0.98;0.979;0.946;0.98	T	0.56469	-0.7974	10	0.15499	T	0.54	-12.6462	8.559	0.33498	0.103:0.0:0.897:0.0	.	986;986;986;986	A8K583;Q14966-4;Q14966-3;Q14966	.;.;.;ZN638_HUMAN	K	565;986;986;986	ENSP00000348066:E986K;ENSP00000264447:E986K;ENSP00000386433:E986K	ENSP00000264447:E986K	E	+	1	0	ZNF638	71484634	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.020000	0.41010	2.375000	0.81037	0.650000	0.86243	GAG		0.328	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		37	198	0	0	0	0.00623	0	37	198				
RETSAT	54884	broad.mit.edu	37	2	85577259	85577260	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:85577259_85577260GG>AA	ENST00000295802.4	-	4	814_815	c.702_703CC>TT	c.(700-705)ttCCtt>ttTTtt	p.L235F	RETSAT_ENST00000263854.6_Missense_Mutation_p.L235F|RETSAT_ENST00000457495.2_Missense_Mutation_p.L174F	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	235					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)	p.L235F(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	GATGCTTGAAGGAATGGAGAGA	0.584																																							uc002spd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(700-705)TTCCTT>TTTTTT		all-trans-13,14-dihydroretinol saturase	Vitamin A(DB00162)																																			SO:0001583	missense	54884				retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity	g.chr2:85577259_85577260GG>AA	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.702_703delinsAA	2.37:g.85577259_85577260delinsAA	ENSP00000295802:p.Leu235Phe					RETSAT_uc010fge.2_RNA|RETSAT_uc010ysm.1_Missense_Mutation_p.L174F|RETSAT_uc010fgf.2_Intron	p.L235F	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN			4	893_894	-			235					A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	DNP	ENST00000295802.4	37	c.702_703CC>TT	CCDS1972.1																																																																																				0.584	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750		35	211	0	0	0	0.004672	0	35	211				
POLR1A	25885	broad.mit.edu	37	2	86305044	86305044	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:86305044C>T	ENST00000263857.6	-	11	1696	c.1318G>A	c.(1318-1320)Gct>Act	p.A440T	POLR1A_ENST00000409681.1_Missense_Mutation_p.A440T			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	440				YA -> ST (in Ref. 1; AAC99959). {ECO:0000305}.	gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)	p.A440T(2)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GAGCGCGCAGCGTAGTCCACT	0.453																																							uc002sqs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(1318-1320)GCT>ACT		DNA-directed RNA polymerase I A							168.0	170.0	169.0					2																	86305044		2004	4158	6162	SO:0001583	missense	25885				termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding	g.chr2:86305044C>T	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.1318G>A	2.37:g.86305044C>T	ENSP00000263857:p.Ala440Thr						p.A440T	NM_015425	NP_056240	O95602	RPA1_HUMAN			11	1697	-			440	YA -> ST (in Ref. 1; AAC99959).				B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	c.1318G>A	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951568	0.73787	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.67523	-0.27;-0.27	5.62	5.62	0.85841	RNA polymerase, alpha subunit (1);RNA polymerase, N-terminal (1);	0.049924	0.85682	D	0.000000	T	0.77363	0.4119	L	0.41124	1.26	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.78102	-0.2335	10	0.72032	D	0.01	-22.1286	19.6343	0.95724	0.0:1.0:0.0:0.0	.	440	O95602	RPA1_HUMAN	T	440	ENSP00000263857:A440T;ENSP00000386300:A440T	ENSP00000263857:A440T	A	-	1	0	POLR1A	86158555	1.000000	0.71417	0.238000	0.24106	0.436000	0.31835	7.334000	0.79224	2.813000	0.96785	0.561000	0.74099	GCT		0.453	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425		48	216	0	0	0	0.01441	0	48	216				
SLC5A7	60482	broad.mit.edu	37	2	108626979	108626979	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:108626979G>A	ENST00000264047.2	+	9	1681	c.1405G>A	c.(1405-1407)Gat>Aat	p.D469N	SLC5A7_ENST00000409059.1_Missense_Mutation_p.D469N|SLC5A7_ENST00000540517.1_Missense_Mutation_p.D364N	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	469					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)	p.D469N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	TTACCCTGATGATAATGGTAT	0.398																																							uc002tdv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1405-1407)GAT>AAT		solute carrier family 5 (choline transporter),	Choline(DB00122)						98.0	98.0	98.0					2																	108626979		2203	4300	6503	SO:0001583	missense	60482				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity	g.chr2:108626979G>A	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.1405G>A	2.37:g.108626979G>A	ENSP00000264047:p.Asp469Asn					SLC5A7_uc010ywm.1_Missense_Mutation_p.D222N|SLC5A7_uc010fjj.2_Missense_Mutation_p.D469N|SLC5A7_uc010ywn.1_Missense_Mutation_p.D356N	p.D469N	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN			9	1681	+			469			Cytoplasmic (Potential).		Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	37	c.1405G>A	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	G	8.975	0.973900	0.18736	.	.	ENSG00000115665	ENST00000409059;ENST00000540517;ENST00000264047	D;D;D	0.92099	-2.75;-2.97;-2.75	5.73	3.26	0.37387	.	0.615400	0.18636	N	0.135459	D	0.84428	0.5470	L	0.38838	1.175	0.27782	N	0.943129	B	0.02656	0.0	B	0.04013	0.001	T	0.69483	-0.5133	10	0.17832	T	0.49	-1.103	5.7082	0.17921	0.6766:0.0:0.3234:0.0	.	469	Q9GZV3	SC5A7_HUMAN	N	469;364;469	ENSP00000387346:D469N;ENSP00000445351:D364N;ENSP00000264047:D469N	ENSP00000264047:D469N	D	+	1	0	SLC5A7	107993411	1.000000	0.71417	0.984000	0.44739	0.046000	0.14306	3.915000	0.56409	0.998000	0.38996	-0.300000	0.09419	GAT		0.398	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1			16	113	0	0	0	0.004007	0	16	113				
MARCO	8685	broad.mit.edu	37	2	119735488	119735488	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:119735488A>T	ENST00000327097.4	+	8	878	c.743A>T	c.(742-744)gAg>gTg	p.E248V	MARCO_ENST00000541757.1_Missense_Mutation_p.E170V	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	248	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.E248V(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						ACTAAGGGAGAGAAAGGAGAC	0.602																																					GBM(8;18 374 7467 11269 32796)	GBM(8;18 374 7467 11269 32796)	uc002tln.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(742-744)GAG>GTG		macrophage receptor with collagenous structure							43.0	43.0	43.0					2																	119735488		2202	4300	6502	SO:0001583	missense	8685				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity	g.chr2:119735488A>T	AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.743A>T	2.37:g.119735488A>T	ENSP00000318916:p.Glu248Val					MARCO_uc010yyf.1_Missense_Mutation_p.E170V	p.E248V	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN			8	875	+			248			Collagen-like.|Extracellular (Potential).		B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	c.743A>T	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	A	4.945	0.175526	0.09391	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.93307	-3.2;-3.2	4.62	2.2	0.27929	.	0.846577	0.10575	N	0.658659	D	0.87309	0.6145	L	0.41492	1.28	0.19300	N	0.999977	B	0.06786	0.001	B	0.06405	0.002	T	0.73084	-0.4094	9	.	.	.	.	3.5326	0.07782	0.6996:0.0:0.1051:0.1953	.	248	Q9UEW3	MARCO_HUMAN	V	248;248;170	ENSP00000318916:E248V;ENSP00000441769:E170V	.	E	+	2	0	MARCO	119451958	1.000000	0.71417	0.798000	0.32154	0.158000	0.22134	2.264000	0.43302	0.285000	0.22329	0.459000	0.35465	GAG		0.602	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770		5	20	0	0	0	0.000602	0	5	20				
MYO7B	4648	broad.mit.edu	37	2	128366435	128366435	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:128366435G>A	ENST00000409816.2	+	21	2828	c.2796G>A	c.(2794-2796)caG>caA	p.Q932Q	MYO7B_ENST00000428314.1_Silent_p.Q932Q|MYO7B_ENST00000389524.4_Silent_p.Q932Q			Q6PIF6	MYO7B_HUMAN	myosin VIIB	932						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.Q932Q(4)		breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AGGAGGGCCAGGCCTCGCCGC	0.622																																							uc002top.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(1)|pancreas(1)	2						c.(2794-2796)CAG>CAA		myosin VIIB							30.0	36.0	34.0					2																	128366435		2073	4189	6262	SO:0001819	synonymous_variant	4648					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity	g.chr2:128366435G>A		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.2796G>A	2.37:g.128366435G>A							p.Q932Q	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0753)	22	2849	+	Colorectal(110;0.1)		932					Q14786|Q8TEE1	Silent	SNP	ENST00000409816.2	37	c.2796G>A	CCDS46405.1																																																																																				0.622	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		15	20	0	0	0	0.014323	0	15	20				
GPR39	2863	broad.mit.edu	37	2	133174758	133174758	+	Missense_Mutation	SNP	A	A	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:133174758A>G	ENST00000329321.3	+	1	612	c.143A>G	c.(142-144)aAc>aGc	p.N48S		NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	48					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)	p.N48S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTTCTGGGGAACAGCGCCACC	0.522																																							uc002ttl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(142-144)AAC>AGC		G protein-coupled receptor 39							143.0	129.0	133.0					2																	133174758		2203	4300	6503	SO:0001583	missense	2863					integral to plasma membrane	G-protein coupled receptor activity|metal ion binding	g.chr2:133174758A>G	AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.143A>G	2.37:g.133174758A>G	ENSP00000327417:p.Asn48Ser						p.N48S	NM_001508	NP_001499	O43194	GPR39_HUMAN			1	612	+			48			Cytoplasmic (Potential).		B2RC12|B6V9G4|Q08AS2|Q53R01	Missense_Mutation	SNP	ENST00000329321.3	37	c.143A>G	CCDS2170.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.065279	0.76187	.	.	ENSG00000183840	ENST00000329321	T	0.75477	-0.94	5.34	5.34	0.76211	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.87402	0.6168	M	0.86268	2.805	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	D	0.89488	0.3755	10	0.87932	D	0	.	15.5393	0.76027	1.0:0.0:0.0:0.0	.	48	O43194	GPR39_HUMAN	S	48	ENSP00000327417:N48S	ENSP00000327417:N48S	N	+	2	0	GPR39	132891228	1.000000	0.71417	0.994000	0.49952	0.697000	0.40408	9.093000	0.94163	2.261000	0.74972	0.449000	0.29647	AAC		0.522	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254582.1			92	91	0	0	0	0.01441	0	92	91				
TANK	10010	broad.mit.edu	37	2	162036261	162036261	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:162036261T>A	ENST00000392749.2	+	2	327	c.88T>A	c.(88-90)Tta>Ata	p.L30I	TANK_ENST00000405852.1_Missense_Mutation_p.L30I|TANK_ENST00000259075.2_Missense_Mutation_p.L30I|TANK_ENST00000402568.1_Missense_Mutation_p.L88I|TANK_ENST00000403609.1_Missense_Mutation_p.L30I|TANK_ENST00000457476.1_Missense_Mutation_p.L30I|TANK_ENST00000406287.1_Missense_Mutation_p.L88I	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	30					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)	p.L30I(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						AGTAAAAGAATTACAGCAAAA	0.378																																							uc002ubr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(88-90)TTA>ATA		TRAF interacting protein TANK isoform a							116.0	112.0	113.0					2																	162036261		2203	4300	6503	SO:0001583	missense	10010					cytosol	metal ion binding|protein binding	g.chr2:162036261T>A	U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.88T>A	2.37:g.162036261T>A	ENSP00000376505:p.Leu30Ile					TANK_uc002ubq.1_Missense_Mutation_p.L30I|TANK_uc002ubs.2_Missense_Mutation_p.L30I	p.L30I	NM_004180	NP_004171	Q92844	TANK_HUMAN			2	246	+			30					D3DPB5|Q7Z4J6|Q92885	Missense_Mutation	SNP	ENST00000392749.2	37	c.88T>A	CCDS2215.1	.	.	.	.	.	.	.	.	.	.	T	17.79	3.476579	0.63737	.	.	ENSG00000136560	ENST00000259075;ENST00000432002;ENST00000457476;ENST00000392749;ENST00000440506;ENST00000429217;ENST00000406287;ENST00000402568;ENST00000405852;ENST00000456358;ENST00000403609	T;T;T;T;T	0.60548	0.67;0.67;1.62;0.18;1.62	6.03	3.28	0.37604	.	0.080371	0.52532	D	0.000075	T	0.60599	0.2281	L	0.34521	1.04	0.38050	D	0.935738	D;D	0.76494	0.999;0.998	D;D	0.77557	0.971;0.99	T	0.62534	-0.6834	10	0.72032	D	0.01	-10.5244	5.7593	0.18190	0.1352:0.6495:0.0:0.2153	.	30;30	Q92844;Q7Z4J6	TANK_HUMAN;.	I	30;30;30;30;30;30;88;88;30;56;30	ENSP00000259075:L30I;ENSP00000376505:L30I;ENSP00000384492:L88I;ENSP00000385487:L30I;ENSP00000392776:L56I	ENSP00000259075:L30I	L	+	1	2	TANK	161744507	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	1.349000	0.33998	0.440000	0.26502	-0.375000	0.07067	TTA		0.378	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324232.1	NM_133484		4	36	0	0	0	0.000602	0	4	36				
KCNH7	90134	broad.mit.edu	37	2	163253285	163253285	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:163253285C>G	ENST00000332142.5	-	11	2677	c.2578G>C	c.(2578-2580)Gag>Cag	p.E860Q		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	860					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.E860Q(2)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AAAGTCAACTCTAGGTTTGTT	0.363																																					GBM(196;1492 2208 17507 24132 45496)	GBM(196;1492 2208 17507 24132 45496)	uc002uch.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)	5						c.(2578-2580)GAG>CAG		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						70.0	69.0	69.0					2																	163253285		2202	4298	6500	SO:0001583	missense	90134				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity	g.chr2:163253285C>G	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2578G>C	2.37:g.163253285C>G	ENSP00000331727:p.Glu860Gln						p.E860Q	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN			11	2790	-			860			Cytoplasmic (Potential).|cNMP.		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	c.2578G>C	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916282	0.92249	.	.	ENSG00000184611	ENST00000332142	D	0.98914	-5.23	5.67	5.67	0.87782	RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.97275	0.9109	N	0.24115	0.695	0.80722	D	1	P	0.42010	0.768	P	0.48270	0.572	D	0.96716	0.9529	10	0.27082	T	0.32	.	19.7712	0.96366	0.0:1.0:0.0:0.0	.	860	Q9NS40	KCNH7_HUMAN	Q	860	ENSP00000331727:E860Q	ENSP00000331727:E860Q	E	-	1	0	KCNH7	162961531	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.818000	0.86416	2.677000	0.91161	0.585000	0.79938	GAG		0.363	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272		16	22	0	0	0	0.004007	0	16	22				
LRP2	4036	broad.mit.edu	37	2	170148767	170148767	+	Silent	SNP	T	T	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:170148767T>A	ENST00000263816.3	-	7	1050	c.765A>T	c.(763-765)ggA>ggT	p.G255G	LRP2_ENST00000443831.1_Silent_p.G255G	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	255	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.G255G(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CCTTACCACATCCATCTTCAT	0.418																																							uc002ues.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(763-765)GGA>GGT		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						170.0	156.0	161.0					2																	170148767		2203	4300	6503	SO:0001819	synonymous_variant	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170148767T>A		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.765A>T	2.37:g.170148767T>A						LRP2_uc010zdf.1_Silent_p.G255G	p.G255G	NM_004525	NP_004516	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	7	978	-			255			LDL-receptor class A 6.|Extracellular (Potential).		O00711|Q16215	Silent	SNP	ENST00000263816.3	37	c.765A>T	CCDS2232.1																																																																																				0.418	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		20	126	0	0	0	0.00278	0	20	126				
DLX1	1745	broad.mit.edu	37	2	172952956	172952956	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:172952956G>C	ENST00000361725.4	+	3	1191	c.739G>C	c.(739-741)Gaa>Caa	p.E247Q	DLX1_ENST00000341900.6_3'UTR|DLX1_ENST00000550686.1_3'UTR	NM_178120.4	NP_835221.2	P56177	DLX1_HUMAN	distal-less homeobox 1	247					cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic skeletal system development (GO:0048706)|hippocampus development (GO:0021766)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|lung(4)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.216)			AGCGCACCAAGAAGCTATGCA	0.617																																							uc002uhl.2		NA																	0					0						c.(739-741)GAA>CAA		distal-less homeobox 1 isoform 1							99.0	108.0	105.0					2																	172952956		2203	4300	6503	SO:0001583	missense	1745					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:172952956G>C	BC013010	CCDS2247.2, CCDS33328.1	2q31.1	2011-06-20	2005-12-22		ENSG00000144355	ENSG00000144355		"""Homeoboxes / ANTP class : NKL subclass"""	2914	protein-coding gene	gene with protein product		600029	"""distal-less homeo box 1"""			7907794	Standard	NM_001038493		Approved		uc002uhl.3	P56177	OTTHUMG00000073951	ENST00000361725.4:c.739G>C	2.37:g.172952956G>C	ENSP00000354478:p.Glu247Gln					DLX1_uc002uhm.2_3'UTR	p.E247Q	NM_178120	NP_835221	P56177	DLX1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.216)		3	937	+			247					D3DPD7|Q53ZU4|Q7Z724|Q8IYB2	Missense_Mutation	SNP	ENST00000361725.4	37	c.739G>C	CCDS2247.2	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994670	0.54041	.	.	ENSG00000144355	ENST00000361725;ENST00000550686	D	0.91631	-2.88	5.6	4.67	0.58626	.	0.633837	0.16953	N	0.192805	D	0.92071	0.7487	M	0.69823	2.125	0.54753	D	0.999985	P	0.41910	0.764	B	0.43445	0.42	D	0.91308	0.5072	9	.	.	.	-10.0771	14.9475	0.71044	0.0:0.0:0.8563:0.1436	.	247	P56177	DLX1_HUMAN	Q	247;81	ENSP00000354478:E247Q	.	E	+	1	0	DLX1	172661202	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.234000	0.72326	2.647000	0.89833	0.650000	0.86243	GAA		0.617	DLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405916.1	XM_087198		7	340	0	0	0	0.004482	0	7	340				
AOX1	316	broad.mit.edu	37	2	201469469	201469469	+	Silent	SNP	A	A	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:201469469A>G	ENST00000374700.2	+	9	961	c.720A>G	c.(718-720)agA>agG	p.R240R		NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	240	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)	p.R240R(1)		breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GCAGTGAGAGAATGATGTGGT	0.463																																							uc002uvx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(1)|skin(1)	6						c.(718-720)AGA>AGG		aldehyde oxidase 1	Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)						156.0	138.0	144.0					2																	201469469		2203	4300	6503	SO:0001819	synonymous_variant	316				inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity	g.chr2:201469469A>G	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.720A>G	2.37:g.201469469A>G							p.R240R	NM_001159	NP_001150	Q06278	ADO_HUMAN			9	821	+			240			FAD-binding PCMH-type.		O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Silent	SNP	ENST00000374700.2	37	c.720A>G	CCDS33360.1																																																																																				0.463	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159		30	117	0	0	0	0.009535	0	30	117				
CLK1	1195	broad.mit.edu	37	2	201719419	201719419	+	Splice_Site	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:201719419C>A	ENST00000321356.4	-	11	1276		c.e11-1		CLK1_ENST00000409769.2_Splice_Site|CLK1_ENST00000434813.2_Splice_Site	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1						cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.?(4)		NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TATCGTGTGTCTAGAAATAAA	0.368																																							uc002uwe.2		NA																	4	Unknown(4)		lung(4)	pancreas(2)	2						c.e11-1		CDC-like kinase 1 isoform 1							132.0	135.0	134.0					2																	201719419		2203	4299	6502	SO:0001630	splice_region_variant	1195				cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity	g.chr2:201719419C>A	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.1141-1G>T	2.37:g.201719419C>A						CLK1_uc002uwd.2_Splice_Site_p.T204_splice|CLK1_uc010zhi.1_Splice_Site_p.T423_splice|CLK1_uc002uwf.2_Splice_Site_p.T155_splice|CLK1_uc002uwg.2_Splice_Site_p.T230_splice|CLK1_uc010fsv.2_Splice_Site	p.T381_splice	NM_004071	NP_004062	P49759	CLK1_HUMAN			11	1322	-								B4DFW7|Q0P694|Q8N5V8	Splice_Site	SNP	ENST00000321356.4	37	c.1141_splice	CCDS2331.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997385	0.54147	.	.	ENSG00000013441	ENST00000321356;ENST00000357369;ENST00000409769;ENST00000434813	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4145	0.94689	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CLK1	201427664	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	7.209000	0.77916	2.757000	0.94681	0.563000	0.77884	.		0.368	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2		Intron	27	158	1	0	4.87955e-14	0.005443	5.46437e-14	27	158				
AQP12B	653437	broad.mit.edu	37	2	241621963	241621963	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:241621963G>T	ENST00000407834.3	-	1	354	c.292C>A	c.(292-294)Ctg>Atg	p.L98M		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	86						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.L98M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		AACTCCTGCAGGGACACGGTG	0.687																																							uc010fzj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(292-294)CTG>ATG		aquaporin 12B							49.0	50.0	50.0					2																	241621963		2203	4300	6503	SO:0001583	missense	653437					integral to membrane	transporter activity	g.chr2:241621963G>T	BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.292C>A	2.37:g.241621963G>T	ENSP00000384894:p.Leu98Met					AQP12B_uc002vzt.2_Intron	p.L98M	NM_001102467	NP_001095937	A6NM10	AQ12B_HUMAN		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)	1	355	-		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	86					A4QPB9	Missense_Mutation	SNP	ENST00000407834.3	37	c.292C>A	CCDS46560.1	.	.	.	.	.	.	.	.	.	.	.	14.78	2.638540	0.47153	.	.	ENSG00000185176	ENST00000407834	D	0.88741	-2.42	2.63	1.71	0.24356	.	0.394012	0.23668	N	0.045749	D	0.90369	0.6986	L	0.57536	1.79	0.32532	N	0.534784	D	0.76494	0.999	D	0.70016	0.967	D	0.88025	0.2771	9	.	.	.	-5.3224	5.1112	0.14809	0.2918:0.0:0.7082:0.0	.	98	A6NM10-2	.	M	98	ENSP00000384894:L98M	.	L	-	1	2	AQP12B	241270636	0.301000	0.24444	0.878000	0.34440	0.949000	0.60115	0.576000	0.23744	0.634000	0.30469	0.479000	0.44913	CTG		0.687	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325625.1			13	74	1	0	7.03913e-09	0.013537	7.54372e-09	13	74				
RPN2	6185	broad.mit.edu	37	20	35827457	35827457	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr20:35827457C>G	ENST00000237530.6	+	4	619	c.308C>G	c.(307-309)tCt>tGt	p.S103C	RPN2_ENST00000373622.5_Missense_Mutation_p.S71C	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	103					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)	p.S103C(2)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				TCTTAGATCTCTATTTCAAAT	0.468																																							uc002xgp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(307-309)TCT>TGT		ribophorin II isoform 1 precursor							122.0	113.0	116.0					20																	35827457		2203	4300	6503	SO:0001583	missense	6185				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|nucleus|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding	g.chr20:35827457C>G	Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.308C>G	20.37:g.35827457C>G	ENSP00000237530:p.Ser103Cys					RPN2_uc002xgo.3_Missense_Mutation_p.S103C|RPN2_uc010gfw.2_Intron|RPN2_uc002xgq.2_Missense_Mutation_p.S71C	p.S103C	NM_002951	NP_002942	P04844	RPN2_HUMAN			4	612	+		Myeloproliferative disorder(115;0.00878)	103			Lumenal (Potential).		Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Missense_Mutation	SNP	ENST00000237530.6	37	c.308C>G	CCDS13291.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265411	0.80358	.	.	ENSG00000118705	ENST00000237530;ENST00000373622;ENST00000373632;ENST00000338768	T;T;T	0.46063	0.88;0.88;0.88	5.31	5.31	0.75309	.	0.123818	0.56097	D	0.000031	T	0.49423	0.1556	L	0.34521	1.04	0.39684	D	0.97094	P;P;D	0.52996	0.95;0.915;0.957	P;P;P	0.57101	0.813;0.729;0.813	T	0.50482	-0.8823	10	0.59425	D	0.04	-15.5083	16.5206	0.84315	0.0:1.0:0.0:0.0	.	71;103;103	Q5JYR6;P04844;B2RE46	.;RPN2_HUMAN;.	C	103;71;103;103	ENSP00000237530:S103C;ENSP00000362724:S71C;ENSP00000362735:S103C	ENSP00000237530:S103C	S	+	2	0	RPN2	35260871	1.000000	0.71417	0.991000	0.47740	0.988000	0.76386	4.174000	0.58256	2.763000	0.94921	0.563000	0.77884	TCT		0.468	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079076.2	NM_002951		70	164	0	0	0	0.01441	0	70	164				
RPN2	6185	broad.mit.edu	37	20	35827584	35827584	+	Silent	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr20:35827584C>G	ENST00000237530.6	+	4	746	c.435C>G	c.(433-435)ctC>ctG	p.L145L	RPN2_ENST00000373622.5_Silent_p.L113L	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	145					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)	p.L145L(2)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				AAGAAGCACTCAGTGCCCTTA	0.527																																							uc002xgp.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(1)	3						c.(433-435)CTC>CTG		ribophorin II isoform 1 precursor							164.0	122.0	136.0					20																	35827584		2203	4300	6503	SO:0001819	synonymous_variant	6185				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|nucleus|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding	g.chr20:35827584C>G	Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.435C>G	20.37:g.35827584C>G						RPN2_uc002xgo.3_Silent_p.L145L|RPN2_uc010gfw.2_Intron|RPN2_uc002xgq.2_Silent_p.L113L	p.L145L	NM_002951	NP_002942	P04844	RPN2_HUMAN			4	739	+		Myeloproliferative disorder(115;0.00878)	145			Lumenal (Potential).		Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Silent	SNP	ENST00000237530.6	37	c.435C>G	CCDS13291.1																																																																																				0.527	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079076.2	NM_002951		47	140	0	0	0	0.011902	0	47	140				
SLC32A1	140679	broad.mit.edu	37	20	37356290	37356290	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr20:37356290C>A	ENST00000217420.1	+	2	849	c.586C>A	c.(586-588)Ccg>Acg	p.P196T		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	196					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.P196T(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CTGCTGCGCCCCGCGCTTCCC	0.632																																							uc002xjc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(586-588)CCG>ACG		solute carrier family 32, member 1	Glycine(DB00145)						76.0	63.0	67.0					20																	37356290		2203	4300	6503	SO:0001583	missense	140679				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity	g.chr20:37356290C>A	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.586C>A	20.37:g.37356290C>A	ENSP00000217420:p.Pro196Thr						p.P196T	NM_080552	NP_542119	Q9H598	VIAAT_HUMAN			2	849	+		Myeloproliferative disorder(115;0.00878)	196			Lumenal, vesicle (Potential).		Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	c.586C>A	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	C	19.40	3.820840	0.71028	.	.	ENSG00000101438	ENST00000217420	T	0.08546	3.08	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.27731	0.0682	M	0.73598	2.24	0.80722	D	1	D	0.67145	0.996	D	0.68765	0.96	T	0.01283	-1.1396	10	0.51188	T	0.08	-30.0747	15.3899	0.74735	0.0:1.0:0.0:0.0	.	196	Q9H598	VIAAT_HUMAN	T	196	ENSP00000217420:P196T	ENSP00000217420:P196T	P	+	1	0	SLC32A1	36789704	1.000000	0.71417	0.815000	0.32552	0.879000	0.50718	7.756000	0.85195	2.317000	0.78254	0.563000	0.77884	CCG		0.632	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552		27	67	1	0	5.45727e-16	0.008361	6.25181e-16	27	67				
PTPRT	11122	broad.mit.edu	37	20	40730910	40730910	+	Missense_Mutation	SNP	G	G	A	rs370873414		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr20:40730910G>A	ENST00000373187.1	-	26	3567	c.3568C>T	c.(3568-3570)Cgg>Tgg	p.R1190W	PTPRT_ENST00000373198.4_Missense_Mutation_p.R1209W|PTPRT_ENST00000373190.1_Missense_Mutation_p.R1189W|PTPRT_ENST00000356100.2_Missense_Mutation_p.R1199W|PTPRT_ENST00000373201.1_Missense_Mutation_p.R1180W|PTPRT_ENST00000373193.3_Missense_Mutation_p.R1193W|PTPRT_ENST00000373184.1_Missense_Mutation_p.R1200W			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1190	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.		R -> W (in a colorectal cancer; reduced phosphatase activity). {ECO:0000269|PubMed:15155950}.		cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TCCTCGGGCCGCACACGGGGT	0.562																																							uc002xkg.2		NA																	0				skin(8)|ovary(7)|lung(5)	20						c.(3568-3570)CGG>TGG		protein tyrosine phosphatase, receptor type, T		G	TRP/ARG,TRP/ARG	1,4143		0,1,2071	54.0	58.0	57.0		3568,3625	2.2	1.0	20		57	0,8456		0,0,4228	no	missense,missense	PTPRT	NM_007050.5,NM_133170.3	101,101	0,1,6299	AA,AG,GG		0.0,0.0241,0.0079	probably-damaging,probably-damaging	1190/1442,1209/1461	40730910	1,12599	2072	4228	6300	SO:0001583	missense	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:40730910G>A	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3568C>T	20.37:g.40730910G>A	ENSP00000362283:p.Arg1190Trp					PTPRT_uc010ggj.2_Missense_Mutation_p.R1209W|PTPRT_uc010ggi.2_Missense_Mutation_p.R393W	p.R1190W	NM_007050	NP_008981	O14522	PTPRT_HUMAN			26	3752	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	1190		R -> W (in a colorectal cancer; reduced phosphatase activity).	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	c.3568C>T	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531290	0.64972	2.41E-4	0.0	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.36699	1.28;1.27;1.27;1.28;1.27;1.24;1.27	5.49	2.2	0.27929	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.066701	0.64402	D	0.000014	T	0.59169	0.2174	M	0.78049	2.395	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.68943	0.961;0.915	T	0.65175	-0.6232	10	0.72032	D	0.01	.	15.5025	0.75709	0.0:0.0:0.5485:0.4515	.	1212;1190	O14522-1;O14522	.;PTPRT_HUMAN	W	1189;1190;1193;1199;1212;1200;1180	ENSP00000362286:R1189W;ENSP00000362283:R1190W;ENSP00000362289:R1193W;ENSP00000348408:R1199W;ENSP00000362294:R1212W;ENSP00000362280:R1200W;ENSP00000362297:R1180W	ENSP00000348408:R1199W	R	-	1	2	PTPRT	40164324	0.991000	0.36638	0.985000	0.45067	0.682000	0.39822	3.057000	0.49931	0.259000	0.21709	-0.808000	0.03180	CGG		0.562	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			5	202	0	0	0	0.001168	0	5	202				
OSER1	51526	broad.mit.edu	37	20	42831602	42831602	+	Splice_Site	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr20:42831602C>A	ENST00000372970.2	-	5	370	c.190G>T	c.(190-192)Ggg>Tgg	p.G64W	OSER1_ENST00000255174.2_Splice_Site_p.G64W			Q9NX31	OSER1_HUMAN	oxidative stress responsive serine-rich 1	64					cellular response to hydrogen peroxide (GO:0070301)			p.G64W(2)									AGCTCTTACCCGTGCCAACTG	0.383																																							uc002xlk.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(190-192)GGG>TGG		oxidative stress responsive 1							166.0	129.0	142.0					20																	42831602		2203	4300	6503	SO:0001630	splice_region_variant	51526							g.chr20:42831602C>A	AL035447	CCDS13327.1	20q13.11	2013-05-17	2013-05-17	2013-05-17	ENSG00000132823	ENSG00000132823			16105	protein-coding gene	gene with protein product	"""peroxide-inducible transcript 1"", ""oxidative stress-responsive 1"""		"""chromosome 20 open reading frame 111"""	C20orf111		17148688	Standard	NM_016470		Approved	dJ1183I21.1, HSPC207, Perit1, Osr1		Q9NX31	OTTHUMG00000032518	ENST00000372970.2:c.191+1G>T	20.37:g.42831602C>A							p.G64W	NM_016470	NP_057554	Q9NX31	CT111_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		3	327	-		Myeloproliferative disorder(115;0.028)	64					B2RCK4|O95912|Q9NZ84|Q9P0R8	Missense_Mutation	SNP	ENST00000372970.2	37	c.190G>T	CCDS13327.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308807	0.60305	.	.	ENSG00000132823	ENST00000255174;ENST00000372970	T;T	0.49720	0.77;0.77	5.9	4.78	0.61160	.	0.153488	0.64402	D	0.000017	T	0.63367	0.2505	L	0.55481	1.735	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.61955	-0.6956	10	0.49607	T	0.09	-12.9493	15.0477	0.71841	0.0:0.9206:0.0:0.0794	.	64	Q9NX31	CT111_HUMAN	W	64	ENSP00000255174:G64W;ENSP00000362061:G64W	ENSP00000255174:G64W	G	-	1	0	C20orf111	42265016	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	3.575000	0.53870	2.806000	0.96561	0.655000	0.94253	GGG		0.383	OSER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079334.2	NM_016470	Missense_Mutation	19	71	1	0	1.45105e-14	0.006122	1.64967e-14	19	71				
PMEPA1	56937	broad.mit.edu	37	20	56227472	56227472	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr20:56227472G>A	ENST00000341744.3	-	4	820	c.501C>T	c.(499-501)ctC>ctT	p.L167L	PMEPA1_ENST00000395816.3_Silent_p.L117L|PMEPA1_ENST00000395814.1_Silent_p.L117L|PMEPA1_ENST00000347215.4_Silent_p.L132L|PMEPA1_ENST00000265626.4_Silent_p.L117L	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	167					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)	p.L167L(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						CCCGAAGCTGGAGGGTGCAGG	0.642																																							uc002xyq.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(499-501)CTC>CTT		transmembrane prostate androgen-induced protein							32.0	35.0	34.0					20																	56227472		2203	4300	6503	SO:0001819	synonymous_variant	56937				androgen receptor signaling pathway	integral to membrane|plasma membrane	WW domain binding	g.chr20:56227472G>A	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.501C>T	20.37:g.56227472G>A						PMEPA1_uc002xyr.2_Silent_p.L117L|PMEPA1_uc002xys.2_Silent_p.L132L|PMEPA1_uc002xyt.2_Silent_p.L117L	p.L167L	NM_020182	NP_064567	Q969W9	PMEPA_HUMAN			4	894	-			167			Cytoplasmic (Potential).		Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Silent	SNP	ENST00000341744.3	37	c.501C>T	CCDS13463.1																																																																																				0.642	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182		14	68	0	0	0	0.001855	0	14	68				
CABLES2	81928	broad.mit.edu	37	20	60971600	60971600	+	Silent	SNP	G	G	C	rs148559612		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr20:60971600G>C	ENST00000279101.5	-	2	419	c.411C>G	c.(409-411)gcC>gcG	p.A137A		NM_031215.2	NP_112492.2	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	137					cell cycle (GO:0007049)|cell division (GO:0051301)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			endometrium(2)|kidney(1)|lung(6)|pancreas(1)|skin(1)	11	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CGCATCCCACGGCATCTTCCA	0.667																																							uc002ycv.2		NA																	0				pancreas(1)	1						c.(409-411)GCC>GCG		Cdk5 and Abl enzyme substrate 2							55.0	57.0	57.0					20																	60971600		2203	4300	6503	SO:0001819	synonymous_variant	81928				cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity	g.chr20:60971600G>C	BC003122	CCDS33503.1	20q13.33	2004-01-09	2004-01-09	2004-01-09	ENSG00000149679	ENSG00000149679			16143	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 150"""	C20orf150		12477932	Standard	NM_031215		Approved	dJ908M14.2, ik3-2	uc002ycv.2	Q9BTV7	OTTHUMG00000032912	ENST00000279101.5:c.411C>G	20.37:g.60971600G>C							p.A137A	NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		2	418	-	Breast(26;2.05e-08)		137					Q5JWL0|Q9BYK0	Silent	SNP	ENST00000279101.5	37	c.411C>G	CCDS33503.1																																																																																				0.667	CABLES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080027.2	XM_037265		9	65	0	0	0	0.010729	0	9	65				
DIDO1	11083	broad.mit.edu	37	20	61511439	61511439	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr20:61511439G>A	ENST00000266070.4	-	16	6194	c.5869C>T	c.(5869-5871)Cca>Tca	p.P1957S	DIDO1_ENST00000395343.1_Missense_Mutation_p.P1957S	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1957	Pro-rich.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CTGGGACCTGGCATAAAGTTA	0.587																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	uc002ydr.1		NA																	0				ovary(3)|skin(3)	6						c.(5869-5871)CCA>TCA		death inducer-obliterator 1 isoform c							116.0	137.0	130.0					20																	61511439		2203	4299	6502	SO:0001583	missense	11083				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr20:61511439G>A	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.5869C>T	20.37:g.61511439G>A	ENSP00000266070:p.Pro1957Ser					DIDO1_uc002yds.1_Missense_Mutation_p.P1957S	p.P1957S	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN			16	6133	-	Breast(26;5.68e-08)		1957			Pro-rich.		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	c.5869C>T	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.556683	0.27827	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.09073	3.02;3.02	4.85	3.87	0.44632	.	0.172654	0.27705	N	0.018184	T	0.09113	0.0225	L	0.57536	1.79	0.36017	D	0.838476	P	0.38922	0.651	B	0.30943	0.122	T	0.26018	-1.0115	10	0.33940	T	0.23	-12.0382	13.7283	0.62771	0.0:0.2948:0.7052:0.0	.	1957	Q9BTC0	DIDO1_HUMAN	S	1957	ENSP00000266070:P1957S;ENSP00000378752:P1957S	ENSP00000266070:P1957S	P	-	1	0	DIDO1	60981884	0.988000	0.35896	0.966000	0.40874	0.124000	0.20399	2.352000	0.44080	1.105000	0.41606	0.561000	0.74099	CCA		0.587	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		7	691	0	0	0	0.00308	0	7	691				
CHRNA4	1137	broad.mit.edu	37	20	61981432	61981432	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr20:61981432G>T	ENST00000370263.4	-	5	1552	c.1331C>A	c.(1330-1332)cCc>cAc	p.P444H	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	444					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.P444H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	TCCAGGCGAGGGGTGGGGGCT	0.706																																							uc002yes.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(1330-1332)CCC>CAC		cholinergic receptor, nicotinic, alpha 4 subunit	Nicotine(DB00184)|Varenicline(DB01273)						8.0	8.0	8.0					20																	61981432		2111	4151	6262	SO:0001583	missense	1137				B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr20:61981432G>T		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.1331C>A	20.37:g.61981432G>T	ENSP00000359285:p.Pro444His					CHRNA4_uc002yet.1_Missense_Mutation_p.P268H|CHRNA4_uc011aaw.1_RNA|CHRNA4_uc010gke.1_Missense_Mutation_p.P373H|CHRNA4_uc002yev.1_Missense_Mutation_p.P268H|CHRNA4_uc010gkf.1_Missense_Mutation_p.P268H	p.P444H	NM_000744	NP_000735	P43681	ACHA4_HUMAN			5	1509	-	all_cancers(38;1.71e-10)		444			Cytoplasmic (Potential).		Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	37	c.1331C>A	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	G	9.308	1.054871	0.19907	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	T	0.78707	-1.2	4.22	-1.38	0.09027	Neurotransmitter-gated ion-channel transmembrane domain (2);	2.992010	0.00654	N	0.000574	T	0.80396	0.4615	L	0.53249	1.67	0.09310	N	1	D;D	0.76494	0.999;0.994	D;P	0.65323	0.934;0.819	T	0.62872	-0.6762	10	0.17369	T	0.5	.	1.3341	0.02141	0.3143:0.1363:0.409:0.1403	.	373;444	Q4VAQ5;P43681	.;ACHA4_HUMAN	H	350;444;373	ENSP00000359285:P444H	ENSP00000359280:P350H	P	-	2	0	CHRNA4	61451876	0.118000	0.22208	0.000000	0.03702	0.000000	0.00434	2.421000	0.44688	-0.654000	0.05394	-1.710000	0.00715	CCC		0.706	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3			17	7	1	0	3.10358e-05	0.014323	3.22212e-05	17	7				
ADARB1	104	broad.mit.edu	37	21	46641940	46641940	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr21:46641940C>T	ENST00000360697.3	+	10	2069	c.2054C>T	c.(2053-2055)tCc>tTc	p.S685F	ADARB1_ENST00000437626.1_3'UTR|ADARB1_ENST00000348831.4_Missense_Mutation_p.S645F|ADARB1_ENST00000539173.1_Missense_Mutation_p.S685F|ADARB1_ENST00000389863.4_Missense_Mutation_p.S685F			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	685	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S685F(2)		endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		CAGGTTCCCTCCCACTTACTA	0.488																																							uc002zgy.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(2053-2055)TCC>TTC		RNA-specific adenosine deaminase B1 isoform 2							64.0	57.0	59.0					21																	46641940		2203	4299	6502	SO:0001583	missense	104				adenosine to inosine editing|mRNA modification|mRNA processing|RNA processing	nucleoplasm|nucleus	double-stranded RNA adenosine deaminase activity|double-stranded RNA adenosine deaminase activity|double-stranded RNA binding|double-stranded RNA binding|metal ion binding|mRNA binding|RNA binding	g.chr21:46641940C>T	U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.2054C>T	21.37:g.46641940C>T	ENSP00000353920:p.Ser685Phe					ADARB1_uc002zgr.2_Missense_Mutation_p.S685F|ADARB1_uc002zgs.2_RNA|ADARB1_uc002zgw.2_Missense_Mutation_p.S645F|ADARB1_uc002zgv.2_RNA|ADARB1_uc002zgt.2_Missense_Mutation_p.S645F|ADARB1_uc010gpx.2_RNA|ADARB1_uc002zgq.2_RNA|ADARB1_uc002zgu.2_RNA	p.S685F	NM_015833	NP_056648	P78563	RED1_HUMAN		Colorectal(79;0.115)	12	2489	+			685			A to I editase.		A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Missense_Mutation	SNP	ENST00000360697.3	37	c.2054C>T	CCDS33589.1	.	.	.	.	.	.	.	.	.	.	C	19.23	3.788404	0.70337	.	.	ENSG00000197381	ENST00000539173;ENST00000389863;ENST00000348831;ENST00000360697	T;T;T;T	0.32515	1.47;1.45;1.46;1.47	5.05	4.16	0.48862	Adenosine deaminase/editase (3);	2.661690	0.01168	N	0.006804	T	0.50922	0.1644	M	0.65975	2.015	0.80722	D	1	B;B;P;B	0.39250	0.4;0.335;0.665;0.313	P;B;B;P	0.49361	0.608;0.287;0.281;0.495	T	0.07366	-1.0776	10	0.66056	D	0.02	-11.5939	11.1549	0.48482	0.0:0.9097:0.0:0.0903	.	685;645;673;685	P78563;Q4AE77;G5E9B4;P78563-3	RED1_HUMAN;.;.;.	F	685;685;645;685	ENSP00000441897:S685F;ENSP00000374513:S685F;ENSP00000015877:S645F;ENSP00000353920:S685F	ENSP00000015877:S645F	S	+	2	0	ADARB1	45466368	1.000000	0.71417	0.005000	0.12908	0.007000	0.05969	3.377000	0.52425	1.259000	0.44117	0.655000	0.94253	TCC		0.488	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206648.2	NM_015833		33	29	0	0	0	0.012213	0	33	29				
PCNT	5116	broad.mit.edu	37	21	47783764	47783764	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr21:47783764G>C	ENST00000359568.5	+	14	2631	c.2524G>C	c.(2524-2526)Gag>Cag	p.E842Q	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	842					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.E842*(1)|p.E842K(1)|p.E842Q(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GTGTGGGCGGGAGCCGCCCAC	0.662																																							uc002zji.3		NA																	3	Substitution - Missense(2)|Substitution - Nonsense(1)		lung(3)	ovary(4)|breast(2)|pancreas(2)	8						c.(2524-2526)GAG>CAG		pericentrin							69.0	81.0	77.0					21																	47783764		2193	4278	6471	SO:0001583	missense	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47783764G>C	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.2524G>C	21.37:g.47783764G>C	ENSP00000352572:p.Glu842Gln					PCNT_uc002zjj.2_Missense_Mutation_p.E724Q	p.E842Q	NM_006031	NP_006022	O95613	PCNT_HUMAN			14	2631	+	Breast(49;0.112)		842					O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	c.2524G>C	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.039311	0.35989	.	.	ENSG00000160299	ENST00000359568	T	0.25414	1.8	4.43	3.52	0.40303	.	0.000000	0.33346	N	0.005003	T	0.42108	0.1188	M	0.64997	1.995	0.31989	N	0.604906	P;D	0.76494	0.773;0.999	B;D	0.64144	0.273;0.922	T	0.50591	-0.8810	10	0.30854	T	0.27	.	11.972	0.53069	0.0:0.3333:0.6667:0.0	.	724;842	O95613-2;O95613	.;PCNT_HUMAN	Q	842	ENSP00000352572:E842Q	ENSP00000352572:E842Q	E	+	1	0	PCNT	46608192	0.939000	0.31865	0.869000	0.34112	0.269000	0.26545	3.996000	0.57009	0.816000	0.34421	0.491000	0.48974	GAG		0.662	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		107	88	0	0	0	0.01441	0	107	88				
CCT8L2	150160	broad.mit.edu	37	22	17072821	17072821	+	Missense_Mutation	SNP	G	G	T	rs376606608		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr22:17072821G>T	ENST00000359963.3	-	1	879	c.620C>A	c.(619-621)gCg>gAg	p.A207E		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	207					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.A207G(1)|p.A207V(1)|p.A207E(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CCCGGGCAGCGCGCACACCCC	0.617																																							uc002zlp.1		NA																	3	Substitution - Missense(3)	p.A207V(1)	lung(2)|ovary(1)	ovary(1)	1						c.(619-621)GCG>GAG		T-complex protein 1							64.0	63.0	63.0					22																	17072821		2203	4300	6503	SO:0001583	missense	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17072821G>T	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.620C>A	22.37:g.17072821G>T	ENSP00000353048:p.Ala207Glu						p.A207E	NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN			1	880	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	207					A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	c.620C>A	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	g	10.46	1.357622	0.24598	.	.	ENSG00000198445	ENST00000359963	T	0.77877	-1.13	1.78	1.78	0.24846	.	1.965940	0.03364	U	0.197938	T	0.72153	0.3425	N	0.22421	0.69	0.09310	N	1	B	0.29886	0.26	B	0.39738	0.308	T	0.64141	-0.6477	10	0.66056	D	0.02	-1.6843	7.0003	0.24805	0.0:0.0:1.0:0.0	.	207	Q96SF2	TCPQM_HUMAN	E	207	ENSP00000353048:A207E	ENSP00000353048:A207E	A	-	2	0	CCT8L2	15452821	0.385000	0.25172	0.019000	0.16419	0.030000	0.12068	0.334000	0.19787	0.995000	0.38917	0.379000	0.24179	GCG		0.617	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			35	149	1	0	1.836e-18	0.003755	2.16128e-18	35	149				
ZNF70	7621	broad.mit.edu	37	22	24087099	24087099	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr22:24087099G>A	ENST00000341976.3	-	2	689	c.229C>T	c.(229-231)Caa>Taa	p.Q77*		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	77					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q77*(2)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						GGGATACTTTGATGCTGAACA	0.488																																							uc002zxs.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)	2						c.(229-231)CAA>TAA		zinc finger protein 70							135.0	131.0	132.0					22																	24087099		2203	4300	6503	SO:0001587	stop_gained	7621					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr22:24087099G>A	X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.229C>T	22.37:g.24087099G>A	ENSP00000339314:p.Gln77*					ZNF70_uc002zxr.1_5'Flank	p.Q77*	NM_021916	NP_068735	Q9UC06	ZNF70_HUMAN			2	690	-			77						Nonsense_Mutation	SNP	ENST00000341976.3	37	c.229C>T	CCDS13812.1	.	.	.	.	.	.	.	.	.	.	G	38	6.723396	0.97788	.	.	ENSG00000187792	ENST00000341976	.	.	.	3.48	3.48	0.39840	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	13.3151	0.60403	0.0:0.0:1.0:0.0	.	.	.	.	X	77	.	ENSP00000339314:Q77X	Q	-	1	0	ZNF70	22417099	0.005000	0.15991	0.023000	0.16930	0.963000	0.63663	1.130000	0.31393	2.250000	0.74265	0.585000	0.79938	CAA		0.488	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319881.1	NM_021916		55	202	0	0	0	0.01441	0	55	202				
SEZ6L	23544	broad.mit.edu	37	22	26747039	26747039	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr22:26747039G>T	ENST00000248933.6	+	12	2524	c.2429G>T	c.(2428-2430)gGa>gTa	p.G810V	SEZ6L_ENST00000404234.3_Missense_Mutation_p.G810V|SEZ6L_ENST00000360929.3_Intron|SEZ6L_ENST00000343706.4_Missense_Mutation_p.G810V|SEZ6L_ENST00000403121.1_Missense_Mutation_p.G583V|SEZ6L_ENST00000402979.1_Missense_Mutation_p.G583V|SEZ6L_ENST00000411842.2_Missense_Mutation_p.G7V|SEZ6L_ENST00000529632.2_Missense_Mutation_p.G810V			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	810	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.G810V(2)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						ACCGACCCCGGAGAGGTGGAT	0.527																																							uc003acb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(2428-2430)GGA>GTA		seizure related 6 homolog (mouse)-like							96.0	86.0	89.0					22																	26747039		2203	4300	6503	SO:0001583	missense	23544					endoplasmic reticulum membrane|integral to membrane		g.chr22:26747039G>T	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2429G>T	22.37:g.26747039G>T	ENSP00000248933:p.Gly810Val					SEZ6L_uc003acc.2_Missense_Mutation_p.G810V|SEZ6L_uc011akc.1_Missense_Mutation_p.G810V|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Missense_Mutation_p.G810V|SEZ6L_uc003ace.2_Missense_Mutation_p.G810V|SEZ6L_uc003acf.1_Missense_Mutation_p.G583V|SEZ6L_uc010gvc.1_Missense_Mutation_p.G583V|SEZ6L_uc011ake.1_RNA	p.G810V	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN			12	2585	+			810			Sushi 4.|Extracellular (Potential).		A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	c.2429G>T	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	g	18.41	3.617572	0.66787	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979;ENST00000411842	T;T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	4.54	4.54	0.55810	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.53938	D	0.000059	D	0.82669	0.5087	M	0.90082	3.085	0.80722	D	1	D;D;D;D;P;D	0.89917	0.982;0.986;0.995;1.0;0.933;0.986	D;D;D;D;P;D	0.97110	0.915;0.943;0.986;1.0;0.876;0.943	D	0.86917	0.2064	10	0.87932	D	0	.	16.5015	0.84257	0.0:0.0:1.0:0.0	.	810;810;583;810;810;810	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	V	810;810;810;810;583;583;7	ENSP00000384772:G810V;ENSP00000437037:G810V;ENSP00000248933:G810V;ENSP00000342661:G810V;ENSP00000384838:G583V;ENSP00000384733:G583V;ENSP00000397274:G7V	ENSP00000248933:G810V	G	+	2	0	SEZ6L	25077039	1.000000	0.71417	0.894000	0.35097	0.428000	0.31595	8.815000	0.91973	2.381000	0.81170	0.539000	0.68188	GGA		0.527	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3			31	214	1	0	9.8876e-21	0.004878	1.18731e-20	31	214				
MN1	4330	broad.mit.edu	37	22	28193194	28193194	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr22:28193194G>A	ENST00000302326.4	-	1	4292	c.3338C>T	c.(3337-3339)tCg>tTg	p.S1113L		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	1113					intramembranous ossification (GO:0001957)			p.S1113L(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						GTCAGGGGTCGAGGTAGAGTT	0.751			T	ETV6	"""AML, meningioma"""																																		uc003adj.2		NA		Dom	yes		22	22q13	4330	T	meningioma (disrupted in balanced translocation) 1			"""L, O"""	ETV6		AML|meningioma		1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						c.(3337-3339)TCG>TTG		meningioma  1							5.0	6.0	6.0					22																	28193194		1759	3882	5641	SO:0001583	missense	4330						binding	g.chr22:28193194G>A	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.3338C>T	22.37:g.28193194G>A	ENSP00000304956:p.Ser1113Leu						p.S1113L	NM_002430	NP_002421	Q10571	MN1_HUMAN			1	4293	-			1113					A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	37	c.3338C>T	CCDS42998.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.288541	0.59976	.	.	ENSG00000169184	ENST00000302326	T	0.56103	0.48	4.3	4.3	0.51218	.	0.000000	0.64402	D	0.000002	T	0.60196	0.2250	L	0.27053	0.805	0.53005	D	0.999964	D	0.89917	1.0	D	0.81914	0.995	T	0.64681	-0.6350	10	0.59425	D	0.04	-6.0929	15.6005	0.76620	0.0:0.0:1.0:0.0	.	1113	Q10571	MN1_HUMAN	L	1113	ENSP00000304956:S1113L	ENSP00000304956:S1113L	S	-	2	0	MN1	26523194	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	6.888000	0.75622	2.238000	0.73509	0.456000	0.33151	TCG		0.751	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430		6	10	0	0	0	0.001168	0	6	10				
GAS2L1	10634	broad.mit.edu	37	22	29704500	29704500	+	Silent	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr22:29704500C>T	ENST00000406549.3	+	2	555	c.405C>T	c.(403-405)agC>agT	p.S135S	GAS2L1_ENST00000403764.1_Silent_p.S135S|GAS2L1_ENST00000407854.1_Silent_p.S135S|GAS2L1_ENST00000471961.1_Silent_p.S135S|GAS2L1_ENST00000407647.2_Silent_p.S135S|GAS2L1_ENST00000341313.6_Silent_p.S135S|GAS2L1_ENST00000360113.2_Silent_p.S135S	NM_001278730.1	NP_001265659.1	Q99501	GA2L1_HUMAN	growth arrest-specific 2 like 1	135	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell cycle arrest (GO:0007050)|cellular response to starvation (GO:0009267)|cellular response to thyroid hormone stimulus (GO:0097067)|microtubule bundle formation (GO:0001578)|negative regulation of cell growth (GO:0030308)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of gene expression (GO:0010629)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)|thyroid hormone receptor binding (GO:0046966)	p.S135S(2)		endometrium(2)|lung(2)|prostate(1)	5						ACGAGAAGAGCGTGGTGCTGT	0.667																																							uc003afa.1		NA																	2	Substitution - coding silent(2)		endometrium(2)		0						c.(403-405)AGC>AGT		growth arrest-specific 2 like 1 isoform a							44.0	47.0	46.0					22																	29704500		2200	4299	6499	SO:0001819	synonymous_variant	10634				cell cycle arrest	cytoplasm|cytoskeleton		g.chr22:29704500C>T	BC001782	CCDS63438.1, CCDS74840.1	22q12.2	2008-06-11			ENSG00000185340	ENSG00000185340			16955	protein-coding gene	gene with protein product		602128				8975699, 12584248, 1607387	Standard	NM_001278730		Approved	GAR22	uc003afc.1	Q99501	OTTHUMG00000151108	ENST00000406549.3:c.405C>T	22.37:g.29704500C>T						GAS2L1_uc010gvm.1_Silent_p.S135S|GAS2L1_uc003afb.1_Silent_p.S135S|GAS2L1_uc003afc.1_Silent_p.S135S|GAS2L1_uc003afd.1_Silent_p.S135S|GAS2L1_uc003afe.1_Silent_p.S135S	p.S135S	NM_152236	NP_689422	Q99501	GA2L1_HUMAN			2	604	+			135			CH.		B5MCR7|Q53EN7|Q92640|Q9BUY9	Silent	SNP	ENST00000406549.3	37	c.405C>T																																																																																					0.667	GAS2L1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000321365.1	NM_006478		5	30	0	0	0	0.000602	0	5	30				
TEX33	339669	broad.mit.edu	37	22	37387544	37387544	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr22:37387544A>T	ENST00000405091.2	-	6	974	c.723T>A	c.(721-723)caT>caA	p.H241Q	TEX33_ENST00000402860.3_Missense_Mutation_p.H156Q|TEX33_ENST00000381821.1_Missense_Mutation_p.H241Q			O43247	TEX33_HUMAN	testis expressed 33	241								p.H156Q(2)									TCTTCCTGCCATGCCAGTGTT	0.542																																							uc003aqf.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(721-723)CAT>CAA		hypothetical protein LOC339669 isoform 1							196.0	164.0	175.0					22																	37387544		2203	4300	6503	SO:0001583	missense	339669							g.chr22:37387544A>T	BC042635	CCDS13937.1, CCDS54524.1	22q12.3	2013-10-11	2012-02-16	2012-02-16	ENSG00000185264	ENSG00000185264			28568	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 33"""	C22orf33		22332119	Standard	NM_178552		Approved	MGC35206, EAN57	uc003aqf.3	O43247	OTTHUMG00000150531	ENST00000405091.2:c.723T>A	22.37:g.37387544A>T	ENSP00000386118:p.His241Gln					C22orf33_uc003aqe.2_Missense_Mutation_p.H156Q	p.H241Q	NM_001163857	NP_001157329	O43247	EAN57_HUMAN			5	869	-			241					B1AH46|Q6ICF2|Q8IVQ2|Q9Y4V8	Missense_Mutation	SNP	ENST00000405091.2	37	c.723T>A	CCDS54524.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.2|20.2	3.957236|3.957236	0.73902|0.73902	.|.	.|.	ENSG00000185264|ENSG00000185264	ENST00000402860;ENST00000405091;ENST00000381821|ENST00000442538	.|.	.|.	.|.	5.11|5.11	-4.3|-4.3	0.03710|0.03710	.|.	0.000000|.	0.64402|.	D|.	0.000014|.	T|T	0.49064|0.49064	0.1535|0.1535	L|L	0.32530|0.32530	0.975|0.975	0.36455|0.36455	D|D	0.866355|0.866355	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.50491|0.50491	-0.8822|-0.8822	9|5	0.62326|.	D|.	0.03|.	-18.9769|-18.9769	13.6107|13.6107	0.62076|0.62076	0.3101:0.0:0.6899:0.0|0.3101:0.0:0.6899:0.0	.|.	241|.	O43247|.	EAN57_HUMAN|.	Q|R	156;241;241|100	.|.	ENSP00000371243:H241Q|.	H|W	-|-	3|1	2|0	C22orf33|C22orf33	35717490|35717490	0.292000|0.292000	0.24362|0.24362	0.964000|0.964000	0.40570|0.40570	0.912000|0.912000	0.54170|0.54170	-0.892000|-0.892000	0.04131|0.04131	-0.821000|-0.821000	0.04312|0.04312	-0.376000|-0.376000	0.06991|0.06991	CAT|TGG		0.542	TEX33-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318778.2	NM_178552		120	209	0	0	0	0.01441	0	120	209				
GADL1	339896	broad.mit.edu	37	3	30769763	30769763	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:30769763C>T	ENST00000282538.5	-	15	1687	c.1537G>A	c.(1537-1539)Gag>Aag	p.E513K	GADL1_ENST00000498387.1_5'UTR	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	513					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)	p.E513K(2)|p.E329K(2)		breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						AAGTCTATCTCATCCAGGAGG	0.537																																							uc003cep.2		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(1537-1539)GAG>AAG		glutamate decarboxylase-like 1	Pyridoxal Phosphate(DB00114)						150.0	143.0	146.0					3																	30769763		2203	4300	6503	SO:0001583	missense	339896				carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding	g.chr3:30769763C>T	AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.1537G>A	3.37:g.30769763C>T	ENSP00000282538:p.Glu513Lys						p.E513K	NM_207359	NP_997242	Q6ZQY3	GADL1_HUMAN			15	1584	-			513						Missense_Mutation	SNP	ENST00000282538.5	37	c.1537G>A	CCDS2649.2	.	.	.	.	.	.	.	.	.	.	C	36	5.789354	0.96945	.	.	ENSG00000144644	ENST00000282538	T	0.38401	1.14	5.91	5.91	0.95273	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.239200	0.39083	N	0.001474	T	0.65407	0.2688	M	0.86573	2.825	0.80722	D	1	D	0.69078	0.997	D	0.63192	0.912	T	0.66304	-0.5957	10	0.44086	T	0.13	1.8985	20.2896	0.98541	0.0:1.0:0.0:0.0	.	513	Q6ZQY3	GADL1_HUMAN	K	513	ENSP00000282538:E513K	ENSP00000282538:E513K	E	-	1	0	GADL1	30744767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.484000	0.81180	2.794000	0.96219	0.655000	0.94253	GAG		0.537	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253106.2	NM_207359		58	152	0	0	0	0.01441	0	58	152				
CCR8	1237	broad.mit.edu	37	3	39374435	39374435	+	Missense_Mutation	SNP	T	T	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:39374435T>G	ENST00000326306.4	+	2	751	c.613T>G	c.(613-615)Tta>Gta	p.L205V	CCR8_ENST00000414803.1_3'UTR|CCR8_ENST00000545843.1_Missense_Mutation_p.L122V	NM_005201.3	NP_005192.1	P51685	CCR8_HUMAN	chemokine (C-C motif) receptor 8	205					cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)	p.L205V(1)		NS(3)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0504)|Kidney(284;0.0635)		AATGAACATTTTAGGCTTGTT	0.398																																							uc010hhr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(613-615)TTA>GTA		chemokine (C-C motif) receptor 8							113.0	112.0	113.0					3																	39374435		2203	4300	6503	SO:0001583	missense	1237				cell adhesion|chemotaxis|elevation of cytosolic calcium ion concentration|immune response	integral to plasma membrane	coreceptor activity	g.chr3:39374435T>G	D49919	CCDS2684.1	3p22	2012-08-08			ENSG00000179934	ENSG00000179934		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1609	protein-coding gene	gene with protein product		601834		CMKBRL2, CMKBR8		8816377, 8886020	Standard	NM_005201		Approved	CY6, TER1, CKR-L1, GPR-CY6, CDw198	uc010hhr.2	P51685	OTTHUMG00000131290	ENST00000326306.4:c.613T>G	3.37:g.39374435T>G	ENSP00000326432:p.Leu205Val					CCR8_uc003cjm.2_Missense_Mutation_p.L122V	p.L205V	NM_005201	NP_005192	P51685	CCR8_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0504)|Kidney(284;0.0635)	2	751	+			205			Helical; Name=5; (Potential).		B2RC64|Q3KNQ8|Q3KNR3|Q9BYX5	Missense_Mutation	SNP	ENST00000326306.4	37	c.613T>G	CCDS2684.1	.	.	.	.	.	.	.	.	.	.	T	9.832	1.188584	0.21954	.	.	ENSG00000179934	ENST00000326306;ENST00000545843	T;T	0.39229	1.09;1.09	4.76	2.3	0.28687	GPCR, rhodopsin-like superfamily (1);	0.209262	0.23162	N	0.051231	T	0.36026	0.0952	L	0.54908	1.71	0.45066	D	0.998084	B;B	0.19817	0.039;0.039	B;B	0.29785	0.107;0.107	T	0.32107	-0.9919	10	0.87932	D	0	.	4.3756	0.11269	0.0:0.1383:0.2016:0.66	.	205;122	P51685;Q3KNR3	CCR8_HUMAN;.	V	205;122	ENSP00000326432:L205V;ENSP00000440474:L122V	ENSP00000326432:L205V	L	+	1	2	CCR8	39349439	0.000000	0.05858	0.834000	0.33040	0.500000	0.33767	-0.925000	0.03992	0.819000	0.34492	0.533000	0.62120	TTA		0.398	CCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254058.2	NM_005201		56	53	0	0	0	0.01441	0	56	53				
COL7A1	1294	broad.mit.edu	37	3	48626185	48626185	+	Missense_Mutation	SNP	G	G	C	rs201299454		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:48626185G>C	ENST00000328333.8	-	19	2584	c.2477C>G	c.(2476-2478)aCa>aGa	p.T826R	COL7A1_ENST00000454817.1_Missense_Mutation_p.T826R	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	826	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGCAGAGTCTGTGTTTCCTGG	0.607																																							uc003ctz.2		NA																	0				ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11						c.(2476-2478)ACA>AGA		alpha 1 type VII collagen precursor							67.0	62.0	64.0					3																	48626185		2203	4300	6503	SO:0001583	missense	1294				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity	g.chr3:48626185G>C	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.2477C>G	3.37:g.48626185G>C	ENSP00000332371:p.Thr826Arg						p.T826R	NM_000094	NP_000085	Q02388	CO7A1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	19	2478	-			826			Nonhelical region (NC1).|Fibronectin type-III 7.		Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	c.2477C>G	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.426774	0.25726	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.59906	0.23;0.23	5.36	1.35	0.21983	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.291630	0.24180	N	0.040819	T	0.34454	0.0898	N	0.19112	0.55	0.21579	N	0.99963	B	0.11235	0.004	B	0.15052	0.012	T	0.16276	-1.0408	10	0.51188	T	0.08	.	2.5048	0.04642	0.1671:0.1446:0.529:0.1593	.	826	Q02388	CO7A1_HUMAN	R	826	ENSP00000332371:T826R;ENSP00000412569:T826R	ENSP00000332371:T826R	T	-	2	0	COL7A1	48601189	0.111000	0.22076	0.718000	0.30602	0.986000	0.74619	0.360000	0.20250	0.288000	0.22398	0.561000	0.74099	ACA		0.607	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		52	55	0	0	0	0.01441	0	52	55				
MANF	7873	broad.mit.edu	37	3	51425216	51425216	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:51425216G>A	ENST00000528157.1	+	3	567	c.271G>A	c.(271-273)Gag>Aag	p.E91K	MANF_ENST00000470900.1_3'UTR	NM_006010.4	NP_006001.3	P55145	MANF_HUMAN	mesencephalic astrocyte-derived neurotrophic factor	91					response to unfolded protein (GO:0006986)|vasoconstriction of artery involved in ischemic response to lowering of systemic arterial blood pressure (GO:0002014)	extracellular space (GO:0005615)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)	p.E91K(1)|p.E94K(1)		lung(1)|ovary(1)	2						AATCATCAATGAGGTATCAAA	0.483																																							uc003dbc.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(280-282)GAG>AAG		mesencephalic astrocyte-derived neurotrophic							89.0	88.0	88.0					3																	51425216		2011	4191	6202	SO:0001583	missense	7873				response to unfolded protein	extracellular region	growth factor activity	g.chr3:51425216G>A	M83751	CCDS46836.1, CCDS46836.2	3p21.1	2010-12-09	2009-06-04	2009-06-04	ENSG00000145050	ENSG00000145050			15461	protein-coding gene	gene with protein product		601916	"""arginine-rich, mutated in early stage tumors"""	ARMET		12794311	Standard	NM_006010		Approved	ARP	uc003dbc.3	P55145	OTTHUMG00000156897	ENST00000528157.1:c.271G>A	3.37:g.51425216G>A	ENSP00000432799:p.Glu91Lys						p.E94K	NM_006010	NP_006001	P55145	MANF_HUMAN			3	342	+			91					Q14CX4|Q86U67|Q96IS4	Missense_Mutation	SNP	ENST00000528157.1	37	c.280G>A	CCDS46836.2	.	.	.	.	.	.	.	.	.	.	G	37	5.999602	0.97189	.	.	ENSG00000145050	ENST00000528157;ENST00000273628	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.85788	0.5778	M	0.88105	2.93	0.80722	D	1	D	0.64830	0.994	D	0.81914	0.995	D	0.87125	0.2193	9	0.87932	D	0	.	20.3789	0.98926	0.0:0.0:1.0:0.0	.	91	P55145	MANF_HUMAN	K	91;94	.	ENSP00000273628:E94K	E	+	1	0	MANF	51400256	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	9.869000	0.99810	2.826000	0.97356	0.563000	0.77884	GAG		0.483	MANF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346490.3	NM_006010		11	22	0	0	0	0.008291	0	11	22				
VPRBP	9730	broad.mit.edu	37	3	51440599	51440599	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:51440599C>A	ENST00000335891.5	-	16	3105	c.3096G>T	c.(3094-3096)gaG>gaT	p.E1032D				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	1481					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)	p.E1485D(2)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		TCAGTTCCACCTCCTCATCTG	0.527																																							uc003dbe.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(4441-4443)GAG>GAT		HIV-1 Vpr binding protein							123.0	124.0	124.0					3																	51440599		2082	4221	6303	SO:0001583	missense	9730				interspecies interaction between organisms	cytoplasm|nucleus	protein binding	g.chr3:51440599C>A	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.3096G>T	3.37:g.51440599C>A	ENSP00000338857:p.Glu1032Asp					VPRBP_uc003dbf.1_Missense_Mutation_p.E757D	p.E1481D	NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)	23	4611	-			1481			Asp/Glu-rich (acidic).|Interaction with NF2.		Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	ENST00000335891.5	37	c.4443G>T		.	.	.	.	.	.	.	.	.	.	C	15.32	2.798278	0.50208	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.55413	0.52;0.52	5.53	1.49	0.22878	.	0.249325	0.45867	D	0.000329	T	0.28366	0.0701	N	0.08118	0	0.43010	D	0.994547	B	0.14438	0.01	B	0.14023	0.01	T	0.03773	-1.1005	10	0.34782	T	0.22	-14.0458	8.7677	0.34713	0.0:0.2409:0.0:0.7591	.	1481	Q9Y4B6	VPRBP_HUMAN	D	1052;1032	ENSP00000393183:E1052D;ENSP00000338857:E1032D	ENSP00000338857:E1032D	E	-	3	2	VPRBP	51415639	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.513000	0.22770	0.043000	0.15746	-0.455000	0.05494	GAG		0.527	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703		33	26	1	0	1.49673e-21	0.00623	1.80453e-21	33	26				
MINA	84864	broad.mit.edu	37	3	97669652	97669652	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:97669652C>T	ENST00000333396.7	-	6	1448	c.866G>A	c.(865-867)gGc>gAc	p.G289D	MINA_ENST00000360258.4_Missense_Mutation_p.G289D|MINA_ENST00000394198.2_Missense_Mutation_p.G289D	NM_001042533.2|NM_032778.5	NP_001035998.1|NP_116167.3			MYC induced nuclear antigen											breast(2)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)	13						CCGGGGTATGCCGGTCCGTAA	0.532																																							uc003drz.1		NA																	0				ovary(1)	1						c.(865-867)GGC>GAC		MYC induced nuclear antigen isoform a							90.0	83.0	85.0					3																	97669652		2203	4300	6503	SO:0001583	missense	84864				ribosome biogenesis	cytoplasm|nucleolus		g.chr3:97669652C>T	AB083189	CCDS2929.1, CCDS43114.1	3q22.1	2005-07-22			ENSG00000170854	ENSG00000170854			19441	protein-coding gene	gene with protein product		612049				12091391	Standard	NM_001042533		Approved	MINA53, FLJ14393, mdig	uc003dsb.1	Q8IUF8	OTTHUMG00000160107	ENST00000333396.7:c.866G>A	3.37:g.97669652C>T	ENSP00000328251:p.Gly289Asp					MINA_uc003dry.1_5'Flank|MINA_uc003dsa.1_Missense_Mutation_p.G289D|MINA_uc003dsb.1_Missense_Mutation_p.G289D|MINA_uc003dsc.1_Missense_Mutation_p.G289D|MINA_uc010hpa.1_RNA	p.G289D	NM_001042533	NP_001035998	Q8IUF8	MINA_HUMAN			6	1372	-			289						Missense_Mutation	SNP	ENST00000333396.7	37	c.866G>A	CCDS43114.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.666304	0.88251	.	.	ENSG00000170854	ENST00000442492;ENST00000333396;ENST00000394198;ENST00000360258	T;T;T	0.18502	2.21;2.21;2.21	5.91	5.91	0.95273	Cupin, JmjC-type (1);	0.044809	0.85682	D	0.000000	T	0.47820	0.1466	M	0.85710	2.77	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.991;0.995	T	0.32561	-0.9902	10	0.22109	T	0.4	-16.5243	20.2985	0.98592	0.0:1.0:0.0:0.0	.	289;289	Q8IUF8-4;Q8IUF8	.;MINA_HUMAN	D	35;289;289;289	ENSP00000328251:G289D;ENSP00000377748:G289D;ENSP00000353395:G289D	ENSP00000328251:G289D	G	-	2	0	MINA	99152342	1.000000	0.71417	0.955000	0.39395	0.680000	0.39746	6.189000	0.72051	2.793000	0.96121	0.655000	0.94253	GGC		0.532	MINA-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359244.3	NM_032778		5	188	0	0	0	0.000602	0	5	188				
OR5H14	403273	broad.mit.edu	37	3	97868579	97868579	+	Missense_Mutation	SNP	C	C	A	rs538919993	byFrequency	TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:97868579C>A	ENST00000437310.1	+	1	410	c.350C>A	c.(349-351)aCa>aAa	p.T117K	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTCTTGGCAACAATGGCATAT	0.388																																							uc003dsg.1		NA																	0				skin(1)	1						c.(349-351)ACA>AAA		olfactory receptor, family 5, subfamily H,							139.0	147.0	144.0					3																	97868579		2203	4299	6502	SO:0001583	missense	403273				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97868579C>A		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.350C>A	3.37:g.97868579C>A	ENSP00000401706:p.Thr117Lys						p.T117K	NM_001005514	NP_001005514	A6NHG9	O5H14_HUMAN			1	350	+			117			Helical; Name=3; (Potential).		B9EH15	Missense_Mutation	SNP	ENST00000437310.1	37	c.350C>A	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	C	4.170	0.030010	0.08101	.	.	ENSG00000236032	ENST00000437310	T	0.01359	4.98	2.49	0.382	0.16234	GPCR, rhodopsin-like superfamily (1);	1.530120	0.04295	N	0.346275	T	0.02571	0.0078	M	0.65677	2.01	0.09310	N	1	B	0.31174	0.311	B	0.31442	0.13	T	0.44772	-0.9306	10	0.87932	D	0	.	4.7776	0.13187	0.0:0.6171:0.2302:0.1526	.	117	A6NHG9	O5H14_HUMAN	K	117	ENSP00000401706:T117K	ENSP00000401706:T117K	T	+	2	0	OR5H14	99351269	0.000000	0.05858	0.202000	0.23494	0.098000	0.18820	-0.044000	0.12023	0.296000	0.22592	0.195000	0.17529	ACA		0.388	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1			49	101	1	0	1.07234e-20	0.01441	1.28252e-20	49	101				
TOMM70A	9868	broad.mit.edu	37	3	100100548	100100548	+	Silent	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:100100548C>A	ENST00000284320.5	-	5	1243	c.795G>T	c.(793-795)acG>acT	p.T265T		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	265					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)	p.T265T(2)		endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						TGATATCATCCGTGAAAGAAC	0.378																																							uc003dtw.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(793-795)ACG>ACT		translocase of outer mitochondrial membrane 70							173.0	161.0	165.0					3																	100100548		2203	4300	6503	SO:0001819	synonymous_variant	9868				protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane translocase complex	protein binding|protein transmembrane transporter activity	g.chr3:100100548C>A	AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.795G>T	3.37:g.100100548C>A							p.T265T	NM_014820	NP_055635	O94826	TOM70_HUMAN			5	1227	-			265			Cytoplasmic (Potential).		D3DN48	Silent	SNP	ENST00000284320.5	37	c.795G>T	CCDS33807.1																																																																																				0.378	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353141.2			42	59	1	0	6.45866e-13	0.00874	7.12597e-13	42	59				
MORC1	27136	broad.mit.edu	37	3	108776234	108776234	+	Silent	SNP	G	G	A	rs144305402		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:108776234G>A	ENST00000483760.1	-	13	1174	c.1131C>T	c.(1129-1131)atC>atT	p.I377I	MORC1_ENST00000232603.5_Silent_p.I377I					MORC family CW-type zinc finger 1									p.I377I(2)		breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						CATGCATTTTGATCAAACGGT	0.388																																							uc003dxl.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|skin(3)|breast(2)	8						c.(1129-1131)ATC>ATT		MORC family CW-type zinc finger 1		G		0,4406		0,0,2203	125.0	119.0	121.0		1131	3.7	1.0	3	dbSNP_134	121	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	MORC1	NM_014429.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		377/985	108776234	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	27136				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding	g.chr3:108776234G>A	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.1131C>T	3.37:g.108776234G>A						MORC1_uc011bhn.1_Silent_p.I377I	p.I377I	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN			13	1218	-			377						Silent	SNP	ENST00000483760.1	37	c.1131C>T																																																																																					0.388	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1			41	69	0	0	0	0.00874	0	41	69				
ATP6V1A	523	broad.mit.edu	37	3	113505180	113505180	+	Silent	SNP	A	A	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:113505180A>C	ENST00000273398.3	+	6	774	c.666A>C	c.(664-666)ccA>ccC	p.P222P	ATP6V1A_ENST00000538620.1_Silent_p.P189P	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	222					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.P222P(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	AGAAGCTGCCAGCCAATCATC	0.463																																							uc003eao.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(1)	3						c.(664-666)CCA>CCC		ATPase, H+ transporting, lysosomal V1 subunit A							204.0	185.0	192.0					3																	113505180		2203	4300	6503	SO:0001819	synonymous_variant	523				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism	g.chr3:113505180A>C	L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.666A>C	3.37:g.113505180A>C						ATP6V1A_uc011bik.1_Silent_p.P189P	p.P222P	NM_001690	NP_001681	P38606	VATA_HUMAN			6	732	+			222					B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Silent	SNP	ENST00000273398.3	37	c.666A>C	CCDS2976.1																																																																																				0.463	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354457.1	NM_001690		41	223	0	0	0	0.009718	0	41	223				
CHCHD6	84303	broad.mit.edu	37	3	126676372	126676372	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:126676372G>A	ENST00000290913.3	+	7	773	c.680G>A	c.(679-681)cGc>cAc	p.R227H	CHCHD6_ENST00000508789.1_Missense_Mutation_p.R228H	NM_032343.2	NP_115719.1	Q9BRQ6	MIC25_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 6	227	CHCH.				cellular response to DNA damage stimulus (GO:0006974)|cristae formation (GO:0042407)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)		p.R227H(1)		endometrium(2)|large_intestine(3)|lung(3)	8						GCATACCAGCGCTGCGTGAGC	0.617																																							uc003ejf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(679-681)CGC>CAC		coiled-coil-helix-coiled-coil-helix domain							39.0	29.0	32.0					3																	126676372		2197	4296	6493	SO:0001583	missense	84303							g.chr3:126676372G>A	BC006123	CCDS3041.1	3q21.3	2012-04-17			ENSG00000159685	ENSG00000159685		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28184	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 23"", ""coiled-coil-helix cristae morphology 1"""	615634				17624330, 22228767	Standard	NM_032343		Approved	MGC13016, PPP1R23, CHCM1	uc003ejf.2	Q9BRQ6	OTTHUMG00000159601	ENST00000290913.3:c.680G>A	3.37:g.126676372G>A	ENSP00000290913:p.Arg227His					CHCHD6_uc010hsj.1_Missense_Mutation_p.R228H	p.R227H	NM_032343	NP_115719	Q9BRQ6	CHCH6_HUMAN			7	718	+			227			CHCH.		D6R9U0|D6RIB4|H8Y0Y7	Missense_Mutation	SNP	ENST00000290913.3	37	c.680G>A	CCDS3041.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.343|5.343	0.248582|0.248582	0.10130|0.10130	.|.	.|.	ENSG00000159685|ENSG00000159685	ENST00000513253|ENST00000290913;ENST00000508789	.|T;T	.|0.42131	.|0.98;0.98	4.22|4.22	-1.42|-1.42	0.08913|0.08913	.|.	.|1.163790	.|0.06206	.|N	.|0.684215	T|T	0.15609|0.15609	0.0376|0.0376	N|N	0.01454|0.01454	-0.855|-0.855	0.27783|0.27783	N|N	0.943091|0.943091	.|B;B	.|0.16396	.|0.014;0.017	.|B;B	.|0.08055	.|0.003;0.003	T|T	0.29427|0.29427	-1.0012|-1.0012	5|10	.|0.10636	.|T	.|0.68	-1.4428|-1.4428	9.5654|9.5654	0.39396|0.39396	0.4418:0.0:0.5582:0.0|0.4418:0.0:0.5582:0.0	.|.	.|228;227	.|D6R9U0;Q9BRQ6	.|.;CHCH6_HUMAN	T|H	158|227;228	.|ENSP00000290913:R227H;ENSP00000422912:R228H	.|ENSP00000290913:R227H	A|R	+|+	1|2	0|0	CHCHD6|CHCHD6	128159062|128159062	0.998000|0.998000	0.40836|0.40836	0.978000|0.978000	0.43139|0.43139	0.765000|0.765000	0.43378|0.43378	0.358000|0.358000	0.20216|0.20216	-0.582000|-0.582000	0.05929|0.05929	-0.373000|-0.373000	0.07131|0.07131	GCT|CGC		0.617	CHCHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356432.1	NM_032343		16	22	0	0	0	0.004007	0	16	22				
PLXND1	23129	broad.mit.edu	37	3	129308193	129308193	+	Splice_Site	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:129308193C>T	ENST00000324093.4	-	2	1667		c.e2+1		RN7SL752P_ENST00000463779.2_RNA|PLXND1_ENST00000393239.1_Splice_Site	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)	p.?(1)	PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						ACCATACCTACCTTGAGAAGC	0.667																																					Ovarian(97;366 1484 3738 22084 39045)	Ovarian(97;366 1484 3738 22084 39045)	uc003emx.2		NA																	1	Unknown(1)		lung(1)	large_intestine(1)	1						c.e2+1		plexin D1 precursor							31.0	28.0	29.0					3																	129308193		2203	4300	6503	SO:0001630	splice_region_variant	23129				axon guidance	integral to membrane|intracellular|plasma membrane		g.chr3:129308193C>T	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.1488+1G>A	3.37:g.129308193C>T							p.K496_splice	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN			2	1588	-								A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Splice_Site	SNP	ENST00000324093.4	37	c.1488_splice	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.113311	0.37339	.	.	ENSG00000004399	ENST00000324093;ENST00000393239;ENST00000505237	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.463	0.87624	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLXND1	130790883	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	6.751000	0.74893	2.184000	0.69523	0.542000	0.68232	.		0.667	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	Intron	10	27	0	0	0	0.013537	0	10	27				
CLSTN2	64084	broad.mit.edu	37	3	139894884	139894884	+	Silent	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:139894884C>T	ENST00000458420.3	+	2	391	c.201C>T	c.(199-201)gcC>gcT	p.A67A		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	67	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.A67A(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CACTGGTAGCCCTGGATAAAG	0.468										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	GBM(45;858 913 3709 36904 37282)	uc003etn.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						c.(199-201)GCC>GCT		calsyntenin 2 precursor							96.0	96.0	96.0					3																	139894884		2203	4300	6503	SO:0001819	synonymous_variant	64084				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding	g.chr3:139894884C>T	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.201C>T	3.37:g.139894884C>T		HNSCC(16;0.037)				CLSTN2_uc003etm.2_Silent_p.A67A	p.A67A	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN			2	391	+			67			Extracellular (Potential).|Cadherin 1.		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Silent	SNP	ENST00000458420.3	37	c.201C>T	CCDS3112.1																																																																																				0.468	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131		8	108	0	0	0	0.004482	0	8	108				
PCOLCE2	26577	broad.mit.edu	37	3	142539807	142539807	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:142539807C>T	ENST00000295992.3	-	8	1336	c.1030G>A	c.(1030-1032)Gag>Aag	p.E344K	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.R264K	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	344	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.E344K(1)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						AAATTTCCCTCTTTGTAGATG	0.507																																							uc003evd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1030-1032)GAG>AAG		procollagen C-endopeptidase enhancer 2							126.0	112.0	117.0					3																	142539807		2203	4300	6503	SO:0001583	missense	26577					extracellular region	collagen binding|heparin binding|peptidase activator activity	g.chr3:142539807C>T	AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.1030G>A	3.37:g.142539807C>T	ENSP00000295992:p.Glu344Lys						p.E344K	NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN			8	1226	-			344			NTR.		B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	ENST00000295992.3	37	c.1030G>A	CCDS3127.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.7|21.7	4.182107|4.182107	0.78677|0.78677	.|.	.|.	ENSG00000163710|ENSG00000163710	ENST00000295992|ENST00000485766	T|T	0.22743|0.23552	1.94|1.9	5.64|5.64	5.64|5.64	0.86602|0.86602	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.47637|0.47637	0.1456|0.1456	M|M	0.72479|0.72479	2.2|2.2	0.32730|0.32730	N|N	0.509049|0.509049	D|.	0.55385|.	0.971|.	P|.	0.56343|.	0.796|.	T|T	0.53982|0.53982	-0.8361|-0.8361	10|6	0.09338|.	T|.	0.73|.	-32.7172|-32.7172	19.6912|19.6912	0.96002|0.96002	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	344|.	Q9UKZ9|.	PCOC2_HUMAN|.	K|K	344|264	ENSP00000295992:E344K|ENSP00000419842:R264K	ENSP00000295992:E344K|.	E|R	-|-	1|2	0|0	PCOLCE2|PCOLCE2	144022497|144022497	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.988000|0.988000	0.76386|0.76386	7.437000|7.437000	0.80417|0.80417	2.641000|2.641000	0.89580|0.89580	0.655000|0.655000	0.94253|0.94253	GAG|AGA		0.507	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363		30	76	0	0	0	0.007291	0	30	76				
FAM43A	131583	broad.mit.edu	37	3	194407563	194407563	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:194407563C>T	ENST00000329759.4	+	1	942	c.8C>T	c.(7-9)cCg>cTg	p.P3L		NM_153690.4	NP_710157.2	Q8N2R8	FA43A_HUMAN	family with sequence similarity 43, member A	3								p.P3L(1)		breast(2)|central_nervous_system(1)|lung(6)|skin(1)	10	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		GAGATGCTGCCGTGGAAGAAG	0.761																																							uc003fuj.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(7-9)CCG>CTG		hypothetical protein LOC131583							9.0	11.0	10.0					3																	194407563		2059	4049	6108	SO:0001583	missense	131583							g.chr3:194407563C>T	AK074503	CCDS33923.1	3q29	2004-07-28			ENSG00000185112	ENSG00000185112			26888	protein-coding gene	gene with protein product						12477932	Standard	NM_153690		Approved	FLJ90022	uc003fuj.3	Q8N2R8	OTTHUMG00000156016	ENST00000329759.4:c.8C>T	3.37:g.194407563C>T	ENSP00000371397:p.Pro3Leu						p.P3L	NM_153690	NP_710157	Q8N2R8	FA43A_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)	1	942	+	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	3					A3KME2|Q8IXP4|Q8WZ07	Missense_Mutation	SNP	ENST00000329759.4	37	c.8C>T	CCDS33923.1	.	.	.	.	.	.	.	.	.	.	C	36	5.926394	0.97110	.	.	ENSG00000185112	ENST00000329759	D	0.83914	-1.78	5.16	5.16	0.70880	.	0.056321	0.64402	D	0.000001	D	0.88396	0.6425	L	0.58101	1.795	0.80722	D	1	D	0.76494	0.999	P	0.61070	0.883	D	0.89670	0.3883	10	0.87932	D	0	-33.8159	17.2284	0.86978	0.0:1.0:0.0:0.0	.	3	Q8N2R8	FA43A_HUMAN	L	3	ENSP00000371397:P3L	ENSP00000371397:P3L	P	+	2	0	FAM43A	195888852	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.218000	0.77991	2.403000	0.81681	0.455000	0.32223	CCG		0.761	FAM43A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342734.1	NM_153690		10	29	0	0	0	0.010729	0	10	29				
TM4SF19	116211	broad.mit.edu	37	3	196050777	196050777	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr3:196050777G>T	ENST00000273695.3	-	5	666	c.541C>A	c.(541-543)Ctg>Atg	p.L181M	TM4SF19_ENST00000442633.1_Missense_Mutation_p.L181M|TM4SF19_ENST00000454715.1_Missense_Mutation_p.L155M|TM4SF19-AS1_ENST00000420226.1_RNA|TM4SF19-AS1_ENST00000444939.1_RNA|TM4SF19_ENST00000446879.1_Missense_Mutation_p.F179L|TM4SF19-AS1_ENST00000452051.1_RNA	NM_001204897.1|NM_138461.3	NP_001191826.1|NP_612470.2	Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19	181						integral component of membrane (GO:0016021)		p.L181M(2)		endometrium(2)|kidney(2)|large_intestine(3)|lung(5)	12	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		CTGATGCACAGAAGGGCGGAG	0.567																																							uc003fwl.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(541-543)CTG>ATG		transmembrane 4 L six family member 19							95.0	89.0	91.0					3																	196050777		2203	4300	6503	SO:0001583	missense	116211					integral to membrane		g.chr3:196050777G>T	BC013113	CCDS3316.1, CCDS56299.1	3q29	2005-08-09			ENSG00000145107	ENSG00000145107			25167	protein-coding gene	gene with protein product						12477932	Standard	NM_138461		Approved		uc021xjs.1	Q96DZ7	OTTHUMG00000155675	ENST00000273695.3:c.541C>A	3.37:g.196050777G>T	ENSP00000273695:p.Leu181Met					TM4SF19_uc003fwj.2_RNA|uc003fwk.1_Missense_Mutation_p.Q14H|TM4SF19_uc010iad.1_Missense_Mutation_p.F179L|TM4SF19_uc011btv.1_Missense_Mutation_p.L155M	p.L181M	NM_138461	NP_612470	Q96DZ7	T4S19_HUMAN	Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)	5	666	-	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		181			Helical; (Potential).		B2RV20|E9PH22|Q336K7	Missense_Mutation	SNP	ENST00000273695.3	37	c.541C>A	CCDS3316.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	18.23|18.23|18.23	3.577830|3.577830|3.577830	0.65878|0.65878|0.65878	.|.|.	.|.|.	ENSG00000145107|ENSG00000145107|ENSG00000145107	ENST00000446879|ENST00000454715;ENST00000273695|ENST00000440822	T|T;T|.	0.24723|0.45276|.	1.84|0.9;0.9|.	5.13|5.13|5.13	4.24|4.24|4.24	0.50183|0.50183|0.50183	.|.|.	.|0.098018|.	.|0.41938|.	.|D|.	.|0.000789|.	T|T|T	0.72898|0.72898|0.72898	0.3518|0.3518|0.3518	M|M|M	0.87381|0.87381|0.87381	2.88|2.88|2.88	0.36180|0.36180|0.36180	D|D|D	0.849323|0.849323|0.849323	B|D;D|.	0.30326|0.89917|.	0.276|0.999;1.0|.	B|D;D|.	0.26094|0.91635|.	0.066|0.999;0.999|.	T|T|T	0.80491|0.80491|0.80491	-0.1359|-0.1359|-0.1359	9|10|5	0.05436|0.59425|.	T|D|.	0.98|0.04|.	.|.|.	10.0614|10.0614|10.0614	0.42277|0.42277|0.42277	0.097:0.0:0.903:0.0|0.097:0.0:0.903:0.0|0.097:0.0:0.903:0.0	.|.|.	179|155;181|.	C9JCD5|E9PH22;Q96DZ7|.	.|.;T4S19_HUMAN|.	L|M|Y	179|155;181|47	ENSP00000395280:F179L|ENSP00000387728:L155M;ENSP00000273695:L181M|.	ENSP00000395280:F179L|ENSP00000273695:L181M|.	F|L|S	-|-|-	3|1|2	2|2|0	TM4SF19|TM4SF19|TM4SF19	197535174|197535174|197535174	0.911000|0.911000|0.911000	0.30947|0.30947|0.30947	0.905000|0.905000|0.905000	0.35620|0.35620|0.35620	0.941000|0.941000|0.941000	0.58515|0.58515|0.58515	1.175000|1.175000|1.175000	0.31944|0.31944|0.31944	2.382000|2.382000|2.382000	0.81193|0.81193|0.81193	0.563000|0.563000|0.563000	0.77884|0.77884|0.77884	TTC|CTG|TCT		0.567	TM4SF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341174.1	NM_138461		19	116	1	0	3.57192e-18	0.006122	4.18826e-18	19	116				
ZNF141	7700	broad.mit.edu	37	4	367007	367007	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr4:367007G>A	ENST00000240499.7	+	4	930	c.781G>A	c.(781-783)Ggc>Agc	p.G261S	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	261					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G261S(2)		breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						TGAAGAATGTGGCAAAGCCTT	0.368																																							uc003gaa.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(781-783)GGC>AGC		zinc finger protein 141							66.0	75.0	72.0					4																	367007		2202	4300	6502	SO:0001583	missense	7700				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	g.chr4:367007G>A	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.781G>A	4.37:g.367007G>A	ENSP00000240499:p.Gly261Ser					ZNF141_uc003gab.2_Intron	p.G261S	NM_003441	NP_003432	Q15928	ZN141_HUMAN			5	959	+			261			C2H2-type 4.		Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	37	c.781G>A	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140192	0.77775	.	.	ENSG00000131127	ENST00000240499	T	0.07216	3.21	1.23	0.214	0.15249	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20292	0.0488	M	0.67397	2.05	0.28841	N	0.896594	D	0.89917	1.0	D	0.81914	0.995	T	0.07481	-1.0770	8	.	.	.	.	5.0912	0.14710	0.2576:0.0:0.7424:0.0	.	261	Q15928	ZN141_HUMAN	S	261	ENSP00000240499:G261S	.	G	+	1	0	ZNF141	357007	0.999000	0.42202	0.632000	0.29296	0.927000	0.56198	2.814000	0.48010	0.585000	0.29608	0.305000	0.20034	GGC		0.368	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441		91	81	0	0	0	0.01441	0	91	81				
PIGG	54872	broad.mit.edu	37	4	515659	515659	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr4:515659G>C	ENST00000453061.2	+	8	1649	c.1543G>C	c.(1543-1545)Gcc>Ccc	p.A515P	PIGG_ENST00000536264.1_3'UTR|PIGG_ENST00000296306.7_3'UTR|PIGG_ENST00000503111.1_3'UTR|PIGG_ENST00000383028.4_Missense_Mutation_p.A382P|PIGG_ENST00000310340.5_Missense_Mutation_p.A507P|PIGG_ENST00000504346.1_Missense_Mutation_p.A426P|PIGG_ENST00000509768.1_Missense_Mutation_p.A426P	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	515					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)	p.A507P(2)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						GATGGTGCTGGCCTCGGCGCT	0.587																																							uc003gak.3		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|ovary(1)|skin(1)	4						c.(1543-1545)GCC>CCC		phosphatidylinositol glycan anchor biosynthesis,							130.0	107.0	115.0					4																	515659		2203	4300	6503	SO:0001583	missense	54872				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity	g.chr4:515659G>C		CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1543G>C	4.37:g.515659G>C	ENSP00000415203:p.Ala515Pro					PIGG_uc003gaj.3_Missense_Mutation_p.A507P|PIGG_uc011bux.1_RNA|PIGG_uc010ibf.2_Missense_Mutation_p.A382P|PIGG_uc003gal.3_Missense_Mutation_p.A426P|PIGG_uc003gai.2_Intron|PIGG_uc011buw.1_3'UTR|PIGG_uc003gam.2_3'UTR|PIGG_uc003gan.2_Missense_Mutation_p.A426P	p.A515P	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN			8	1679	+			515			Helical; (Potential).		B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	ENST00000453061.2	37	c.1543G>C	CCDS46992.1	.	.	.	.	.	.	.	.	.	.	G	10.21	1.287945	0.23478	.	.	ENSG00000174227	ENST00000310340;ENST00000453061;ENST00000504346;ENST00000383028;ENST00000509768	T;T;T;T;T	0.32515	3.23;3.22;2.9;2.9;1.45	5.57	-6.19	0.02078	.	0.928117	0.09271	N	0.825086	T	0.11707	0.0285	N	0.08118	0	0.09310	N	0.999996	P;B;B;P	0.37233	0.538;0.403;0.275;0.588	B;B;B;B	0.37480	0.192;0.086;0.094;0.251	T	0.18745	-1.0327	10	0.36615	T	0.2	.	4.076	0.09904	0.2803:0.1211:0.4796:0.119	.	382;426;515;507	Q5H8A4-3;D6RFE8;Q5H8A4;Q5H8A4-2	.;.;PIGG_HUMAN;.	P	507;515;426;382;426	ENSP00000311750:A507P;ENSP00000415203:A515P;ENSP00000424800:A426P;ENSP00000372494:A382P;ENSP00000421550:A426P	ENSP00000311750:A507P	A	+	1	0	PIGG	505659	0.757000	0.28394	0.000000	0.03702	0.006000	0.05464	0.290000	0.18975	-1.430000	0.01985	-0.367000	0.07326	GCC		0.587	PIGG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357494.1	NM_017733		31	81	0	0	0	0.009535	0	31	81				
NFXL1	152518	broad.mit.edu	37	4	47892633	47892633	+	Silent	SNP	T	T	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr4:47892633T>G	ENST00000507489.1	-	12	1716	c.1540A>C	c.(1540-1542)Aga>Cga	p.R514R	NFXL1_ENST00000381538.3_Silent_p.R514R|NFXL1_ENST00000329043.3_Silent_p.R514R	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	514						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R514R(2)		NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						AGTTTACCTCTGTGACAGACA	0.348																																							uc010igh.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|lung(1)|skin(1)	3						c.(1540-1542)AGA>CGA		nuclear transcription factor, X-box binding-like							91.0	83.0	86.0					4																	47892633		2203	4300	6503	SO:0001819	synonymous_variant	152518					integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr4:47892633T>G	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.1540A>C	4.37:g.47892633T>G						NFXL1_uc003gxp.2_Silent_p.R514R|NFXL1_uc003gxq.3_RNA|NFXL1_uc010igi.2_Silent_p.R514R	p.R514R	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN			12	1717	-			514			NF-X1-type 7.		B1Q2K1|Q86VG1|Q8WVH1	Silent	SNP	ENST00000507489.1	37	c.1540A>C	CCDS3478.2																																																																																				0.348	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995		11	40	0	0	0	0.010729	0	11	40				
GRSF1	2926	broad.mit.edu	37	4	71701932	71701932	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr4:71701932G>C	ENST00000254799.6	-	2	574	c.457C>G	c.(457-459)Cga>Gga	p.R153G	GRSF1_ENST00000502323.1_5'UTR|GRSF1_ENST00000439371.1_5'UTR|GRSF1_ENST00000545193.1_Missense_Mutation_p.R35G|GRSF1_ENST00000508091.1_5'UTR	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	153	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R153G(2)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			CCTTGAGCTCGAATGAGAAAG	0.398																																							uc010iia.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(457-459)CGA>GGA		G-rich RNA sequence binding factor 1 isoform 1							61.0	63.0	62.0					4																	71701932		1877	4102	5979	SO:0001583	missense	2926				mRNA polyadenylation		mRNA binding|nucleotide binding	g.chr4:71701932G>C	BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.457C>G	4.37:g.71701932G>C	ENSP00000254799:p.Arg153Gly					GRSF1_uc011caz.1_Missense_Mutation_p.R35G|GRSF1_uc003hfs.2_5'UTR	p.R153G	NM_002092	NP_002083	Q12849	GRSF1_HUMAN	Lung(101;0.235)		2	540	-		all_hematologic(202;0.21)	153			RRM 1.		B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Missense_Mutation	SNP	ENST00000254799.6	37	c.457C>G	CCDS47069.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.31|18.31	3.594865|3.594865	0.66219|0.66219	.|.	.|.	ENSG00000132463|ENSG00000132463	ENST00000514161|ENST00000254799;ENST00000540657;ENST00000499044;ENST00000545193	.|T;T;T	.|0.09255	.|3.0;3.0;3.0	4.75|4.75	3.89|3.89	0.44902|0.44902	.|RNA recognition motif domain (2);	.|0.131904	.|0.51477	.|D	.|0.000084	T|T	0.21387|0.21387	0.0515|0.0515	M|M	0.91818|0.91818	3.245|3.245	0.80722|0.80722	D|D	1|1	.|B;B	.|0.23185	.|0.01;0.081	.|B;B	.|0.24006	.|0.024;0.05	T|T	0.05209|0.05209	-1.0899|-1.0899	5|10	.|0.87932	.|D	.|0	-4.0315|-4.0315	10.7447|10.7447	0.46172|0.46172	0.0:0.1423:0.7104:0.1473|0.0:0.1423:0.7104:0.1473	.|.	.|66;153	.|B7Z5F9;Q12849	.|.;GRSF1_HUMAN	L|G	89|153;85;126;35	.|ENSP00000254799:R153G;ENSP00000427354:R126G;ENSP00000443380:R35G	.|ENSP00000254799:R153G	F|R	-|-	3|1	2|2	GRSF1|GRSF1	71920796|71920796	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	4.781000|4.781000	0.62389|0.62389	1.176000|1.176000	0.42840|0.42840	0.655000|0.655000	0.94253|0.94253	TTC|CGA		0.398	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362642.1	NM_002092		17	137	0	0	0	0.004007	0	17	137				
CCDC158	339965	broad.mit.edu	37	4	77247123	77247123	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr4:77247123G>C	ENST00000388914.3	-	22	3196	c.3044C>G	c.(3043-3045)tCt>tGt	p.S1015C		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	1015	Ser-rich.							p.S1015C(2)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						CTTCTTAGGAGAAGAATTGAA	0.358																																							uc003hkb.3		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)|pancreas(1)	6						c.(3043-3045)TCT>TGT		coiled-coil domain containing 158							157.0	152.0	154.0					4																	77247123		1849	4094	5943	SO:0001583	missense	339965							g.chr4:77247123G>C	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.3044C>G	4.37:g.77247123G>C	ENSP00000373566:p.Ser1015Cys						p.S1015C	NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN			22	3197	-			1015			Ser-rich.		Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	ENST00000388914.3	37	c.3044C>G	CCDS43242.1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785337	0.31593	.	.	ENSG00000163749	ENST00000388914;ENST00000318586	T	0.35048	1.33	4.96	4.12	0.48240	.	0.419117	0.20617	N	0.088841	T	0.44008	0.1273	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.39603	-0.9606	10	0.66056	D	0.02	.	9.4358	0.38637	0.0961:0.0:0.9039:0.0	.	1015	Q5M9N0	CD158_HUMAN	C	1015;435	ENSP00000373566:S1015C	ENSP00000316815:S435C	S	-	2	0	CCDC158	77466147	1.000000	0.71417	1.000000	0.80357	0.109000	0.19521	4.082000	0.57635	1.471000	0.48121	-0.266000	0.10368	TCT		0.358	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784		65	214	0	0	0	0.01441	0	65	214				
TRPC3	7222	broad.mit.edu	37	4	122828657	122828657	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr4:122828657C>A	ENST00000379645.3	-	7	1931	c.1858G>T	c.(1858-1860)Gtg>Ttg	p.V620L	TRPC3_ENST00000264811.5_Missense_Mutation_p.V547L|TRPC3_ENST00000513531.1_Missense_Mutation_p.V492L	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	535					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.V547L(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						AAGCTGAGCACAACAGCTATG	0.443																																							uc003ieg.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1858-1860)GTG>TTG		transient receptor potential cation channel,							91.0	90.0	90.0					4																	122828657		2203	4299	6502	SO:0001583	missense	7222				axon guidance|phototransduction|platelet activation	integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chr4:122828657C>A	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1858G>T	4.37:g.122828657C>A	ENSP00000368966:p.Val620Leu					TRPC3_uc010inr.2_Missense_Mutation_p.V492L|TRPC3_uc003ief.2_Missense_Mutation_p.V547L|TRPC3_uc011cgl.1_Missense_Mutation_p.V284L	p.V620L	NM_001130698	NP_001124170	Q13507	TRPC3_HUMAN			7	1932	-			535			Helical; (Potential).		A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	37	c.1858G>T	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	C	33	5.235506	0.95240	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.98264	-4.83;-4.83;-4.83	5.3	5.3	0.74995	Ion transport (1);	0.000000	0.64402	D	0.000004	D	0.99083	0.9685	M	0.87180	2.865	0.80722	D	1	D;D;D	0.89917	0.995;0.995;1.0	D;D;D	0.91635	0.971;0.971;0.999	D	0.99744	1.1016	10	0.87932	D	0	-14.5931	18.9622	0.92681	0.0:1.0:0.0:0.0	.	535;492;620	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	L	547;620;492	ENSP00000264811:V547L;ENSP00000368966:V620L;ENSP00000426899:V492L	ENSP00000264811:V547L	V	-	1	0	TRPC3	123048107	1.000000	0.71417	0.945000	0.38365	0.994000	0.84299	7.729000	0.84864	2.465000	0.83290	0.655000	0.94253	GTG		0.443	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305		39	42	1	0	3.61848e-18	0.007835	4.22627e-18	39	42				
JADE1	79960	broad.mit.edu	37	4	129789088	129789088	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr4:129789088C>G	ENST00000226319.6	+	10	1861	c.1581C>G	c.(1579-1581)ttC>ttG	p.F527L	PHF17_ENST00000512960.1_Missense_Mutation_p.F527L|PHF17_ENST00000452328.2_Missense_Mutation_p.F515L	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						AACAGATATTCAATCTTTACA	0.418																																							uc003igk.2		NA																	0					0						c.(1579-1581)TTC>TTG		PHD finger protein 17 long isoform							96.0	91.0	93.0					4																	129789088		2203	4300	6503	SO:0001583	missense	79960				apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding	g.chr4:129789088C>G																												ENST00000226319.6:c.1581C>G	4.37:g.129789088C>G	ENSP00000226319:p.Phe527Leu					PHF17_uc003igl.2_Missense_Mutation_p.F515L|PHF17_uc011cgy.1_Missense_Mutation_p.F527L	p.F527L	NM_199320	NP_955352	Q6IE81	JADE1_HUMAN			10	1861	+			527						Missense_Mutation	SNP	ENST00000226319.6	37	c.1581C>G	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098446	0.76870	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	T;T;T	0.39229	1.09;1.09;1.09	5.28	5.28	0.74379	.	0.046249	0.85682	D	0.000000	T	0.53158	0.1779	L	0.48935	1.535	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.48647	-0.9017	9	.	.	.	.	8.8792	0.35365	0.0:0.8015:0.0:0.1985	.	515;527	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	L	527;515;527;527	ENSP00000226319:F527L;ENSP00000388015:F515L;ENSP00000425730:F527L	.	F	+	3	2	PHF17	130008538	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.682000	0.37628	2.736000	0.93811	0.655000	0.94253	TTC		0.418	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1			19	32	0	0	0	0.010504	0	19	32				
FAT1	2195	broad.mit.edu	37	4	187628476	187628476	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr4:187628476C>A	ENST00000441802.2	-	2	2715	c.2506G>T	c.(2506-2508)Gag>Tag	p.E836*		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	836	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CTATGTACCTCCTTGTCTTCA	0.473										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	0				ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(2506-2508)GAG>TAG		FAT tumor suppressor 1 precursor							160.0	157.0	158.0					4																	187628476		1960	4121	6081	SO:0001587	stop_gained	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187628476C>A	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.2506G>T	4.37:g.187628476C>A	ENSP00000406229:p.Glu836*	HNSCC(5;0.00058)				FAT1_uc010iso.1_Nonsense_Mutation_p.E836*	p.E836*	NM_005245	NP_005236	Q14517	FAT1_HUMAN			2	2694	-			836			Extracellular (Potential).|Cadherin 7.			Nonsense_Mutation	SNP	ENST00000441802.2	37	c.2506G>T	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	42	9.777815	0.99261	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	.	.	.	4.95	4.95	0.65309	.	0.231153	0.43919	D	0.000506	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	18.3634	0.90383	0.0:1.0:0.0:0.0	.	.	.	.	X	836	.	ENSP00000260147:E836X	E	-	1	0	FAT1	187865470	0.995000	0.38212	0.975000	0.42487	0.989000	0.77384	3.245000	0.51407	2.575000	0.86900	0.491000	0.48974	GAG		0.473	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		95	84	1	0	2.1089e-46	0.01441	2.70627e-46	95	84				
TRIO	7204	broad.mit.edu	37	5	14291189	14291189	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:14291189C>T	ENST00000344204.4	+	5	929	c.905C>T	c.(904-906)gCg>gTg	p.A302V	TRIO_ENST00000537187.1_Missense_Mutation_p.A302V|TRIO_ENST00000509967.2_Missense_Mutation_p.A253V	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	302					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TCAGGCAATGCGGACCTGCAG	0.562																																							uc003jff.2		NA																	0				skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18						c.(904-906)GCG>GTG		triple functional domain (PTPRF interacting)							74.0	76.0	75.0					5																	14291189		2203	4300	6503	SO:0001583	missense	7204				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr5:14291189C>T	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.905C>T	5.37:g.14291189C>T	ENSP00000339299:p.Ala302Val					TRIO_uc003jfg.2_RNA|TRIO_uc011cna.1_Missense_Mutation_p.A253V|TRIO_uc003jfh.1_5'Flank	p.A302V	NM_007118	NP_009049	O75962	TRIO_HUMAN			5	911	+	Lung NSC(4;0.000742)		302					D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	c.905C>T	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671920	0.47781	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967	T;T;T	0.42900	0.96;0.96;0.96	5.19	4.32	0.51571	.	0.176109	0.49305	N	0.000157	T	0.63010	0.2475	M	0.73598	2.24	0.54753	D	0.999988	D;D	0.89917	1.0;0.977	D;P	0.75020	0.985;0.532	T	0.66716	-0.5853	10	0.59425	D	0.04	.	13.6293	0.62186	0.0:0.9251:0.0:0.0749	.	253;302	F5H228;O75962	.;TRIO_HUMAN	V	302;302;253	ENSP00000339299:A302V;ENSP00000446348:A302V;ENSP00000445592:A253V	ENSP00000339299:A302V	A	+	2	0	TRIO	14344189	0.998000	0.40836	0.222000	0.23844	0.711000	0.40976	3.886000	0.56190	1.205000	0.43262	0.462000	0.41574	GCG		0.562	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		5	222	0	0	0	0.000602	0	5	222				
CDH9	1007	broad.mit.edu	37	5	26881693	26881693	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:26881693T>C	ENST00000231021.4	-	12	2094	c.1922A>G	c.(1921-1923)aAa>aGa	p.K641R		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	641					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K641R(2)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AGGTTCCTTTTTTCTTTGCCT	0.388																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(1921-1923)AAA>AGA		cadherin 9, type 2 preproprotein							66.0	69.0	68.0					5																	26881693		2203	4300	6503	SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26881693T>C	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1922A>G	5.37:g.26881693T>C	ENSP00000231021:p.Lys641Arg					CDH9_uc011cnv.1_Missense_Mutation_p.K234R	p.K641R	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN			12	2091	-			641			Cytoplasmic (Potential).		Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.1922A>G	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.438658	0.62955	.	.	ENSG00000113100	ENST00000231021	T	0.76839	-1.05	4.96	4.96	0.65561	Cadherin, cytoplasmic domain (1);	0.041875	0.85682	D	0.000000	T	0.79656	0.4483	L	0.45422	1.42	0.51233	D	0.999917	B;P	0.37708	0.357;0.606	P;P	0.51016	0.464;0.656	T	0.77242	-0.2660	9	.	.	.	.	13.7586	0.62952	0.0:0.0:0.0:1.0	.	234;641	B4DFP0;Q9ULB4	.;CADH9_HUMAN	R	641	ENSP00000231021:K641R	.	K	-	2	0	CDH9	26917450	1.000000	0.71417	0.951000	0.38953	0.662000	0.39071	7.772000	0.85439	1.981000	0.57761	0.455000	0.32223	AAA		0.388	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		16	61	0	0	0	0.00499	0	16	61				
PDZD2	23037	broad.mit.edu	37	5	31799826	31799826	+	Silent	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:31799826G>C	ENST00000438447.1	+	2	859	c.471G>C	c.(469-471)ggG>ggC	p.G157G	PDZD2_ENST00000282493.3_Silent_p.G157G			O15018	PDZD2_HUMAN	PDZ domain containing 2	157	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						ATGTCAGTGGGGCCAGGTAAG	0.572																																							uc003jhl.2		NA																	0				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						c.(469-471)GGG>GGC		PDZ domain containing 2							71.0	75.0	74.0					5																	31799826		2203	4300	6503	SO:0001819	synonymous_variant	23037				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus		g.chr5:31799826G>C	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.471G>C	5.37:g.31799826G>C						PDZD2_uc003jhm.2_Silent_p.G157G	p.G157G	NM_178140	NP_835260	O15018	PDZD2_HUMAN			2	859	+			157			PDZ 1.		Q9BXD4	Silent	SNP	ENST00000438447.1	37	c.471G>C	CCDS34137.1																																																																																				0.572	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			7	222	0	0	0	0.001984	0	7	222				
WDR70	55100	broad.mit.edu	37	5	37727024	37727024	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:37727024C>G	ENST00000265107.4	+	17	1910	c.1754C>G	c.(1753-1755)tCt>tGt	p.S585C		NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70	585							enzyme binding (GO:0019899)	p.S585C(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGCACTCTCTCTTCCTATATT	0.448																																							uc003jkv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1753-1755)TCT>TGT		WD repeat domain 70							108.0	108.0	108.0					5																	37727024		2203	4300	6503	SO:0001583	missense	55100							g.chr5:37727024C>G	BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.1754C>G	5.37:g.37727024C>G	ENSP00000265107:p.Ser585Cys						p.S585C	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		17	1812	+	all_lung(31;0.000285)		585					Q9H053	Missense_Mutation	SNP	ENST00000265107.4	37	c.1754C>G	CCDS34147.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586247	0.86851	.	.	ENSG00000082068	ENST00000265107	T	0.69806	-0.43	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.81427	0.4820	M	0.76574	2.34	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	T	0.83105	-0.0126	10	0.72032	D	0.01	-49.4705	19.4052	0.94644	0.0:1.0:0.0:0.0	.	585	Q9NW82	WDR70_HUMAN	C	585	ENSP00000265107:S585C	ENSP00000265107:S585C	S	+	2	0	WDR70	37762781	1.000000	0.71417	0.953000	0.39169	0.933000	0.57130	7.246000	0.78247	2.588000	0.87417	0.650000	0.86243	TCT		0.448	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368294.1	NM_018034		79	183	0	0	0	0.01441	0	79	183				
EGFLAM	133584	broad.mit.edu	37	5	38406296	38406296	+	Missense_Mutation	SNP	G	G	A	rs267600618		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:38406296G>A	ENST00000354891.3	+	7	1127	c.781G>A	c.(781-783)Gat>Aat	p.D261N	EGFLAM_ENST00000336740.6_Missense_Mutation_p.D27N|EGFLAM-AS2_ENST00000512603.1_RNA|EGFLAM_ENST00000397202.2_Intron|EGFLAM-AS2_ENST00000514377.1_RNA|EGFLAM_ENST00000322350.5_Missense_Mutation_p.D261N	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	261					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)	p.D261N(4)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					TGGTGAGGATGATGAAGGATT	0.473																																					Colon(62;485 1295 3347 17454)	Colon(62;485 1295 3347 17454)	uc003jlc.1		NA																	4	Substitution - Missense(4)		lung(4)	pancreas(3)|skin(3)|ovary(1)	7						c.(781-783)GAT>AAT		EGF-like, fibronectin type III and laminin G							125.0	123.0	124.0					5																	38406296		2203	4300	6503	SO:0001583	missense	133584					cell junction|proteinaceous extracellular matrix|synapse		g.chr5:38406296G>A	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.781G>A	5.37:g.38406296G>A	ENSP00000346964:p.Asp261Asn					EGFLAM_uc003jlb.1_Missense_Mutation_p.D261N|EGFLAM_uc003jle.1_Missense_Mutation_p.D27N|EGFLAM_uc003jlf.1_Intron	p.D261N	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN			7	1105	+	all_lung(31;0.000385)		261					A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	c.781G>A	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.071014	0.55646	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	T;T;T	0.81078	0.83;0.67;-1.45	5.39	4.51	0.55191	.	0.207171	0.49916	D	0.000121	T	0.78666	0.4319	M	0.71581	2.175	0.80722	D	1	B;B;B	0.28026	0.006;0.125;0.198	B;B;B	0.27608	0.011;0.037;0.081	T	0.78150	-0.2316	10	0.48119	T	0.1	-7.6235	12.8166	0.57669	0.0775:0.0:0.9225:0.0	.	27;261;261	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	N	261;261;27;27	ENSP00000346964:D261N;ENSP00000313084:D261N;ENSP00000337607:D27N	ENSP00000313084:D261N	D	+	1	0	EGFLAM	38442053	1.000000	0.71417	0.994000	0.49952	0.886000	0.51366	7.082000	0.76851	2.514000	0.84764	0.462000	0.41574	GAT		0.473	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403		36	54	0	0	0	0.003271	0	36	54				
CMYA5	202333	broad.mit.edu	37	5	79054629	79054629	+	Missense_Mutation	SNP	A	A	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:79054629A>G	ENST00000446378.2	+	7	11195	c.11164A>G	c.(11164-11166)Aca>Gca	p.T3722A	CMYA5_ENST00000505466.1_3'UTR	NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3722	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.T3722A(2)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CACCAGCACAACAATTGCAGT	0.378																																							uc003kgc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|pancreas(2)|lung(1)	9						c.(11164-11166)ACA>GCA		cardiomyopathy associated 5							106.0	99.0	101.0					5																	79054629		1899	4125	6024	SO:0001583	missense	202333					perinuclear region of cytoplasm		g.chr5:79054629A>G	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.11164A>G	5.37:g.79054629A>G	ENSP00000394770:p.Thr3722Ala						p.T3722A	NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)	7	11236	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	3722			Fibronectin type-III 1.		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	c.11164A>G	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	A	15.36	2.811260	0.50527	.	.	ENSG00000164309	ENST00000446378	T	0.58358	0.34	5.59	5.59	0.84812	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000100	T	0.58963	0.2159	L	0.29908	0.895	0.30414	N	0.778809	D	0.71674	0.998	D	0.72075	0.976	T	0.62291	-0.6885	10	0.87932	D	0	.	10.5098	0.44855	0.818:0.0:0.0:0.182	.	3722	Q8N3K9	CMYA5_HUMAN	A	3722	ENSP00000394770:T3722A	ENSP00000394770:T3722A	T	+	1	0	CMYA5	79090385	0.998000	0.40836	0.845000	0.33349	0.428000	0.31595	4.047000	0.57383	2.127000	0.65507	0.459000	0.35465	ACA		0.378	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610		38	30	0	0	0	0.005524	0	38	30				
SLCO4C1	353189	broad.mit.edu	37	5	101631628	101631628	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:101631628G>A	ENST00000310954.6	-	1	625	c.339C>T	c.(337-339)ctC>ctT	p.L113L		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1									p.L113L(2)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TGACGGCCAAGAGGCAGTAGT	0.632																																							uc003knm.2		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4						c.(337-339)CTC>CTT		solute carrier organic anion transporter family,							48.0	47.0	48.0					5																	101631628		2203	4300	6503	SO:0001819	synonymous_variant	353189				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity	g.chr5:101631628G>A	AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.339C>T	5.37:g.101631628G>A							p.L113L	NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)	1	626	-		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)	113			Helical; Name=1; (Potential).			Silent	SNP	ENST00000310954.6	37	c.339C>T	CCDS34205.1																																																																																				0.632	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370332.1	NM_180991		39	34	0	0	0	0.00874	0	39	34				
FBN2	2201	broad.mit.edu	37	5	127599169	127599169	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:127599169C>A	ENST00000508053.1	-	69	9114	c.8140G>T	c.(8140-8142)Gag>Tag	p.E2714*	FBN2_ENST00000262464.4_Nonsense_Mutation_p.E2714*			P35556	FBN2_HUMAN	fibrillin 2	2714	EGF-like 47; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.E2714*(4)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TAGCCCCCCTCCGTGTTAGAG	0.587																																							uc003kuu.2		NA																	4	Substitution - Nonsense(4)		lung(4)	ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(8140-8142)GAG>TAG		fibrillin 2 precursor							84.0	88.0	87.0					5																	127599169		2203	4300	6503	SO:0001587	stop_gained	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127599169C>A	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.8140G>T	5.37:g.127599169C>A	ENSP00000424571:p.Glu2714*						p.E2714*	NM_001999	NP_001990	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	63	8579	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	2714			EGF-like 47; calcium-binding.		B4DU01|Q59ES6	Nonsense_Mutation	SNP	ENST00000508053.1	37	c.8140G>T	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	51	18.180920	0.99900	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	.	.	.	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	19.001	0.92834	0.0:1.0:0.0:0.0	.	.	.	.	X	2714	.	ENSP00000262464:E2714X	E	-	1	0	FBN2	127627068	1.000000	0.71417	0.934000	0.37439	0.756000	0.42949	4.676000	0.61627	2.701000	0.92244	0.650000	0.86243	GAG		0.587	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		50	59	1	0	1.42676e-28	0.01441	1.76282e-28	50	59				
SLC22A4	6583	broad.mit.edu	37	5	131630701	131630701	+	Splice_Site	SNP	A	A	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:131630701A>T	ENST00000200652.3	+	1	566	c.392A>T	c.(391-393)gAg>gTg	p.E131V	P4HA2_ENST00000471826.1_Intron	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	131					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)	p.E131V(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	GTCGTGACCGAGGTGGGTGCC	0.701																																							uc003kwq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(391-393)GAG>GTG		solute carrier family 22 member 4	L-Carnitine(DB00583)						15.0	19.0	17.0					5																	131630701		2189	4267	6456	SO:0001630	splice_region_variant	6583				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity	g.chr5:131630701A>T	AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.393+1A>T	5.37:g.131630701A>T						uc003kwm.3_Intron|SLC22A4_uc010jdq.1_5'Flank	p.E131V	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		1	557	+		all_cancers(142;0.0752)|Breast(839;0.198)	131			Extracellular (Potential).		O14546	Missense_Mutation	SNP	ENST00000200652.3	37	c.392A>T	CCDS4153.1	.	.	.	.	.	.	.	.	.	.	A	28.7	4.943086	0.92526	.	.	ENSG00000197208	ENST00000200652	D	0.81996	-1.56	4.61	4.61	0.57282	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.061993	0.64402	D	0.000007	D	0.94248	0.8153	H	0.97874	4.095	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.96202	0.9146	10	0.87932	D	0	.	14.4598	0.67440	1.0:0.0:0.0:0.0	.	131	Q9H015	S22A4_HUMAN	V	131	ENSP00000200652:E131V	ENSP00000200652:E131V	E	+	2	0	SLC22A4	131658600	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	8.298000	0.89944	2.070000	0.61991	0.533000	0.62120	GAG		0.701	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059	Missense_Mutation	10	6	0	0	0	0.010729	0	10	6				
PCDHB1	29930	broad.mit.edu	37	5	140431299	140431299	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:140431299G>C	ENST00000306549.3	+	1	321	c.244G>C	c.(244-246)Gga>Cga	p.G82R		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	82	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G82R(2)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCGCAAGACGGGAGATTTGTT	0.572																																							uc003lik.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(244-246)GGA>CGA		protocadherin beta 1 precursor							66.0	70.0	69.0					5																	140431299		2203	4300	6503	SO:0001583	missense	29930				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140431299G>C	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.244G>C	5.37:g.140431299G>C	ENSP00000307234:p.Gly82Arg						p.G82R	NM_013340	NP_037472	Q9Y5F3	PCDB1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	321	+			82			Cadherin 1.|Extracellular (Potential).		Q2M257	Missense_Mutation	SNP	ENST00000306549.3	37	c.244G>C	CCDS4243.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.137738	0.77775	.	.	ENSG00000171815	ENST00000306549	T	0.39997	1.05	5.81	5.81	0.92471	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	0.000000	0.47852	D	0.000209	T	0.80221	0.4583	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87431	0.2388	10	0.87932	D	0	.	20.0762	0.97745	0.0:0.0:1.0:0.0	.	82	Q9Y5F3	PCDB1_HUMAN	R	82	ENSP00000307234:G82R	ENSP00000307234:G82R	G	+	1	0	PCDHB1	140411483	1.000000	0.71417	0.935000	0.37517	0.774000	0.43823	6.545000	0.73883	2.756000	0.94617	0.655000	0.94253	GGA		0.572	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340		22	61	0	0	0	0.014323	0	22	61				
PCDHB4	56131	broad.mit.edu	37	5	140503320	140503320	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:140503320G>A	ENST00000194152.1	+	1	1740	c.1740G>A	c.(1738-1740)gaG>gaA	p.E580E	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	580	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E580E(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGCGGCCGAGCCGGGCTACC	0.697																																							uc003lip.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1738-1740)GAG>GAA		protocadherin beta 4 precursor							7.0	10.0	9.0					5																	140503320		1689	3496	5185	SO:0001819	synonymous_variant	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140503320G>A	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1740G>A	5.37:g.140503320G>A							p.E580E	NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1740	+			580			Cadherin 6.|Extracellular (Potential).		Q4V761	Silent	SNP	ENST00000194152.1	37	c.1740G>A	CCDS4246.1																																																																																				0.697	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		38	29	0	0	0	0.01441	0	38	29				
PCDHB7	56129	broad.mit.edu	37	5	140553584	140553584	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:140553584C>T	ENST00000231137.3	+	1	1342	c.1168C>T	c.(1168-1170)Ccc>Tcc	p.P390S		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	390	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P390S(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGACGATGTCCCCTTCATCCT	0.473																																							uc003lit.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(1168-1170)CCC>TCC		protocadherin beta 7 precursor							75.0	76.0	75.0					5																	140553584		2203	4300	6503	SO:0001583	missense	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140553584C>T	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1168C>T	5.37:g.140553584C>T	ENSP00000231137:p.Pro390Ser						p.P390S	NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1342	+			390			Extracellular (Potential).|Cadherin 4.		A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	c.1168C>T	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.327294	0.60743	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.49432	0.78	4.18	4.18	0.49190	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.74688	0.3749	M	0.93678	3.445	0.44221	D	0.997054	D	0.89917	1.0	D	0.97110	1.0	T	0.81357	-0.0969	9	0.66056	D	0.02	.	12.9392	0.58333	0.0:0.9158:0.0:0.0842	.	390	Q9Y5E2	PCDB7_HUMAN	S	390;173	ENSP00000231137:P390S	ENSP00000231137:P390S	P	+	1	0	PCDHB7	140533768	0.910000	0.30920	0.928000	0.36995	0.809000	0.45718	2.410000	0.44592	2.244000	0.73946	0.650000	0.86243	CCC		0.473	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		43	34	0	0	0	0.007835	0	43	34				
HRH2	3274	broad.mit.edu	37	5	175111158	175111158	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:175111158G>A	ENST00000231683.2	+	1	2695	c.922G>A	c.(922-924)Gcc>Acc	p.A308T	HRH2_ENST00000377291.2_Missense_Mutation_p.A308T	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2	308					digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	CTGCAGGCTGGCCAACCGCAA	0.582																																							uc003mdd.2		NA																	0				ovary(1)	1						c.(922-924)GCC>ACC		histamine receptor H2 isoform 2	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)						89.0	81.0	84.0					5																	175111158		2203	4300	6503	SO:0001583	missense	3274				G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity	g.chr5:175111158G>A		CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660	ENST00000231683.2:c.922G>A	5.37:g.175111158G>A	ENSP00000231683:p.Ala308Thr					HRH2_uc003mdc.3_Missense_Mutation_p.A308T	p.A308T	NM_022304	NP_071640	P25021	HRH2_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	1	2695	+	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	308			Cytoplasmic (Potential).		B5BUP7|Q14464|Q7Z5R9	Missense_Mutation	SNP	ENST00000231683.2	37	c.922G>A	CCDS4395.1	.	.	.	.	.	.	.	.	.	.	G	5.436	0.265613	0.10294	.	.	ENSG00000113749	ENST00000377291;ENST00000231683	T;T	0.36878	1.23;1.23	4.83	-0.575	0.11734	.	0.644862	0.14716	N	0.302598	T	0.18383	0.0441	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.20505	-1.0273	10	0.22706	T	0.39	.	6.2968	0.21091	0.2793:0.2299:0.4908:0.0	.	308;308	P25021;Q7Z5R9	HRH2_HUMAN;.	T	308	ENSP00000366506:A308T;ENSP00000231683:A308T	ENSP00000231683:A308T	A	+	1	0	HRH2	175043764	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.059000	0.14322	-0.036000	0.13669	0.650000	0.86243	GCC		0.582	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253151.1			4	117	0	0	0	0.009096	0	4	117				
RMND5B	64777	broad.mit.edu	37	5	177570722	177570722	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr5:177570722C>T	ENST00000515098.1	+	7	872	c.521C>T	c.(520-522)gCg>gTg	p.A174V	RMND5B_ENST00000542098.1_Missense_Mutation_p.A161V|RMND5B_ENST00000313386.4_Missense_Mutation_p.A174V			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	174	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.							p.A174V(2)		endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGGGTCCTGCGTTGGAGTAA	0.527																																							uc003mim.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(520-522)GCG>GTG		required for meiotic nuclear division 5 homolog							87.0	88.0	88.0					5																	177570722		2203	4300	6503	SO:0001583	missense	64777							g.chr5:177570722C>T	BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.521C>T	5.37:g.177570722C>T	ENSP00000420875:p.Ala174Val					RMND5B_uc003min.2_Missense_Mutation_p.A174V|RMND5B_uc003mio.2_Missense_Mutation_p.A161V|RMND5B_uc003mip.2_Missense_Mutation_p.A174V|RMND5B_uc011dgf.1_Missense_Mutation_p.A215V|RMND5B_uc003miq.2_Missense_Mutation_p.A114V	p.A174V	NM_022762	NP_073599	Q96G75	RMD5B_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		6	701	+	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	174			CTLH.		Q1HE27|Q6UVY7|Q9H6F6	Missense_Mutation	SNP	ENST00000515098.1	37	c.521C>T	CCDS4431.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766024	0.69878	.	.	ENSG00000145916	ENST00000313386;ENST00000515098;ENST00000542098	.	.	.	4.15	4.15	0.48705	CTLH, C-terminal LisH motif (2);	0.000000	0.85682	D	0.000000	T	0.79557	0.4466	M	0.87038	2.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;P;D	0.74348	0.943;0.906;0.983	T	0.82612	-0.0371	9	0.62326	D	0.03	-16.1289	11.8189	0.52226	0.0:1.0:0.0:0.0	.	161;161;174	B3KSG5;F5H6G4;Q96G75	.;.;RMD5B_HUMAN	V	174;174;161	.	ENSP00000320623:A174V	A	+	2	0	RMND5B	177503328	1.000000	0.71417	0.225000	0.23894	0.352000	0.29268	6.803000	0.75180	2.153000	0.67306	0.462000	0.41574	GCG		0.527	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373542.1	NM_022762		19	40	0	0	0	0.007413	0	19	40				
RPP40	10799	broad.mit.edu	37	6	4996626	4996626	+	Nonsense_Mutation	SNP	A	A	T	rs375624591		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr6:4996626A>T	ENST00000380051.2	-	6	632	c.588T>A	c.(586-588)taT>taA	p.Y196*	RPP40_ENST00000464646.1_Nonsense_Mutation_p.Y136*|RPP40_ENST00000319533.5_Nonsense_Mutation_p.Y173*	NM_006638.2	NP_006629.2	O75818	RPP40_HUMAN	ribonuclease P/MRP 40kDa subunit	196					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)	p.Y196*(1)		NS(1)|breast(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	14	Ovarian(93;0.11)	all_hematologic(90;0.0895)				ACTTGGAAAAATATGACATCA	0.453																																							uc003mwl.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(586-588)TAT>TAA		ribonuclease P 40kDa subunit							105.0	102.0	103.0					6																	4996626		2203	4300	6503	SO:0001587	stop_gained	10799				tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity	g.chr6:4996626A>T	U94317	CCDS34333.1, CCDS69040.1, CCDS75391.1	6p25.1	2012-05-21	2007-06-26	2004-03-19	ENSG00000124787	ENSG00000124787			20992	protein-coding gene	gene with protein product		606117	"""ribonuclease P1"", ""ribonuclease P 40kDa subunit"""	RNASEP1		9630247	Standard	NM_006638		Approved	bA428J1.3	uc003mwl.3	O75818	OTTHUMG00000014168	ENST00000380051.2:c.588T>A	6.37:g.4996626A>T	ENSP00000369391:p.Tyr196*					RPP40_uc003mwm.2_Nonsense_Mutation_p.Y173*	p.Y196*	NM_006638	NP_006629	O75818	RPP40_HUMAN			6	623	-	Ovarian(93;0.11)	all_hematologic(90;0.0895)	196					Q5VX97|Q8WVK8	Nonsense_Mutation	SNP	ENST00000380051.2	37	c.588T>A	CCDS34333.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.833605	0.91036	.	.	ENSG00000124787	ENST00000380051;ENST00000319533;ENST00000464646	.	.	.	5.23	0.123	0.14709	.	0.247316	0.42420	D	0.000718	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.0323	9.3147	0.37926	0.3759:0.0:0.6241:0.0	.	.	.	.	X	196;173;136	.	ENSP00000317998:Y173X	Y	-	3	2	RPP40	4941625	1.000000	0.71417	0.995000	0.50966	0.920000	0.55202	1.187000	0.32090	0.211000	0.20683	-0.182000	0.12963	TAT		0.453	RPP40-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039733.2	NM_006638		17	161	0	0	0	0.00499	0	17	161				
SLC44A4	80736	broad.mit.edu	37	6	31833121	31833121	+	Silent	SNP	C	C	T	rs142009471		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr6:31833121C>T	ENST00000229729.6	-	17	1751	c.1731G>A	c.(1729-1731)gcG>gcA	p.A577A	NEU1_ENST00000375631.4_5'Flank|SLC44A4_ENST00000544672.1_Silent_p.A501A|SLC44A4_ENST00000375562.4_Silent_p.A535A	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	577					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A577A(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	GTAGCATGAACGCATTTTTGG	0.562																																							uc010jti.2		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(2)|ovary(1)|central_nervous_system(1)	4						c.(1729-1731)GCG>GCA		choline transporter-like protein 4	Choline(DB00122)	C	,,	0,4406		0,0,2203	161.0	165.0	163.0		1605,1503,1731	4.4	1.0	6	dbSNP_134	163	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	SLC44A4	NM_001178044.1,NM_001178045.1,NM_025257.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	535/669,501/635,577/711	31833121	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	80736					integral to membrane|plasma membrane	choline transmembrane transporter activity	g.chr6:31833121C>T	AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.1731G>A	6.37:g.31833121C>T						NEU1_uc003nxq.3_5'Flank|NEU1_uc010jtg.2_5'Flank|NEU1_uc003nxr.3_5'Flank|NEU1_uc010jth.2_5'Flank|NEU1_uc003nxs.3_5'Flank	p.A577A	NM_025257	NP_079533	Q53GD3	CTL4_HUMAN			17	1797	-			577			Helical; (Potential).		A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Silent	SNP	ENST00000229729.6	37	c.1731G>A	CCDS4724.2																																																																																				0.562	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3			52	270	0	0	0	0.01441	0	52	270				
ITPR3	3710	broad.mit.edu	37	6	33632679	33632679	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr6:33632679C>A	ENST00000374316.5	+	13	2241	c.1181C>A	c.(1180-1182)aCc>aAc	p.T394N	ITPR3_ENST00000605930.1_Missense_Mutation_p.T394N			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	394	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.T394N(4)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CACCTCTGCACCAACACGTGG	0.662																																							uc011drk.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						c.(1180-1182)ACC>AAC		inositol 1,4,5-triphosphate receptor, type 3							62.0	57.0	59.0					6																	33632679		2203	4300	6503	SO:0001583	missense	3710				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding	g.chr6:33632679C>A	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.1181C>A	6.37:g.33632679C>A	ENSP00000363435:p.Thr394Asn						p.T394N	NM_002224	NP_002215	Q14573	ITPR3_HUMAN			12	1400	+			394			Cytoplasmic (Potential).|MIR 5.		Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	c.1181C>A	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305652	0.81247	.	.	ENSG00000096433	ENST00000374316	D	0.91124	-2.79	4.98	4.98	0.66077	MIR motif (2);MIR (2);	0.056367	0.64402	D	0.000001	D	0.95683	0.8596	M	0.88450	2.955	0.58432	D	0.999999	D	0.89917	1.0	D	0.79108	0.992	D	0.96464	0.9343	10	0.87932	D	0	-35.3408	17.8402	0.88713	0.0:1.0:0.0:0.0	.	394	Q14573	ITPR3_HUMAN	N	394	ENSP00000363435:T394N	ENSP00000363435:T394N	T	+	2	0	ITPR3	33740657	1.000000	0.71417	1.000000	0.80357	0.601000	0.36947	5.977000	0.70492	2.303000	0.77524	0.305000	0.20034	ACC		0.662	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224		24	48	1	0	2.48779e-11	0.005443	2.70491e-11	24	48				
TTBK1	84630	broad.mit.edu	37	6	43225669	43225669	+	Silent	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr6:43225669C>T	ENST00000259750.4	+	10	1064	c.981C>T	c.(979-981)ccC>ccT	p.P327P	TTBK1_ENST00000304139.5_Silent_p.P276P	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	327					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P327P(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CTACCCCGCCCCAGCAGAACA	0.627																																							uc003ouq.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9						c.(979-981)CCC>CCT		tau tubulin kinase 1							63.0	59.0	60.0					6																	43225669		2203	4300	6503	SO:0001819	synonymous_variant	84630					cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr6:43225669C>T	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.981C>T	6.37:g.43225669C>T							p.P327P	NM_032538	NP_115927	Q5TCY1	TTBK1_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)		10	1260	+			327					A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	37	c.981C>T	CCDS34455.1																																																																																				0.627	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3			44	31	0	0	0	0.01441	0	44	31				
SLC35A1	10559	broad.mit.edu	37	6	88218187	88218187	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr6:88218187G>A	ENST00000369552.4	+	6	651	c.624G>A	c.(622-624)gtG>gtA	p.V208V	SLC35A1_ENST00000464978.1_3'UTR|SLC35A1_ENST00000544441.1_Silent_p.V74V|SLC35A1_ENST00000369557.5_Intron|SLC35A1_ENST00000369556.3_Intron|C6orf165_ENST00000506888.1_3'UTR	NM_006416.4	NP_006407.1	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid transporter), member A1	208					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|CMP-N-acetylneuraminate transport (GO:0015782)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	CMP-N-acetylneuraminate transmembrane transporter activity (GO:0005456)|sugar:proton symporter activity (GO:0005351)	p.V208V(2)		breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CTCTTTGGGTGAGAAACATTC	0.294																																					NSCLC(183;214 2117 17033 22638 44782)|Ovarian(87;1008 1343 9644 42916 50932)	NSCLC(183;214 2117 17033 22638 44782)|Ovarian(87;1008 1343 9644 42916 50932)	uc011dzj.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(622-624)GTG>GTA		solute carrier family 35 (CMP-sialic acid							77.0	79.0	78.0					6																	88218187		2202	4297	6499	SO:0001819	synonymous_variant	10559				carbohydrate metabolic process|protein modification process	Golgi membrane|integral to plasma membrane	CMP-N-acetylneuraminate transmembrane transporter activity|sugar:hydrogen symporter activity	g.chr6:88218187G>A	D87969	CCDS5010.1, CCDS55043.1	6q15	2013-05-22			ENSG00000164414	ENSG00000164414		"""Solute carriers"""	11021	protein-coding gene	gene with protein product		605634	"""solute carrier family 35 (UDP-galactose transporter), member 1"""			9010752, 9644260	Standard	NM_006416		Approved	CMPST, hCST	uc011dzj.2	P78382	OTTHUMG00000015177	ENST00000369552.4:c.624G>A	6.37:g.88218187G>A						SLC35A1_uc003plx.2_RNA|SLC35A1_uc010kbw.2_Silent_p.V56V|SLC35A1_uc003plz.2_Intron|SLC35A1_uc011dzi.1_Silent_p.V74V|SLC35A1_uc003ply.2_Intron|SLC35A1_uc010kbx.2_Intron|SLC35A1_uc010kby.2_Intron|SLC35A1_uc011dzk.1_5'Flank	p.V208V	NM_006416	NP_006407	P78382	S35A1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0429)	6	703	+		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)	208			Cytoplasmic (Potential).		Q5W1L8	Silent	SNP	ENST00000369552.4	37	c.624G>A	CCDS5010.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518255	0.44763	.	.	ENSG00000164414	ENST00000369544	.	.	.	5.88	5.01	0.66863	.	.	.	.	.	T	0.65354	0.2683	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71513	-0.4570	5	0.87932	D	0	-39.8036	12.7995	0.57578	0.0:0.1249:0.7452:0.1299	.	.	.	.	K	167	.	ENSP00000358557:E167K	E	+	1	0	SLC35A1	88274906	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.548000	0.53670	1.471000	0.48121	0.561000	0.74099	GAG		0.294	SLC35A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041446.1			16	14	0	0	0	0.010504	0	16	14				
SPACA1	81833	broad.mit.edu	37	6	88773828	88773828	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr6:88773828A>T	ENST00000237201.1	+	6	739	c.622A>T	c.(622-624)Aga>Tga	p.R208*	SPACA1_ENST00000462690.1_Intron	NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	208					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		ATTGCAGATGAGAAGATCAAG	0.323																																							uc003pmn.2		NA																	0					0						c.(622-624)AGA>TGA		sperm acrosome associated 1 precursor							127.0	124.0	125.0					6																	88773828		2203	4300	6503	SO:0001587	stop_gained	81833					integral to membrane		g.chr6:88773828A>T	AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.622A>T	6.37:g.88773828A>T	ENSP00000237201:p.Arg208*						p.R208*	NM_030960	NP_112222	Q9HBV2	SACA1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.11)	6	739	+		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)	208			Extracellular (Potential).			Nonsense_Mutation	SNP	ENST00000237201.1	37	c.622A>T	CCDS5014.1	.	.	.	.	.	.	.	.	.	.	A	34	5.303028	0.95601	.	.	ENSG00000118434	ENST00000237201	.	.	.	5.46	5.46	0.80206	.	0.265708	0.32918	N	0.005495	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.232	12.9065	0.58156	1.0:0.0:0.0:0.0	.	.	.	.	X	208	.	ENSP00000237201:R208X	R	+	1	2	SPACA1	88830547	1.000000	0.71417	1.000000	0.80357	0.494000	0.33585	4.352000	0.59404	2.090000	0.63153	0.477000	0.44152	AGA		0.323	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041459.1			5	54	0	0	0	0.000602	0	5	54				
UBE2J1	51465	broad.mit.edu	37	6	90062268	90062268	+	Silent	SNP	C	C	A	rs568729388		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr6:90062268C>A	ENST00000435041.2	-	1	299	c.21G>T	c.(19-21)ctG>ctT	p.L7L		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	7					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)	p.L7L(1)		NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		CCGGACTCTTCAGGTTGTAGC	0.756																																							uc010kcb.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(19-21)CTG>CTT		ubiquitin-conjugating enzyme E2, J1							16.0	17.0	17.0					6																	90062268		2194	4283	6477	SO:0001819	synonymous_variant	51465					endoplasmic reticulum membrane|integral to membrane	ATP binding|ubiquitin-protein ligase activity	g.chr6:90062268C>A	AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.21G>T	6.37:g.90062268C>A						UBE2J1_uc003pnc.2_Silent_p.L7L	p.L7L	NM_016021	NP_057105	Q9Y385	UB2J1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0139)	2	194	-		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)	7			Cytoplasmic (Potential).		A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Silent	SNP	ENST00000435041.2	37	c.21G>T	CCDS5021.1																																																																																				0.756	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043742.2	NM_016021		15	7	1	0	4.7546e-09	0.004007	5.11376e-09	15	7				
AK9	221264	broad.mit.edu	37	6	109814589	109814589	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr6:109814589C>T	ENST00000424296.2	-	41	5795	c.5719G>A	c.(5719-5721)Gac>Aac	p.D1907N	RP5-919F19.5_ENST00000423747.2_RNA	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1907					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)	p.D1907N(1)|p.D306N(1)									TTAATTGGGTCTATATTTCTG	0.383																																							uc003ptn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(5719-5721)GAC>AAC		adenylate kinase domain containing 1 isoform 1							158.0	161.0	160.0					6																	109814589		2203	4300	6503	SO:0001583	missense	221264				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity	g.chr6:109814589C>T	AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.5719G>A	6.37:g.109814589C>T	ENSP00000410186:p.Asp1907Asn					AKD1_uc011eas.1_Missense_Mutation_p.D292N	p.D1907N	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN			41	5796	-			1907					A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	ENST00000424296.2	37	c.5719G>A	CCDS55048.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.92|19.92	3.915762|3.915762	0.73098|0.73098	.|.	.|.	ENSG00000155085|ENSG00000155085	ENST00000424296|ENST00000490722	T|.	0.64803|.	-0.12|.	5.58|5.58	4.52|4.52	0.55395|0.55395	.|.	0.269688|.	0.35067|.	N|.	0.003477|.	T|T	0.40743|0.40743	0.1129|0.1129	L|L	0.31294|0.31294	0.92|0.92	0.80722|0.80722	D|D	1|1	B;B|.	0.29909|.	0.004;0.261|.	B;B|.	0.22880|.	0.006;0.042|.	T|T	0.22661|0.22661	-1.0210|-1.0210	9|5	.|.	.|.	.|.	.|.	12.3593|12.3593	0.55194|0.55194	0.0:0.8014:0.123:0.0756|0.0:0.8014:0.123:0.0756	.|.	292;1907|.	B7ZL24;Q5TCS8|.	.;AKD1_HUMAN|.	N|K	1907|307	ENSP00000410186:D1907N|.	.|.	D|R	-|-	1|2	0|0	AKD1|AKD1	109921282|109921282	0.982000|0.982000	0.34865|0.34865	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	1.526000|1.526000	0.35964|0.35964	2.623000|2.623000	0.88846|0.88846	0.591000|0.591000	0.81541|0.81541	GAC|AGA		0.383	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001145128		81	58	0	0	0	0.01441	0	81	58				
FAM184A	79632	broad.mit.edu	37	6	119345909	119345909	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr6:119345909C>T	ENST00000338891.7	-	2	672	c.229G>A	c.(229-231)Gaa>Aaa	p.E77K	FAM184A_ENST00000352896.5_5'UTR|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000522284.1_5'UTR|FAM184A_ENST00000368475.4_5'UTR|FAM184A_ENST00000521531.1_Missense_Mutation_p.E77K	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	77						extracellular space (GO:0005615)		p.E77K(2)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						ATTTCTTCTTCATGAGCATCT	0.338																																							uc003pyj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						c.(229-231)GAA>AAA		hypothetical protein LOC79632 isoform 1							70.0	63.0	66.0					6																	119345909		1819	4078	5897	SO:0001583	missense	79632							g.chr6:119345909C>T	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.229G>A	6.37:g.119345909C>T	ENSP00000342604:p.Glu77Lys					FAM184A_uc003pyk.3_5'UTR|FAM184A_uc003pyl.3_5'UTR	p.E77K	NM_024581	NP_078857	Q8NB25	F184A_HUMAN			2	577	-			77			Potential.		B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	c.229G>A	CCDS43499.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.724500	0.89298	.	.	ENSG00000111879	ENST00000338891;ENST00000521531	T;T	0.30981	1.51;1.51	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.47116	0.1428	L	0.59436	1.845	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	T	0.27297	-1.0078	10	0.49607	T	0.09	-18.5797	20.0953	0.97838	0.0:1.0:0.0:0.0	.	77	Q8NB25	F184A_HUMAN	K	77	ENSP00000342604:E77K;ENSP00000430442:E77K	ENSP00000342604:E77K	E	-	1	0	FAM184A	119387608	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.229000	0.78088	2.767000	0.95098	0.655000	0.94253	GAA		0.338	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581		33	21	0	0	0	0.010818	0	33	21				
FAM120B	84498	broad.mit.edu	37	6	170627094	170627094	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr6:170627094C>G	ENST00000476287.1	+	2	724	c.616C>G	c.(616-618)Ctc>Gtc	p.L206V	FAM120B_ENST00000537664.1_Missense_Mutation_p.L229V|FAM120B_ENST00000540480.1_Missense_Mutation_p.L218V|FAM120B_ENST00000252510.9_Intron	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	206					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.L206V(1)		endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		CACCGTCATGCTCTGCAGAGA	0.527																																							uc003qxp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(616-618)CTC>GTC		family with sequence similarity 120B							73.0	75.0	74.0					6																	170627094		2203	4300	6503	SO:0001583	missense	84498				cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding	g.chr6:170627094C>G	AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.616C>G	6.37:g.170627094C>G	ENSP00000417970:p.Leu206Val					FAM120B_uc003qxo.1_Missense_Mutation_p.L206V|FAM120B_uc011ehd.1_Intron	p.L206V	NM_032448	NP_115824	Q96EK7	F120B_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)	2	724	+		Breast(66;0.000338)|Esophageal squamous(34;0.241)	206					B4DL34|Q86V68|Q96JI9	Missense_Mutation	SNP	ENST00000476287.1	37	c.616C>G	CCDS5314.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.357899	0.61403	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287	T;T;T	0.60299	0.2;0.2;0.2	5.5	1.19	0.21007	.	0.295977	0.38058	N	0.001822	T	0.44329	0.1288	L	0.60455	1.87	0.80722	D	1	P;P	0.48834	0.916;0.916	P;P	0.50109	0.631;0.631	T	0.45977	-0.9224	10	0.72032	D	0.01	-16.4647	6.7275	0.23365	0.0:0.3963:0.0:0.6037	.	206;206	Q96EK7;F2Z2E1	F120B_HUMAN;.	V	218;229;206	ENSP00000444125:L218V;ENSP00000440125:L229V;ENSP00000417970:L206V	ENSP00000436640:L206V	L	+	1	0	FAM120B	170469019	1.000000	0.71417	0.652000	0.29579	0.897000	0.52465	3.710000	0.54860	0.386000	0.24997	0.650000	0.86243	CTC		0.527	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448		33	132	0	0	0	0.012213	0	33	132				
USP42	84132	broad.mit.edu	37	7	6189291	6189291	+	Silent	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr7:6189291C>T	ENST00000306177.5	+	13	1622	c.1464C>T	c.(1462-1464)tcC>tcT	p.S488S		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	488					cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.S616S(1)|p.S488S(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		ACGGGAATTCCAGTGTCAACA	0.463																																							uc011jwo.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)|ovary(1)|pancreas(1)|breast(1)	5						c.(1462-1464)TCC>TCT		ubiquitin specific peptidase 42							134.0	128.0	130.0					7																	6189291		1946	4136	6082	SO:0001819	synonymous_variant	84132				cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr7:6189291C>T	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.1464C>T	7.37:g.6189291C>T						USP42_uc010kth.1_Silent_p.S421S|USP42_uc011jwp.1_Silent_p.S488S|USP42_uc011jwq.1_Silent_p.S295S|USP42_uc011jwr.1_Silent_p.S333S	p.S488S	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)	13	1587	+		Ovarian(82;0.0423)	488					A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	ENST00000306177.5	37	c.1464C>T	CCDS47535.1																																																																																				0.463	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526		66	108	0	0	0	0.01441	0	66	108				
ZNF655	79027	broad.mit.edu	37	7	99171066	99171066	+	Silent	SNP	C	C	T	rs372713595		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr7:99171066C>T	ENST00000394163.2	+	3	1518	c.1335C>T	c.(1333-1335)ttC>ttT	p.F445F	GS1-259H13.10_ENST00000455905.1_Intron|GS1-259H13.10_ENST00000486324.1_Intron|ZNF655_ENST00000424881.1_Silent_p.F480F|ZNF655_ENST00000493277.1_Silent_p.F480F|ZNF655_ENST00000419215.2_3'UTR|ZNF655_ENST00000252713.4_Silent_p.F445F|ZNF655_ENST00000425063.1_3'UTR	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655	445					negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F480F(2)|p.F445F(2)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					AGGGCAGTTTCAGTCATAGCT	0.408																																							uc003urh.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(1)	1						c.(1333-1335)TTC>TTT		zinc finger protein 655 isoform a							139.0	138.0	138.0					7																	99171066		2203	4300	6503	SO:0001819	synonymous_variant	79027				G1 phase|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding	g.chr7:99171066C>T	AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.1335C>T	7.37:g.99171066C>T						ZNF655_uc010lga.2_Silent_p.F480F|ZNF655_uc010lgc.2_Silent_p.F480F|ZNF655_uc003urj.2_Silent_p.F445F|ZNF655_uc003urk.2_Silent_p.F282F|ZNF655_uc010lgd.2_Silent_p.F282F	p.F445F	NM_138494	NP_612503	Q8N720	ZN655_HUMAN			3	1728	+	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)		445					A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	Silent	SNP	ENST00000394163.2	37	c.1335C>T	CCDS5669.1																																																																																				0.408	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000344929.1	NM_138494		40	81	0	0	0	0.00874	0	40	81				
LRCH4	4034	broad.mit.edu	37	7	100179736	100179736	+	Silent	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr7:100179736G>T	ENST00000310300.6	-	3	472	c.420C>A	c.(418-420)gtC>gtA	p.V140V	LRCH4_ENST00000497245.1_5'UTR	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4	140					nervous system development (GO:0007399)	PML body (GO:0016605)		p.V140V(2)		NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGACGATGAGGACCCTCAGGG	0.637																																							uc003uvj.2		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(1)|ovary(1)	2						c.(418-420)GTC>GTA		leucine-rich repeats and calponin homology (CH)							61.0	63.0	63.0					7																	100179736		2203	4300	6503	SO:0001819	synonymous_variant	4034				nervous system development	PML body	protein binding	g.chr7:100179736G>T	AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.420C>A	7.37:g.100179736G>T						LRCH4_uc010lgz.2_RNA|LRCH4_uc003uvi.2_RNA|LRCH4_uc011kjx.1_RNA	p.V140V	NM_002319	NP_002310	O75427	LRCH4_HUMAN			3	473	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		140			LRR 5.		A4D2D5|Q8WV85|Q96ID0	Silent	SNP	ENST00000310300.6	37	c.420C>A	CCDS34706.1																																																																																				0.637	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356110.1	NM_002319		27	61	1	0	5.77227e-19	0.008361	6.82177e-19	27	61				
SPAM1	6677	broad.mit.edu	37	7	123599915	123599915	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr7:123599915G>A	ENST00000439500.1	+	6	2035	c.1422G>A	c.(1420-1422)gaG>gaA	p.E474E	SPAM1_ENST00000402183.2_Silent_p.E474E|SPAM1_ENST00000340011.5_Silent_p.E474E|SPAM1_ENST00000223028.7_Silent_p.E474E|SPAM1_ENST00000460182.1_Silent_p.E474E	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	474					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.E474E(4)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CTCCCATGGAGACAGAAGAAC	0.383																																							uc003vld.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(3)|kidney(1)	4						c.(1420-1422)GAG>GAA		sperm adhesion molecule 1 isoform 2	Hyaluronidase(DB00070)						151.0	141.0	145.0					7																	123599915		2203	4300	6503	SO:0001819	synonymous_variant	6677				binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity	g.chr7:123599915G>A	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.1422G>A	7.37:g.123599915G>A						SPAM1_uc003vle.2_Silent_p.E474E|SPAM1_uc011koa.1_Silent_p.E130E|SPAM1_uc003vlf.3_Silent_p.E474E|SPAM1_uc010lku.2_Silent_p.E474E	p.E474E	NM_153189	NP_694859	P38567	HYALP_HUMAN			6	1824	+			474					Q8TC30	Silent	SNP	ENST00000439500.1	37	c.1422G>A	CCDS5791.1																																																																																				0.383	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1			16	46	0	0	0	0.004007	0	16	46				
GALNT11	63917	broad.mit.edu	37	7	151818708	151818708	+	Silent	SNP	C	C	T	rs368113531		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr7:151818708C>T	ENST00000434507.1	+	14	2210	c.1773C>T	c.(1771-1773)gtC>gtT	p.V591V	GALNT11_ENST00000430044.2_Silent_p.V591V|GALNT11_ENST00000320311.2_Silent_p.V591V|RP5-981O7.2_ENST00000424630.1_RNA|GALNT11_ENST00000452146.2_Silent_p.V510V			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	591	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.V591V(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		AGGGCTCTGTCGCCATGGCGA	0.532																																							uc010lqg.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1771-1773)GTC>GTT		N-acetylgalactosaminyltransferase 11		T		1,4405	2.1+/-5.4	0,1,2202	126.0	101.0	110.0		1773	-10.4	0.0	7		110	0,8600		0,0,4300	no	coding-synonymous	GALNT11	NM_022087.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		591/609	151818708	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	63917					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr7:151818708C>T	AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.1773C>T	7.37:g.151818708C>T						GALNT11_uc011kvm.1_Silent_p.V510V|GALNT11_uc003wku.2_Silent_p.V591V	p.V591V	NM_022087	NP_071370	Q8NCW6	GLT11_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)	12	2003	+	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	591			Lumenal (Potential).|Ricin B-type lectin.		B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Silent	SNP	ENST00000434507.1	37	c.1773C>T	CCDS5930.1																																																																																				0.532	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348184.1	NM_022087		27	72	0	0	0	0.007291	0	27	72				
KMT2C	58508	broad.mit.edu	37	7	151945303	151945303	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr7:151945303G>C	ENST00000262189.6	-	14	2434	c.2216C>G	c.(2215-2217)tCt>tGt	p.S739C	KMT2C_ENST00000355193.2_Missense_Mutation_p.S739C	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	739					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AGTCATTTCAGAGTCCATCAA	0.363																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(2215-2217)TCT>TGT		myeloid/lymphoid or mixed-lineage leukemia 3							76.0	74.0	75.0					7																	151945303		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151945303G>C	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2216C>G	7.37:g.151945303G>C	ENSP00000262189:p.Ser739Cys						p.S739C	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	14	2435	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	739					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.2216C>G	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	9.310	1.055261	0.19907	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.83837	-1.77;-1.77	5.23	-0.269	0.12930	.	0.778623	0.10960	N	0.615052	T	0.63604	0.2525	N	0.14661	0.345	0.09310	N	0.999999	P	0.36438	0.553	B	0.31191	0.125	T	0.53365	-0.8449	10	0.44086	T	0.13	.	5.9324	0.19146	0.5455:0.1321:0.3224:0.0	.	739	Q8NEZ4	MLL3_HUMAN	C	739	ENSP00000262189:S739C;ENSP00000347325:S739C	ENSP00000262189:S739C	S	-	2	0	MLL3	151576236	0.934000	0.31675	0.155000	0.22561	0.691000	0.40173	0.667000	0.25112	0.007000	0.14760	-0.355000	0.07637	TCT		0.363	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			3	78	0	0	0	0.009096	0	3	78				
KIAA1456	57604	broad.mit.edu	37	8	12878691	12878692	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr8:12878691_12878692TC>AA	ENST00000524591.2	+	5	992_993	c.503_504TC>AA	c.(502-504)cTC>cAA	p.L168Q	KIAA1456_ENST00000447063.2_Intron	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456	168							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						TGTTCCCAGCTCTTCTCAGAGT	0.51																																							uc010lsq.2		NA																	0					0						c.(502-504)CTC>CAA		hypothetical protein LOC57604 isoform 1																																				SO:0001583	missense	57604						methyltransferase activity	g.chr8:12878691_12878692TC>AA	BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477	Exception_encountered	8.37:g.12878691_12878692delinsAA	ENSP00000432695:p.Leu168Gln					C8orf79_uc011kxw.1_Intron|C8orf79_uc003wwj.3_Missense_Mutation_p.L81Q|C8orf79_uc010lsr.2_Missense_Mutation_p.L42Q	p.L168Q	NM_020844	NP_065895	Q9P272	K1456_HUMAN			5	995_996	+			168					Q96AW6	Missense_Mutation	DNP	ENST00000524591.2	37	c.503_504TC>AA	CCDS47808.1																																																																																				0.510	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383262.2	NM_001099677		9	52	0	0	0	0.004672	0	9	52				
LZTS1	11178	broad.mit.edu	37	8	20112537	20112537	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr8:20112537G>A	ENST00000381569.1	-	2	513	c.156C>T	c.(154-156)caC>caT	p.H52H	LZTS1_ENST00000265801.6_Silent_p.H52H|LZTS1_ENST00000522290.1_Silent_p.H52H			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	52					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H52H(2)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		TGGACTTGCCGTGACCGGAGT	0.577																																							uc003wzr.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(154-156)CAC>CAT		leucine zipper, putative tumor suppressor 1							94.0	89.0	91.0					8																	20112537		2203	4300	6503	SO:0001819	synonymous_variant	11178				cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr8:20112537G>A	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.156C>T	8.37:g.20112537G>A						LZTS1_uc010ltg.1_Silent_p.H52H	p.H52H	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN		Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)	1	267	-			52					D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Silent	SNP	ENST00000381569.1	37	c.156C>T	CCDS6015.1																																																																																				0.577	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020		71	69	0	0	0	0.01441	0	71	69				
GPR124	25960	broad.mit.edu	37	8	37692771	37692771	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr8:37692771G>A	ENST00000412232.2	+	12	1701	c.1688G>A	c.(1687-1689)aGg>aAg	p.R563K	GPR124_ENST00000315215.7_Intron	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	563					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R556K(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCCTTCCAGAGGAGGGAGGGA	0.672																																							uc003xkj.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(2)|skin(1)	5						c.(1687-1689)AGG>AAG		G protein-coupled receptor 124 precursor							47.0	47.0	47.0					8																	37692771		2203	4300	6503	SO:0001583	missense	25960				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr8:37692771G>A	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1688G>A	8.37:g.37692771G>A	ENSP00000406367:p.Arg563Lys					GPR124_uc010lvy.2_Intron	p.R563K	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		12	2051	+			563			Extracellular (Potential).		A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	c.1688G>A	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	G	11.83	1.754680	0.31046	.	.	ENSG00000020181	ENST00000416514;ENST00000412232	T	0.54866	0.55	5.34	4.26	0.50523	.	0.202841	0.37304	N	0.002145	T	0.27027	0.0662	N	0.08118	0	0.29386	N	0.862952	B	0.06786	0.001	B	0.06405	0.002	T	0.09751	-1.0660	10	0.02654	T	1	-27.517	12.4567	0.55708	0.1414:0.0:0.8586:0.0	.	563	Q96PE1	GP124_HUMAN	K	556;563	ENSP00000406367:R563K	ENSP00000406367:R563K	R	+	2	0	GPR124	37811929	0.988000	0.35896	1.000000	0.80357	0.984000	0.73092	1.736000	0.38187	2.507000	0.84556	0.655000	0.94253	AGG		0.672	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2			23	52	0	0	0	0.003954	0	23	52				
WHSC1L1	54904	broad.mit.edu	37	8	38205058	38205058	+	Missense_Mutation	SNP	C	C	T	rs142206759	byFrequency	TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr8:38205058C>T	ENST00000317025.8	-	2	1149	c.632G>A	c.(631-633)cGc>cAc	p.R211H	WHSC1L1_ENST00000433384.2_Missense_Mutation_p.R211H|WHSC1L1_ENST00000316985.3_Missense_Mutation_p.R211H|WHSC1L1_ENST00000527502.1_Missense_Mutation_p.R211H	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	211					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.R211H(2)		NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			GTGTGACTTGCGCTCTTCAGA	0.353			T	NUP98	AML								C|||	3	0.000599042	0.0	0.0	5008	,	,		19795	0.0		0.0	False		,,,				2504	0.0031						uc003xli.2		NA		Dom	yes		8	8p12	54904	T	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)			L	NUP98		AML		2	Substitution - Missense(2)		lung(2)	breast(1)	1						c.(631-633)CGC>CAC		WHSC1L1 protein isoform long		C	HIS/ARG,HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	189.0	176.0	181.0		632,632	5.4	1.0	8	dbSNP_134	181	0,8600		0,0,4300	no	missense,missense	WHSC1L1	NM_017778.2,NM_023034.1	29,29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging	211/646,211/1438	38205058	2,13004	2203	4300	6503	SO:0001583	missense	54904				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding	g.chr8:38205058C>T	AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.632G>A	8.37:g.38205058C>T	ENSP00000313983:p.Arg211His					WHSC1L1_uc011lbm.1_Missense_Mutation_p.R211H|WHSC1L1_uc010lwe.2_Missense_Mutation_p.R211H|WHSC1L1_uc003xlj.2_Missense_Mutation_p.R211H	p.R211H	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)		2	1150	-	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	211					B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Missense_Mutation	SNP	ENST00000317025.8	37	c.632G>A	CCDS43729.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237114	0.39498	4.54E-4	0.0	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502;ENST00000316985;ENST00000529223	D;D;D;T;T	0.95137	-3.61;-3.62;-3.62;-0.14;0.87	5.45	5.45	0.79879	.	0.000000	0.48767	U	0.000171	D	0.91603	0.7347	L	0.51422	1.61	0.46044	D	0.998836	B;B;B;B	0.29253	0.154;0.239;0.157;0.154	B;B;B;B	0.27500	0.01;0.014;0.08;0.006	D	0.89436	0.3720	10	0.44086	T	0.13	.	12.6128	0.56560	0.0:0.924:0.0:0.076	.	211;211;211;211	B7ZL11;Q9BZ95-2;Q9BZ95-3;Q9BZ95	.;.;.;NSD3_HUMAN	H	211;211;148;211;211;211	ENSP00000393284:R211H;ENSP00000313983:R211H;ENSP00000434730:R211H;ENSP00000313410:R211H;ENSP00000435422:R211H	ENSP00000313410:R211H	R	-	2	0	WHSC1L1	38324215	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.163000	0.50763	2.547000	0.85894	0.563000	0.77884	CGC		0.353	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381924.3	NM_023034		47	160	0	0	0	0.01441	0	47	160				
MSC	9242	broad.mit.edu	37	8	72754901	72754901	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr8:72754901C>T	ENST00000325509.4	-	2	905	c.616G>A	c.(616-618)Gct>Act	p.A206T	RP11-383H13.1_ENST00000524152.1_5'Flank|RP11-383H13.1_ENST00000521467.1_Intron|RP11-383H13.1_ENST00000537896.1_5'Flank|MSC_ENST00000518440.1_5'UTR	NM_005098.3	NP_005089.2	O60682	MUSC_HUMAN	musculin	206					branchiomeric skeletal muscle development (GO:0014707)|diaphragm development (GO:0060539)|palate development (GO:0060021)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.A206T(2)		endometrium(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(4)|skin(2)	26	Breast(64;0.176)		Epithelial(68;0.137)|BRCA - Breast invasive adenocarcinoma(89;0.203)			CCGATTTAAGCGGTGGTTCCA	0.493																																							uc003xyx.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(616-618)GCT>ACT		musculin							380.0	380.0	380.0					8																	72754901		1955	4138	6093	SO:0001583	missense	9242				transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr8:72754901C>T		CCDS43746.1	8q13.3	2013-06-07	2010-04-28		ENSG00000178860	ENSG00000178860		"""Basic helix-loop-helix proteins"""	7321	protein-coding gene	gene with protein product	"""activated B-cell factor-1"""	603628	"""musculin (activated B-cell factor-1)"""			9584154, 10198176	Standard	NM_005098		Approved	ABF-1, bHLHa22	uc003xyx.1	O60682	OTTHUMG00000164489	ENST00000325509.4:c.616G>A	8.37:g.72754901C>T	ENSP00000321445:p.Ala206Thr					uc011lff.1_5'Flank|uc003xyy.2_5'Flank	p.A206T	NM_005098	NP_005089	O60682	MUSC_HUMAN	Epithelial(68;0.137)|BRCA - Breast invasive adenocarcinoma(89;0.203)		2	934	-	Breast(64;0.176)		206					O75946|Q53XZ2|Q9BRE7	Missense_Mutation	SNP	ENST00000325509.4	37	c.616G>A	CCDS43746.1	.	.	.	.	.	.	.	.	.	.	C	35	5.491239	0.96339	.	.	ENSG00000178860	ENST00000325509	D	0.98400	-4.91	4.88	4.88	0.63580	.	0.695786	0.13008	N	0.421069	D	0.98245	0.9419	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98863	1.0763	10	0.87932	D	0	.	18.2206	0.89901	0.0:1.0:0.0:0.0	.	206	O60682	MUSC_HUMAN	T	206	ENSP00000321445:A206T	ENSP00000321445:A206T	A	-	1	0	MSC	72917455	1.000000	0.71417	0.999000	0.59377	0.871000	0.50021	6.805000	0.75191	2.559000	0.86315	0.462000	0.41574	GCT		0.493	MSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378974.1	NM_005098		182	605	0	0	0	0.01441	0	182	605				
PI15	51050	broad.mit.edu	37	8	75756265	75756266	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr8:75756265_75756266GC>AT	ENST00000260113.2	+	3	502_503	c.323_324GC>AT	c.(322-324)tGC>tAT	p.C108Y	RP11-758M4.4_ENST00000518128.1_RNA|PI15_ENST00000523773.1_Missense_Mutation_p.C108Y|RP11-758M4.4_ENST00000522914.1_RNA|RP11-758M4.4_ENST00000523860.1_RNA	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	108	SCP.					extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)	p.C108Y(2)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			GCGGCTACTTGCATTTGGGACC	0.431																																							uc003yal.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|ovary(1)	3						c.(322-324)TGC>TAT		protease inhibitor 15 preproprotein																																				SO:0001583	missense	51050					extracellular region	peptidase inhibitor activity	g.chr8:75756265_75756266GC>AT	D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	Exception_encountered	8.37:g.75756265_75756266delinsAT	ENSP00000260113:p.Cys108Tyr					uc003yak.1_Intron|PI15_uc003yam.2_Missense_Mutation_p.C108Y	p.C108Y	NM_015886	NP_056970	O43692	PI15_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)		3	502_503	+	Breast(64;0.137)		108					Q68CY1	Missense_Mutation	DNP	ENST00000260113.2	37	c.323_324GC>AT	CCDS6218.1																																																																																				0.431	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886		29	128	0	0	0	0.004672	0	29	128				
ZFHX4	79776	broad.mit.edu	37	8	77617598	77617598	+	Silent	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr8:77617598C>A	ENST00000521891.2	+	2	1723	c.1275C>A	c.(1273-1275)ctC>ctA	p.L425L	ZFHX4_ENST00000518282.1_Silent_p.L425L|ZFHX4_ENST00000455469.2_Silent_p.L425L|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Silent_p.L425L	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	425					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.L425L(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTGTCTCCCTCAGCCACTCAT	0.502										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(1273-1275)CTC>CTA		zinc finger homeodomain 4							44.0	41.0	42.0					8																	77617598		1953	4166	6119	SO:0001819	synonymous_variant	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77617598C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1275C>A	8.37:g.77617598C>A		HNSCC(33;0.089)				ZFHX4_uc003yat.1_Silent_p.L425L|ZFHX4_uc003yau.1_Silent_p.L425L|ZFHX4_uc003yaw.1_Silent_p.L425L	p.L425L	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		2	1662	+			425					G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	c.1275C>A	CCDS47878.2																																																																																				0.502	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		20	33	1	0	8.34094e-07	0.008871	8.75067e-07	20	33				
ZFHX4	79776	broad.mit.edu	37	8	77617600	77617600	+	Missense_Mutation	SNP	G	G	A	rs372128559		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr8:77617600G>A	ENST00000521891.2	+	2	1725	c.1277G>A	c.(1276-1278)aGc>aAc	p.S426N	ZFHX4_ENST00000518282.1_Missense_Mutation_p.S426N|ZFHX4_ENST00000455469.2_Missense_Mutation_p.S426N|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Missense_Mutation_p.S426N	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.S426N(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GTCTCCCTCAGCCACTCATCG	0.502										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(1276-1278)AGC>AAC		zinc finger homeodomain 4		G	ASN/SER	0,3908		0,0,1954	45.0	42.0	43.0		1277	5.5	1.0	8		43	1,8337		0,1,4168	no	missense	ZFHX4	NM_024721.4	46	0,1,6122	AA,AG,GG		0.012,0.0,0.0082	benign	426/3617	77617600	1,12245	1954	4169	6123	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77617600G>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1277G>A	8.37:g.77617600G>A	ENSP00000430497:p.Ser426Asn	HNSCC(33;0.089)				ZFHX4_uc003yat.1_Missense_Mutation_p.S426N|ZFHX4_uc003yau.1_Missense_Mutation_p.S426N|ZFHX4_uc003yaw.1_Missense_Mutation_p.S426N	p.S426N	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		2	1664	+			426					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.1277G>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	10.30	1.313410	0.23908	0.0	1.2E-4	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.51574	0.7;0.74;0.71;0.7	5.5	5.5	0.81552	.	0.000000	0.53938	U	0.000058	T	0.37945	0.1022	N	0.24115	0.695	0.54753	D	0.999986	P;P;P;P	0.41848	0.651;0.763;0.763;0.557	B;B;B;B	0.39027	0.15;0.288;0.288;0.167	T	0.10753	-1.0616	10	0.30078	T	0.28	.	19.5916	0.95514	0.0:0.0:1.0:0.0	.	426;426;426;426	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	N	426	ENSP00000430497:S426N;ENSP00000399605:S426N;ENSP00000050961:S426N;ENSP00000430848:S426N	ENSP00000050961:S426N	S	+	2	0	ZFHX4	77780155	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.959000	0.93110	2.861000	0.98227	0.655000	0.94253	AGC		0.502	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		21	33	0	0	0	0.008871	0	21	33				
EBAG9	9166	broad.mit.edu	37	8	110576697	110576697	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr8:110576697G>C	ENST00000337573.5	+	7	851	c.551G>C	c.(550-552)aGa>aCa	p.R184T	EBAG9_ENST00000395785.2_Missense_Mutation_p.R184T|EBAG9_ENST00000531677.1_Missense_Mutation_p.R229T	NM_001278938.1|NM_004215.3	NP_001265867.1|NP_004206.1	O00559	RCAS1_HUMAN	estrogen receptor binding site associated, antigen, 9	184					regulation of cell growth (GO:0001558)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	peptidase activator activity involved in apoptotic process (GO:0016505)	p.R184T(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)	10			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			AGAGAAAAGAGAGCAGCCGAA	0.343																																							uc003ynf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(550-552)AGA>ACA		estrogen receptor binding site associated							144.0	147.0	146.0					8																	110576697		2203	4300	6503	SO:0001583	missense	9166				apoptosis|regulation of cell growth	focal adhesion|Golgi membrane|integral to membrane|soluble fraction	apoptotic protease activator activity	g.chr8:110576697G>C	AB007619	CCDS6313.1	8q23	2013-03-07			ENSG00000147654	ENSG00000147654			3123	protein-coding gene	gene with protein product		605772					Standard	NM_004215		Approved	EB9, RCAS1	uc003ynf.3	O00559	OTTHUMG00000165346	ENST00000337573.5:c.551G>C	8.37:g.110576697G>C	ENSP00000337675:p.Arg184Thr					EBAG9_uc003yng.2_Missense_Mutation_p.R184T	p.R184T	NM_198120	NP_936056	O00559	RCAS1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)		7	786	+			184			Cytoplasmic (Potential).|Potential.		A8K3N6|Q5Y8C7|Q6IB20|Q9BS76	Missense_Mutation	SNP	ENST00000337573.5	37	c.551G>C	CCDS6313.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.036658	0.75617	.	.	ENSG00000147654	ENST00000395785;ENST00000337573;ENST00000530629;ENST00000531677	.	.	.	5.61	4.74	0.60224	.	0.096213	0.64402	D	0.000001	T	0.49115	0.1538	L	0.29908	0.895	0.58432	D	0.999999	P	0.37330	0.59	B	0.38954	0.286	T	0.55309	-0.8161	9	0.87932	D	0	1.477	14.098	0.65037	0.0725:0.0:0.9274:0.0	.	184	O00559	RCAS1_HUMAN	T	184;184;184;229	.	ENSP00000337675:R184T	R	+	2	0	EBAG9	110645873	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.714000	0.91412	1.497000	0.48584	0.655000	0.94253	AGA		0.343	EBAG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383536.1	NM_004215		17	39	0	0	0	0.007413	0	17	39				
C9orf131	138724	broad.mit.edu	37	9	35042966	35042966	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr9:35042966C>A	ENST00000312292.5	+	2	387	c.340C>A	c.(340-342)Ctg>Atg	p.L114M	FLJ00273_ENST00000595331.1_5'Flank|C9orf131_ENST00000354479.5_Missense_Mutation_p.L41M|C9orf131_ENST00000421362.2_Missense_Mutation_p.L66M	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	114								p.L114M(2)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			cgaggCATCTCTGGATCCACT	0.557																																							uc003zvw.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(340-342)CTG>ATG		hypothetical protein LOC138724 isoform A							84.0	80.0	82.0					9																	35042966		2203	4300	6503	SO:0001583	missense	138724							g.chr9:35042966C>A	BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.340C>A	9.37:g.35042966C>A	ENSP00000308279:p.Leu114Met					C9orf131_uc003zvu.2_Missense_Mutation_p.L66M|C9orf131_uc003zvv.2_Missense_Mutation_p.L41M|C9orf131_uc003zvx.2_Missense_Mutation_p.L79M	p.L114M	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)		2	369	+	all_epithelial(49;0.22)		114					A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	ENST00000312292.5	37	c.340C>A	CCDS6572.2	.	.	.	.	.	.	.	.	.	.	C	15.93	2.978495	0.53720	.	.	ENSG00000174038	ENST00000421362;ENST00000354479;ENST00000312292;ENST00000378745;ENST00000435140	T;T;T;T	0.50548	1.6;1.57;1.62;0.74	5.01	-0.18	0.13295	.	0.427722	0.17327	N	0.178276	T	0.33644	0.0870	L	0.32530	0.975	0.09310	N	1	B;B;B	0.34181	0.44;0.44;0.44	B;B;B	0.40677	0.337;0.231;0.337	T	0.29336	-1.0015	10	0.66056	D	0.02	-0.5035	1.3484	0.02168	0.151:0.4481:0.1466:0.2542	.	114;41;66	Q5VYM1;A6NLE6;E9PB26	CI131_HUMAN;.;.	M	66;41;114;79;42	ENSP00000393683:L66M;ENSP00000346472:L41M;ENSP00000308279:L114M;ENSP00000368019:L79M	ENSP00000308279:L114M	L	+	1	2	C9orf131	35032966	0.017000	0.18338	0.003000	0.11579	0.245000	0.25701	-0.097000	0.11042	-0.110000	0.12022	-0.165000	0.13383	CTG		0.557	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5	NM_203299		54	43	1	0	2.01872e-29	0.01441	2.50455e-29	54	43				
VCP	7415	broad.mit.edu	37	9	35059557	35059557	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr9:35059557G>T	ENST00000358901.6	-	14	2832	c.1937C>A	c.(1936-1938)cCa>cAa	p.P646Q		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	646					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)	p.P646Q(2)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			ATCAGGAAGTGGGATGTAGAT	0.522																																							uc003zvy.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)	1						c.(1936-1938)CCA>CAA		valosin-containing protein							150.0	120.0	130.0					9																	35059557		2203	4300	6503	SO:0001583	missense	7415				activation of caspase activity|double-strand break repair|endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|retrograde protein transport, ER to cytosol	cytosol|endoplasmic reticulum|microsome|nucleus|proteasome complex	ATP binding|ATPase activity|lipid binding|polyubiquitin binding|protein domain specific binding|protein phosphatase binding	g.chr9:35059557G>T	AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.1937C>A	9.37:g.35059557G>T	ENSP00000351777:p.Pro646Gln					VCP_uc003zvz.2_RNA|VCP_uc010mkh.1_Missense_Mutation_p.P315Q|VCP_uc010mki.1_Missense_Mutation_p.P601Q	p.P646Q	NM_007126	NP_009057	P55072	TERA_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)		14	2326	-			646					B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	ENST00000358901.6	37	c.1937C>A	CCDS6573.1	.	.	.	.	.	.	.	.	.	.	G	35	5.454723	0.96223	.	.	ENSG00000165280	ENST00000358901	D	0.95238	-3.65	6.07	6.07	0.98685	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97952	0.9326	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97868	1.0284	10	0.66056	D	0.02	-26.4201	20.6439	0.99570	0.0:0.0:1.0:0.0	.	646	P55072	TERA_HUMAN	Q	646	ENSP00000351777:P646Q	ENSP00000351777:P646Q	P	-	2	0	VCP	35049557	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	CCA		0.522	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052290.1	NM_007126		39	46	1	0	1.49673e-21	0.00623	1.80453e-21	39	46				
RECK	8434	broad.mit.edu	37	9	36112407	36112407	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr9:36112407A>T	ENST00000377966.3	+	16	2560	c.1994A>T	c.(1993-1995)cAg>cTg	p.Q665L		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	665	Kazal-like 1. {ECO:0000255|PROSITE- ProRule:PRU00798}.				blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q665L(2)		cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			CAAGACCATCAGTTTGAGTTT	0.463																																							uc003zyv.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)	3						c.(1993-1995)CAG>CTG		RECK protein precursor							151.0	125.0	134.0					9																	36112407		2203	4300	6503	SO:0001583	missense	8434					anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity	g.chr9:36112407A>T	E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.1994A>T	9.37:g.36112407A>T	ENSP00000367202:p.Gln665Leu					RECK_uc003zyw.2_Missense_Mutation_p.Q537L|RECK_uc003zyx.2_RNA	p.Q665L	NM_021111	NP_066934	O95980	RECK_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)		16	2080	+			665			Kazal-like 1.		B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	ENST00000377966.3	37	c.1994A>T	CCDS6597.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.859041	0.91433	.	.	ENSG00000122707	ENST00000377966	T	0.03524	3.9	5.83	5.83	0.93111	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.070713	0.64402	D	0.000019	T	0.09335	0.0230	L	0.44542	1.39	0.47905	D	0.999545	D;D	0.57257	0.979;0.979	P;P	0.54759	0.76;0.76	T	0.03077	-1.1075	10	0.56958	D	0.05	-10.4328	14.1648	0.65469	1.0:0.0:0.0:0.0	.	665;665	A8K9D8;O95980	.;RECK_HUMAN	L	665	ENSP00000367202:Q665L	ENSP00000367202:Q665L	Q	+	2	0	RECK	36102407	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.994000	0.93529	2.236000	0.73375	0.533000	0.62120	CAG		0.463	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052409.1			43	68	0	0	0	0.01441	0	43	68				
GOLM1	51280	broad.mit.edu	37	9	88661457	88661457	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr9:88661457C>G	ENST00000388712.3	-	5	563	c.395G>C	c.(394-396)gGc>gCc	p.G132A	GOLM1_ENST00000388711.3_Missense_Mutation_p.G132A|GOLM1_ENST00000257504.6_5'UTR	NM_016548.3	NP_057632.2	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1	132					nucleus organization (GO:0006997)|regulation of lipid metabolic process (GO:0019216)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)		p.G132A(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17						CTGCAGCCTGCCGTAATTCCT	0.532																																							uc004aol.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(394-396)GGC>GCC		golgi membrane protein 1							98.0	73.0	82.0					9																	88661457		2203	4300	6503	SO:0001583	missense	51280					Golgi apparatus|integral to plasma membrane		g.chr9:88661457C>G	AF236056	CCDS35054.1	9q21.33	2012-12-13	2007-07-30	2007-07-30	ENSG00000135052	ENSG00000135052			15451	protein-coding gene	gene with protein product		606804	"""golgi phosphoprotein 2"", ""chromosome 9 open reading frame 155"""	GOLPH2, C9orf155		10831838, 18953438, 22542941	Standard	NM_016548		Approved	GP73, FLJ23608, bA379P1.3	uc004aol.3	Q8NBJ4	OTTHUMG00000020130	ENST00000388712.3:c.395G>C	9.37:g.88661457C>G	ENSP00000373364:p.Gly132Ala					GOLM1_uc010mqd.1_RNA|GOLM1_uc004aom.2_Missense_Mutation_p.G132A	p.G132A	NM_016548	NP_057632	Q8NBJ4	GOLM1_HUMAN			5	593	-			132			Potential.|Lumenal (Potential).		Q6IAF4|Q9NRB9	Missense_Mutation	SNP	ENST00000388712.3	37	c.395G>C	CCDS35054.1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.693589	0.68386	.	.	ENSG00000135052	ENST00000388712;ENST00000388711	T;T	0.42131	0.98;0.98	5.87	3.02	0.34903	.	0.464210	0.24740	N	0.035983	T	0.34513	0.0900	M	0.61703	1.905	0.18873	N	0.999987	B	0.26081	0.141	B	0.26202	0.067	T	0.23547	-1.0185	10	0.18276	T	0.48	-1.0436	6.4	0.21632	0.0:0.6885:0.1498:0.1616	.	132	Q8NBJ4	GOLM1_HUMAN	A	132	ENSP00000373364:G132A;ENSP00000373363:G132A	ENSP00000373363:G132A	G	-	2	0	GOLM1	87851277	0.799000	0.28903	0.039000	0.18376	0.968000	0.65278	1.846000	0.39289	0.471000	0.27319	0.655000	0.94253	GGC		0.532	GOLM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052904.2	NM_177937		13	10	0	0	0	0.001855	0	13	10				
HSDL2	84263	broad.mit.edu	37	9	115171264	115171264	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr9:115171264C>G	ENST00000398805.3	+	4	585	c.358C>G	c.(358-360)Ctg>Gtg	p.L120V	HSDL2_ENST00000262542.7_5'UTR|HSDL2_ENST00000539114.1_5'UTR|HSDL2_ENST00000488101.1_3'UTR|HSDL2_ENST00000398803.1_Intron	NM_032303.4	NP_115679.2	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	120						membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)	p.L120V(1)		NS(1)|breast(2)|cervix(2)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	13						GAGATTGGATCTGATGATGAA	0.408																																							uc004bga.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(358-360)CTG>GTG		hydroxysteroid dehydrogenase like 2							149.0	136.0	140.0					9																	115171264		1946	4148	6094	SO:0001583	missense	84263					peroxisome	oxidoreductase activity|sterol binding	g.chr9:115171264C>G	AY093428	CCDS43864.1, CCDS56582.1	9q32	2011-09-14			ENSG00000119471	ENSG00000119471		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18572	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 13C, member 1"""		"""chromosome 9 open reading frame 99"""	C9orf99		12834046, 19027726	Standard	NM_032303		Approved	SDR13C1	uc004bga.2	Q6YN16	OTTHUMG00000020504	ENST00000398805.3:c.358C>G	9.37:g.115171264C>G	ENSP00000381785:p.Leu120Val					HSDL2_uc011lwv.1_Translation_Start_Site|HSDL2_uc004bgb.1_Intron|HSDL2_uc004bgc.1_Intron|HSDL2_uc011lww.1_Translation_Start_Site	p.L120V	NM_032303	NP_115679	Q6YN16	HSDL2_HUMAN			4	451	+			120					A8K1L4|A8K8X1|A8MSV3|Q658M8|Q9BT58	Missense_Mutation	SNP	ENST00000398805.3	37	c.358C>G	CCDS43864.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089392	0.76756	.	.	ENSG00000119471	ENST00000398805	D	0.87103	-2.21	6.17	3.76	0.43208	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.93468	0.7916	M	0.92923	3.36	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.92438	0.5959	10	0.87932	D	0	.	5.6461	0.17590	0.0:0.3453:0.0:0.6547	.	120	Q6YN16	HSDL2_HUMAN	V	120	ENSP00000381785:L120V	ENSP00000381785:L120V	L	+	1	2	HSDL2	114211085	1.000000	0.71417	0.998000	0.56505	0.930000	0.56654	3.456000	0.53000	1.146000	0.42352	-0.290000	0.09829	CTG		0.408	HSDL2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053681.1	NM_032303		28	67	0	0	0	0.013726	0	28	67				
GOLGA1	2800	broad.mit.edu	37	9	127693657	127693657	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr9:127693657T>C	ENST00000373555.4	-	4	497	c.164A>G	c.(163-165)gAt>gGt	p.D55G		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	55					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)		p.D55G(2)		NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						GGATGAAAGATCTTCTCTGGA	0.433																																							uc004bpc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(163-165)GAT>GGT		golgin 97							131.0	126.0	128.0					9																	127693657		2203	4300	6503	SO:0001583	missense	2800					Golgi cisterna membrane		g.chr9:127693657T>C	U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.164A>G	9.37:g.127693657T>C	ENSP00000362656:p.Asp55Gly					GOLGA1_uc010mwt.1_Missense_Mutation_p.D55G	p.D55G	NM_002077	NP_002068	Q92805	GOGA1_HUMAN			4	506	-			55			Potential.		Q5T164|Q8IYZ9	Missense_Mutation	SNP	ENST00000373555.4	37	c.164A>G	CCDS6860.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.671116	0.88348	.	.	ENSG00000136935	ENST00000373555;ENST00000421514	T;T	0.18016	2.24;2.24	5.11	5.11	0.69529	.	0.000000	0.43919	U	0.000504	T	0.32615	0.0835	M	0.63428	1.95	0.58432	D	0.999999	D	0.69078	0.997	P	0.56163	0.793	T	0.04537	-1.0944	10	0.59425	D	0.04	-17.4192	14.232	0.65898	0.0:0.0:0.0:1.0	.	55	Q92805	GOGA1_HUMAN	G	55	ENSP00000362656:D55G;ENSP00000396966:D55G	ENSP00000362656:D55G	D	-	2	0	GOLGA1	126733478	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.174000	0.77620	2.142000	0.66516	0.482000	0.46254	GAT		0.433	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054049.1	NM_002077		39	22	0	0	0	0.007835	0	39	22				
TTC16	158248	broad.mit.edu	37	9	130479208	130479208	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr9:130479208T>A	ENST00000373289.3	+	2	184	c.104T>A	c.(103-105)aTc>aAc	p.I35N	PTRH1_ENST00000543175.1_5'Flank|PTRH1_ENST00000423807.1_5'Flank|PTRH1_ENST00000429848.1_Intron|TTC16_ENST00000393748.4_Intron|PTRH1_ENST00000419060.1_5'UTR	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	35								p.I35N(1)		central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						CTGCAGCACATCTTTGGGACC	0.542																																							uc004brq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(103-105)ATC>AAC		tetratricopeptide repeat domain 16							114.0	101.0	106.0					9																	130479208		2203	4300	6503	SO:0001583	missense	158248						binding	g.chr9:130479208T>A	AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.104T>A	9.37:g.130479208T>A	ENSP00000362386:p.Ile35Asn					PTRH1_uc004brm.2_5'Flank|PTRH1_uc004bro.2_5'Flank|PTRH1_uc010mxm.2_5'UTR|PTRH1_uc011mah.1_5'UTR|TTC16_uc011mai.1_Missense_Mutation_p.I35N|TTC16_uc004brr.1_5'Flank	p.I35N	NM_144965	NP_659402	Q8NEE8	TTC16_HUMAN			2	171	+			35					B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	ENST00000373289.3	37	c.104T>A	CCDS6875.1	.	.	.	.	.	.	.	.	.	.	T	14.31	2.498324	0.44455	.	.	ENSG00000167094	ENST00000373289	T	0.22134	1.97	3.8	3.8	0.43715	.	0.239258	0.21795	N	0.069018	T	0.30355	0.0762	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.67231	0.95;0.95	T	0.03354	-1.1045	10	0.66056	D	0.02	-27.6614	9.1254	0.36812	0.0:0.0:0.0:1.0	.	35;35	B4DZ42;Q8NEE8	.;TTC16_HUMAN	N	35	ENSP00000362386:I35N	ENSP00000362386:I35N	I	+	2	0	TTC16	129519029	0.999000	0.42202	1.000000	0.80357	0.299000	0.27559	2.375000	0.44283	1.728000	0.51552	0.379000	0.24179	ATC		0.542	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054224.1	NM_144965		47	36	0	0	0	0.01441	0	47	36				
ENTPD8	377841	broad.mit.edu	37	9	140327948	140327948	+	IGR	SNP	T	T	C			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr9:140327948T>C	ENST00000472938.1	-	0	1749				NOXA1_ENST00000392815.2_Missense_Mutation_p.V262A|NOXA1_ENST00000341349.2_Missense_Mutation_p.V318A			Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8						nucleoside diphosphate biosynthetic process (GO:0009133)|nucleoside monophosphate biosynthetic process (GO:0009124)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)	p.V318A(1)		biliary_tract(1)|lung(4)|prostate(1)|skin(1)	7	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		ACTGTCACCGTGCAGTGCGCC	0.711																																							uc004cmv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(952-954)GTG>GCG		NADPH oxidase activator 1							18.0	24.0	22.0					9																	140327948		2192	4292	6484	SO:0001628	intergenic_variant	10811				regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|superoxide metabolic process	cytoplasm|NADPH oxidase complex	Rac GTPase binding|superoxide-generating NADPH oxidase activator activity	g.chr9:140327948T>C	AY359088	CCDS7043.1, CCDS43913.1	9q34.3	2013-09-20			ENSG00000188833	ENSG00000188833			24860	protein-coding gene	gene with protein product	"""GLSR2492"""					12975309	Standard	NM_198585		Approved	UNQ2492, NTPDase-8	uc004cmw.3	Q5MY95	OTTHUMG00000131831		9.37:g.140327948T>C						C9orf167_uc011mew.1_Intron|NOXA1_uc004cmu.2_Missense_Mutation_p.V318A|NOXA1_uc010nch.2_Missense_Mutation_p.V262A	p.V318A	NM_006647	NP_006638	Q86UR1	NOXA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)	11	1088	+	all_cancers(76;0.0926)		318		Missing (in NOXA1truncated, a cDNA isolated from Caco-2 cells treated with butyrate).	OPR.		A2BG17|Q6UVZ0	Missense_Mutation	SNP	ENST00000472938.1	37	c.953T>C	CCDS43913.1	.	.	.	.	.	.	.	.	.	.	T	13.36	2.213097	0.39102	.	.	ENSG00000188747	ENST00000341349;ENST00000392815	T;T	0.60040	0.22;0.22	3.17	3.17	0.36434	Phox/Bem1p (1);	0.074117	0.53938	D	0.000055	T	0.69015	0.3064	M	0.65498	2.005	0.37460	D	0.915173	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	T	0.72833	-0.4173	10	0.87932	D	0	.	6.6553	0.22984	0.0:0.0:0.2433:0.7567	.	262;318;318	Q86UR1-3;Q86UR1;Q86UR1-2	.;NOXA1_HUMAN;.	A	318;262	ENSP00000342848:V318A;ENSP00000376562:V262A	ENSP00000342848:V318A	V	+	2	0	NOXA1	139447769	0.905000	0.30787	0.991000	0.47740	0.272000	0.26649	1.458000	0.35223	1.221000	0.43506	0.459000	0.35465	GTG		0.711	ENTPD8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355991.1	NM_198585		5	7	0	0	0	0.000602	0	5	7				
NLGN4X	57502	broad.mit.edu	37	X	5827175	5827176	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chrX:5827175_5827176TC>AA	ENST00000381095.3	-	4	1357_1358	c.730_731GA>TT	c.(730-732)GAc>TTc	p.D244F	NLGN4X_ENST00000381092.1_Missense_Mutation_p.D244F|NLGN4X_ENST00000538097.1_Missense_Mutation_p.D244F|NLGN4X_ENST00000275857.6_Missense_Mutation_p.D244F|NLGN4X_ENST00000381093.2_Missense_Mutation_p.D264F	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	244					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.D244F(1)|p.D244Y(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TCTCTTGGGGTCCCCGCCAAAG	0.569																																							uc010ndh.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|large_intestine(1)|ovary(1)	4						c.(730-732)GAC>TTC		X-linked neuroligin 4 precursor																																				SO:0001583	missense	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5827175_5827176TC>AA	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.730_731delinsAA	X.37:g.5827175_5827176delinsAA	ENSP00000370485:p.Asp244Phe					NLGN4X_uc004crp.2_Missense_Mutation_p.D264F|NLGN4X_uc004crq.2_Missense_Mutation_p.D244F|NLGN4X_uc010ndi.2_Missense_Mutation_p.D281F|NLGN4X_uc004crr.2_Missense_Mutation_p.D244F|NLGN4X_uc010ndj.2_Missense_Mutation_p.D244F	p.D244F	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN			4	1231_1232	-			244			Extracellular (Potential).		Q6UX10|Q9ULG0	Missense_Mutation	DNP	ENST00000381095.3	37	c.730_731GA>TT	CCDS14126.1																																																																																				0.569	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		18	47	0	0	0	0.004672	0	18	47				
DCAF8L2	347442	broad.mit.edu	37	X	27766598	27766598	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chrX:27766598C>T	ENST00000451261.2	+	5	1985	c.1586C>T	c.(1585-1587)gCg>gTg	p.A529V		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	529								p.A496V(2)		central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						CCTGTGTTGGCGTGCAGTGGC	0.473																																							uc011mjy.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)|pancreas(1)	2						c.(1585-1587)GCG>GTG		DDB1 and CUL4 associated factor 8-like 2							157.0	116.0	129.0					X																	27766598		692	1591	2283	SO:0001583	missense	347442							g.chrX:27766598C>T		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.1586C>T	X.37:g.27766598C>T	ENSP00000462745:p.Ala529Val						p.A529V	NM_001136533	NP_001130005					1	1673	+								B2RXH9|J3KT06	Missense_Mutation	SNP	ENST00000451261.2	37	c.1586C>T	CCDS59162.1																																																																																				0.473	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354		17	4	0	0	0	0.004007	0	17	4				
FAM47B	170062	broad.mit.edu	37	X	34962140	34962140	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chrX:34962140C>T	ENST00000329357.5	+	1	1228	c.1192C>T	c.(1192-1194)Cgc>Tgc	p.R398C		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	398								p.R398C(2)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						GCCCCATCTCCGCCTGGTGCT	0.582																																							uc004ddi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(1)	4						c.(1192-1194)CGC>TGC		hypothetical protein LOC170062							60.0	53.0	55.0					X																	34962140		2202	4300	6502	SO:0001583	missense	170062							g.chrX:34962140C>T	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1192C>T	X.37:g.34962140C>T	ENSP00000328307:p.Arg398Cys						p.R398C	NM_152631	NP_689844	Q8NA70	FA47B_HUMAN			1	1210	+			398					Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	c.1192C>T	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	C	4.968	0.179798	0.09443	.	.	ENSG00000189132	ENST00000329357	T	0.16196	2.36	0.158	0.158	0.14942	.	.	.	.	.	T	0.14270	0.0345	L	0.50333	1.59	0.32173	N	0.581408	B	0.22414	0.069	B	0.14578	0.011	T	0.11616	-1.0580	8	0.46703	T	0.11	.	.	.	.	.	398	Q8NA70	FA47B_HUMAN	C	398	ENSP00000328307:R398C	ENSP00000328307:R398C	R	+	1	0	FAM47B	34872061	0.002000	0.14202	0.024000	0.17045	0.024000	0.10985	-0.270000	0.08584	0.187000	0.20147	0.190000	0.17370	CGC		0.582	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		47	18	0	0	0	0.01441	0	47	18				
JADE3	9767	broad.mit.edu	37	X	46913983	46913983	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chrX:46913983C>T	ENST00000218343.4	+	9	1694	c.1396C>T	c.(1396-1398)Cac>Tac	p.H466Y	PHF16_ENST00000397189.1_Missense_Mutation_p.H466Y	NM_014735.3	NP_055550.1												p.H466Y(2)		NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						GGAAAGCATTCACACTCGAAT	0.453																																							uc004dgx.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1396-1398)CAC>TAC		PHD finger protein 16							26.0	26.0	26.0					X																	46913983		2203	4300	6503	SO:0001583	missense	9767				histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding	g.chrX:46913983C>T																												ENST00000218343.4:c.1396C>T	X.37:g.46913983C>T	ENSP00000218343:p.His466Tyr					PHF16_uc004dgy.2_Missense_Mutation_p.H466Y	p.H466Y	NM_001077445	NP_001070913	Q92613	JADE3_HUMAN			9	1447	+			466						Missense_Mutation	SNP	ENST00000218343.4	37	c.1396C>T	CCDS14271.1	.	.	.	.	.	.	.	.	.	.	C	8.617	0.890585	0.17613	.	.	ENSG00000102221	ENST00000397189;ENST00000218343	T;T	0.49139	0.79;0.79	5.14	5.14	0.70334	.	0.046152	0.85682	D	0.000000	T	0.29817	0.0745	N	0.16130	0.375	0.80722	D	1	B	0.15141	0.012	B	0.15870	0.014	T	0.18808	-1.0325	10	0.02654	T	1	.	17.9754	0.89126	0.0:1.0:0.0:0.0	.	466	Q92613	JADE3_HUMAN	Y	466	ENSP00000380373:H466Y;ENSP00000218343:H466Y	ENSP00000218343:H466Y	H	+	1	0	PHF16	46798927	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.631000	0.67812	2.265000	0.75225	0.600000	0.82982	CAC		0.453	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056376.1			18	16	0	0	0	0.00499	0	18	16				
TNMD	64102	broad.mit.edu	37	X	99854065	99854065	+	Silent	SNP	C	C	G			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chrX:99854065C>G	ENST00000373031.4	+	6	847	c.630C>G	c.(628-630)gcC>gcG	p.A210A		NM_022144.2	NP_071427.2	Q9H2S6	TNMD_HUMAN	tenomodulin	210					cellular response to BMP stimulus (GO:0071773)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|tendon cell differentiation (GO:0035990)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.A210A(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(7)|skin(1)	16						ACTTTCCTGCCAACGAAAAAA	0.423																																							uc004efy.3		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)	1						c.(628-630)GCC>GCG		tenomodulin							78.0	63.0	68.0					X																	99854065		2203	4300	6503	SO:0001819	synonymous_variant	64102					integral to membrane		g.chrX:99854065C>G	AF191770	CCDS14469.1	Xq21.33-q23	2012-10-10			ENSG00000000005	ENSG00000000005		"""BRICHOS domain containing"""	17757	protein-coding gene	gene with protein product	"""BRICHOS domain containing 4"""	300459					Standard	NM_022144		Approved	myodulin, ChM1L, tendin, TEM, BRICD4	uc004efy.4	Q9H2S6	OTTHUMG00000022001	ENST00000373031.4:c.630C>G	X.37:g.99854065C>G						TNMD_uc004efz.2_3'UTR	p.A210A	NM_022144	NP_071427	Q9H2S6	TNMD_HUMAN			6	856	+			210			Extracellular (Potential).		Q9HBX0|Q9UJG0	Silent	SNP	ENST00000373031.4	37	c.630C>G	CCDS14469.1																																																																																				0.423	TNMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057481.1	NM_022144		16	5	0	0	0	0.004007	0	16	5				
FLNA	2316	broad.mit.edu	37	X	153593044	153593044	+	Silent	SNP	G	G	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chrX:153593044G>A	ENST00000369850.3	-	13	2108	c.1872C>T	c.(1870-1872)gaC>gaT	p.D624D	FLNA_ENST00000422373.1_Silent_p.D624D|FLNA_ENST00000360319.4_Silent_p.D624D|FLNA_ENST00000344736.4_Silent_p.D624D	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	624					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)	p.D624D(1)		breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGCCCTTGTCGTCACATTCGA	0.632																																							uc004fkk.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(6)	6						c.(1870-1872)GAC>GAT		filamin A, alpha isoform 2							79.0	86.0	83.0					X																	153593044		2174	4241	6415	SO:0001819	synonymous_variant	2316				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding	g.chrX:153593044G>A	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.1872C>T	X.37:g.153593044G>A						FLNA_uc010nuu.1_Silent_p.D624D	p.D624D	NM_001110556	NP_001104026	P21333	FLNA_HUMAN			13	2121	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		624			Filamin 4.		E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	ENST00000369850.3	37	c.1872C>T	CCDS48194.1																																																																																				0.632	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			44	64	0	0	0	0.01441	0	44	64				
C1orf168	199920	broad.mit.edu	37	1	57219538	57219538	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr1:57219538delC	ENST00000343433.6	-	8	1281	c.1201delG	c.(1201-1203)gaafs	p.E401fs	C1orf168_ENST00000484327.1_Intron	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	401										NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						GAATATGGTTCCTTTTCTGTG	0.353																																							uc001cym.3		NA																	0				ovary(3)|skin(2)	5						c.(1201-1203)GAAfs		hypothetical protein LOC199920							245.0	215.0	225.0					1																	57219538		2202	4300	6502	SO:0001589	frameshift_variant	199920							g.chr1:57219538delC	BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.1201delG	1.37:g.57219538delC	ENSP00000345972:p.Glu401fs					C1orf168_uc009vzu.1_Intron|C1orf168_uc001cyl.2_RNA	p.E401fs	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN			8	1607	-			401					Q63HM3|Q6ZUY6	Frame_Shift_Del	DEL	ENST00000343433.6	37	c.1201delG	CCDS30729.1																																																																																				0.353	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022751.2	NM_001004303		14	60	NA	NA	NA	NA	NA	14	60	---	---	---	---
TAS2R31	259290	broad.mit.edu	37	12	11183906	11183907	+	Frame_Shift_Ins	INS	-	-	A			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr12:11183906_11183907insA	ENST00000390675.2	-	1	99_100	c.28_29insT	c.(28-30)tccfs	p.S10fs	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	10					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						TACCACACTGGAAAAAATGATG	0.381																																							uc001qzo.1		NA																	0					0						c.(28-30)TCCfs		taste receptor, type 2, member 31																																				SO:0001589	frameshift_variant	259290				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr12:11183906_11183907insA	AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.29dupT	12.37:g.11183912_11183912dupA	ENSP00000375093:p.Ser10fs					PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	p.S10fs	NM_176885	NP_795366	P59538	T2R31_HUMAN			1	100_101	-			10			Helical; Name=1; (Potential).		P59547|Q17R84|Q645X5	Frame_Shift_Ins	INS	ENST00000390675.2	37	c.28_29insT	CCDS53747.1																																																																																				0.381	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885		7	69	NA	NA	NA	NA	NA	7	69	---	---	---	---
ABCC1	4363	broad.mit.edu	37	16	16177395	16177397	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	AGA	AGA	-	-	AGA	AGA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr16:16177395_16177397delAGA	ENST00000399410.3	+	17	2463_2465	c.2288_2290delAGA	c.(2287-2292)gagaag>gag	p.K764del	ABCC1_ENST00000351154.5_Intron|ABCC1_ENST00000345148.5_In_Frame_Del_p.K764del|ABCC1_ENST00000349029.5_Intron|ABCC1_ENST00000346370.5_In_Frame_Del_p.K764del|ABCC1_ENST00000399408.2_In_Frame_Del_p.K764del	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	764	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GAGATTGGCGAGAAGGTCAGTAT	0.542																																							uc010bvi.2		NA																	0				ovary(4)	4						c.(2287-2292)GAGAAG>GAG		ATP-binding cassette, sub-family C, member 1	Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)																																			SO:0001651	inframe_deletion	4363				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:16177395_16177397delAGA	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2288_2290delAGA	16.37:g.16177395_16177397delAGA	ENSP00000382342:p.Lys764del					ABCC1_uc010bvj.2_Intron|ABCC1_uc010bvk.2_In_Frame_Del_p.K764del|ABCC1_uc010bvl.2_In_Frame_Del_p.K764del|ABCC1_uc010bvm.2_Intron|ABCC1_uc002del.3_In_Frame_Del_p.K648del	p.K764del	NM_004996	NP_004987	P33527	MRP1_HUMAN			17	2463_2465	+			764			ABC transporter 1.|Cytoplasmic.		A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	In_Frame_Del	DEL	ENST00000399410.3	37	c.2288_2290delAGA	CCDS42122.1																																																																																				0.542	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996		27	221	NA	NA	NA	NA	NA	27	221	---	---	---	---
FSHR	2492	broad.mit.edu	37	2	49217718	49217718	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:49217718delG	ENST00000406846.2	-	5	552	c.433delC	c.(433-435)caafs	p.Q145fs	FSHR_ENST00000346173.3_Frame_Shift_Del_p.Q145fs|FSHR_ENST00000469138.1_5'UTR|FSHR_ENST00000541117.1_5'UTR|FSHR_ENST00000304421.4_Frame_Shift_Del_p.Q145fs	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	145					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	AAAACTTTTTGGAGAGAATGA	0.383									Gonadal Dysgenesis, 46 XX																														uc002rww.2		NA																	0				ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8						c.(433-435)CAAfs		follicle stimulating hormone receptor isoform 1	Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)						140.0	151.0	147.0					2																	49217718		2203	4300	6503	SO:0001589	frameshift_variant	2492	Gonadal_Dysgenesis_46_XX	Familial Cancer Database		female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding	g.chr2:49217718delG		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.433delC	2.37:g.49217718delG	ENSP00000384708:p.Gln145fs					FSHR_uc002rwx.2_Frame_Shift_Del_p.Q145fs|FSHR_uc010fbn.2_Frame_Shift_Del_p.Q145fs|FSHR_uc010fbo.1_RNA	p.Q145fs	NM_000145	NP_000136	P23945	FSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		5	507	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	145			LRR 5.|Extracellular (Potential).		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Frame_Shift_Del	DEL	ENST00000406846.2	37	c.433delC	CCDS1843.1																																																																																				0.383	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2			23	107	NA	NA	NA	NA	NA	23	107	---	---	---	---
EIF5B	9669	broad.mit.edu	37	2	99993096	99993102	+	Splice_Site	DEL	TGAGGTA	TGAGGTA	-			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	TGAGGTA	TGAGGTA	-	-	TGAGGTA	TGAGGTA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr2:99993096_99993102delTGAGGTA	ENST00000289371.6	+	10	2041_2044	c.1839_1842delTGAGGTA	c.(1837-1842)attgag>at	p.IE613fs		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	613					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AACGGAGGATTGAGGTATTTATTTTAC	0.362																																					Colon(162;2388 2567 2705 3444)	Colon(162;2388 2567 2705 3444)	uc002tab.2		NA																	0				ovary(2)|pancreas(1)	3						c.e10+1		eukaryotic translation initiation factor 5B																																				SO:0001630	splice_region_variant	9669				regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity	g.chr2:99993096_99993102delTGAGGTA	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.1842+1TGAGGTA>-	2.37:g.99993096_99993102delTGAGGTA							p.E614_splice	NM_015904	NP_056988	O60841	IF2P_HUMAN			10	2026	+								O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Splice_Site	DEL	ENST00000289371.6	37	c.1842_splice	CCDS42721.1																																																																																				0.362	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904	Frame_Shift_Del	12	130	NA	NA	NA	NA	NA	12	130	---	---	---	---
CDKN2A	1029	broad.mit.edu	37	9	21971057	21971058	+	Frame_Shift_Ins	INS	-	-	A	rs104894094		TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr9:21971057_21971058insA	ENST00000304494.5	-	2	570_571	c.300_301insT	c.(298-303)gccgggfs	p.G101fs	CDKN2A_ENST00000446177.1_Frame_Shift_Ins_p.G101fs|CDKN2A_ENST00000578845.2_Frame_Shift_Ins_p.G50fs|CDKN2A_ENST00000497750.1_Frame_Shift_Ins_p.G50fs|CDKN2A_ENST00000494262.1_Frame_Shift_Ins_p.G50fs|CDKN2A_ENST00000361570.3_Frame_Shift_Ins_p.R156fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579755.1_Frame_Shift_Ins_p.R115fs|CDKN2A_ENST00000479692.2_Frame_Shift_Ins_p.G50fs|CDKN2A_ENST00000498628.2_Frame_Shift_Ins_p.G50fs|CDKN2A_ENST00000530628.2_Frame_Shift_Ins_p.R115fs|CDKN2A_ENST00000498124.1_Frame_Shift_Ins_p.G101fs|CDKN2A_ENST00000579122.1_Frame_Shift_Ins_p.G101fs	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	101			G -> W (in CMM2 and FAMMMPC; impairs the function). {ECO:0000269|PubMed:10874641, ECO:0000269|PubMed:7987387}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.H83fs*2(2)|p.A102fs*18(1)|p.0(1)|p.G101fs*17(1)|p.T93_D105del(1)|p.A68fs*3(1)|p.G101W(1)|p.A102fs*42(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		AGCCGCGCCCCGGCCCGGTGCA	0.752		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																													uc003zpk.2		17																	1368	Whole gene deletion(1316)|Unknown(44)|Deletion - Frameshift(5)|Deletion - In frame(1)|Insertion - Frameshift(1)|Substitution - Missense(1)	p.0?(1112)|p.?(13)|p.A100S(3)|p.A100P(2)|p.H83fs*2(2)|p.A102fs*18(1)|p.A100V(1)|p.G101fs*17(1)|p.T93_D105del(1)|p.A68fs*3(1)|p.G101W(1)|p.A102fs*42(1)	haematopoietic_and_lymphoid_tissue(283)|skin(174)|central_nervous_system(167)|lung(146)|urinary_tract(91)|bone(74)|soft_tissue(57)|upper_aerodigestive_tract(53)|pleura(51)|oesophagus(51)|ovary(36)|kidney(32)|breast(32)|pancreas(30)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(9)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678	GRCh37	CM043784|CM940230	CDKN2A|p14arf	M	rs104894094	c.(298-303)GCCGGGfs		cyclin-dependent kinase inhibitor 2A isoform 1																																				SO:0001589	frameshift_variant	1029	Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma			cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	g.chr9:21971057_21971058insA	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.300_301insT	9.37:g.21971057_21971058insA	ENSP00000307101:p.Gly101fs	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Frame_Shift_Ins_p.R156fs	p.A100fs	NM_000077	NP_000068	P42771	CD2A1_HUMAN		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)	2	512_513	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	100_101		G -> W (in CMM2 and FAMMMPC; impairs the function).	ANK 3.		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Ins	INS	ENST00000304494.5	37	c.300_301insT	CCDS6510.1																																																																																				0.752	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077		14	24	NA	NA	NA	NA	NA	14	24	---	---	---	---
SPATA31A1	647060	broad.mit.edu	37	9	39361117	39361117	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-1594-01A-01D-1040-01	TCGA-55-1594-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	88620207-646f-49ec-bb4f-7e8fd22e77ae	087484e8-dc3e-461a-be5f-4217b7c39732	g.chr9:39361117delG	ENST00000377647.3	+	4	3384	c.3355delG	c.(3355-3357)gaafs	p.E1119fs		NM_001085452.1	NP_001078921.1	Q5TZJ5	S31A1_HUMAN	SPATA31 subfamily A, member 1	1119					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GCCCAACTTAGAAAAACATGA	0.488																																							uc004abm.2		NA																	0					0						c.(3355-3357)GAAfs		hypothetical protein LOC642265							95.0	87.0	89.0					9																	39361117		1124	2890	4014	SO:0001589	frameshift_variant	642265					integral to membrane		g.chr9:39361117delG		CCDS43808.1	9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000204849	ENSG00000204849			23394	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 36"", ""family with sequence similarity 75, member A1"""	C9orf36, FAM75A1		20850414	Standard	XM_006716851		Approved	DKFZP434B204, C9orf36A, OTTHUMG00000013156		Q5TZJ5	OTTHUMG00000013156	ENST00000377647.3:c.3355delG	9.37:g.39361117delG	ENSP00000366875:p.Glu1119fs						p.E1119fs	NM_001040065	NP_001035154	Q5RGS2	F75A2_HUMAN		GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)	4	3384	+			1119						Frame_Shift_Del	DEL	ENST00000377647.3	37	c.3355delG	CCDS43808.1																																																																																				0.488	SPATA31A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036910.1	NM_001085452		62	203	NA	NA	NA	NA	NA	62	203	---	---	---	---
