#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
KLHL17	339451	broad.mit.edu	37	1	898548	898548	+	Missense_Mutation	SNP	C	C	T	rs370965813		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:898548C>T	ENST00000338591.3	+	7	1209	c.1102C>T	c.(1102-1104)Cgc>Tgc	p.R368C		NM_198317.2	NP_938073.1	Q6TDP4	KLH17_HUMAN	kelch-like family member 17	368	Interaction with F-actin. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|dendrite cytoplasm (GO:0032839)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein complex scaffold (GO:0032947)			central_nervous_system(1)|kidney(2)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GCGCACCGACCGCTGGCACGT	0.701																																							uc001aca.1		NA																	0					0						c.(1102-1104)CGC>TGC		kelch-like 17		C	CYS/ARG	0,4390		0,0,2195	34.0	36.0	35.0		1102	5.5	1.0	1		35	2,8588	2.2+/-6.3	0,2,4293	no	missense	KLHL17	NM_198317.2	180	0,2,6488	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	368/643	898548	2,12978	2195	4295	6490	SO:0001583	missense	339451				actin cytoskeleton organization	actin cytoskeleton|cell junction|postsynaptic density|postsynaptic membrane	protein complex scaffold	g.chr1:898548C>T	AY423763	CCDS30550.1	1p36	2013-01-30	2013-01-30		ENSG00000187961	ENSG00000187961		"""Kelch-like"", ""BTB/POZ domain containing"""	24023	protein-coding gene	gene with protein product	"""actinfilin"""		"""kelch-like 17 (Drosophila)"""			12063253	Standard	NM_198317		Approved		uc001aca.2	Q6TDP4	OTTHUMG00000040721	ENST00000338591.3:c.1102C>T	1.37:g.898548C>T	ENSP00000343930:p.Arg368Cys					KLHL17_uc001acc.1_RNA|KLHL17_uc010nyb.1_Silent_p.T116T	p.R368C	NM_198317	NP_938073	Q6TDP4	KLH17_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	7	1209	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	368			Interaction with F-actin (By similarity).|Kelch 1.		Q5SV94	Missense_Mutation	SNP	ENST00000338591.3	37	c.1102C>T	CCDS30550.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132535	0.77662	0.0	2.33E-4	ENSG00000187961	ENST00000338591;ENST00000455747;ENST00000540863	T	0.74526	-0.85	5.52	5.52	0.82312	Galactose oxidase, beta-propeller (1);	0.068496	0.64402	D	0.000003	T	0.79423	0.4443	N	0.21282	0.65	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.80839	-0.1203	10	0.52906	T	0.07	.	19.4354	0.94792	0.0:1.0:0.0:0.0	.	368	Q6TDP4	KLH17_HUMAN	C	368;244;91	ENSP00000343930:R368C	ENSP00000343930:R368C	R	+	1	0	KLHL17	888411	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.379000	0.59575	2.608000	0.88229	0.448000	0.29417	CGC		0.701	KLHL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097875.3	NM_198317		8	15	0	0	0	0.004482	0	8	15				
CNKSR1	10256	broad.mit.edu	37	1	26515397	26515397	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:26515397C>T	ENST00000374253.5	+	20	1885	c.1846C>T	c.(1846-1848)Ctc>Ttc	p.L616F	CNKSR1_ENST00000361530.6_Missense_Mutation_p.L609F|CNKSR1_ENST00000531191.1_Missense_Mutation_p.L351F|CATSPER4_ENST00000456354.2_5'Flank	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	616					Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		AGACCCTCAGCTCAATGAGCG	0.657																																					NSCLC(180;1396 2109 28270 30756 34275)	NSCLC(180;1396 2109 28270 30756 34275)	uc001bln.3		NA																	0				lung(1)|kidney(1)	2						c.(1846-1848)CTC>TTC		connector enhancer of kinase suppressor of Ras							55.0	60.0	58.0					1																	26515397		2203	4300	6503	SO:0001583	missense	10256				Rho protein signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cell cortex|cell-cell junction	protein binding, bridging	g.chr1:26515397C>T	AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.1846C>T	1.37:g.26515397C>T	ENSP00000363371:p.Leu616Phe					CNKSR1_uc001blm.3_Missense_Mutation_p.L609F|CNKSR1_uc009vsd.2_Missense_Mutation_p.L351F|CNKSR1_uc009vse.2_Missense_Mutation_p.L351F|CNKSR1_uc001blo.2_Missense_Mutation_p.L351F|CATSPER4_uc010oey.1_5'Flank|CATSPER4_uc010oez.1_5'Flank|CATSPER4_uc009vsf.2_5'Flank	p.L616F	NM_006314	NP_006305	Q969H4	CNKR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)	20	1904	+		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)	616			Potential.		B1AMW9|O95381	Missense_Mutation	SNP	ENST00000374253.5	37	c.1846C>T		.	.	.	.	.	.	.	.	.	.	C	21.1	4.096621	0.76870	.	.	ENSG00000142675	ENST00000361530;ENST00000374253;ENST00000531191	T;T;T	0.17691	2.3;2.3;2.26	5.74	3.74	0.42951	.	0.120213	0.56097	D	0.000036	T	0.24699	0.0599	M	0.66939	2.045	0.27173	N	0.960877	D;D	0.54397	0.966;0.966	P;P	0.49226	0.603;0.603	T	0.09015	-1.0694	10	0.59425	D	0.04	-10.5497	9.1336	0.36861	0.2164:0.4174:0.3662:0.0	.	616;609	Q969H4;Q53GM7	CNKR1_HUMAN;.	F	609;616;351	ENSP00000354609:L609F;ENSP00000363371:L616F;ENSP00000431817:L351F	ENSP00000354609:L609F	L	+	1	0	CNKSR1	26387984	0.990000	0.36364	0.998000	0.56505	0.995000	0.86356	2.869000	0.48444	1.405000	0.46838	0.655000	0.94253	CTC		0.657	CNKSR1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000089943.2	NM_006314		30	44	0	0	0	0.008361	0	30	44				
AGO3	192669	broad.mit.edu	37	1	36492838	36492838	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:36492838G>C	ENST00000373191.4	+	12	1879	c.1530G>C	c.(1528-1530)aaG>aaC	p.K510N	AGO3_ENST00000246314.6_Missense_Mutation_p.K276N	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	510					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										GGCATCTCAAGAACACATATT	0.488																																						Colon(144;60 2363 31043 40539)	uc001bzp.2		NA																	0					0						c.(1528-1530)AAG>AAC		eukaryotic translation initiation factor 2C, 3							114.0	100.0	105.0					1																	36492838		2203	4300	6503	SO:0001583	missense	192669				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding	g.chr1:36492838G>C	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.1530G>C	1.37:g.36492838G>C	ENSP00000362287:p.Lys510Asn					EIF2C3_uc001bzq.2_Missense_Mutation_p.K276N	p.K510N	NM_024852	NP_079128	Q9H9G7	AGO3_HUMAN			12	1786	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	510					B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	c.1530G>C	CCDS399.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842161	0.51057	.	.	ENSG00000126070	ENST00000373191;ENST00000246314	T;T	0.11930	2.73;2.75	5.47	4.56	0.56223	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.21427	0.0516	M	0.86343	2.81	0.80722	D	1	B	0.25235	0.121	B	0.26864	0.074	T	0.02617	-1.1133	10	0.44086	T	0.13	-11.8243	8.7359	0.34528	0.2257:0.0:0.7743:0.0	.	510	Q9H9G7	AGO3_HUMAN	N	510;276	ENSP00000362287:K510N;ENSP00000246314:K276N	ENSP00000246314:K276N	K	+	3	2	EIF2C3	36265425	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.925000	0.48884	1.300000	0.44818	0.650000	0.86243	AAG		0.488	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852		5	59	0	0	0	0.000602	0	5	59				
USP1	7398	broad.mit.edu	37	1	62916294	62916294	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:62916294G>C	ENST00000339950.4	+	9	2815	c.2000G>C	c.(1999-2001)gGa>gCa	p.G667A	USP1_ENST00000371146.1_Missense_Mutation_p.G667A	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	667	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		GAAGCTATTGGACTTCTTGGA	0.358																																					Ovarian(122;1846 2315 3982 19504)	Ovarian(122;1846 2315 3982 19504)	uc001daj.1		NA																	0				ovary(1)	1						c.(1999-2001)GGA>GCA		ubiquitin specific protease 1							63.0	69.0	67.0					1																	62916294		2203	4300	6503	SO:0001583	missense	7398				DNA repair|monoubiquitinated protein deubiquitination|regulation of DNA repair|response to UV|ubiquitin-dependent protein catabolic process	nucleoplasm	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr1:62916294G>C		CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.2000G>C	1.37:g.62916294G>C	ENSP00000343526:p.Gly667Ala					USP1_uc001dak.1_Missense_Mutation_p.G667A|USP1_uc001dal.1_Missense_Mutation_p.G667A	p.G667A	NM_001017415	NP_001017415	O94782	UBP1_HUMAN		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)	9	2328	+		all_neural(321;0.0281)	667					A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	ENST00000339950.4	37	c.2000G>C	CCDS621.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058649	0.76074	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	T;T	0.32023	1.47;1.47	5.39	5.39	0.77823	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (1);	0.051795	0.85682	D	0.000000	T	0.40297	0.1111	L	0.27053	0.805	0.58432	D	0.999998	D	0.67145	0.996	P	0.57283	0.817	T	0.21793	-1.0235	10	0.62326	D	0.03	-22.231	19.352	0.94392	0.0:0.0:1.0:0.0	.	667	O94782	UBP1_HUMAN	A	667	ENSP00000360188:G667A;ENSP00000343526:G667A	ENSP00000343526:G667A	G	+	2	0	USP1	62688882	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.018000	0.93657	2.801000	0.96364	0.650000	0.86243	GGA		0.358	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024881.1	NM_001017415		27	40	0	0	0	0.003954	0	27	40				
REG4	83998	broad.mit.edu	37	1	120342457	120342457	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:120342457G>C	ENST00000354219.1	-	5	633	c.194C>G	c.(193-195)gCc>gGc	p.A65G	REG4_ENST00000256585.5_Missense_Mutation_p.A65G|REG4_ENST00000530654.1_Missense_Mutation_p.A65G	NM_001159352.1	NP_001152824.1	Q9BYZ8	REG4_HUMAN	regenerating islet-derived family, member 4	65	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|mannan binding (GO:2001065)			central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(2)|prostate(1)|skin(2)	15	all_cancers(5;4.81e-10)|all_epithelial(5;7.98e-11)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;8.1e-07)|Lung NSC(69;5.89e-06)|all_epithelial(167;0.000959)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0588)		TGCCAGGTGGGCTCCGTTTCC	0.507																																							uc001eig.2		NA																	0				ovary(1)	1						c.(193-195)GCC>GGC		regenerating islet-derived family, member 4							210.0	194.0	200.0					1																	120342457		2203	4300	6503	SO:0001583	missense	83998					extracellular region	sugar binding	g.chr1:120342457G>C	AY007243	CCDS906.1, CCDS53354.1	1p13.1-p12	2008-02-05			ENSG00000134193	ENSG00000134193			22977	protein-coding gene	gene with protein product	"""regenerating gene type IV"", "" gastrointestinal secretory protein"""	609846				11311942, 12455032	Standard	NM_032044		Approved	REG-IV, RELP, GISP	uc001eif.3	Q9BYZ8	OTTHUMG00000012175	ENST00000354219.1:c.194C>G	1.37:g.120342457G>C	ENSP00000346158:p.Ala65Gly					REG4_uc001eif.2_Missense_Mutation_p.A65G	p.A65G	NM_001159352	NP_001152824	Q9BYZ8	REG4_HUMAN		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0588)	5	634	-	all_cancers(5;4.81e-10)|all_epithelial(5;7.98e-11)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;8.1e-07)|Lung NSC(69;5.89e-06)|all_epithelial(167;0.000959)	65			C-type lectin.		Q8NER6|Q8NER7	Missense_Mutation	SNP	ENST00000354219.1	37	c.194C>G	CCDS906.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.223881	0.58668	.	.	ENSG00000134193	ENST00000354219;ENST00000256585;ENST00000369402;ENST00000530654	T;T;T	0.19394	2.15;2.15;2.15	4.89	3.95	0.45737	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.380726	0.24412	N	0.038754	T	0.06280	0.0162	N	0.17564	0.495	0.58432	D	0.999999	B	0.25743	0.133	B	0.32149	0.141	T	0.16867	-1.0388	10	0.32370	T	0.25	-3.2056	10.9562	0.47358	0.0:0.1891:0.8109:0.0	.	65	Q9BYZ8	REG4_HUMAN	G	65	ENSP00000346158:A65G;ENSP00000256585:A65G;ENSP00000437135:A65G	ENSP00000256585:A65G	A	-	2	0	REG4	120143980	0.990000	0.36364	0.414000	0.26521	0.024000	0.10985	2.599000	0.46231	1.254000	0.44035	0.650000	0.86243	GCC		0.507	REG4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033675.1	NM_032044		12	173	0	0	0	0.001368	0	12	173				
NBPF9	400818	broad.mit.edu	37	1	144828683	144828683	+	Nonsense_Mutation	SNP	C	C	T	rs369617939		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:144828683C>T	ENST00000281815.8	+	13	1269	c.523C>T	c.(523-525)Cag>Tag	p.Q175*	NBPF9_ENST00000338347.4_Nonsense_Mutation_p.Q577*|NBPF9_ENST00000468645.1_3'UTR|NBPF9_ENST00000440491.2_3'UTR			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	835	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.Q577E(1)		NS(2)|prostate(1)	3						ATTTGAGGAACAGCACATCAG	0.438																																							uc009wig.1		NA																	1	Substitution - Missense(1)		kidney(1)		0						c.(2728-2730)CAG>TAG		hypothetical protein LOC400818							42.0	35.0	37.0					1																	144828683		692	1578	2270	SO:0001587	stop_gained	400818					cytoplasm		g.chr1:144828683C>T		CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000281815.8:c.523C>T	1.37:g.144828683C>T	ENSP00000281815:p.Gln175*					NBPF9_uc010oxn.1_Nonsense_Mutation_p.Q808*|NBPF9_uc010oxo.1_Nonsense_Mutation_p.Q835*|NBPF9_uc010oxr.1_Nonsense_Mutation_p.Q937*|NBPF9_uc010oxt.1_Nonsense_Mutation_p.Q725*|NBPF9_uc001ekg.1_Nonsense_Mutation_p.Q237*|NBPF9_uc001ekk.1_Nonsense_Mutation_p.Q481*|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Nonsense_Mutation_p.Q237*|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Nonsense_Mutation_p.Q570*|uc001elr.3_5'Flank	p.Q910*	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN			23	2804	+			910			NBPF 7.			Nonsense_Mutation	SNP	ENST00000281815.8	37	c.2728C>T		.	.	.	.	.	.	.	.	.	.	.	36	5.637345	0.96693	.	.	ENSG00000168614	ENST00000338347;ENST00000281815	.	.	.	0.618	-1.08	0.09936	.	.	.	.	.	.	.	.	.	.	.	0.45066	D	0.99808	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	.	.	.	.	.	.	.	X	577;175	.	ENSP00000281815:Q175X	Q	+	1	0	NBPF9	143540040	0.003000	0.15002	0.000000	0.03702	0.022000	0.10575	0.038000	0.13862	-0.343000	0.08351	0.194000	0.17425	CAG		0.438	NBPF9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001037675		14	392	0	0	0	0.008871	0	14	392				
IVL	3713	broad.mit.edu	37	1	152883939	152883939	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:152883939C>A	ENST00000368764.3	+	2	1730	c.1666C>A	c.(1666-1668)Caa>Aaa	p.Q556K	IVL_ENST00000392667.2_Missense_Mutation_p.Q410K			P07476	INVO_HUMAN	involucrin	556					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCAAGACATTCAACCAGCCCT	0.592																																							uc001fau.2		NA																	0				ovary(3)	3						c.(1666-1668)CAA>AAA		involucrin							65.0	66.0	65.0					1																	152883939		2203	4300	6503	SO:0001583	missense	3713				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine|keratinization|response to UV-B	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity	g.chr1:152883939C>A	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1666C>A	1.37:g.152883939C>A	ENSP00000357753:p.Gln556Lys						p.Q556K	NM_005547	NP_005538	P07476	INVO_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	1712	+	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		556					Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	37	c.1666C>A	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.094742	0.56075	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.12879	3.17;2.64	4.8	-0.632	0.11523	.	.	.	.	.	T	0.03434	0.0099	L	0.59436	1.845	0.09310	N	1	B	0.30824	0.296	B	0.26094	0.066	T	0.40327	-0.9569	9	0.42905	T	0.14	.	1.0612	0.01600	0.2807:0.2783:0.2741:0.167	.	556	P07476	INVO_HUMAN	K	556;410	ENSP00000357753:Q556K;ENSP00000376435:Q410K	ENSP00000357753:Q556K	Q	+	1	0	IVL	151150563	0.004000	0.15560	0.000000	0.03702	0.143000	0.21401	0.781000	0.26774	0.006000	0.14734	0.563000	0.77884	CAA		0.592	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547		52	34	1	0	6.32628e-17	0.00361	9.9996e-17	52	34				
PGLYRP3	114771	broad.mit.edu	37	1	153270572	153270572	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:153270572C>A	ENST00000290722.1	-	7	938	c.886G>T	c.(886-888)Gac>Tac	p.D296Y		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	296					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGGATCAGGTCCTGGGCCGCC	0.547																																							uc001fbn.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(886-888)GAC>TAC		peptidoglycan recognition protein 3 precursor							258.0	231.0	240.0					1																	153270572		2203	4300	6503	SO:0001583	missense	114771				defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding	g.chr1:153270572C>A	AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.886G>T	1.37:g.153270572C>A	ENSP00000290722:p.Asp296Tyr						p.D296Y	NM_052891	NP_443123	Q96LB9	PGRP3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		7	939	-	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		296					A1A4U8|Q5SY65	Missense_Mutation	SNP	ENST00000290722.1	37	c.886G>T	CCDS1035.1	.	.	.	.	.	.	.	.	.	.	c	12.05	1.821594	0.32237	.	.	ENSG00000159527	ENST00000290722	T	0.14391	2.51	4.26	-2.28	0.06826	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	0.954279	0.08641	N	0.915478	T	0.12603	0.0306	M	0.63169	1.94	0.26499	N	0.974806	D	0.61080	0.989	P	0.62649	0.905	T	0.10064	-1.0646	10	0.87932	D	0	-15.9499	4.4882	0.11801	0.1689:0.5125:0.0:0.3186	.	296	Q96LB9	PGRP3_HUMAN	Y	296	ENSP00000290722:D296Y	ENSP00000290722:D296Y	D	-	1	0	PGLYRP3	151537196	0.010000	0.17322	0.892000	0.35008	0.754000	0.42855	-1.046000	0.03525	-0.330000	0.08514	0.563000	0.77884	GAC		0.547	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039488.1	NM_052891		240	204	1	0	1.44279e-96	0.00361	2.74019e-96	240	204				
SPTA1	6708	broad.mit.edu	37	1	158623215	158623215	+	Splice_Site	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:158623215C>A	ENST00000368147.4	-	22	3217	c.3037G>T	c.(3037-3039)Gac>Tac	p.D1013Y		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1013	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTCCACCAGTCCTGAAGGGAG	0.532																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(3037-3039)GAC>TAC		spectrin, alpha, erythrocytic 1							70.0	70.0	70.0					1																	158623215		2021	4173	6194	SO:0001630	splice_region_variant	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158623215C>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3037-1G>T	1.37:g.158623215C>A							p.D1013Y	NM_003126	NP_003117	P02549	SPTA1_HUMAN			22	3236	-	all_hematologic(112;0.0378)		1013			SH3.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.3037G>T	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188653	0.78789	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.34472	1.36;1.36	5.03	5.03	0.67393	Src homology-3 domain (4);Spectrin alpha chain, SH3 domain (1);	0.000000	0.34046	N	0.004317	T	0.61664	0.2365	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68957	-0.5272	10	0.72032	D	0.01	.	17.1084	0.86669	0.0:1.0:0.0:0.0	.	1013	P02549	SPTA1_HUMAN	Y	1013	ENSP00000357130:D1013Y;ENSP00000357129:D1013Y	ENSP00000357129:D1013Y	D	-	1	0	SPTA1	156889839	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	5.340000	0.65958	2.633000	0.89246	0.655000	0.94253	GAC		0.532	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	Missense_Mutation	46	16	1	0	1.48646e-12	0.010771	2.19387e-12	46	16				
OR6N1	128372	broad.mit.edu	37	1	158736189	158736189	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:158736189G>A	ENST00000335094.2	-	1	303	c.284C>T	c.(283-285)tCt>tTt	p.S95F		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					GAGACACCCAGAGAATGAAAT	0.483																																							uc010piq.1		NA																	0				ovary(1)	1						c.(283-285)TCT>TTT		olfactory receptor, family 6, subfamily N,							77.0	73.0	74.0					1																	158736189		2203	4300	6503	SO:0001583	missense	128372				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158736189G>A	BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.284C>T	1.37:g.158736189G>A	ENSP00000335535:p.Ser95Phe						p.S95F	NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN			1	284	-	all_hematologic(112;0.0378)		95			Extracellular (Potential).		Q5VUU8|Q96R35	Missense_Mutation	SNP	ENST00000335094.2	37	c.284C>T	CCDS30905.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.651740	0.47362	.	.	ENSG00000197403	ENST00000335094	T	0.00382	7.61	5.1	4.14	0.48551	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45867	D	0.000325	T	0.00144	0.0004	L	0.41356	1.27	0.28200	N	0.927402	P	0.46706	0.883	P	0.47206	0.541	T	0.47368	-0.9123	10	0.30854	T	0.27	-17.1966	6.5305	0.22324	0.0867:0.0:0.632:0.2813	.	95	Q8NGY5	OR6N1_HUMAN	F	95	ENSP00000335535:S95F	ENSP00000335535:S95F	S	-	2	0	OR6N1	157002813	0.000000	0.05858	0.998000	0.56505	0.964000	0.63967	0.659000	0.24994	2.623000	0.88846	0.655000	0.94253	TCT		0.483	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185		6	75	0	0	0	0.001984	0	6	75				
FCRLA	84824	broad.mit.edu	37	1	161683078	161683078	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:161683078G>T	ENST00000236938.6	+	5	1281	c.1039G>T	c.(1039-1041)Gat>Tat	p.D347Y	FCRLA_ENST00000349527.4_Missense_Mutation_p.D235Y|FCRLA_ENST00000367950.1_Missense_Mutation_p.D123Y|FCRLA_ENST00000367959.2_Missense_Mutation_p.D353Y|FCRLA_ENST00000309691.6_Missense_Mutation_p.D241Y|FCRLA_ENST00000540926.1_Missense_Mutation_p.D336Y|FCRLA_ENST00000294796.4_Missense_Mutation_p.D196Y|FCRLA_ENST00000470841.1_3'UTR|FCRLA_ENST00000367953.3_Missense_Mutation_p.D336Y|FCRLA_ENST00000367949.2_Missense_Mutation_p.D163Y|FCRLA_ENST00000350710.3_Missense_Mutation_p.D112Y|FCRLA_ENST00000540521.1_Missense_Mutation_p.D213Y|FCRLA_ENST00000367957.2_Missense_Mutation_p.D207Y|FCRLA_ENST00000546024.1_Missense_Mutation_p.D258Y	NM_032738.3	NP_116127.3	Q7L513	FCRLA_HUMAN	Fc receptor-like A	330					cell differentiation (GO:0030154)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|kidney(12)|large_intestine(4)|lung(13)|prostate(1)|skin(2)|stomach(1)	34	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			ACACATGCAGGATGTGAGAGT	0.522																																							uc001gbe.2		NA																	0					0						c.(1057-1059)GAT>TAT		Fc receptor-like and mucin-like 1							85.0	80.0	82.0					1																	161683078		2203	4300	6503	SO:0001583	missense	84824				cell differentiation	cytoplasm|extracellular region		g.chr1:161683078G>T	AF531423	CCDS30926.1, CCDS53415.1, CCDS53416.1, CCDS53417.1, CCDS53418.1, CCDS53419.1, CCDS53420.1	1q23.3	2014-01-28	2006-09-26	2006-09-26	ENSG00000132185	ENSG00000132185		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18504	protein-coding gene	gene with protein product		606891	"""Fc receptor-like and mucin-like 1"""	FCRLM1		11754007	Standard	NM_001184866		Approved	MGC4595, FCRLc2, FCRLb, FCRLc1, FCRLd, FCRLe, FCRL, FCRLa, FREB, FCRLX	uc001gbe.3	Q7L513	OTTHUMG00000034537	ENST00000236938.6:c.1039G>T	1.37:g.161683078G>T	ENSP00000236938:p.Asp347Tyr					FCRLA_uc001gbd.2_Missense_Mutation_p.D347Y|FCRLA_uc001gbf.2_Missense_Mutation_p.D258Y|FCRLA_uc001gbg.2_Missense_Mutation_p.D207Y|FCRLA_uc009wuo.2_Missense_Mutation_p.D213Y|FCRLA_uc009wup.2_Missense_Mutation_p.D163Y|FCRLA_uc009wuq.2_Missense_Mutation_p.D112Y	p.D353Y	NM_032738	NP_116127	Q7L513	FCRLA_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00301)		6	1299	+	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		330					A0N0M1|A6NC03|A6NL20|F5H720|F8W743|G3V1J2|Q5VXA1|Q5VXA2|Q5VXA3|Q5VXA4|Q5VXB0|Q5VXB1|Q8NEW4|Q8WXH3|Q96PC6|Q96PJ0|Q96PJ1|Q96PJ2|Q96PJ4|Q9BR57	Missense_Mutation	SNP	ENST00000236938.6	37	c.1057G>T	CCDS30926.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766820	0.69878	.	.	ENSG00000132185	ENST00000236938;ENST00000367959;ENST00000546024;ENST00000540521;ENST00000367949;ENST00000350710;ENST00000540926;ENST00000367957;ENST00000349527;ENST00000309691;ENST00000294796;ENST00000367953;ENST00000367950	T;T;T;T;T;T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.23	4.24	0.50183	.	0.210885	0.33753	N	0.004594	T	0.44746	0.1308	L	0.52573	1.65	0.39404	D	0.96664	D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.998;1.0;0.999;0.995	D;D;D;P;D;D;D	0.78314	0.943;0.991;0.988;0.897;0.988;0.915;0.946	T	0.41910	-0.9482	10	0.59425	D	0.04	.	7.8705	0.29563	0.1116:0.0:0.8884:0.0	.	112;163;213;207;258;353;347	F8W743;A6NL20;F5H720;Q5VXB1;G3V1J2;A6NC03;Q7L513-9	.;.;.;.;.;.;.	Y	347;353;258;213;163;112;336;207;235;241;196;336;123	ENSP00000236938:D347Y;ENSP00000356936:D353Y;ENSP00000439838:D258Y;ENSP00000442870:D213Y;ENSP00000356926:D163Y;ENSP00000344808:D112Y;ENSP00000446380:D336Y;ENSP00000356934:D207Y;ENSP00000294798:D235Y;ENSP00000309596:D241Y;ENSP00000294796:D196Y;ENSP00000356930:D336Y;ENSP00000356927:D123Y	ENSP00000236938:D347Y	D	+	1	0	FCRLA	159949702	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	1.812000	0.38952	2.716000	0.92895	0.655000	0.94253	GAT		0.522	FCRLA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083574.1	NM_032738		25	65	1	0	1.38267e-23	0.005443	2.36891e-23	25	65				
SEC16B	89866	broad.mit.edu	37	1	177909851	177909851	+	Splice_Site	SNP	T	T	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:177909851T>A	ENST00000308284.6	-	17	2112		c.e17-2		RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)						COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						CTCTGCTAGCTGTGCCAGGTT	0.507																																							uc001gli.1		NA																	0				ovary(3)|central_nervous_system(1)	4						c.e17-1		leucine zipper transcription regulator 2							38.0	41.0	40.0					1																	177909851		1988	4169	6157	SO:0001630	splice_region_variant	89866				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane		g.chr1:177909851T>A	AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2023-2A>T	1.37:g.177909851T>A						SEC16B_uc001glk.1_Splice_Site_p.L352_splice|SEC16B_uc009wwy.1_Splice_Site_p.L230_splice|SEC16B_uc001glh.1_Splice_Site_p.L334_splice|SEC16B_uc009wwz.1_Splice_Site_p.L334_splice|SEC16B_uc001glj.1_Splice_Site_p.L676_splice	p.L675_splice	NM_033127	NP_149118	Q96JE7	SC16B_HUMAN			17	2113	-								A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Splice_Site	SNP	ENST00000308284.6	37	c.2023_splice	CCDS44281.1	.	.	.	.	.	.	.	.	.	.	T	15.19	2.760383	0.49468	.	.	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2442	0.54560	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	AL359075.1	176176474	1.000000	0.71417	0.987000	0.45799	0.474000	0.32979	5.339000	0.65953	2.143000	0.66587	0.533000	0.62120	.		0.507	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127	Intron	26	13	0	0	0	0.004656	0	26	13				
TDRD5	163589	broad.mit.edu	37	1	179587789	179587789	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:179587789G>T	ENST00000367614.1	+	5	1246	c.887G>T	c.(886-888)aGt>aTt	p.S296I	TDRD5_ENST00000444136.1_Missense_Mutation_p.S296I|TDRD5_ENST00000294848.8_Missense_Mutation_p.S296I	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	296	HTH OST-type 3. {ECO:0000255|PROSITE- ProRule:PRU00975}.				DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						GGAACTATCAGTTCAGAACTA	0.313																																							uc001gnf.1		NA																	0				ovary(2)|skin(2)|central_nervous_system(1)	5						c.(886-888)AGT>ATT		tudor domain containing 5							61.0	66.0	64.0					1																	179587789		2203	4298	6501	SO:0001583	missense	163589				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding	g.chr1:179587789G>T	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.887G>T	1.37:g.179587789G>T	ENSP00000356586:p.Ser296Ile					TDRD5_uc010pnp.1_Missense_Mutation_p.S296I|TDRD5_uc001gnh.1_5'UTR	p.S296I	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN			5	1137	+			296					A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	37	c.887G>T	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.915004	0.52546	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	T;T;T	0.14516	2.5;2.5;2.71	4.77	0.704	0.18121	.	0.763118	0.11968	N	0.512073	T	0.19127	0.0459	L	0.39898	1.24	0.21256	N	0.999749	P;P	0.47604	0.898;0.896	P;P	0.55455	0.736;0.776	T	0.13229	-1.0517	10	0.59425	D	0.04	-2.3931	6.5826	0.22602	0.6309:0.0:0.3691:0.0	.	296;296	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	I	296	ENSP00000356586:S296I;ENSP00000294848:S296I;ENSP00000406052:S296I	ENSP00000294848:S296I	S	+	2	0	TDRD5	177854412	0.071000	0.21146	0.425000	0.26659	0.933000	0.57130	0.126000	0.15769	0.166000	0.19597	-0.253000	0.11424	AGT		0.313	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533		43	43	1	0	8.48111e-28	0.00361	1.47367e-27	43	43				
KCNH1	3756	broad.mit.edu	37	1	210977509	210977509	+	Splice_Site	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:210977509C>T	ENST00000271751.4	-	8	1490		c.e8-1		KCNH1_ENST00000367007.4_Splice_Site			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1						myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TAGAGAAGTGCTAGAGGTGAG	0.488																																							uc001hib.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.e8-1		potassium voltage-gated channel, subfamily H,							91.0	82.0	85.0					1																	210977509		2203	4300	6503	SO:0001630	splice_region_variant	3756				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity	g.chr1:210977509C>T	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1463-1G>A	1.37:g.210977509C>T						KCNH1_uc001hic.2_Splice_Site_p.S461_splice	p.S488_splice	NM_172362	NP_758872	O95259	KCNH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)	8	1633	-								B1AQ26|O76035|Q14CL3	Splice_Site	SNP	ENST00000271751.4	37	c.1463_splice	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.925679	0.92319	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7543	0.96284	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KCNH1	209044132	1.000000	0.71417	0.994000	0.49952	0.899000	0.52679	7.538000	0.82048	2.680000	0.91292	0.561000	0.74099	.		0.488	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	Intron	10	10	0	0	0	0.006214	0	10	10				
OBSCN	84033	broad.mit.edu	37	1	228431083	228431083	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:228431083G>T	ENST00000422127.1	+	10	3173	c.3129G>T	c.(3127-3129)caG>caT	p.Q1043H	OBSCN_ENST00000570156.2_Missense_Mutation_p.Q1135H|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.Q1043H|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1043	Ig-like 10.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGGTGCAGCAGGCAGGCAAGA	0.577																																							uc009xez.1		NA																	0				stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(3127-3129)CAG>CAT		obscurin, cytoskeletal calmodulin and							43.0	46.0	45.0					1																	228431083		2096	4205	6301	SO:0001583	missense	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228431083G>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.3129G>T	1.37:g.228431083G>T	ENSP00000409493:p.Gln1043His					OBSCN_uc001hsn.2_Missense_Mutation_p.Q1043H	p.Q1043H	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN			10	3173	+		Prostate(94;0.0405)	1043			Ig-like 10.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	c.3129G>T	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	.	9.122	1.009244	0.19277	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.04758	3.56;3.56	5.11	5.11	0.69529	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.860313	0.09921	U	0.738535	T	0.16599	0.0399	L	0.37630	1.12	0.80722	D	1	D;D	0.71674	0.979;0.998	P;D	0.70487	0.786;0.969	T	0.05937	-1.0855	10	0.52906	T	0.07	.	18.5431	0.91037	0.0:0.0:1.0:0.0	.	1043;1043	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	H	1043	ENSP00000284548:Q1043H;ENSP00000409493:Q1043H	ENSP00000284548:Q1043H	Q	+	3	2	OBSCN	226497706	0.980000	0.34600	0.997000	0.53966	0.106000	0.19336	0.604000	0.24164	2.371000	0.80710	0.460000	0.39030	CAG		0.577	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		17	38	1	0	4.14922e-12	0.004007	5.97975e-12	17	38				
PCNXL2	80003	broad.mit.edu	37	1	233136268	233136268	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:233136268C>T	ENST00000258229.9	-	30	5345	c.5111G>A	c.(5110-5112)tGc>tAc	p.C1704Y	PCNXL2_ENST00000344698.2_Missense_Mutation_p.C356Y	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1704						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				CTCGTCAGGGCAAGTGAACTG	0.617																																							uc001hvl.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(5110-5112)TGC>TAC		pecanex-like 2							60.0	62.0	62.0					1																	233136268		2021	4185	6206	SO:0001583	missense	80003					integral to membrane		g.chr1:233136268C>T	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.5111G>A	1.37:g.233136268C>T	ENSP00000258229:p.Cys1704Tyr					PCNXL2_uc001hvk.1_Missense_Mutation_p.C356Y|PCNXL2_uc001hvm.1_RNA	p.C1704Y	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN			30	5346	-		all_cancers(173;0.0347)|Prostate(94;0.137)	1704					O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	c.5111G>A	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.466561	0.26335	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	T;T	0.44482	0.92;0.92	5.51	5.51	0.81932	.	0.041460	0.85682	D	0.000000	T	0.60196	0.2250	L	0.47716	1.5	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.71184	0.972;0.966	T	0.60480	-0.7255	10	0.72032	D	0.01	.	19.7892	0.96452	0.0:1.0:0.0:0.0	.	1704;356	A6NKB5;A6NKB5-3	PCX2_HUMAN;.	Y	356;1704	ENSP00000340759:C356Y;ENSP00000258229:C1704Y	ENSP00000258229:C1704Y	C	-	2	0	PCNXL2	231202891	1.000000	0.71417	0.999000	0.59377	0.921000	0.55340	3.730000	0.55006	2.753000	0.94483	0.650000	0.86243	TGC		0.617	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801		8	17	0	0	0	0.00308	0	8	17				
OR2T4	127074	broad.mit.edu	37	1	248525924	248525924	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:248525924G>A	ENST00000366475.1	+	1	1042	c.1042G>A	c.(1042-1044)Gag>Aag	p.E348K		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	348						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AAAAGCTATGGAGTAGACCAT	0.403																																							uc001ieh.1		NA																	0				central_nervous_system(1)	1						c.(1042-1044)GAG>AAG		olfactory receptor, family 2, subfamily T,							77.0	81.0	80.0					1																	248525924		2203	4300	6503	SO:0001583	missense	127074				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248525924G>A	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.1042G>A	1.37:g.248525924G>A	ENSP00000355431:p.Glu348Lys						p.E348K	NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	1042	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		348			Cytoplasmic (Potential).		Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	c.1042G>A	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.548338	0.00926	.	.	ENSG00000196944	ENST00000366475	T	0.01767	4.65	2.6	1.25	0.21368	.	0.825134	0.09736	N	0.762467	T	0.00967	0.0032	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.46275	-0.9203	10	0.02654	T	1	.	6.5696	0.22531	0.8691:0.0:0.1309:0.0	.	348	Q8NH00	OR2T4_HUMAN	K	348	ENSP00000355431:E348K	ENSP00000355431:E348K	E	+	1	0	OR2T4	246592547	0.013000	0.17824	0.002000	0.10522	0.002000	0.02628	0.700000	0.25601	0.231000	0.21079	-0.441000	0.05720	GAG		0.403	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696		11	110	0	0	0	0.008291	0	11	110				
OR14I1	401994	broad.mit.edu	37	1	248845249	248845249	+	Missense_Mutation	SNP	G	G	T	rs367802071		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:248845249G>T	ENST00000342623.3	-	1	380	c.357C>A	c.(355-357)gaC>gaA	p.D119E		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	119						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						CAACATAGCGGTCATAAGACA	0.502																																							uc001ieu.1		NA																	0					0						c.(355-357)GAC>GAA		olfactory receptor, family 14, subfamily I,							85.0	74.0	78.0					1																	248845249		2203	4300	6503	SO:0001583	missense	401994				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248845249G>T		CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.357C>A	1.37:g.248845249G>T	ENSP00000339726:p.Asp119Glu						p.D119E	NM_001004734	NP_001004734	A6ND48	O14I1_HUMAN			1	357	-			119			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000342623.3	37	c.357C>A	CCDS31125.1	.	.	.	.	.	.	.	.	.	.	.	15.00	2.702600	0.48307	.	.	ENSG00000189181	ENST00000342623	T	0.02103	4.45	3.48	2.52	0.30459	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000188	T	0.20414	0.0491	H	0.98769	4.325	0.24874	N	0.992269	D	0.76494	0.999	D	0.91635	0.999	T	0.19712	-1.0297	10	0.87932	D	0	.	8.7936	0.34866	0.1225:0.0:0.8775:0.0	.	119	A6ND48	O14I1_HUMAN	E	119	ENSP00000339726:D119E	ENSP00000339726:D119E	D	-	3	2	OR14I1	246911872	0.973000	0.33851	0.806000	0.32338	0.550000	0.35303	-0.048000	0.11944	1.739000	0.51704	0.536000	0.68110	GAC		0.502	OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097128.1	NM_001004734		33	21	1	0	8.53417e-09	0.002836	1.10046e-08	33	21				
OR14I1	401994	broad.mit.edu	37	1	248845465	248845465	+	Silent	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:248845465G>T	ENST00000342623.3	-	1	164	c.141C>A	c.(139-141)atC>atA	p.I47I		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						GATCGAGAGTGATGACTGCAA	0.507																																							uc001ieu.1		NA																	0					0						c.(139-141)ATC>ATA		olfactory receptor, family 14, subfamily I,							135.0	113.0	120.0					1																	248845465		2203	4300	6503	SO:0001819	synonymous_variant	401994				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248845465G>T		CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.141C>A	1.37:g.248845465G>T							p.I47I	NM_001004734	NP_001004734	A6ND48	O14I1_HUMAN			1	141	-			47			Helical; Name=1; (Potential).			Silent	SNP	ENST00000342623.3	37	c.141C>A	CCDS31125.1																																																																																				0.507	OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097128.1	NM_001004734		7	53	1	0	4.26978e-12	0.00333	6.04679e-12	7	53				
PTER	9317	broad.mit.edu	37	10	16553053	16553053	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr10:16553053T>C	ENST00000378000.1	+	6	1094	c.848T>C	c.(847-849)cTc>cCc	p.L283P	PTER_ENST00000423462.2_Missense_Mutation_p.L236P|PTER_ENST00000298942.3_Missense_Mutation_p.L283P|PTER_ENST00000535784.2_Missense_Mutation_p.L283P	NM_001001484.2|NM_001261838.1|NM_030664.4	NP_001001484.1|NP_001248767.1|NP_109589.2	Q96BW5	PTER_HUMAN	phosphotriesterase related	283					catabolic process (GO:0009056)|epithelial cell differentiation (GO:0030855)	extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)	15						AGGGTGCGTCTCCTGGTGGAA	0.403																																					Ovarian(2;46 150 15648 38137 47908)	Ovarian(2;46 150 15648 38137 47908)	uc001iog.1		NA																	0				ovary(2)	2						c.(847-849)CTC>CCC		phosphotriesterase related							82.0	75.0	77.0					10																	16553053		2203	4300	6503	SO:0001583	missense	9317				catabolic process		hydrolase activity, acting on ester bonds|zinc ion binding	g.chr10:16553053T>C	BC015092	CCDS7111.1, CCDS58070.1, CCDS73070.1	10p12	2003-11-05			ENSG00000165983	ENSG00000165983			9590	protein-coding gene	gene with protein product		604446				9925913	Standard	NM_001001484		Approved		uc001ioi.2	Q96BW5	OTTHUMG00000017737	ENST00000378000.1:c.848T>C	10.37:g.16553053T>C	ENSP00000367239:p.Leu283Pro					PTER_uc001ioh.1_Missense_Mutation_p.L283P|PTER_uc001ioi.1_Missense_Mutation_p.L283P|PTER_uc009xjp.1_Missense_Mutation_p.L236P	p.L283P	NM_030664	NP_109589	Q96BW5	PTER_HUMAN			6	1055	+			283					B0YJ77|B3KTF5|D3DRU0|Q9BY46	Missense_Mutation	SNP	ENST00000378000.1	37	c.848T>C	CCDS7111.1	.	.	.	.	.	.	.	.	.	.	T	15.31	2.794962	0.50208	.	.	ENSG00000165983	ENST00000343656;ENST00000535784;ENST00000423462;ENST00000378000;ENST00000298942	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.9	5.9	0.94986	.	0.224290	0.45606	D	0.000349	T	0.48295	0.1492	M	0.61703	1.905	0.80722	D	1	P;P	0.44006	0.824;0.626	B;P	0.45660	0.382;0.489	T	0.39375	-0.9617	10	0.27785	T	0.31	-4.4433	16.3444	0.83118	0.0:0.0:0.0:1.0	.	236;283	Q96BW5-2;Q96BW5	.;PTER_HUMAN	P	283;283;236;283;283	ENSP00000439485:L283P;ENSP00000389535:L236P;ENSP00000367239:L283P;ENSP00000298942:L283P	ENSP00000298942:L283P	L	+	2	0	PTER	16593059	0.999000	0.42202	0.986000	0.45419	0.557000	0.35523	5.781000	0.68964	2.270000	0.75569	0.519000	0.50382	CTC		0.403	PTER-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047001.2	NM_030664		5	13	0	0	0	0.001984	0	5	13				
PTCHD3	374308	broad.mit.edu	37	10	27702277	27702277	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr10:27702277G>T	ENST00000438700.3	-	1	1020	c.903C>A	c.(901-903)ttC>ttA	p.F301L		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	301					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TGTATCCTCCGAAGAAGCCGG	0.597																																							uc001itu.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(901-903)TTC>TTA		patched domain containing 3							58.0	62.0	61.0					10																	27702277		2203	4300	6503	SO:0001583	missense	374308				spermatid development	integral to membrane	hedgehog receptor activity	g.chr10:27702277G>T	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.903C>A	10.37:g.27702277G>T	ENSP00000417658:p.Phe301Leu						p.F301L	NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN			1	1021	-			301			Helical; (Potential).		I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	c.903C>A	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	G	0.973	-0.699471	0.03279	.	.	ENSG00000182077	ENST00000438700	D	0.85171	-1.95	3.98	-7.96	0.01144	.	0.828097	0.11010	N	0.609554	T	0.56262	0.1973	N	0.02129	-0.67	0.23227	N	0.998085	B	0.09022	0.002	B	0.06405	0.002	T	0.48340	-0.9044	10	0.02654	T	1	-1.343	12.5135	0.56019	0.1387:0.3837:0.4776:0.0	.	301	Q3KNS1	PTHD3_HUMAN	L	301	ENSP00000417658:F301L	ENSP00000417658:F301L	F	-	3	2	PTCHD3	27742283	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-4.471000	0.00229	-3.799000	0.00105	-2.303000	0.00259	TTC		0.597	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541		21	75	1	0	4.26978e-12	0.00333	6.04679e-12	21	75				
JMJD1C	221037	broad.mit.edu	37	10	64974626	64974626	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr10:64974626C>T	ENST00000399262.2	-	8	1519	c.1301G>A	c.(1300-1302)tGg>tAg	p.W434*	JMJD1C_ENST00000402544.1_Nonsense_Mutation_p.W215*|JMJD1C_ENST00000399251.1_Nonsense_Mutation_p.W215*|JMJD1C_ENST00000542921.1_Nonsense_Mutation_p.W252*|JMJD1C_ENST00000489372.2_5'Flank	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	434					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TATTTGATCCCAGGGAGGCTG	0.368																																							uc001jmn.2		NA																	0				ovary(4)|breast(1)|central_nervous_system(1)	6						c.(1300-1302)TGG>TAG		jumonji domain containing 1C isoform a							154.0	134.0	140.0					10																	64974626		1818	4072	5890	SO:0001587	stop_gained	221037				blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding	g.chr10:64974626C>T	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.1301G>A	10.37:g.64974626C>T	ENSP00000382204:p.Trp434*					JMJD1C_uc001jml.2_Nonsense_Mutation_p.W215*|JMJD1C_uc001jmm.2_Nonsense_Mutation_p.W146*|JMJD1C_uc010qiq.1_Nonsense_Mutation_p.W252*|JMJD1C_uc009xpi.2_Nonsense_Mutation_p.W252*|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmp.1_Nonsense_Mutation_p.W146*	p.W434*	NM_032776	NP_116165	Q15652	JHD2C_HUMAN			8	1601	-	Prostate(12;0.0119)|all_hematologic(501;0.191)		434					A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Nonsense_Mutation	SNP	ENST00000399262.2	37	c.1301G>A	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	C	43	9.858615	0.99281	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	.	.	.	5.75	5.75	0.90469	.	0.164581	0.43579	U	0.000548	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-3.0057	19.9421	0.97168	0.0:1.0:0.0:0.0	.	.	.	.	X	434;215;215;252	.	ENSP00000382195:W215X	W	-	2	0	JMJD1C	64644632	1.000000	0.71417	0.995000	0.50966	0.868000	0.49771	6.181000	0.71988	2.714000	0.92807	0.561000	0.74099	TGG		0.368	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241		16	58	0	0	0	0.003163	0	16	58				
PPP3CB	5532	broad.mit.edu	37	10	75198004	75198004	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr10:75198004T>A	ENST00000360663.5	-	14	1682	c.1571A>T	c.(1570-1572)cAg>cTg	p.Q524L	PPP3CB_ENST00000394828.2_Missense_Mutation_p.Q515L|PPP3CB_ENST00000544628.1_Missense_Mutation_p.Q152L|PPP3CB_ENST00000394829.2_Missense_Mutation_p.Q525L			P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta isozyme	524					axon extension (GO:0048675)|calcium ion-dependent exocytosis (GO:0017156)|cellular response to drug (GO:0035690)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|innate immune response (GO:0045087)|learning (GO:0007612)|locomotion involved in locomotory behavior (GO:0031987)|memory (GO:0007613)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of transcription, DNA-templated (GO:0045893)|protein dephosphorylation (GO:0006470)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)|social behavior (GO:0035176)|T cell activation (GO:0042110)|T cell differentiation (GO:0030217)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	calcineurin complex (GO:0005955)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein phosphatase 2B binding (GO:0030346)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(7)|skin(1)|urinary_tract(1)	22	Prostate(51;0.0119)					AGTGGGTCACTGGGCAGTATG	0.547																																							uc001jue.2		NA																	0				skin(1)	1						c.(1570-1572)CAG>CTG		protein phosphatase 3, catalytic subunit, beta							112.0	96.0	102.0					10																	75198004		2203	4300	6503	SO:0001583	missense	5532							g.chr10:75198004T>A	M29551	CCDS7328.1, CCDS44436.1, CCDS44437.1	10q22.2	2010-03-17	2010-03-05		ENSG00000107758	ENSG00000107758	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9315	protein-coding gene	gene with protein product	"""calcineurin A beta"", ""protein phosphatase 2B, catalytic subunit, beta isoform"""	114106	"""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform"""	CALNB		1659808, 2558868	Standard	XM_005269944		Approved	CALNA2, CNA2, PP2Bbeta	uc001juf.3	P16298	OTTHUMG00000018472	ENST00000360663.5:c.1571A>T	10.37:g.75198004T>A	ENSP00000353881:p.Gln524Leu					PPP3CB_uc001juf.2_Missense_Mutation_p.Q525L|PPP3CB_uc001jug.2_Missense_Mutation_p.Q515L|PPP3CB_uc010qkj.1_Missense_Mutation_p.Q152L	p.Q524L	NM_021132	NP_066955	P16298	PP2BB_HUMAN			14	1706	-	Prostate(51;0.0119)		524					P16299|Q5F2F9|Q8N1F0|Q8N3W4	Missense_Mutation	SNP	ENST00000360663.5	37	c.1571A>T	CCDS7328.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.085737	0.36758	.	.	ENSG00000107758	ENST00000360663;ENST00000394829;ENST00000394828;ENST00000394823;ENST00000544628;ENST00000430762	T;T;T;T	0.44881	2.58;2.57;2.58;0.91	5.74	5.74	0.90152	.	0.566206	0.16787	N	0.199551	T	0.26484	0.0647	N	0.08118	0	0.80722	D	1	P;B;B	0.36535	0.557;0.421;0.421	B;B;B	0.32762	0.152;0.073;0.073	T	0.22871	-1.0204	10	0.66056	D	0.02	.	16.0363	0.80631	0.0:0.0:0.0:1.0	.	514;525;524	P16298-3;Q8N1F0;P16298	.;.;PP2BB_HUMAN	L	524;525;515;196;152;186	ENSP00000353881:Q524L;ENSP00000378306:Q525L;ENSP00000378305:Q515L;ENSP00000437596:Q152L	ENSP00000353881:Q524L	Q	-	2	0	PPP3CB	74868010	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.376000	0.59556	2.193000	0.70182	0.460000	0.39030	CAG		0.547	PPP3CB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048669.1	NM_021132		8	36	0	0	0	0.00308	0	8	36				
LIPK	643414	broad.mit.edu	37	10	90490869	90490869	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr10:90490869G>A	ENST00000404190.1	+	3	353	c.353G>A	c.(352-354)aGc>aAc	p.S118N		NM_001080518.1	NP_001073987.1	Q5VXJ0	LIPK_HUMAN	lipase, family member K	118					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	12		Colorectal(252;0.0381)		Colorectal(12;7.03e-05)|COAD - Colon adenocarcinoma(12;8.33e-05)		TTGGGGAACAGCCGAGGAAAC	0.443																																							uc010qmv.1		NA																	0				ovary(2)	2						c.(352-354)AGC>AAC		lipase, family member K precursor							78.0	79.0	79.0					10																	90490869		2030	4230	6260	SO:0001583	missense	643414				lipid catabolic process	extracellular region	hydrolase activity	g.chr10:90490869G>A		CCDS44455.1	10q23.31	2008-02-04	2007-02-27	2007-02-27	ENSG00000204021	ENSG00000204021			23444	protein-coding gene	gene with protein product		613922	"""lipase-like, ab-hydrolase domain containing 2"""	LIPL2			Standard	NM_001080518		Approved	bA186O14.2	uc010qmv.2	Q5VXJ0	OTTHUMG00000018693	ENST00000404190.1:c.353G>A	10.37:g.90490869G>A	ENSP00000383900:p.Ser118Asn						p.S118N	NM_001080518	NP_001073987	Q5VXJ0	LIPK_HUMAN		Colorectal(12;7.03e-05)|COAD - Colon adenocarcinoma(12;8.33e-05)	3	353	+		Colorectal(252;0.0381)	118					A7KIH8	Missense_Mutation	SNP	ENST00000404190.1	37	c.353G>A	CCDS44455.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875689	0.91664	.	.	ENSG00000204021	ENST00000404190	T	0.70631	-0.5	5.45	5.45	0.79879	Alpha/beta hydrolase fold-1 (1);	0.000000	0.64402	D	0.000003	T	0.76328	0.3972	L	0.48986	1.54	0.45567	D	0.99851	D	0.61080	0.989	P	0.60789	0.879	T	0.74290	-0.3713	10	0.40728	T	0.16	-21.375	12.1656	0.54127	0.081:0.0:0.919:0.0	.	118	Q5VXJ0	LIPK_HUMAN	N	118	ENSP00000383900:S118N	ENSP00000383900:S118N	S	+	2	0	LIPK	90480849	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.458000	0.73509	2.836000	0.97738	0.655000	0.94253	AGC		0.443	LIPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049253.2	XM_061222		6	16	0	0	0	0.001168	0	6	16				
CYP17A1	1586	broad.mit.edu	37	10	104592307	104592307	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr10:104592307G>A	ENST00000369887.3	-	6	1271	c.1100C>T	c.(1099-1101)gCc>gTc	p.A367V	CYP17A1_ENST00000489268.1_5'Flank|CYP17A1-AS1_ENST00000369884.4_RNA	NM_000102.3	NP_000093.1	P05093	CP17A_HUMAN	cytochrome P450, family 17, subfamily A, polypeptide 1	367					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|biphenyl metabolic process (GO:0018879)|cellular response to antibiotic (GO:0071236)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to lipopolysaccharide (GO:0071222)|dibenzo-p-dioxin metabolic process (GO:0018894)|glucocorticoid biosynthetic process (GO:0006704)|hippocampus development (GO:0021766)|hormone biosynthetic process (GO:0042446)|Leydig cell differentiation (GO:0033327)|ovulation (GO:0030728)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|progesterone metabolic process (GO:0042448)|response to acetate (GO:0010034)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to insecticide (GO:0017085)|response to ionizing radiation (GO:0010212)|response to methylmercury (GO:0051597)|response to nutrient levels (GO:0031667)|response to retinoic acid (GO:0032526)|response to steroid hormone (GO:0048545)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	axon (GO:0030424)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)	17-alpha-hydroxyprogesterone aldolase activity (GO:0047442)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|steroid 17-alpha-monooxygenase activity (GO:0004508)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	Abiraterone(DB05812)|Aminophenazone(DB01424)|Dexamethasone(DB01234)|Metoclopramide(DB01233)|Progesterone(DB00396)	GAGCATAGGGGCCACGGGCCT	0.602																																							uc001kwg.2		NA																	0					0						c.(1099-1101)GCC>GTC		cytochrome P450, family 17	NADH(DB00157)|Progesterone(DB00396)						113.0	87.0	96.0					10																	104592307		2203	4300	6503	SO:0001583	missense	1586				androgen biosynthetic process|glucocorticoid biosynthetic process|sex differentiation|xenobiotic metabolic process	endoplasmic reticulum membrane	electron carrier activity|heme binding|oxygen binding|steroid 17-alpha-monooxygenase activity	g.chr10:104592307G>A	M19489	CCDS7541.1	10q24.3	2010-05-04	2003-02-14	2003-02-28	ENSG00000148795	ENSG00000148795	1.14.99.9	"""Cytochrome P450s"""	2593	protein-coding gene	gene with protein product	"""Steroid 17-alpha-monooxygenase"""	609300	"""cytochrome P450, subfamily XVII (steroid 17-alpha-hydroxylase), adrenal hyperplasia"""	CYP17		1347802	Standard	NM_000102		Approved	P450C17, CPT7, S17AH	uc001kwg.3	P05093	OTTHUMG00000018969	ENST00000369887.3:c.1100C>T	10.37:g.104592307G>A	ENSP00000358903:p.Ala367Val						p.A367V	NM_000102	NP_000093	P05093	CP17A_HUMAN		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	6	1272	-		Colorectal(252;0.122)|all_hematologic(284;0.152)	367					Q5TZV7	Missense_Mutation	SNP	ENST00000369887.3	37	c.1100C>T	CCDS7541.1	.	.	.	.	.	.	.	.	.	.	G	19.43	3.826321	0.71143	.	.	ENSG00000148795	ENST00000369887	T	0.64438	-0.1	5.37	4.46	0.54185	.	0.254195	0.45361	D	0.000373	T	0.57388	0.2050	N	0.20574	0.59	0.42647	D	0.993438	D	0.57571	0.98	P	0.56916	0.809	T	0.52298	-0.8594	10	0.10377	T	0.69	.	13.9121	0.63873	0.0747:0.0:0.9253:0.0	.	367	P05093	CP17A_HUMAN	V	367	ENSP00000358903:A367V	ENSP00000358903:A367V	A	-	2	0	CYP17A1	104582297	1.000000	0.71417	0.992000	0.48379	0.985000	0.73830	9.319000	0.96338	1.393000	0.46605	0.561000	0.74099	GCC		0.602	CYP17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050101.1	NM_000102		23	75	0	0	0	0.00278	0	23	75				
SORCS1	114815	broad.mit.edu	37	10	108337311	108337311	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr10:108337311C>A	ENST00000263054.6	-	26	3381	c.3374G>T	c.(3373-3375)aGa>aTa	p.R1125I	SORCS1_ENST00000344440.6_Intron|SORCS1_ENST00000369698.1_Nonsense_Mutation_p.E714*	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	1125					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TAAAGCTACTCTCCTAAGAGA	0.488																																							uc001kym.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(3373-3375)AGA>ATA		SORCS receptor 1 isoform a							74.0	74.0	74.0					10																	108337311		2203	4300	6503	SO:0001583	missense	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108337311C>A	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.3374G>T	10.37:g.108337311C>A	ENSP00000263054:p.Arg1125Ile					SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_3'UTR	p.R1125I	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	26	3382	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	1125			Cytoplasmic (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	c.3374G>T	CCDS7559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.811612|5.811612	0.96975|0.96975	.|.	.|.	ENSG00000108018|ENSG00000108018	ENST00000369698|ENST00000263054	.|T	.|0.16324	.|2.35	5.52|5.52	4.56|4.56	0.56223|0.56223	.|.	.|.	.|.	.|.	.|.	.|T	.|0.14141	.|0.0342	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|P	.|0.37663	.|0.604	.|B	.|0.43386	.|0.418	.|T	.|0.04115	.|-1.0976	.|8	.|.	.|.	.|.	.|.	4.4076|4.4076	0.11416|0.11416	0.1504:0.6002:0.1656:0.0838|0.1504:0.6002:0.1656:0.0838	.|.	.|1125	.|Q8WY21	.|SORC1_HUMAN	X|I	714|1125	.|ENSP00000263054:R1125I	.|.	E|R	-|-	1|2	0|0	SORCS1|SORCS1	108327301|108327301	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.407000|1.407000	0.34657|0.34657	2.759000|2.759000	0.94783|0.94783	0.555000|0.555000	0.69702|0.69702	GAG|AGA		0.488	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		20	74	1	0	3.99206e-14	0.007413	6.03737e-14	20	74				
CCDC186	55088	broad.mit.edu	37	10	115891846	115891846	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr10:115891846C>A	ENST00000369287.3	-	11	2019	c.1753G>T	c.(1753-1755)Gaa>Taa	p.E585*	C10orf118_ENST00000497592.1_5'Flank|C10orf118_ENST00000543782.1_Nonsense_Mutation_p.E183*	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		585										NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		AGCTCAGATTCTCTTTTCCTA	0.363																																							uc001lbb.1		NA																	0				ovary(2)	2						c.(1753-1755)GAA>TAA		CTCL tumor antigen L14-2							108.0	100.0	103.0					10																	115891846		2203	4300	6503	SO:0001587	stop_gained	55088							g.chr10:115891846C>A																												ENST00000369287.3:c.1753G>T	10.37:g.115891846C>A	ENSP00000358293:p.Glu585*					C10orf118_uc009xyd.1_Nonsense_Mutation_p.E183*|C10orf118_uc001lbc.1_Nonsense_Mutation_p.E585*|C10orf118_uc009xye.1_RNA	p.E585*	NM_018017	NP_060487	Q7Z3E2	CJ118_HUMAN		Epithelial(162;0.0161)|all cancers(201;0.0397)	11	2405	-		Colorectal(252;0.172)|Breast(234;0.188)	585			Potential.		Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Nonsense_Mutation	SNP	ENST00000369287.3	37	c.1753G>T	CCDS7587.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	10.078526|10.078526	0.99331|0.99331	.|.	.|.	ENSG00000165813|ENSG00000165813	ENST00000369287;ENST00000543782;ENST00000430353|ENST00000428953	.|T	.|0.76186	.|-1.0	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.048057|.	0.85682|.	D|.	0.000000|.	.|D	.|0.85526	.|0.5717	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|D	.|0.86355	.|0.1713	.|5	0.32370|0.66056	T|D	0.25|0.02	.|.	18.2733|18.2733	0.90074|0.90074	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	585;183;691|213	.|ENSP00000415344:R213I	ENSP00000358293:E585X|ENSP00000415344:R213I	E|R	-|-	1|2	0|0	C10orf118|C10orf118	115881836|115881836	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.751000|7.751000	0.85126|0.85126	2.744000|2.744000	0.94065|0.94065	0.650000|0.650000	0.86243|0.86243	GAA|AGA		0.363	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050455.1			27	57	1	0	5.77227e-19	0.008361	9.42804e-19	27	57				
CUZD1	50624	broad.mit.edu	37	10	124596450	124596450	+	Silent	SNP	C	C	A	rs201913985		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr10:124596450C>A	ENST00000368904.1	-	7	1663	c.714G>T	c.(712-714)tcG>tcT	p.S238S	CUZD1_ENST00000392790.1_Silent_p.S238S|CUZD1_ENST00000545804.1_Silent_p.S238S					CUB and zona pellucida-like domains 1											NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|stomach(1)	39		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		AGTTTGATGACGATTCGAAGG	0.453																																							uc001lgq.2		NA																	0		p.S238L(1)		ovary(1)|skin(1)	2						c.(712-714)TCG>TCT		CUB and zona pellucida-like domains 1 precursor							130.0	121.0	124.0					10																	124596450		2203	4300	6503	SO:0001819	synonymous_variant	50624				cell cycle|cell division|cell proliferation|substrate-dependent cell migration, cell attachment to substrate|trypsinogen activation	integral to membrane|transport vesicle membrane|zymogen granule membrane		g.chr10:124596450C>A	AF305835	CCDS7631.1	10q26.13	2003-11-18			ENSG00000138161	ENSG00000138161			17937	protein-coding gene	gene with protein product						10542259	Standard	NM_022034		Approved	ERG-1, UO-44		Q86UP6	OTTHUMG00000019195	ENST00000368904.1:c.714G>T	10.37:g.124596450C>A						CUZD1_uc001lgp.2_5'UTR|CUZD1_uc009yad.2_5'UTR|CUZD1_uc009yaf.2_Intron|CUZD1_uc001lgr.2_5'UTR|CUZD1_uc010qty.1_Intron|CUZD1_uc009yae.2_Intron|CUZD1_uc001lgs.2_Silent_p.S238S|CUZD1_uc010qtz.1_Silent_p.S238S	p.S238S	NM_022034	NP_071317	Q86UP6	CUZD1_HUMAN		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)	5	1046	-		all_neural(114;0.169)|Glioma(114;0.222)	238			Extracellular (Potential).|CUB 2.			Silent	SNP	ENST00000368904.1	37	c.714G>T	CCDS7631.1																																																																																				0.453	CUZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050829.2	NM_022034		20	57	1	0	0.00887093	0.008871	0.00965946	20	57				
OR52W1	120787	broad.mit.edu	37	11	6220734	6220734	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr11:6220734C>A	ENST00000311352.2	+	1	359	c.281C>A	c.(280-282)cCc>cAc	p.P94H	RP11-290F24.6_ENST00000600308.1_lincRNA	NM_001005178.1	NP_001005178.1	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W, member 1	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)	11		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGCTTGGGCCCCGATCTGTG	0.562																																							uc010qzz.1		NA																	0					0						c.(280-282)CCC>CAC		olfactory receptor, family 52, subfamily W,							72.0	55.0	61.0					11																	6220734		2201	4296	6497	SO:0001583	missense	120787				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6220734C>A	AB065511	CCDS31407.1	11p15.4	2012-08-09		2004-03-10	ENSG00000175485	ENSG00000175485		"""GPCR / Class A : Olfactory receptors"""	15239	protein-coding gene	gene with protein product				OR52W1P			Standard	NM_001005178		Approved		uc010qzz.2	Q6IF63	OTTHUMG00000165378	ENST00000311352.2:c.281C>A	11.37:g.6220734C>A	ENSP00000309673:p.Pro94His						p.P94H	NM_001005178	NP_001005178	Q6IF63	O52W1_HUMAN		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	281	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	94			Extracellular (Potential).		Q8NH78	Missense_Mutation	SNP	ENST00000311352.2	37	c.281C>A	CCDS31407.1	.	.	.	.	.	.	.	.	.	.	C	7.432	0.638861	0.14386	.	.	ENSG00000175485	ENST00000311352	T	0.01538	4.79	5.85	4.88	0.63580	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36374	U	0.002637	T	0.01558	0.0050	N	0.00801	-1.175	0.09310	N	1	D	0.61697	0.99	P	0.55824	0.785	T	0.65763	-0.6089	10	0.25106	T	0.35	.	15.5577	0.76213	0.0:0.8621:0.1379:0.0	.	94	Q6IF63	O52W1_HUMAN	H	94	ENSP00000309673:P94H	ENSP00000309673:P94H	P	+	2	0	OR52W1	6177310	0.000000	0.05858	0.333000	0.25482	0.390000	0.30446	0.133000	0.15912	2.767000	0.95098	0.655000	0.94253	CCC		0.562	OR52W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383758.1	NM_001005178		13	21	1	0	4.36969e-10	0.001855	5.91477e-10	13	21				
OR2AG1	144125	broad.mit.edu	37	11	6807054	6807055	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr11:6807054_6807055CA>AG	ENST00000307401.4	+	1	807_808	c.786_787CA>AG	c.(784-789)ccCAgt>ccAGgt	p.S263G		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	263						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ATGTCTTGCCCAGTTCCTTCCA	0.485																																							uc001mer.1		NA																	0				central_nervous_system(1)	1						c.(784-789)CCCAGT>CCAGGT		olfactory receptor, family 2, subfamily AG,																																				SO:0001583	missense	144125				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6807054_6807055CA>AG	AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	Exception_encountered	11.37:g.6807054_6807055delinsAG	ENSP00000307447:p.Ser263Gly						p.S263G	NM_001004489	NP_001004489	Q9H205	O2AG1_HUMAN		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	786_787	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)	263			Extracellular (Potential).		B9EKV7|Q6IFG7|Q96R26	Missense_Mutation	DNP	ENST00000307401.4	37	c.786_787CA>AG	CCDS31414.1																																																																																				0.485	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385980.1	NM_001004489		20	44	0	0	0	0.004672	0	20	44				
OR6A2	8590	broad.mit.edu	37	11	6816318	6816318	+	Missense_Mutation	SNP	C	C	T	rs377074755		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr11:6816318C>T	ENST00000332601.3	-	1	810	c.622G>A	c.(622-624)Gcc>Acc	p.A208T		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	208					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ATAAAAATGGCCAGGATGAAA	0.488																																							uc001mes.1		NA																	0				ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(622-624)GCC>ACC		olfactory receptor, family 6, subfamily A,		C	THR/ALA	1,4401	2.1+/-5.4	0,1,2200	107.0	114.0	112.0		622	5.1	1.0	11		112	2,8590	2.2+/-6.3	0,2,4294	no	missense	OR6A2	NM_003696.2	58	0,3,6494	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	208/328	6816318	3,12991	2201	4296	6497	SO:0001583	missense	8590				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6816318C>T	AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.622G>A	11.37:g.6816318C>T	ENSP00000330384:p.Ala208Thr						p.A208T	NM_003696	NP_003687	O95222	OR6A2_HUMAN		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	822	-		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	208			Helical; Name=5; (Potential).		Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	ENST00000332601.3	37	c.622G>A	CCDS7772.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101981	0.56183	2.27E-4	2.33E-4	ENSG00000184933	ENST00000332601	T	0.37752	1.18	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000035	T	0.54854	0.1884	L	0.49778	1.585	0.38870	D	0.956681	D	0.89917	1.0	D	0.97110	1.0	T	0.55860	-0.8074	10	0.56958	D	0.05	.	16.3566	0.83237	0.0:1.0:0.0:0.0	.	208	O95222	OR6A2_HUMAN	T	208	ENSP00000330384:A208T	ENSP00000330384:A208T	A	-	1	0	OR6A2	6772894	0.747000	0.28283	0.996000	0.52242	0.134000	0.20937	1.252000	0.32874	2.809000	0.96659	0.655000	0.94253	GCC		0.488	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385981.1	NM_003696		31	74	0	0	0	0.010818	0	31	74				
OR5B3	441608	broad.mit.edu	37	11	58170070	58170070	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr11:58170070C>T	ENST00000309403.2	-	1	812	c.813G>A	c.(811-813)atG>atA	p.M271I		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ACACAGGTGCCATTTTGTCTG	0.453																																							uc010rkf.1		NA																	0					0						c.(811-813)ATG>ATA		olfactory receptor, family 5, subfamily B,							123.0	113.0	116.0					11																	58170070		2201	4295	6496	SO:0001583	missense	441608				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58170070C>T	AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.813G>A	11.37:g.58170070C>T	ENSP00000308270:p.Met271Ile						p.M271I	NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN			1	813	-	Esophageal squamous(5;0.0027)	Breast(21;0.0778)	271			Helical; Name=7; (Potential).		Q6IEV6	Missense_Mutation	SNP	ENST00000309403.2	37	c.813G>A	CCDS31549.1	.	.	.	.	.	.	.	.	.	.	c	0	-2.773203	0.00081	.	.	ENSG00000172769	ENST00000309403	T	0.00063	8.78	4.06	-0.917	0.10485	GPCR, rhodopsin-like superfamily (1);	0.575817	0.15961	N	0.236252	T	0.00039	0.0001	N	0.02802	-0.49	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.25606	-1.0127	10	0.02654	T	1	-13.8695	7.9035	0.29748	0.6001:0.3177:0.0:0.0822	.	271	Q8NH48	OR5B3_HUMAN	I	271	ENSP00000308270:M271I	ENSP00000308270:M271I	M	-	3	0	OR5B3	57926646	0.000000	0.05858	0.009000	0.14445	0.211000	0.24417	-2.088000	0.01359	-0.258000	0.09446	-1.014000	0.02459	ATG		0.453	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394886.1	NM_001005469		32	54	0	0	0	0.012213	0	32	54				
C11orf24	53838	broad.mit.edu	37	11	68030132	68030132	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr11:68030132C>A	ENST00000304271.6	-	4	733	c.331G>T	c.(331-333)Gcc>Tcc	p.A111S	C11orf24_ENST00000533310.1_Intron|C11orf24_ENST00000530166.1_5'UTR	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	111						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						GTACTGGAGGCCACAGCCGTG	0.587																																					NSCLC(21;855 905 4198 36694)	NSCLC(21;855 905 4198 36694)	uc001onr.3		NA																	0					0						c.(331-333)GCC>TCC		hypothetical protein LOC53838 precursor							100.0	71.0	81.0					11																	68030132		2200	4294	6494	SO:0001583	missense	53838					integral to membrane		g.chr11:68030132C>A	AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.331G>T	11.37:g.68030132C>A	ENSP00000307264:p.Ala111Ser					C11orf24_uc001ons.2_Missense_Mutation_p.A111S	p.A111S	NM_022338	NP_071733	Q96F05	CK024_HUMAN			4	773	-			111			Extracellular (Potential).		Q9H2K4	Missense_Mutation	SNP	ENST00000304271.6	37	c.331G>T	CCDS8180.1	.	.	.	.	.	.	.	.	.	.	C	0.617	-0.822623	0.02755	.	.	ENSG00000171067	ENST00000304271	T	0.30448	1.53	1.91	0.679	0.17975	.	.	.	.	.	T	0.13114	0.0318	N	0.14661	0.345	0.09310	N	1	B	0.30068	0.267	B	0.24394	0.053	T	0.26916	-1.0089	9	0.08599	T	0.76	.	7.1291	0.25490	0.4664:0.5336:0.0:0.0	.	111	Q96F05	CK024_HUMAN	S	111	ENSP00000307264:A111S	ENSP00000307264:A111S	A	-	1	0	C11orf24	67786708	0.000000	0.05858	0.003000	0.11579	0.026000	0.11368	-0.848000	0.04326	0.720000	0.32209	0.298000	0.19748	GCC		0.587	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394750.1	NM_022338		23	29	1	0	1.9806e-07	0.002299	2.45074e-07	23	29				
NXPE4	54827	broad.mit.edu	37	11	114450953	114450953	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr11:114450953T>C	ENST00000375478.3	-	5	1180	c.1000A>G	c.(1000-1002)Aca>Gca	p.T334A	NXPE4_ENST00000424261.2_Missense_Mutation_p.T50A	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	334						extracellular vesicular exosome (GO:0070062)											ATTTTGACTGTAGCCAAACTA	0.443																																							uc001ppc.2		NA																	0				ovary(2)|skin(2)	4						c.(1000-1002)ACA>GCA		hypothetical protein LOC54827 isoform 1							189.0	178.0	181.0					11																	114450953		1882	4127	6009	SO:0001583	missense	54827					extracellular region		g.chr11:114450953T>C	AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.1000A>G	11.37:g.114450953T>C	ENSP00000364627:p.Thr334Ala					FAM55D_uc001ppd.2_Missense_Mutation_p.T50A	p.T334A	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)	5	1181	-		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)	334					Q6QDB4|Q9NXP5	Missense_Mutation	SNP	ENST00000375478.3	37	c.1000A>G	CCDS41718.1	.	.	.	.	.	.	.	.	.	.	T	8.613	0.889487	0.17540	.	.	ENSG00000137634	ENST00000424261;ENST00000375478	T;T	0.13538	2.58;2.78	5.31	-0.162	0.13367	.	1.013270	0.07901	N	0.972586	T	0.06781	0.0173	N	0.21282	0.65	0.09310	N	1	B	0.14805	0.011	B	0.17979	0.02	T	0.43343	-0.9397	10	0.08837	T	0.75	.	1.4674	0.02408	0.1532:0.2269:0.3426:0.2773	.	334	Q6UWF7	FA55D_HUMAN	A	50;334	ENSP00000401503:T50A;ENSP00000364627:T334A	ENSP00000364627:T334A	T	-	1	0	FAM55D	113956163	0.000000	0.05858	0.005000	0.12908	0.799000	0.45148	-0.679000	0.05203	-0.210000	0.10140	-0.256000	0.11100	ACA		0.443	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399179.1	NM_017678		35	91	0	0	0	0.003271	0	35	91				
OR8B12	219858	broad.mit.edu	37	11	124412733	124412733	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr11:124412733G>A	ENST00000306842.2	-	1	842	c.818C>T	c.(817-819)tCc>tTc	p.S273F		NM_001005195.1	NP_001005195.1	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B, member 12	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		GAACAGGGAGGACACTTTCCC	0.448																																							uc010sam.1		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(817-819)TCC>TTC		olfactory receptor, family 8, subfamily B,							88.0	84.0	85.0					11																	124412733		2201	4299	6500	SO:0001583	missense	219858				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124412733G>A		CCDS31711.1	11q24.2	2013-09-24			ENSG00000170953	ENSG00000170953		"""GPCR / Class A : Olfactory receptors"""	15307	protein-coding gene	gene with protein product							Standard	NM_001005195		Approved		uc010sam.2	Q8NGG6	OTTHUMG00000165922	ENST00000306842.2:c.818C>T	11.37:g.124412733G>A	ENSP00000307159:p.Ser273Phe						p.S273F	NM_001005195	NP_001005195	Q8NGG6	OR8BC_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)	1	818	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	273			Helical; Name=7; (Potential).		B2RNF6|Q6IEW8|Q96RC7	Missense_Mutation	SNP	ENST00000306842.2	37	c.818C>T	CCDS31711.1	.	.	.	.	.	.	.	.	.	.	G	9.882	1.201763	0.22121	.	.	ENSG00000170953	ENST00000306842	T	0.34859	1.34	3.89	2.02	0.26589	GPCR, rhodopsin-like superfamily (1);	0.371038	0.23594	N	0.046510	T	0.18759	0.0450	N	0.04508	-0.205	0.09310	N	1	B	0.22080	0.064	B	0.34418	0.182	T	0.22208	-1.0223	10	0.72032	D	0.01	.	5.7984	0.18399	0.4116:0.0:0.5884:0.0	.	273	Q8NGG6	OR8BC_HUMAN	F	273	ENSP00000307159:S273F	ENSP00000307159:S273F	S	-	2	0	OR8B12	123917943	0.000000	0.05858	0.599000	0.28851	0.770000	0.43624	-0.055000	0.11807	0.614000	0.30107	0.650000	0.86243	TCC		0.448	OR8B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387061.1			14	31	0	0	0	0.003163	0	14	31				
NOP2	4839	broad.mit.edu	37	12	6672840	6672840	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr12:6672840G>C	ENST00000322166.5	-	7	749	c.628C>G	c.(628-630)Ctg>Gtg	p.L210V	NOP2_ENST00000382421.3_Missense_Mutation_p.L243V|NOP2_ENST00000545200.1_Missense_Mutation_p.L206V|NOP2_ENST00000541778.1_Missense_Mutation_p.L206V|NOP2_ENST00000399466.2_Missense_Mutation_p.L206V|NOP2_ENST00000537442.1_Missense_Mutation_p.L210V|NOP2_ENST00000542015.1_Intron	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	210					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						TTGATCTGCAGGCCCCCATCT	0.567											OREG0021630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001qpk.1		NA																	0				ovary(2)	2						c.(628-630)CTG>GTG		Homo sapiens cDNA FLJ31646 fis, clone NT2RI2003921, highly similar to PROLIFERATING-CELL NUCLEOLAR ANTIGEN P120.							46.0	49.0	48.0					12																	6672840		1954	4123	6077	SO:0001583	missense	4839				positive regulation of cell proliferation|rRNA processing	nucleolus	protein binding|RNA binding|S-adenosylmethionine-dependent methyltransferase activity	g.chr12:6672840G>C		CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.628C>G	12.37:g.6672840G>C	ENSP00000313272:p.Leu210Val		OREG0021630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	635	NOP2_uc009zeq.1_5'Flank|NOP2_uc001qph.1_Missense_Mutation_p.L206V|NOP2_uc001qpi.1_Missense_Mutation_p.L206V|NOP2_uc001qpj.1_Intron|NOP2_uc001qpl.1_Missense_Mutation_p.L243V|NOP2_uc001qpm.1_Missense_Mutation_p.L210V	p.L210V			P46087	NOP2_HUMAN			6	672	-			210					A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Missense_Mutation	SNP	ENST00000322166.5	37	c.628C>G	CCDS58203.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860669	0.51482	.	.	ENSG00000111641	ENST00000537442;ENST00000382421;ENST00000545200;ENST00000399466;ENST00000322166;ENST00000541778;ENST00000542944;ENST00000542867	T;T;T;T;T;T;T;T	0.57273	2.23;2.03;2.33;2.21;2.23;2.21;0.73;0.41	5.57	4.67	0.58626	.	0.306880	0.30999	N	0.008457	T	0.43188	0.1236	L	0.43646	1.37	0.80722	D	1	B;P	0.36110	0.402;0.537	B;B	0.32928	0.119;0.155	T	0.38243	-0.9670	10	0.44086	T	0.13	-8.756	12.3045	0.54893	0.0836:0.0:0.9164:0.0	.	243;206	Q3KQS4;P46087-2	.;.	V	210;243;206;206;210;206;86;206	ENSP00000444437:L210V;ENSP00000371858:L243V;ENSP00000439422:L206V;ENSP00000382392:L206V;ENSP00000313272:L210V;ENSP00000443150:L206V;ENSP00000440754:L86V;ENSP00000443035:L206V	ENSP00000313272:L210V	L	-	1	2	NOP2	6543101	0.012000	0.17670	0.818000	0.32626	0.987000	0.75469	0.242000	0.18087	1.324000	0.45282	0.563000	0.77884	CTG		0.567	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402614.1	NM_006170		10	26	0	0	0	0.006214	0	10	26				
CD163L1	283316	broad.mit.edu	37	12	7556223	7556223	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr12:7556223G>T	ENST00000313599.3	-	6	1373	c.1316C>A	c.(1315-1317)aCt>aAt	p.T439N	CD163L1_ENST00000416109.2_Missense_Mutation_p.T449N|CD163L1_ENST00000396630.1_Missense_Mutation_p.T439N			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	439	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CTCATTCCCAGTGCAAGATAT	0.448																																							uc001qsy.2		NA																	0				ovary(8)|skin(2)|central_nervous_system(1)	11						c.(1315-1317)ACT>AAT		scavenger receptor cysteine-rich type 1							140.0	130.0	133.0					12																	7556223		2203	4300	6503	SO:0001583	missense	283316					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity	g.chr12:7556223G>T	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.1316C>A	12.37:g.7556223G>T	ENSP00000315945:p.Thr439Asn					CD163L1_uc010sge.1_Missense_Mutation_p.T449N	p.T439N	NM_174941	NP_777601	Q9NR16	C163B_HUMAN			6	1342	-			439			SRCR 4.|Extracellular (Potential).		B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	c.1316C>A	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	G	9.502	1.103438	0.20632	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630;ENST00000545926	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	2.22	-4.45	0.03546	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.17916	0.0430	N	0.13272	0.32	0.09310	N	1	P;P	0.41080	0.737;0.536	B;B	0.43508	0.422;0.324	T	0.09164	-1.0687	9	0.25751	T	0.34	.	2.1973	0.03914	0.1103:0.1451:0.3138:0.4308	.	449;439	E7EVK4;Q9NR16	.;C163B_HUMAN	N	439;449;439;85	ENSP00000315945:T439N;ENSP00000393474:T449N;ENSP00000379871:T439N;ENSP00000439921:T85N	ENSP00000315945:T439N	T	-	2	0	CD163L1	7447490	0.000000	0.05858	0.000000	0.03702	0.985000	0.73830	-7.086000	0.00044	-1.570000	0.01665	0.563000	0.77884	ACT		0.448	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941		46	58	1	0	2.61675e-31	0.013114	4.64569e-31	46	58				
PRB1	5542	broad.mit.edu	37	12	11506399	11506399	+	Intron	SNP	T	T	C	rs111543911	byFrequency	TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr12:11506399T>C	ENST00000500254.2	-	4	351				PRB1_ENST00000546254.1_Intron|PRB1_ENST00000545626.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1							extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGGAGGAGATTGGGAACTTCG	0.612													N|||	1192	0.238019	0.1808	0.1816	5008	,	,		11447	0.3393		0.1759	False		,,,				2504	0.3149						uc001qzw.1		NA																	0					0						c.(637-639)CAA>CGA		proline-rich protein BstNI subfamily 1 isoform 1							11.0	7.0	9.0					12																	11506399		1009	1967	2976	SO:0001627	intron_variant	5542					extracellular region		g.chr12:11506399T>C		CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.314-75A>G	12.37:g.11506399T>C						PRB1_uc001qzu.1_Intron|PRB1_uc001qzv.1_Intron	p.Q213R	NM_005039	NP_005030	P04280	PRP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;0.185)		4	675	-			274	Q -> R (in Ref. 5; CAA30395).	Missing (in clone CP-4).|Missing (in clone CP-5).	11.|15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].		Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Missense_Mutation	SNP	ENST00000500254.2	37	c.638A>G	CCDS8642.1																																																																																				0.612	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1	NM_005039		5	31	0	0	0	0.001368	0	5	31				
ART4	420	broad.mit.edu	37	12	14993823	14993823	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr12:14993823T>C	ENST00000228936.4	-	2	790	c.409A>G	c.(409-411)Act>Gct	p.T137A	C12orf60_ENST00000527783.1_Intron|RP11-233G1.4_ENST00000444324.2_RNA	NM_021071.2	NP_066549.2	Q93070	NAR4_HUMAN	ADP-ribosyltransferase 4 (Dombrock blood group)	137					arginine metabolic process (GO:0006525)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)			large_intestine(5)|liver(1)|lung(3)|prostate(1)|skin(2)|stomach(3)	15						ATGGCTCTAGTAAAGTCAGAA	0.438																																							uc001rcl.1		NA																	0					0						c.(409-411)ACT>GCT		ADP-ribosyltransferase 4 precursor							135.0	131.0	132.0					12																	14993823		2203	4300	6503	SO:0001583	missense	420				arginine metabolic process|protein ADP-ribosylation	anchored to membrane|plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity	g.chr12:14993823T>C	X95826	CCDS8668.1	12q13.2-q13.3	2014-07-18	2014-01-02	2006-01-12	ENSG00000111339	ENSG00000111339		"""CD molecules"", ""Blood group antigens"""	726	protein-coding gene	gene with protein product		110600	"""Dombrock blood group"", ""ADP-ribosyltransferase 4 (DO blood group)"", ""ADP-ribosyltransferase 4"""	DO		9119374	Standard	NM_021071		Approved	DOK1, CD297	uc001rcl.1	Q93070	OTTHUMG00000168738	ENST00000228936.4:c.409A>G	12.37:g.14993823T>C	ENSP00000228936:p.Thr137Ala					ART4_uc009zid.1_Intron|ART4_uc009zie.1_Intron|ART4_uc001rcm.1_Missense_Mutation_p.T137A	p.T137A	NM_021071	NP_066549	Q93070	NAR4_HUMAN			2	775	-			137					Q9BZ50|Q9BZ51|Q9HB06	Missense_Mutation	SNP	ENST00000228936.4	37	c.409A>G	CCDS8668.1	.	.	.	.	.	.	.	.	.	.	T	1.814	-0.473894	0.04414	.	.	ENSG00000111339	ENST00000228936;ENST00000420600	T;T	0.07327	3.2;3.2	4.35	-5.78	0.02362	.	0.703192	0.14254	N	0.331245	T	0.02649	0.0080	N	0.05124	-0.11	0.09310	N	1	B;B	0.13145	0.007;0.007	B;B	0.14023	0.01;0.01	T	0.36040	-0.9764	10	0.28530	T	0.3	-2.5206	4.1535	0.10249	0.4546:0.2415:0.0:0.3039	.	137;137	A8K6J7;Q93070	.;NAR4_HUMAN	A	137;120	ENSP00000228936:T137A;ENSP00000405689:T120A	ENSP00000228936:T137A	T	-	1	0	ART4	14885090	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.689000	0.25437	-1.066000	0.03164	-0.490000	0.04691	ACT		0.438	ART4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400859.1	NM_021071		34	56	0	0	0	0.004878	0	34	56				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GTT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	p.G12V	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		4	9	1	0	2.56e-06	0.009096	3.04466e-06	4	9				
ASIC1	41	broad.mit.edu	37	12	50479969	50479969	+	IGR	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr12:50479969G>T	ENST00000447966.2	+	0	3778				SMARCD1_ENST00000381513.4_Missense_Mutation_p.R68L|SMARCD1_ENST00000548573.1_5'Flank|SMARCD1_ENST00000394963.4_Missense_Mutation_p.R68L	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1						associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)									Amiloride(DB00594)|Diclofenac(DB00586)	CCAGGCAGCCGAATGACACCT	0.582																																							uc001rvx.3		NA																	0				ovary(1)	1						c.(202-204)CGA>CTA		SWI/SNF-related matrix-associated							66.0	69.0	68.0					12																	50479969		2203	4300	6503	SO:0001628	intergenic_variant	6602				chromatin-mediated maintenance of transcription|nervous system development|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	protein complex scaffold|transcription coactivator activity	g.chr12:50479969G>T	U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812		12.37:g.50479969G>T						SMARCD1_uc010smo.1_Missense_Mutation_p.R68L|SMARCD1_uc001rvy.3_Missense_Mutation_p.R68L|SMARCD1_uc009zlp.2_Missense_Mutation_p.R68L	p.R68L	NM_003076	NP_003067	Q96GM5	SMRD1_HUMAN			2	373	+			68			Interaction with ESR1, NR1H4, NR3C1, PGR and SMARCA4.		A3KN86|E5KBL7|P78349|Q96CV2	Missense_Mutation	SNP	ENST00000447966.2	37	c.203G>T	CCDS44876.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.859056	0.51376	.	.	ENSG00000066117	ENST00000394963;ENST00000381513;ENST00000551966;ENST00000550477;ENST00000551497	D;D;T;T;T	0.84660	-1.88;-1.88;0.86;0.86;0.59	5.1	4.21	0.49690	.	0.000000	0.85682	D	0.000000	D	0.90783	0.7106	M	0.71206	2.165	0.80722	D	1	D;P;P	0.69078	0.997;0.943;0.666	D;P;B	0.68192	0.956;0.713;0.11	D	0.91506	0.5223	10	0.66056	D	0.02	-3.2898	13.9071	0.63843	0.0741:0.0:0.9259:0.0	.	68;68;68	B4DF50;Q96GM5-2;Q96GM5	.;.;SMRD1_HUMAN	L	68;68;68;68;6	ENSP00000378414:R68L;ENSP00000370924:R68L;ENSP00000447386:R68L;ENSP00000448030:R68L;ENSP00000449825:R6L	ENSP00000370924:R68L	R	+	2	0	SMARCD1	48766236	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.622000	0.83099	1.284000	0.44531	-0.266000	0.10368	CGA		0.582	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406004.2	NM_020039		25	44	1	0	3.28513e-13	0.003954	4.87792e-13	25	44				
SMARCD1	6602	broad.mit.edu	37	12	50492536	50492536	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr12:50492536C>T	ENST00000394963.4	+	12	1830	c.1432C>T	c.(1432-1434)Cga>Tga	p.R478*	SMARCD1_ENST00000381513.4_Nonsense_Mutation_p.R437*|SMARCD1_ENST00000548573.1_Nonsense_Mutation_p.R276*	NM_003076.4	NP_003067.3			SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1											NS(1)|breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	18						GGAGGAGCGCCGAGCTGAGTT	0.537																																							uc001rvx.3		NA																	0				ovary(1)	1						c.(1432-1434)CGA>TGA		SWI/SNF-related matrix-associated							74.0	67.0	69.0					12																	50492536		2203	4300	6503	SO:0001587	stop_gained	6602				chromatin-mediated maintenance of transcription|nervous system development|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	protein complex scaffold|transcription coactivator activity	g.chr12:50492536C>T	U66617	CCDS8797.2, CCDS8798.2	12q13-q14	2008-08-05			ENSG00000066117	ENSG00000066117			11106	protein-coding gene	gene with protein product		601735				8804307, 9693044, 12917342	Standard	NM_003076		Approved	BAF60A, Rsc6p, CRACD1	uc001rvx.4	Q96GM5	OTTHUMG00000150194	ENST00000394963.4:c.1432C>T	12.37:g.50492536C>T	ENSP00000378414:p.Arg478*					SMARCD1_uc001rvy.3_Nonsense_Mutation_p.R437*|SMARCD1_uc009zlp.2_Nonsense_Mutation_p.R437*	p.R478*	NM_003076	NP_003067	Q96GM5	SMRD1_HUMAN			12	1602	+			478			Necessary for GR/NR3C1-mediated remodeling and transcription from chromatin; required for GR/NR3C1 interaction with the BRG1/SMARCA4 complex in vivo.			Nonsense_Mutation	SNP	ENST00000394963.4	37	c.1432C>T	CCDS8797.2	.	.	.	.	.	.	.	.	.	.	C	39	7.710491	0.98447	.	.	ENSG00000066117	ENST00000394963;ENST00000381513;ENST00000542914;ENST00000548573	.	.	.	5.21	4.3	0.51218	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.2707	14.0572	0.64776	0.287:0.713:0.0:0.0	.	.	.	.	X	478;437;254;276	.	ENSP00000370924:R437X	R	+	1	2	SMARCD1	48778803	0.998000	0.40836	1.000000	0.80357	0.937000	0.57800	2.380000	0.44327	1.512000	0.48834	0.655000	0.94253	CGA		0.537	SMARCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316759.2	NM_003076		11	20	0	0	0	0.010729	0	11	20				
GALNT6	11226	broad.mit.edu	37	12	51759270	51759270	+	Missense_Mutation	SNP	C	C	G	rs536166167		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr12:51759270C>G	ENST00000543196.2	-	4	963	c.758G>C	c.(757-759)cGg>cCg	p.R253P	GALNT6_ENST00000356317.3_Missense_Mutation_p.R253P			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	253	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CCCCAGCAGCCGGGCGGTGAT	0.657																																							uc001ryk.2		NA																	0				ovary(2)	2						c.(757-759)CGG>CCG		polypeptide N-acetylgalactosaminyltransferase 6							71.0	64.0	66.0					12																	51759270		2203	4300	6503	SO:0001583	missense	11226				protein O-linked glycosylation	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:51759270C>G	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.758G>C	12.37:g.51759270C>G	ENSP00000444171:p.Arg253Pro					GALNT6_uc009zma.1_RNA|GALNT6_uc001ryl.1_Missense_Mutation_p.R253P	p.R253P	NM_007210	NP_009141	Q8NCL4	GALT6_HUMAN			4	983	-			253			Catalytic subdomain A.|Lumenal (Potential).		Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	SNP	ENST00000543196.2	37	c.758G>C	CCDS8813.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.792938	0.90453	.	.	ENSG00000139629	ENST00000543196;ENST00000356317;ENST00000546163	T;T	0.64438	-0.1;-0.1	3.83	3.83	0.44106	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	D	0.89040	0.6602	H	0.99922	4.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94006	0.7280	10	0.87932	D	0	.	15.7104	0.77623	0.0:1.0:0.0:0.0	.	253	Q8NCL4	GALT6_HUMAN	P	253;253;234	ENSP00000444171:R253P;ENSP00000348668:R253P	ENSP00000348668:R253P	R	-	2	0	GALNT6	50045537	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.506000	0.81665	2.460000	0.83146	0.561000	0.74099	CGG		0.657	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210		18	40	0	0	0	0.006122	0	18	40				
AMER2	219287	broad.mit.edu	37	13	25743891	25743891	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr13:25743891G>A	ENST00000515384.1	-	1	2534	c.1867C>T	c.(1867-1869)Ccc>Tcc	p.P623S	AMER2_ENST00000357816.2_Missense_Mutation_p.P504S|AMER2_ENST00000381853.3_Missense_Mutation_p.P504S			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	623					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)										TGCACCACGGGATGGCTAGAT	0.562																																							uc001uqb.2		NA																	0				ovary(2)|large_intestine(1)|lung(1)	4						c.(1867-1869)CCC>TCC		hypothetical protein LOC219287 isoform 1							173.0	155.0	161.0					13																	25743891		2203	4300	6503	SO:0001583	missense	219287							g.chr13:25743891G>A	AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1867C>T	13.37:g.25743891G>A	ENSP00000426528:p.Pro623Ser					FAM123A_uc001uqa.2_Missense_Mutation_p.P504S|FAM123A_uc001uqc.2_Missense_Mutation_p.P504S	p.P623S	NM_152704	NP_689917	Q8N7J2	F123A_HUMAN		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)	1	1967	-		Lung SC(185;0.0225)|Breast(139;0.0602)	623					Q5RL80|Q5VX56|Q8N593|Q96NN5	Missense_Mutation	SNP	ENST00000515384.1	37	c.1867C>T	CCDS53859.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.430784	0.25726	.	.	ENSG00000165566	ENST00000357816;ENST00000381853;ENST00000515384	T;T;T	0.21734	2.01;2.01;1.99	5.97	3.29	0.37713	.	0.734000	0.13224	N	0.404137	T	0.11580	0.0282	N	0.19112	0.55	0.09310	N	1	B;B	0.31485	0.325;0.225	B;B	0.25614	0.062;0.053	T	0.23726	-1.0180	10	0.38643	T	0.18	-16.2594	6.1378	0.20243	0.0671:0.2497:0.5539:0.1293	.	623;504	Q8N7J2;Q8N7J2-2	F123A_HUMAN;.	S	504;504;623	ENSP00000350469:P504S;ENSP00000371277:P504S;ENSP00000426528:P623S	ENSP00000350469:P504S	P	-	1	0	FAM123A	24641891	1.000000	0.71417	0.011000	0.14972	0.593000	0.36681	2.805000	0.47939	0.407000	0.25591	0.655000	0.94253	CCC		0.562	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704		41	82	0	0	0	0.013114	0	41	82				
FAM124A	220108	broad.mit.edu	37	13	51805511	51805511	+	Silent	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr13:51805511G>T	ENST00000322475.8	+	2	231	c.96G>T	c.(94-96)acG>acT	p.T32T	FAM124A_ENST00000280057.6_Silent_p.T32T	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	32								p.T32T(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		TGTCCTCCACGAGCAGTAAGT	0.428																																							uc001vfg.1		NA																	1	Substitution - coding silent(1)		endometrium(1)	central_nervous_system(1)	1						c.(94-96)ACG>ACT		hypothetical protein LOC220108							209.0	180.0	190.0					13																	51805511		2203	4300	6503	SO:0001819	synonymous_variant	220108							g.chr13:51805511G>T	AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.96G>T	13.37:g.51805511G>T						FAM124A_uc001vfe.2_Silent_p.T32T|FAM124A_uc001vff.1_Silent_p.T32T	p.T32T	NM_145019	NP_659456	Q86V42	F124A_HUMAN		GBM - Glioblastoma multiforme(99;4.25e-07)	2	227	+		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)	32					A2A324|Q8N8P9|Q8NE66|Q96NJ9	Silent	SNP	ENST00000322475.8	37	c.96G>T	CCDS55900.1																																																																																				0.428	FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045019.3	NM_145019		31	75	1	0	2.42023e-17	0.003271	3.85037e-17	31	75				
PCDH17	27253	broad.mit.edu	37	13	58299398	58299398	+	Silent	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr13:58299398G>T	ENST00000377918.3	+	4	3476	c.3450G>T	c.(3448-3450)cgG>cgT	p.R1150R		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	1150					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		AAGACTGCCGGGGAAACGACC	0.443																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	0				ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(3448-3450)CGG>CGT		protocadherin 17 precursor																																				SO:0001819	synonymous_variant	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58299398G>T	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.3450G>T	13.37:g.58299398G>T						PCDH17_uc010aec.1_Silent_p.R1149R|PCDH17_uc001vhr.1_Silent_p.R239R	p.R1150R	NM_001040429	NP_001035519	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	4	4342	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	1150			Cytoplasmic (Potential).		A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	ENST00000377918.3	37	c.3450G>T	CCDS31986.1																																																																																				0.443	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		57	92	1	0	4.17463e-26	0.00361	7.2027e-26	57	92				
COL4A1	1282	broad.mit.edu	37	13	110839649	110839649	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr13:110839649C>A	ENST00000375820.4	-	25	1685	c.1564G>T	c.(1564-1566)Ggc>Tgc	p.G522C		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	522	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCTGGCTGGCCTATCAGCCCT	0.547																																							uc001vqw.3		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6						c.(1564-1566)GGC>TGC		alpha 1 type IV collagen preproprotein							48.0	48.0	48.0					13																	110839649		2203	4300	6503	SO:0001583	missense	1282				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding	g.chr13:110839649C>A	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.1564G>T	13.37:g.110839649C>A	ENSP00000364979:p.Gly522Cys					COL4A1_uc010agl.2_Intron	p.G522C	NM_001845	NP_001836	P02462	CO4A1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)		25	1686	-	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	522			Triple-helical region.		A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	c.1564G>T	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.384874	0.61956	.	.	ENSG00000187498	ENST00000375820	D	0.99369	-5.78	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	H	0.98507	4.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97073	0.9779	10	0.87932	D	0	.	17.9388	0.89021	0.0:1.0:0.0:0.0	.	522	P02462	CO4A1_HUMAN	C	522	ENSP00000364979:G522C	ENSP00000364979:G522C	G	-	1	0	COL4A1	109637650	1.000000	0.71417	0.996000	0.52242	0.765000	0.43378	7.104000	0.77024	2.308000	0.77769	0.563000	0.77884	GGC		0.547	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3			12	24	1	0	2.31682e-05	0.003163	2.67746e-05	12	24				
TRAJ18	28737	broad.mit.edu	37	14	22994680	22994680	+	RNA	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr14:22994680G>T	ENST00000390519.1	+	0	61				TRAJ17_ENST00000390520.1_RNA|TRAJ21_ENST00000390516.1_RNA|TRAJ16_ENST00000390521.1_RNA|TRAJ19_ENST00000390518.1_RNA|TRAJ20_ENST00000390517.1_RNA					T cell receptor alpha joining 18																		TTGACTGTCTGGCCTGGTGAG	0.448																																							uc001wbw.2		NA																	0					NA						c.(400-402)TGG>TTG		SubName: Full=Alpha-chain C region; Flags: Fragment;							95.0	98.0	97.0					14																	22994680		1891	4115	6006			0							g.chr14:22994680G>T	M94081		14q11.2	2012-02-07			ENSG00000211871	ENSG00000211871		"""T cell receptors / TRA locus"""	12046	other	T cell receptor gene						8188290	Standard	NG_001332		Approved				OTTHUMG00000170949		14.37:g.22994680G>T						uc010aja.1_Intron|uc010tmk.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wee.3_Intron|uc010tmt.1_Intron|uc010ajv.1_Intron|uc001weg.2_Intron|uc001wei.2_Intron|uc001wej.2_Intron|uc001wek.2_Intron|uc001wel.2_Intron|uc001wem.3_Intron|uc001wen.1_Intron|uc001weo.2_Intron|uc001wep.2_Intron|uc001weq.2_Intron|uc001wer.2_Intron|uc001wet.2_Intron|uc001weu.2_Intron|uc001wev.2_Intron|uc001wew.2_Intron|uc010tmv.1_Intron|uc001wez.2_Intron|uc010ajx.1_Intron|uc001wfb.1_Intron|uc001wfd.1_Intron|uc001wfe.2_Intron|uc001wfg.2_Intron|uc001wfh.1_Intron|uc001wfi.2_Intron|uc001wfk.2_Intron|uc001wfl.2_Intron|uc010ajy.1_Intron|uc001wfn.2_Intron|uc001wfp.2_Intron|uc001wfq.1_Intron|uc001wfr.1_Intron|uc010ajz.1_Intron|uc001wfs.1_Intron|uc001wft.1_Intron|uc001wfu.2_Intron|uc001wfv.1_Intron|uc001wfw.1_5'UTR|uc001wfx.2_5'Flank|uc001wfy.1_5'Flank	p.W134L							3	410	+									Missense_Mutation	SNP	ENST00000390519.1	37	c.401G>T																																																																																					0.448	TRAJ18-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	TR_J_gene	TR_J_gene	OTTHUMT00000410980.1	NG_001332		35	47	1	0	9.04072e-19	0.003271	1.46687e-18	35	47				
TGM1	7051	broad.mit.edu	37	14	24731047	24731047	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr14:24731047C>A	ENST00000206765.6	-	3	485	c.362G>T	c.(361-363)cGc>cTc	p.R121L	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	121					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	CTGGTCCGAGCGCGAGCTCAG	0.597																																							uc001wod.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(361-363)CGC>CTC		transglutaminase 1	L-Glutamine(DB00130)						100.0	92.0	95.0					14																	24731047		2203	4300	6503	SO:0001583	missense	7051				cell envelope organization|keratinization|peptide cross-linking	cornified envelope|intrinsic to membrane	acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity	g.chr14:24731047C>A	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.362G>T	14.37:g.24731047C>A	ENSP00000206765:p.Arg121Leu					TGM1_uc010tog.1_Intron	p.R121L	NM_000359	NP_000350	P22735	TGM1_HUMAN		GBM - Glioblastoma multiforme(265;0.0186)	3	486	-			121					B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	c.362G>T	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.202986	0.38905	.	.	ENSG00000092295	ENST00000206765	D	0.85013	-1.93	5.29	3.46	0.39613	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.128026	0.52532	D	0.000080	T	0.82093	0.4962	L	0.39467	1.215	0.09310	N	0.999995	P	0.43885	0.82	P	0.48063	0.565	T	0.73525	-0.3955	10	0.59425	D	0.04	-19.0745	8.9751	0.35930	0.0:0.6396:0.2818:0.0786	.	121	P22735	TGM1_HUMAN	L	121	ENSP00000206765:R121L	ENSP00000206765:R121L	R	-	2	0	TGM1	23800887	0.028000	0.19301	0.024000	0.17045	0.065000	0.16274	0.719000	0.25881	0.617000	0.30160	0.561000	0.74099	CGC		0.597	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359		25	60	1	0	4.22769e-11	0.00632	5.85189e-11	25	60				
SLC8A3	6547	broad.mit.edu	37	14	70634693	70634693	+	Silent	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr14:70634693G>T	ENST00000381269.2	-	2	1200	c.447C>A	c.(445-447)ctC>ctA	p.L149L	SLC8A3_ENST00000528359.1_Silent_p.L149L|SLC8A3_ENST00000356921.2_Silent_p.L149L|SLC8A3_ENST00000534137.1_Silent_p.L149L|SLC8A3_ENST00000357887.3_Silent_p.L149L	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	149					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TTAAAGAGAGGAGTATCTCAG	0.488																																							uc001xly.2		NA																	0				skin(3)|ovary(2)|breast(2)	7						c.(445-447)CTC>CTA		solute carrier family 8 (sodium/calcium							95.0	88.0	90.0					14																	70634693		2203	4300	6503	SO:0001819	synonymous_variant	6547				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding	g.chr14:70634693G>T	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.447C>A	14.37:g.70634693G>T						SLC8A3_uc001xlw.2_Silent_p.L149L|SLC8A3_uc001xlx.2_Silent_p.L149L|SLC8A3_uc001xlz.2_Silent_p.L149L|SLC8A3_uc010ara.2_RNA	p.L149L	NM_183002	NP_892114	P57103	NAC3_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)	2	1201	-			149			Alpha-1.|Helical; (Potential).		Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	c.447C>A	CCDS35498.1																																																																																				0.488	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1			19	43	1	0	1.40151e-16	0.010504	2.18707e-16	19	43				
SIPA1L1	26037	broad.mit.edu	37	14	72165763	72165763	+	Missense_Mutation	SNP	G	G	C	rs200964349		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr14:72165763G>C	ENST00000555818.1	+	11	3788	c.3440G>C	c.(3439-3441)cGg>cCg	p.R1147P	SIPA1L1_ENST00000381232.3_Missense_Mutation_p.R1147P|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.R1147P|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.R622P	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1147					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		TCCCAGTGTCGGAACTCTCCT	0.493																																							uc001xms.2		NA																	0				ovary(3)|breast(1)	4						c.(3439-3441)CGG>CCG		signal-induced proliferation-associated 1 like							150.0	137.0	141.0					14																	72165763		2203	4300	6503	SO:0001583	missense	26037				actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity	g.chr14:72165763G>C	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.3440G>C	14.37:g.72165763G>C	ENSP00000450832:p.Arg1147Pro					SIPA1L1_uc001xmt.2_Missense_Mutation_p.R1147P|SIPA1L1_uc001xmu.2_Missense_Mutation_p.R1147P|SIPA1L1_uc001xmv.2_Missense_Mutation_p.R1147P|SIPA1L1_uc010ttm.1_Missense_Mutation_p.R622P	p.R1147P	NM_015556	NP_056371	O43166	SI1L1_HUMAN		all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)	11	3788	+			1147					J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	37	c.3440G>C	CCDS9807.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.612625	0.28712	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	T;T;T;T	0.61040	0.14;0.14;0.14;0.14	5.58	4.68	0.58851	.	0.100891	0.64402	D	0.000001	T	0.72187	0.3429	L	0.56769	1.78	0.58432	D	0.999999	D;B;B;D;B	0.89917	1.0;0.002;0.121;1.0;0.002	D;B;B;D;B	0.79784	0.982;0.001;0.066;0.993;0.001	T	0.72337	-0.4324	10	0.40728	T	0.16	-11.15	16.4541	0.84007	0.0:0.1315:0.8685:0.0	.	622;1147;622;1147;1147	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	P	1147;1147;1147;622	ENSP00000370630:R1147P;ENSP00000450832:R1147P;ENSP00000351352:R1147P;ENSP00000440682:R622P	ENSP00000351352:R1147P	R	+	2	0	SIPA1L1	71235516	1.000000	0.71417	0.985000	0.45067	0.154000	0.21943	5.081000	0.64444	1.353000	0.45828	-0.302000	0.09304	CGG		0.493	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556		22	60	0	0	0	0.010504	0	22	60				
ABCD4	5826	broad.mit.edu	37	14	74764696	74764696	+	Missense_Mutation	SNP	C	C	T	rs201744101		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr14:74764696C>T	ENST00000356924.4	-	4	505	c.362G>A	c.(361-363)cGc>cAc	p.R121H	ABCD4_ENST00000557588.1_Missense_Mutation_p.R121H|ABCD4_ENST00000557554.1_Intron|ABCD4_ENST00000298816.7_Missense_Mutation_p.R34H	NM_005050.3	NP_005041.1	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D (ALD), member 4	121	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cobalamin metabolic process (GO:0009235)|transmembrane transport (GO:0055085)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00153)		GAAGTAGAGGCGGTGAAGGTG	0.572													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18451	0.0		0.0	False		,,,				2504	0.0						uc001xpr.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)|ovary(1)	4						c.(361-363)CGC>CAC		ATP-binding cassette, sub-family D, member 4							93.0	81.0	85.0					14																	74764696		2203	4300	6503	SO:0001583	missense	5826					ATP-binding cassette (ABC) transporter complex|integral to membrane|peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr14:74764696C>T	AF009746	CCDS9828.1	14q24	2012-03-14			ENSG00000119688	ENSG00000119688		"""ATP binding cassette transporters / subfamily D"""	68	protein-coding gene	gene with protein product		603214		PXMP1L		9266848, 9302272	Standard	NR_003256		Approved	PMP69, P70R, EST352188	uc001xpr.2	O14678	OTTHUMG00000171207	ENST00000356924.4:c.362G>A	14.37:g.74764696C>T	ENSP00000349396:p.Arg121His					ABCD4_uc001xps.2_5'UTR|ABCD4_uc001xpt.2_5'UTR|ABCD4_uc010tur.1_Missense_Mutation_p.R34H|ABCD4_uc001xpu.2_Intron|ABCD4_uc001xpv.2_RNA	p.R121H	NM_005050	NP_005041	O14678	ABCD4_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00153)	4	514	-			121			ABC transmembrane type-1.		A8K5L7|Q6IAQ0|Q96E75	Missense_Mutation	SNP	ENST00000356924.4	37	c.362G>A	CCDS9828.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	1|1	0.0027624309392265192|0.0027624309392265192	0|0	0.0|0.0	0|0	0.0|0.0	C|C	11.69|11.69	1.714323|1.714323	0.30413|0.30413	.|.	.|.	ENSG00000119688|ENSG00000119688	ENST00000556971|ENST00000356924;ENST00000298816;ENST00000557588	.|D;D;D	.|0.94931	.|-3.56;-3.56;-3.56	5.5|5.5	-3.14|-3.14	0.05250|0.05250	.|ABC transporter, N-terminal (1);ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	.|1.068870	.|0.06962	.|N	.|0.816523	D|D	0.88411|0.88411	0.6429|0.6429	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	.|B;B	.|0.14805	.|0.011;0.007	.|B;B	.|0.15484	.|0.004;0.013	T|T	0.73616|0.73616	-0.3926|-0.3926	5|10	.|0.35671	.|T	.|0.21	.|.	11.7902|11.7902	0.52065|0.52065	0.0:0.5289:0.0:0.4711|0.0:0.5289:0.0:0.4711	.|.	.|34;121	.|F8W7M4;O14678	.|.;ABCD4_HUMAN	T|H	81|121;34;121	.|ENSP00000349396:R121H;ENSP00000298816:R34H;ENSP00000451993:R121H	.|ENSP00000298816:R34H	A|R	-|-	1|2	0|0	ABCD4|ABCD4	73834449|73834449	0.000000|0.000000	0.05858|0.05858	0.547000|0.547000	0.28179|0.28179	0.911000|0.911000	0.54048|0.54048	-0.086000|-0.086000	0.11233|0.11233	-1.140000|-1.140000	0.02877|0.02877	-0.215000|-0.215000	0.12644|0.12644	GCC|CGC		0.572	ABCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314382.1	NM_005050		11	57	0	0	0	0.010729	0	11	57				
WDR25	79446	broad.mit.edu	37	14	100934431	100934431	+	Missense_Mutation	SNP	G	G	T	rs146541699	byFrequency	TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr14:100934431G>T	ENST00000335290.6	+	3	1122	c.896G>T	c.(895-897)cGg>cTg	p.R299L	WDR25_ENST00000402312.3_Missense_Mutation_p.R299L|WDR25_ENST00000554998.1_Missense_Mutation_p.R299L|WDR25_ENST00000542471.2_Missense_Mutation_p.R42L	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	299										central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				CGGGCCGCCCGGTGGGCTCCC	0.627																																							uc010avx.2		NA																	0					0						c.(895-897)CGG>CTG		WD repeat domain 25							108.0	109.0	109.0					14																	100934431		2203	4300	6503	SO:0001583	missense	79446							g.chr14:100934431G>T	BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.896G>T	14.37:g.100934431G>T	ENSP00000334148:p.Arg299Leu					WDR25_uc001yhm.2_Missense_Mutation_p.R291L|WDR25_uc001yhn.2_Missense_Mutation_p.R299L|WDR25_uc010avy.2_Intron|WDR25_uc001yho.2_Missense_Mutation_p.R42L	p.R299L	NM_001161476	NP_001154948	Q64LD2	WDR25_HUMAN			3	989	+		Melanoma(154;0.212)	299			WD 2.		A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Missense_Mutation	SNP	ENST00000335290.6	37	c.896G>T	CCDS32157.1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.826661	0.32329	.	.	ENSG00000176473	ENST00000554998;ENST00000402312;ENST00000335290;ENST00000542471	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	4.99	2.74	0.32292	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.220196	0.29239	N	0.012740	T	0.50000	0.1590	L	0.60067	1.865	0.32189	N	0.579292	P;P	0.43578	0.811;0.8	B;B	0.43155	0.296;0.41	T	0.58836	-0.7566	10	0.42905	T	0.14	-19.4814	4.6238	0.12469	0.4324:0.0:0.5676:0.0	.	42;299	Q64LD2-2;Q64LD2	.;WDR25_HUMAN	L	299;299;299;42	ENSP00000450661:R299L;ENSP00000385540:R299L;ENSP00000334148:R299L;ENSP00000441903:R42L	ENSP00000334148:R299L	R	+	2	0	WDR25	100004184	1.000000	0.71417	0.983000	0.44433	0.398000	0.30690	2.778000	0.47726	1.244000	0.43870	0.650000	0.86243	CGG		0.627	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1	NM_024515		72	77	1	0	3.19358e-47	0.00361	5.92747e-47	72	77				
DYNC1H1	1778	broad.mit.edu	37	14	102481660	102481660	+	Silent	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr14:102481660C>A	ENST00000360184.4	+	35	7397	c.7233C>A	c.(7231-7233)ccC>ccA	p.P2411P		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2411	AAA 2. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CCGCTTCCCCCATGCTGCAGG	0.622																																							uc001yks.2		NA																	0				ovary(7)|central_nervous_system(2)|pancreas(1)	10						c.(7231-7233)CCC>CCA		cytoplasmic dynein 1 heavy chain 1							30.0	28.0	29.0					14																	102481660		2203	4300	6503	SO:0001819	synonymous_variant	1778				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding	g.chr14:102481660C>A	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.7233C>A	14.37:g.102481660C>A						DYNC1H1_uc001ykt.1_5'UTR	p.P2411P	NM_001376	NP_001367	Q14204	DYHC1_HUMAN			35	7397	+			2411			AAA 2 (By similarity).		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	37	c.7233C>A	CCDS9966.1																																																																																				0.622	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		12	11	1	0	1.5842e-08	0.001855	2.03209e-08	12	11				
NPAP1	23742	broad.mit.edu	37	15	24923786	24923786	+	Silent	SNP	A	A	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr15:24923786A>T	ENST00000329468.2	+	1	3246	c.2772A>T	c.(2770-2772)ccA>ccT	p.P924P		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	924					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											CCCCAGCACCAGTTATAGGCT	0.478																																							uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(2770-2772)CCA>CCT		hypothetical protein LOC23742							94.0	98.0	97.0					15																	24923786		2203	4300	6503	SO:0001819	synonymous_variant	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24923786A>T	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2772A>T	15.37:g.24923786A>T							p.P924P	NM_018958	NP_061831	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	3246	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	924						Silent	SNP	ENST00000329468.2	37	c.2772A>T	CCDS10015.1																																																																																				0.478	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		33	87	0	0	0	0.012213	0	33	87				
RYR3	6263	broad.mit.edu	37	15	34064229	34064229	+	Silent	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr15:34064229G>A	ENST00000389232.4	+	63	8995	c.8925G>A	c.(8923-8925)aaG>aaA	p.K2975K	RYR3_ENST00000415757.3_Silent_p.K2975K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2975					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.K2975N(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AACTTGGGAAGTTCACCCATT	0.468																																							uc001zhi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(8923-8925)AAG>AAA		ryanodine receptor 3							86.0	81.0	82.0					15																	34064229		1875	4106	5981	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34064229G>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8925G>A	15.37:g.34064229G>A						RYR3_uc010bar.2_Silent_p.K2975K	p.K2975K	NM_001036	NP_001027	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	63	8995	+		all_lung(180;7.18e-09)	2975			Cytoplasmic (By similarity).		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.8925G>A	CCDS45210.1																																																																																				0.468	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			10	13	0	0	0	0.006214	0	10	13				
BNIP2	663	broad.mit.edu	37	15	59971852	59971852	+	Silent	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr15:59971852C>A	ENST00000607373.1	-	4	436	c.234G>T	c.(232-234)ggG>ggT	p.G78G	BNIP2_ENST00000267859.3_Silent_p.G199G|BNIP2_ENST00000415213.2_Silent_p.G140G	NM_004330.2	NP_004321.2	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 2	78					apoptotic process (GO:0006915)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|positive regulation of GTPase activity (GO:0043547)|positive regulation of muscle cell differentiation (GO:0051149)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)			NS(1)|large_intestine(2)|lung(5)|ovary(1)	9						AGTCAATCTCCCCACTTTCAT	0.383																																					Ovarian(174;1936 1978 6671 8240 38212)	Ovarian(174;1936 1978 6671 8240 38212)	uc010uhc.1		NA																	0				ovary(1)	1						c.(595-597)GGG>GGT		BCL2/adenovirus E1B 19kD interacting protein 2							130.0	113.0	118.0					15																	59971852		2190	4290	6480	SO:0001819	synonymous_variant	663				anti-apoptosis|apoptosis|positive regulation of muscle cell differentiation	nuclear envelope|perinuclear region of cytoplasm	calcium ion binding|GTPase activator activity|protein binding	g.chr15:59971852C>A	U15173	CCDS10174.2	15q21.3	2008-07-18	2002-08-29		ENSG00000140299	ENSG00000140299			1083	protein-coding gene	gene with protein product		603292	"""BCL2/adenovirus E1B 19kD-interacting protein 2"""			7954800	Standard	NM_004330		Approved	Nip2, BNIP-2	uc010uhc.2	Q12982	OTTHUMG00000132727	ENST00000607373.1:c.234G>T	15.37:g.59971852C>A						BNIP2_uc010uhb.1_Silent_p.G140G	p.G199G	NM_004330	NP_004321	Q12982	BNIP2_HUMAN			4	600	-			78					B4DS94	Silent	SNP	ENST00000607373.1	37	c.597G>T																																																																																					0.383	BNIP2-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470740.1	NM_004330		7	28	1	0	5.4927e-09	0.004482	7.23501e-09	7	28				
HEXA	3073	broad.mit.edu	37	15	72637811	72637811	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr15:72637811G>A	ENST00000268097.5	-	13	2005	c.1502C>T	c.(1501-1503)tCa>tTa	p.S501L	RP11-106M3.3_ENST00000570175.1_RNA|HEXA_ENST00000567159.1_Missense_Mutation_p.S501L|RP11-106M3.2_ENST00000379915.4_RNA|HEXA_ENST00000566304.1_Missense_Mutation_p.S512L|HEXA_ENST00000457859.2_3'UTR	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	501					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						GCGGAAGTGTGACAAACGTTC	0.562																																							uc002aun.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(1501-1503)TCA>TTA		hexosaminidase A preproprotein							138.0	101.0	114.0					15																	72637811		2199	4297	6496	SO:0001583	missense	3073				cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity	g.chr15:72637811G>A	M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.1502C>T	15.37:g.72637811G>A	ENSP00000268097:p.Ser501Leu					uc002aug.2_RNA|CELF6_uc002auk.3_RNA|HEXA_uc010ukn.1_Missense_Mutation_p.S512L|HEXA_uc002auo.3_Missense_Mutation_p.S364L|HEXA_uc010bix.2_Missense_Mutation_p.S501L	p.S501L	NM_000520	NP_000511	P06865	HEXA_HUMAN			13	1709	-			501					B4DKE7|E7ENH7|Q53HS8|Q6AI32	Missense_Mutation	SNP	ENST00000268097.5	37	c.1502C>T	CCDS10243.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.355497	0.41700	.	.	ENSG00000213614	ENST00000268097	D	0.96396	-4.0	5.71	5.71	0.89125	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.869836	0.09994	N	0.729298	D	0.90584	0.7048	N	0.05050	-0.12	0.80722	D	1	B;B;B	0.15930	0.001;0.001;0.015	B;B;B	0.14578	0.004;0.004;0.011	T	0.82165	-0.0592	10	0.26408	T	0.33	-0.0462	13.1069	0.59252	0.0728:0.0:0.9272:0.0	.	512;381;501	B4DVA7;Q9BVJ8;P06865	.;.;HEXA_HUMAN	L	501	ENSP00000268097:S501L	ENSP00000268097:S501L	S	-	2	0	HEXA	70424865	0.675000	0.27558	0.007000	0.13788	0.094000	0.18550	3.593000	0.54001	2.709000	0.92574	0.655000	0.94253	TCA		0.562	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257317.2	NM_000520		23	45	0	0	0	0.00278	0	23	45				
FBXO22	26263	broad.mit.edu	37	15	76205553	76205553	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr15:76205553A>G	ENST00000308275.3	+	3	394	c.289A>G	c.(289-291)Atc>Gtc	p.I97V	FBXO22_ENST00000540507.1_5'UTR|FBXO22_ENST00000453211.2_Missense_Mutation_p.I97V	NM_147188.2	NP_671717.1	Q8NEZ5	FBX22_HUMAN	F-box protein 22	97					cellular protein modification process (GO:0006464)|cellular response to starvation (GO:0009267)|nucleocytoplasmic transport (GO:0006913)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein polyubiquitination (GO:0000209)|regulation of skeletal muscle fiber development (GO:0048742)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GAATGTTCGCATCTTACCACA	0.388																																							uc002bbk.2		NA																	0					0						c.(289-291)ATC>GTC		F-box only protein 22 isoform a							68.0	72.0	71.0					15																	76205553		2197	4294	6491	SO:0001583	missense	26263				ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity	g.chr15:76205553A>G	AF174602	CCDS10287.1, CCDS45310.1	15q23	2008-10-03	2004-06-15		ENSG00000167196	ENSG00000167196		"""F-boxes /  ""other"""""	13593	protein-coding gene	gene with protein product	"""FIST domain containing 1"""	609096	"""F-box only protein 22"""			10531035, 10531037, 17855421	Standard	NM_147188		Approved	FBX22, FISTC1	uc002bbk.3	Q8NEZ5	OTTHUMG00000142841	ENST00000308275.3:c.289A>G	15.37:g.76205553A>G	ENSP00000307833:p.Ile97Val					FBXO22_uc002bbj.1_Missense_Mutation_p.I97V|FBXO22_uc002bbl.2_5'UTR	p.I97V	NM_147188	NP_671717	Q8NEZ5	FBX22_HUMAN			3	394	+			97					Q0D2P8|Q6PIL5|Q8IXW3|Q9H824|Q9UKC0	Missense_Mutation	SNP	ENST00000308275.3	37	c.289A>G	CCDS10287.1	.	.	.	.	.	.	.	.	.	.	A	7.919	0.738094	0.15574	.	.	ENSG00000167196	ENST00000308275;ENST00000453211	.	.	.	5.95	2.29	0.28610	.	0.253885	0.39407	N	0.001368	T	0.12732	0.0309	N	0.11560	0.145	0.19775	N	0.99996	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.29549	-1.0008	9	0.05351	T	0.99	-22.8358	3.0784	0.06254	0.5083:0.2237:0.2679:0.0	.	97;97	Q8NEZ5;Q8NEZ5-3	FBX22_HUMAN;.	V	97	.	ENSP00000307833:I97V	I	+	1	0	FBXO22	73992608	0.964000	0.33143	0.537000	0.28052	0.826000	0.46750	1.430000	0.34914	0.488000	0.27723	0.533000	0.62120	ATC		0.388	FBXO22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286477.2	NM_147188		16	49	0	0	0	0.003163	0	16	49				
AKAP13	11214	broad.mit.edu	37	15	86225438	86225438	+	Silent	SNP	T	T	A	rs146923250		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr15:86225438T>A	ENST00000394518.2	+	15	5246	c.5151T>A	c.(5149-5151)acT>acA	p.T1717T	AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000394510.2_5'UTR|AKAP13_ENST00000361243.2_Silent_p.T1721T	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1717					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CTAATCTGACTGAGAGGTACT	0.328																																					Melanoma(94;603 1453 3280 32295 32951)	Melanoma(94;603 1453 3280 32295 32951)	uc002blv.1		NA																	0				central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						c.(5149-5151)ACT>ACA		A-kinase anchor protein 13 isoform 2							96.0	89.0	91.0					15																	86225438		2202	4299	6501	SO:0001819	synonymous_variant	11214				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr15:86225438T>A	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.5151T>A	15.37:g.86225438T>A						AKAP13_uc002blt.1_Silent_p.T1699T|AKAP13_uc002blu.1_Silent_p.T1721T|AKAP13_uc010bnf.1_Silent_p.T339T|AKAP13_uc002blw.1_Silent_p.T184T|AKAP13_uc002blx.1_5'UTR|AKAP13_uc010bne.1_Silent_p.T370T	p.T1717T	NM_007200	NP_009131	Q12802	AKP13_HUMAN			15	5321	+			1717					Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent	SNP	ENST00000394518.2	37	c.5151T>A	CCDS32319.1																																																																																				0.328	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200		3	30	0	0	0	0.004672	0	3	30				
MSLNL	401827	broad.mit.edu	37	16	830154	830154	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr16:830154G>A	ENST00000442466.1	-	2	45	c.46C>T	c.(46-48)Cag>Tag	p.Q16*	MSLNL_ENST00000293892.3_Nonsense_Mutation_p.Q283*			Q96KJ4	MSLNL_HUMAN	mesothelin-like	16					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						CCTGAGCTCTGCAGGGCACCT	0.697																																							uc002cjz.1		NA																	0				breast(3)|ovary(1)	4						c.(847-849)CAG>TAG		mesothelin-like							17.0	22.0	20.0					16																	830154		1958	4141	6099	SO:0001587	stop_gained	401827				cell adhesion	integral to membrane		g.chr16:830154G>A			16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.46C>T	16.37:g.830154G>A	ENSP00000415767:p.Gln16*						p.Q283*	NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN			3	847	-			16						Nonsense_Mutation	SNP	ENST00000442466.1	37	c.847C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.90|17.90	3.501848|3.501848	0.64298|0.64298	.|.	.|.	ENSG00000162006|ENSG00000162006	ENST00000543963|ENST00000442466;ENST00000293892	T|.	0.79247|.	-1.25|.	4.14|4.14	0.939|0.939	0.19506|0.19506	.|.	.|1.346520	.|0.05380	.|N	.|0.537115	T|.	0.34948|.	0.0915|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35943|.	-0.9768|.	5|.	0.87932|0.51188	D|T	0|0.08	-5.0982|-5.0982	3.2404|3.2404	0.06778|0.06778	0.1647:0.3877:0.3509:0.0967|0.1647:0.3877:0.3509:0.0967	.|.	.|.	.|.	.|.	V|X	37|16;283	ENSP00000441381:A37V|.	ENSP00000441381:A37V|ENSP00000293892:Q283X	A|Q	-|-	2|1	0|0	MSLNL|MSLNL	770155|770155	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.001000|0.001000	0.01503|0.01503	0.265000|0.265000	0.18515|0.18515	0.130000|0.130000	0.18549|0.18549	-0.344000|-0.344000	0.07964|0.07964	GCA|CAG		0.697	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001025190		4	15	0	0	0	0.009096	0	4	15				
NDUFB10	4716	broad.mit.edu	37	16	2011497	2011497	+	Splice_Site	SNP	G	G	A	rs113652159		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr16:2011497G>A	ENST00000268668.6	+	3	386		c.e3-1		SNORA64_ENST00000384674.1_RNA|NDUFB10_ENST00000543683.2_Splice_Site|NDUFB10_ENST00000569148.1_Splice_Site|SNORA10_ENST00000384084.1_RNA	NM_004548.2	NP_004539.1	O96000	NDUBA_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			lung(1)|urinary_tract(1)	2						TTCTCCACCAGCAAAGTCGAC	0.488																																							uc002cni.2		NA																	0					0						c.e3-1		NADH dehydrogenase (ubiquinone) 1 beta	NADH(DB00157)						189.0	196.0	193.0					16																	2011497		2199	4300	6499	SO:0001630	splice_region_variant	4716				mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding	g.chr16:2011497G>A	AF044954	CCDS10451.1	16p13.3	2011-07-04	2002-08-29		ENSG00000140990	ENSG00000140990		"""Mitochondrial respiratory chain complex / Complex I"""	7696	protein-coding gene	gene with protein product	"""complex I PDSW subunit"""	603843	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 (22kD, PDSW)"""			9763677, 9878551	Standard	NM_004548		Approved	PDSW	uc002cni.2	O96000	OTTHUMG00000128709	ENST00000268668.6:c.270-1G>A	16.37:g.2011497G>A						NDUFB10_uc002cnj.2_Splice_Site_p.Y90_splice	p.Y90_splice	NM_004548	NP_004539	O96000	NDUBA_HUMAN			3	379	+								Q96II6	Splice_Site	SNP	ENST00000268668.6	37	c.270_splice	CCDS10451.1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830233	0.32329	.	.	ENSG00000140990	ENST00000268668;ENST00000543683	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5781	0.87957	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NDUFB10	1951498	1.000000	0.71417	0.999000	0.59377	0.123000	0.20343	9.501000	0.97979	2.389000	0.81357	0.655000	0.94253	.		0.488	NDUFB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250614.2	NM_004548	Intron	5	206	0	0	0	0.000602	0	5	206				
CDH5	1003	broad.mit.edu	37	16	66436571	66436571	+	Silent	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr16:66436571C>T	ENST00000341529.3	+	12	2002	c.1854C>T	c.(1852-1854)atC>atT	p.I618I	CDH5_ENST00000539168.1_Silent_p.I57I	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	618					adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	CCCTGCTCATCTTCCTGCGGC	0.721																																							uc002eom.3		NA																	0				ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6						c.(1852-1854)ATC>ATT		cadherin 5, type 2 preproprotein							9.0	11.0	10.0					16																	66436571		2124	4142	6266	SO:0001819	synonymous_variant	1003				adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding	g.chr16:66436571C>T	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.1854C>T	16.37:g.66436571C>T							p.I618I	NM_001795	NP_001786	P33151	CADH5_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.107)	12	2010	+		Ovarian(137;0.0955)	618			Helical; (Potential).		Q4VAI5|Q4VAI6	Silent	SNP	ENST00000341529.3	37	c.1854C>T	CCDS10804.1																																																																																				0.721	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795		7	14	0	0	0	0.006214	0	7	14				
CASC3	22794	broad.mit.edu	37	17	38318122	38318122	+	Silent	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr17:38318122C>T	ENST00000264645.7	+	4	640	c.414C>T	c.(412-414)acC>acT	p.T138T		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	138	Necessary for RNA-binding, interaction with MAGOH and localization in nucleus speckles.|Sufficient to form the EJC.				gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						AGCCTGACACCAAAAGCACTG	0.443																																							uc010cwt.1		NA																	0				ovary(1)	1						c.(412-414)ACC>ACT		metastatic lymph node 51							112.0	109.0	110.0					17																	38318122		2203	4300	6503	SO:0001819	synonymous_variant	22794				mRNA processing|mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|response to stress|RNA splicing	exon-exon junction complex|nuclear speck|perinuclear region of cytoplasm	identical protein binding|RNA binding|ubiquitin protein ligase binding	g.chr17:38318122C>T	X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.414C>T	17.37:g.38318122C>T						CASC3_uc010cws.1_Silent_p.T138T|CASC3_uc002hue.2_Silent_p.T138T	p.T138T	NM_007359	NP_031385	O15234	CASC3_HUMAN			4	709	+			138			Necessary for RNA-binding, interaction with MAGOH and localization in nucleus speckles.|Sufficient to form the EJC.		A8K8R0	Silent	SNP	ENST00000264645.7	37	c.414C>T	CCDS11362.1																																																																																				0.443	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257127.3	NM_007359		5	40	0	0	0	0.000602	0	5	40				
BZRAP1	9256	broad.mit.edu	37	17	56389964	56389964	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr17:56389964G>A	ENST00000343736.4	-	17	2381	c.2218C>T	c.(2218-2220)Cct>Tct	p.P740S	BZRAP1_ENST00000355701.3_Missense_Mutation_p.P740S|BZRAP1_ENST00000268893.6_Missense_Mutation_p.P680S			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	740						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGAGTTCAGGGCCTGAGCTG	0.607																																							uc002ivx.3		NA																	0				upper_aerodigestive_tract(2)|skin(1)	3						c.(2218-2220)CCT>TCT		peripheral benzodiazepine receptor-associated							62.0	55.0	58.0					17																	56389964		2203	4300	6503	SO:0001583	missense	9256					mitochondrion	benzodiazepine receptor binding	g.chr17:56389964G>A	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.2218C>T	17.37:g.56389964G>A	ENSP00000345824:p.Pro740Ser					BZRAP1_uc010dcs.2_Missense_Mutation_p.P680S|BZRAP1_uc010wnt.1_Missense_Mutation_p.P740S	p.P740S	NM_004758	NP_004749	O95153	RIMB1_HUMAN			17	3089	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		740					O75111|Q8N5W3	Missense_Mutation	SNP	ENST00000343736.4	37	c.2218C>T	CCDS11605.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.616438	0.66672	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.04502	3.62;3.61;3.62	5.4	5.4	0.78164	.	0.242548	0.42548	D	0.000699	T	0.15609	0.0376	M	0.65975	2.015	0.37140	D	0.901689	P;D;P	0.62365	0.501;0.991;0.949	B;P;P	0.59221	0.081;0.854;0.771	T	0.20505	-1.0273	10	0.14252	T	0.57	.	18.1634	0.89717	0.0:0.0:1.0:0.0	.	740;680;740	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	S	740;740;680	ENSP00000347929:P740S;ENSP00000345824:P740S;ENSP00000268893:P680S	ENSP00000268893:P680S	P	-	1	0	BZRAP1	53744963	1.000000	0.71417	0.988000	0.46212	0.890000	0.51754	5.374000	0.66167	2.528000	0.85240	0.462000	0.41574	CCT		0.607	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758		27	39	0	0	0	0.008361	0	27	39				
MTMR4	9110	broad.mit.edu	37	17	56573570	56573570	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr17:56573570C>A	ENST00000323456.5	-	16	2057	c.1933G>T	c.(1933-1935)Gag>Tag	p.E645*	MTMR4_ENST00000579925.1_Nonsense_Mutation_p.E588*	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	645					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGCCAGGGCTCCAGGCCTACC	0.557																																							uc002iwj.2		NA																	0				skin(1)	1						c.(1933-1935)GAG>TAG		myotubularin related protein 4							66.0	64.0	65.0					17																	56573570		2203	4300	6503	SO:0001587	stop_gained	9110					cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity	g.chr17:56573570C>A	AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.1933G>T	17.37:g.56573570C>A	ENSP00000325285:p.Glu645*						p.E645*	NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN			16	2043	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		645					D3DTZ6|Q8IV27|Q9Y4D5	Nonsense_Mutation	SNP	ENST00000323456.5	37	c.1933G>T	CCDS11608.1	.	.	.	.	.	.	.	.	.	.	C	37	6.270494	0.97431	.	.	ENSG00000108389	ENST00000323456	.	.	.	4.75	4.75	0.60458	.	0.489572	0.19918	N	0.103149	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	15.4052	0.74871	0.0:1.0:0.0:0.0	.	.	.	.	X	645	.	ENSP00000325285:E645X	E	-	1	0	MTMR4	53928569	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	6.863000	0.75489	2.635000	0.89317	0.655000	0.94253	GAG		0.557	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687		23	30	1	0	4.4004e-07	0.00333	5.31083e-07	23	30				
TANC2	26115	broad.mit.edu	37	17	61482500	61482500	+	Nonsense_Mutation	SNP	G	G	T	rs200323393		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr17:61482500G>T	ENST00000424789.2	+	18	3131	c.3127G>T	c.(3127-3129)Gga>Tga	p.G1043*	TANC2_ENST00000389520.4_Nonsense_Mutation_p.G1043*|AC015923.1_ENST00000431604.1_RNA|RP11-269G24.3_ENST00000583552.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1043					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						AGCTGCAGCCGGAAGGGGCAA	0.562																																							uc002jal.3		NA																	0				ovary(2)	2						c.(3127-3129)GGA>TGA		tetratricopeptide repeat, ankyrin repeat and							35.0	37.0	36.0					17																	61482500		1965	4150	6115	SO:0001587	stop_gained	26115						binding	g.chr17:61482500G>T	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.3127G>T	17.37:g.61482500G>T	ENSP00000387593:p.Gly1043*					TANC2_uc010wpe.1_Nonsense_Mutation_p.G953*|TANC2_uc002jao.3_Nonsense_Mutation_p.G144*	p.G1043*	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN			18	3150	+			1043			ANK 6.		Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Nonsense_Mutation	SNP	ENST00000424789.2	37	c.3127G>T	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	G	41	9.071047	0.99055	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	.	.	.	5.33	4.34	0.51931	.	0.161807	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	15.8434	0.78868	0.0:0.1362:0.8638:0.0	.	.	.	.	X	1043	.	ENSP00000374171:G1043X	G	+	1	0	TANC2	58836232	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	5.715000	0.68430	1.209000	0.43321	0.655000	0.94253	GGA		0.562	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1			9	15	1	0	1.08611e-07	0.010729	1.35763e-07	9	15				
OSBPL1A	114876	broad.mit.edu	37	18	21897289	21897289	+	Splice_Site	SNP	A	A	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr18:21897289A>T	ENST00000319481.3	-	10	1013		c.e10+1			NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CATAATACTTACTGTTTCCTA	0.299																																							uc002kve.2		NA																	0				ovary(4)	4						c.e10+1		oxysterol-binding protein-like 1A isoform B							102.0	111.0	108.0					18																	21897289		2203	4300	6503	SO:0001630	splice_region_variant	114876				cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding	g.chr18:21897289A>T	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.806+1T>A	18.37:g.21897289A>T						OSBPL1A_uc002kvf.3_Splice_Site_p.Q49_splice	p.Q269_splice	NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN			10	980	-	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)							B7Z7D3|Q9BZF5|Q9NW87	Splice_Site	SNP	ENST00000319481.3	37	c.806_splice	CCDS11884.1	.	.	.	.	.	.	.	.	.	.	A	18.14	3.556979	0.65425	.	.	ENSG00000141447	ENST00000319481	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.538	0.61657	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	OSBPL1A	20151287	1.000000	0.71417	0.999000	0.59377	0.722000	0.41435	7.993000	0.88291	2.080000	0.62538	0.455000	0.32223	.		0.299	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597	Intron	28	80	0	0	0	0.00632	0	28	80				
DYNAP	284254	broad.mit.edu	37	18	52265217	52265217	+	Silent	SNP	G	G	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr18:52265217G>C	ENST00000321600.1	+	3	520	c.474G>C	c.(472-474)gtG>gtC	p.V158V	DYNAP_ENST00000585973.1_Silent_p.V106V	NM_173629.1	NP_775900.1	Q8N1N2	DYNAP_HUMAN	dynactin associated protein	158					activation of protein kinase B activity (GO:0032148)|cellular response to ergosterol (GO:1901625)|positive regulation of cell proliferation (GO:0008284)|regulation of apoptotic process (GO:0042981)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GAGAGTGTGTGACTGTCAAAC	0.443																																							uc002lfq.1		NA																	0					0						c.(472-474)GTG>GTC		hypothetical protein LOC284254							160.0	133.0	142.0					18																	52265217		2203	4300	6503	SO:0001819	synonymous_variant	284254					integral to membrane		g.chr18:52265217G>C	AK096425	CCDS11957.1	18q21.2	2012-10-24	2012-10-24	2012-10-24	ENSG00000178690	ENSG00000178690			26808	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 26"""	C18orf26		20978158	Standard	NM_173629		Approved	FLJ39106	uc002lfq.1	Q8N1N2	OTTHUMG00000132709	ENST00000321600.1:c.474G>C	18.37:g.52265217G>C						C18orf26_uc002lfp.1_Silent_p.V106V	p.V158V	NM_173629	NP_775900	Q8N1N2	CR026_HUMAN		Colorectal(16;0.0193)|READ - Rectum adenocarcinoma(59;0.178)	3	520	+			158						Silent	SNP	ENST00000321600.1	37	c.474G>C	CCDS11957.1																																																																																				0.443	DYNAP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256007.1	NM_173629		11	58	0	0	0	0.008291	0	11	58				
PIGN	23556	broad.mit.edu	37	18	59821870	59821870	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr18:59821870G>A	ENST00000357637.5	-	7	872	c.457C>T	c.(457-459)Cac>Tac	p.H153Y	PIGN_ENST00000400334.3_Missense_Mutation_p.H153Y	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	153					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				GTATAAACGTGGTCTCCACTA	0.313																																							uc002lii.3		NA																	0				breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5						c.(457-459)CAC>TAC		phosphatidylinositol glycan anchor biosynthesis,							120.0	113.0	115.0					18																	59821870		1816	4075	5891	SO:0001583	missense	23556				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups	g.chr18:59821870G>A	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.457C>T	18.37:g.59821870G>A	ENSP00000350263:p.His153Tyr					PIGN_uc002lij.3_Missense_Mutation_p.H153Y	p.H153Y	NM_176787	NP_789744	O95427	PIGN_HUMAN			7	905	-		Colorectal(73;0.187)	153			Lumenal (Potential).		Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	ENST00000357637.5	37	c.457C>T	CCDS45879.1	.	.	.	.	.	.	.	.	.	.	G	18.37	3.608801	0.66558	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.72051	-0.62;-0.62	5.79	5.79	0.91817	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.87470	0.6185	M	0.84433	2.695	0.80722	D	1	B;B	0.34255	0.445;0.023	P;B	0.60473	0.875;0.072	D	0.84328	0.0520	9	.	.	.	-13.0782	20.0246	0.97519	0.0:0.0:1.0:0.0	.	153;153	B2RCI8;O95427	.;PIGN_HUMAN	Y	153	ENSP00000350263:H153Y;ENSP00000383188:H153Y	.	H	-	1	0	PIGN	57972850	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	7.268000	0.78473	2.734000	0.93682	0.609000	0.83330	CAC		0.313	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787		28	82	0	0	0	0.008361	0	28	82				
SERPINB3	6317	broad.mit.edu	37	18	61328359	61328359	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr18:61328359G>A	ENST00000283752.5	-	2	235	c.92C>T	c.(91-93)cCt>cTt	p.P31L	SERPINB3_ENST00000332821.8_Missense_Mutation_p.P31L|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	31					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						GATGCTGATAGGGGAATAGAA	0.423																																							uc002ljg.2		NA																	0				ovary(2)|lung(1)	3						c.(91-93)CCT>CTT		SubName: Full=Squamous cell carcinoma antigen 2;							229.0	198.0	208.0					18																	61328359		2203	4297	6500	SO:0001583	missense	6318				immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity	g.chr18:61328359G>A	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.92C>T	18.37:g.61328359G>A	ENSP00000283752:p.Pro31Leu					SERPINB3_uc002lji.2_Missense_Mutation_p.P31L|SERPINB3_uc010dqa.2_Missense_Mutation_p.P31L|SERPINB3_uc010dqb.2_Missense_Mutation_p.P31L|SERPINB3_uc010dqc.2_Missense_Mutation_p.P31L	p.P31L			P48594	SPB4_HUMAN			1	118	-			31					A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	ENST00000283752.5	37	c.92C>T	CCDS11987.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.181345	0.57800	.	.	ENSG00000057149	ENST00000283752;ENST00000332821	D;D	0.97232	-4.3;-4.3	3.26	3.26	0.37387	Serpin domain (3);	0.000000	0.39475	N	0.001354	D	0.99083	0.9685	H	0.99058	4.415	0.39222	D	0.963515	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.98971	1.0801	10	0.87932	D	0	.	14.7404	0.69448	0.0:0.0:1.0:0.0	.	31;31;31;31;31	B3W5Y6;A8K847;P29508-2;P29508;Q5K684	.;.;.;SPB3_HUMAN;.	L	31	ENSP00000283752:P31L;ENSP00000329498:P31L	ENSP00000283752:P31L	P	-	2	0	SERPINB3	59479339	1.000000	0.71417	0.018000	0.16275	0.007000	0.05969	5.831000	0.69330	2.133000	0.65898	0.555000	0.69702	CCT		0.423	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919		32	80	0	0	0	0.002836	0	32	80				
MUC16	94025	broad.mit.edu	37	19	9087226	9087226	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:9087226C>A	ENST00000397910.4	-	1	4792	c.4589G>T	c.(4588-4590)gGg>gTg	p.G1530V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1530	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTTAAGTCCCCAGTTCTGCC	0.468																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(4588-4590)GGG>GTG		mucin 16							317.0	295.0	302.0					19																	9087226		2026	4187	6213	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9087226C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4589G>T	19.37:g.9087226C>A	ENSP00000381008:p.Gly1530Val						p.G1530V	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			1	4793	-			1530			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.4589G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	1.099	-0.661800	0.03454	.	.	ENSG00000181143	ENST00000397910	T	0.03580	3.88	0.821	0.821	0.18799	.	.	.	.	.	T	0.04452	0.0122	N	0.08118	0	.	.	.	D	0.71674	0.998	P	0.61328	0.887	T	0.40683	-0.9550	8	0.87932	D	0	.	4.9522	0.14021	0.0:1.0:0.0:0.0	.	1530	B5ME49	.	V	1530	ENSP00000381008:G1530V	ENSP00000381008:G1530V	G	-	2	0	MUC16	8948226	0.002000	0.14202	0.019000	0.16419	0.033000	0.12548	0.862000	0.27899	0.724000	0.32296	0.313000	0.20887	GGG		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		71	115	1	0	6.8682e-38	0.00361	1.26519e-37	71	115				
ZNF43	7594	broad.mit.edu	37	19	21992268	21992268	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:21992268G>A	ENST00000354959.4	-	4	740	c.571C>T	c.(571-573)Caa>Taa	p.Q191*	ZNF43_ENST00000598381.1_Nonsense_Mutation_p.Q185*|ZNF43_ENST00000594012.1_Nonsense_Mutation_p.Q185*|ZNF43_ENST00000595461.1_Nonsense_Mutation_p.Q185*	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		ATTTTATGTTGAGCTAGATGT	0.303																																							uc002nqj.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(571-573)CAA>TAA		zinc finger protein 43							44.0	44.0	44.0					19																	21992268		2202	4299	6501	SO:0001587	stop_gained	7594				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21992268G>A	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.571C>T	19.37:g.21992268G>A	ENSP00000347045:p.Gln191*					ZNF43_uc010ecv.2_Nonsense_Mutation_p.Q185*|ZNF43_uc002nql.2_Nonsense_Mutation_p.Q185*|ZNF43_uc002nqm.2_Nonsense_Mutation_p.Q185*|ZNF43_uc002nqk.2_Nonsense_Mutation_p.Q121*	p.Q191*	NM_003423	NP_003414	P17038	ZNF43_HUMAN		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)	4	701	-		Renal(1328;0.000219)|Hepatocellular(1079;0.121)	191			C2H2-type 1.		A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Nonsense_Mutation	SNP	ENST00000354959.4	37	c.571C>T	CCDS12413.2	.	.	.	.	.	.	.	.	.	.	G	11.52	1.661933	0.29515	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	.	.	.	1.29	-2.57	0.06248	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.9857	0.01446	0.1609:0.1653:0.3469:0.3269	.	.	.	.	X	190;191	.	ENSP00000347045:Q191X	Q	-	1	0	ZNF43	21784108	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.259000	0.02861	-0.941000	0.03700	-0.535000	0.04281	CAA		0.303	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423		11	14	0	0	0	0.008291	0	11	14				
ZNF99	7652	broad.mit.edu	37	19	22939436	22939436	+	IGR	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:22939436C>T	ENST00000596209.1	-	0	2686				CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Missense_Mutation_p.G912E	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CGGTTTCTCCCCAGTATGAAT	0.358																																							uc010xrh.1		NA																	0				ovary(1)|skin(1)	2						c.(2734-2736)GGG>GAG		zinc finger protein 99							34.0	48.0	43.0					19																	22939436		1943	4229	6172	SO:0001628	intergenic_variant	7652							g.chr19:22939436C>T	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4			19.37:g.22939436C>T							p.G912E	NM_001080409	NP_001073878					7	2735	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)						M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	c.2735G>A	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	12.18	1.860627	0.32884	.	.	ENSG00000213973	ENST00000397104	T	0.25749	1.78	1.45	1.45	0.22620	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.45296	0.1335	.	.	.	0.35472	D	0.797424	D	0.60575	0.988	D	0.66084	0.941	T	0.58912	-0.7552	8	0.87932	D	0	.	9.8605	0.41112	0.0:1.0:0.0:0.0	.	912	A8MXY4	ZNF99_HUMAN	E	912	ENSP00000380293:G912E	ENSP00000380293:G912E	G	-	2	0	ZNF99	22731276	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.024000	0.12435	0.787000	0.33731	0.380000	0.24917	GGG		0.358	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		21	27	0	0	0	0.010504	0	21	27				
FAM187B	148109	broad.mit.edu	37	19	35716023	35716023	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:35716023C>T	ENST00000324675.3	-	2	863	c.815G>A	c.(814-816)gGc>gAc	p.G272D		NM_152481.1	NP_689694.1	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	272						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	9						CTGCCTGCCGCCGGTGGAGGG	0.667																																							uc002nyk.1		NA																	0				ovary(2)	2						c.(814-816)GGC>GAC		family with sequence similarity 187, member B							12.0	15.0	14.0					19																	35716023		2192	4292	6484	SO:0001583	missense	148109					integral to membrane		g.chr19:35716023C>T	AK098526	CCDS12448.1	19q13.12	2008-10-16	2008-10-16	2008-10-16	ENSG00000177558	ENSG00000177558			26366	protein-coding gene	gene with protein product			"""transmembrane protein 162"""	TMEM162			Standard	NM_152481		Approved	FLJ25660	uc002nyk.1	Q17R55	OTTHUMG00000164450	ENST00000324675.3:c.815G>A	19.37:g.35716023C>T	ENSP00000323355:p.Gly272Asp						p.G272D	NM_152481	NP_689694	Q17R55	F187B_HUMAN			2	860	-			272			Extracellular (Potential).		Q8N7G6	Missense_Mutation	SNP	ENST00000324675.3	37	c.815G>A	CCDS12448.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793153	0.90453	.	.	ENSG00000177558	ENST00000324675	T	0.40756	1.02	4.25	4.25	0.50352	.	0.000000	0.51477	D	0.000094	T	0.59252	0.2180	M	0.64997	1.995	0.09310	N	0.999996	D	0.89917	1.0	D	0.85130	0.997	T	0.50398	-0.8833	10	0.54805	T	0.06	-26.6187	12.3208	0.54983	0.0:1.0:0.0:0.0	.	272	Q17R55	F187B_HUMAN	D	272	ENSP00000323355:G272D	ENSP00000323355:G272D	G	-	2	0	FAM187B	40407863	0.134000	0.22483	0.061000	0.19648	0.899000	0.52679	3.205000	0.51090	2.370000	0.80446	0.467000	0.42956	GGC		0.667	FAM187B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378854.1	NM_152481		9	20	0	0	0	0.004482	0	9	20				
ARHGAP33	115703	broad.mit.edu	37	19	36278085	36278085	+	Missense_Mutation	SNP	C	C	T	rs187189822		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:36278085C>T	ENST00000007510.4	+	21	2762	c.2618C>T	c.(2617-2619)tCa>tTa	p.S873L	AC002398.5_ENST00000433059.1_lincRNA|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.S737L|ARHGAP33_ENST00000314737.5_Missense_Mutation_p.S712L			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	873					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						GATATGGAGTCACCACTGCCA	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		11088	0.001		0.0	False		,,,				2504	0.0						uc002obs.1		NA																	0				skin(2)|ovary(1)|pancreas(1)	4						c.(2134-2136)TCA>TTA		sorting nexin 26							29.0	37.0	35.0					19																	36278085		2170	4265	6435	SO:0001583	missense	115703				cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding	g.chr19:36278085C>T	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.2618C>T	19.37:g.36278085C>T	ENSP00000007510:p.Ser873Leu					ARHGAP33_uc002obt.1_Missense_Mutation_p.S737L|ARHGAP33_uc010eel.2_Missense_Mutation_p.S461L|ARHGAP33_uc002obv.1_Missense_Mutation_p.S461L	p.S712L	NM_052948	NP_443180	O14559	RHG33_HUMAN			21	2220	+			760					O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37	c.2135C>T		1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	15.38	2.817545	0.50633	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.13538	3.04;2.58;3.09	4.92	4.92	0.64577	.	0.344301	0.21372	N	0.075608	T	0.30198	0.0757	L	0.53249	1.67	0.49483	D	0.999792	D;D;D	0.61697	0.982;0.99;0.99	P;P;P	0.59424	0.781;0.857;0.857	T	0.01570	-1.1322	10	0.56958	D	0.05	.	16.864	0.86025	0.0:1.0:0.0:0.0	.	873;737;712	O14559;O14559-10;O14559-11	RHG33_HUMAN;.;.	L	873;712;737	ENSP00000007510:S873L;ENSP00000320038:S712L;ENSP00000368227:S737L	ENSP00000007510:S873L	S	+	2	0	ARHGAP33	40969925	0.420000	0.25457	0.219000	0.23793	0.042000	0.13812	1.977000	0.40589	2.253000	0.74438	0.655000	0.94253	TCA		0.657	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948		9	72	0	0	0	0.004482	0	9	72				
ZNF383	163087	broad.mit.edu	37	19	37733742	37733742	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:37733742G>T	ENST00000589413.1	+	8	1187	c.604G>T	c.(604-606)Gag>Tag	p.E202*	ZNF383_ENST00000590503.1_Nonsense_Mutation_p.E202*|ZNF383_ENST00000352998.3_Nonsense_Mutation_p.E202*			Q8NA42	ZN383_HUMAN	zinc finger protein 383	202					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)	15			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGAATGTAAAGAGTGTGGGAA	0.358																																							uc002oft.1		NA																	0				ovary(1)|skin(1)	2						c.(604-606)GAG>TAG		zinc finger protein 383							57.0	61.0	60.0					19																	37733742		2203	4300	6503	SO:0001587	stop_gained	163087				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	g.chr19:37733742G>T	AY438646	CCDS12501.1	19q13.13	2013-01-08				ENSG00000188283		"""Zinc fingers, C2H2-type"", ""-"""	18609	protein-coding gene	gene with protein product							Standard	NM_152604		Approved	FLJ35863	uc002ofu.1	Q8NA42		ENST00000589413.1:c.604G>T	19.37:g.37733742G>T	ENSP00000464871:p.Glu202*					ZNF383_uc002ofs.1_Nonsense_Mutation_p.E137*|ZNF383_uc002ofu.1_Nonsense_Mutation_p.E202*	p.E202*	NM_152604	NP_689817	Q8NA42	ZN383_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		8	1184	+			202			C2H2-type 2.		Q6X2C7	Nonsense_Mutation	SNP	ENST00000589413.1	37	c.604G>T	CCDS12501.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595583	0.66219	.	.	ENSG00000188283	ENST00000352998	.	.	.	3.74	1.52	0.23074	.	0.000000	0.32068	N	0.006631	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	5.8382	0.18619	0.1113:0.0:0.6929:0.1958	.	.	.	.	X	202	.	ENSP00000340132:E202X	E	+	1	0	ZNF383	42425582	0.014000	0.17966	0.133000	0.22050	0.698000	0.40448	0.268000	0.18571	0.854000	0.35336	0.563000	0.77884	GAG		0.358	ZNF383-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458141.1	NM_152604		33	35	1	0	4.15321e-07	0.009535	5.06237e-07	33	35				
RYR1	6261	broad.mit.edu	37	19	38980864	38980864	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:38980864C>T	ENST00000359596.3	+	36	5963	c.5963C>T	c.(5962-5964)gCa>gTa	p.A1988V	RYR1_ENST00000355481.4_Missense_Mutation_p.A1988V|RYR1_ENST00000360985.3_Missense_Mutation_p.A1988V			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1988	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGCATGACCGCAGCAGAGACT	0.602																																							uc002oit.2		NA																	0				ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(5962-5964)GCA>GTA		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						60.0	55.0	57.0					19																	38980864		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38980864C>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5963C>T	19.37:g.38980864C>T	ENSP00000352608:p.Ala1988Val					RYR1_uc002oiu.2_Missense_Mutation_p.A1988V	p.A1988V	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		36	6093	+	all_cancers(60;7.91e-06)		1988			Cytoplasmic.|6 X approximate repeats.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.5963C>T	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869363	0.51588	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.74209	-0.82;-0.82;-0.82	4.61	4.61	0.57282	.	0.000000	0.64402	U	0.000005	D	0.85431	0.5695	M	0.74881	2.28	0.58432	D	0.999991	D;D	0.71674	0.998;0.997	D;D	0.80764	0.994;0.985	D	0.85748	0.1341	10	0.44086	T	0.13	.	17.2078	0.86922	0.0:1.0:0.0:0.0	.	1988;1988	P21817-2;P21817	.;RYR1_HUMAN	V	1988	ENSP00000352608:A1988V;ENSP00000347667:A1988V;ENSP00000354254:A1988V	ENSP00000347667:A1988V	A	+	2	0	RYR1	43672704	1.000000	0.71417	0.522000	0.27862	0.103000	0.19146	7.556000	0.82233	2.365000	0.80145	0.557000	0.71058	GCA		0.602	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			8	44	0	0	0	0.004482	0	8	44				
ARHGEF1	9138	broad.mit.edu	37	19	42392303	42392303	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:42392303G>T	ENST00000354532.3	+	3	213	c.65G>T	c.(64-66)aGc>aTc	p.S22I	ARHGEF1_ENST00000347545.4_Missense_Mutation_p.S22I|ARHGEF1_ENST00000337665.4_Missense_Mutation_p.S37I|ARHGEF1_ENST00000596957.1_Intron|ARHGEF1_ENST00000599846.1_Missense_Mutation_p.S22I|ARHGEF1_ENST00000378152.4_Missense_Mutation_p.S37I	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	22					cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GTTCCCGTCAGCATCATCGGG	0.632																																							uc002orx.2		NA																	0				ovary(3)|large_intestine(1)	4						c.(64-66)AGC>ATC		Rho guanine nucleotide exchange factor 1 isoform							125.0	142.0	137.0					19																	42392303		2203	4300	6503	SO:0001583	missense	9138				cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr19:42392303G>T	U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.65G>T	19.37:g.42392303G>T	ENSP00000346532:p.Ser22Ile					ARHGEF1_uc002orw.1_Missense_Mutation_p.S22I|ARHGEF1_uc002ory.2_Missense_Mutation_p.S22I|ARHGEF1_uc002orz.2_5'UTR|ARHGEF1_uc002osa.2_Missense_Mutation_p.S37I|ARHGEF1_uc002osb.2_Missense_Mutation_p.S37I	p.S22I	NM_004706	NP_004697	Q92888	ARHG1_HUMAN		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)	3	174	+		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)	22					O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	ENST00000354532.3	37	c.65G>T	CCDS12591.1	.	.	.	.	.	.	.	.	.	.	g	15.63	2.891622	0.52014	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000316079;ENST00000337665;ENST00000378152	T;T;T;T	0.66995	-0.03;-0.07;-0.04;-0.24	3.28	0.997	0.19851	.	0.108508	0.32852	U	0.005575	T	0.63558	0.2521	N	0.19112	0.55	0.23787	N	0.996841	D;D;D;D;D	0.69078	0.995;0.997;0.994;0.995;0.995	D;D;D;P;D	0.78314	0.979;0.991;0.975;0.854;0.986	T	0.53208	-0.8471	10	0.72032	D	0.01	.	5.6886	0.17817	0.0:0.2182:0.5571:0.2247	.	37;37;22;22;82	Q6NX52;Q92888-3;Q92888-2;Q92888;Q8NF33	.;.;.;ARHG1_HUMAN;.	I	22;22;58;37;37	ENSP00000346532:S22I;ENSP00000344429:S22I;ENSP00000337261:S37I;ENSP00000367394:S37I	ENSP00000323044:S58I	S	+	2	0	ARHGEF1	47084143	1.000000	0.71417	0.991000	0.47740	0.835000	0.47333	3.516000	0.53436	0.220000	0.20860	0.448000	0.29417	AGC		0.632	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000463360.1	NM_199002		45	138	1	0	1.67211e-32	0.00361	3.01225e-32	45	138				
APOE	348	broad.mit.edu	37	19	45412386	45412386	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:45412386G>T	ENST00000252486.4	+	4	944	c.833G>T	c.(832-834)cGc>cTc	p.R278L		NM_000041.2	NP_000032.1	P02649	APOE_HUMAN	apolipoprotein E	278					aging (GO:0007568)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|artery morphogenesis (GO:0048844)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cGMP-mediated signaling (GO:0019934)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|cytoskeleton organization (GO:0007010)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular transport (GO:0046907)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle remodeling (GO:0034374)|maintenance of location in cell (GO:0051651)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of blood coagulation (GO:0030195)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cholesterol biosynthetic process (GO:0045541)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of dendritic spine development (GO:0061000)|negative regulation of dendritic spine maintenance (GO:1902951)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lipid biosynthetic process (GO:0051055)|negative regulation of lipid transport across blood brain barrier (GO:1903001)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of phospholipid efflux (GO:1902999)|negative regulation of platelet activation (GO:0010544)|negative regulation of postsynaptic membrane organization (GO:1901627)|negative regulation of presynaptic membrane organization (GO:1901630)|nitric oxide mediated signal transduction (GO:0007263)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system axon regeneration (GO:0014012)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of axon extension (GO:0045773)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of dendritic spine maintenance (GO:1902952)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of lipid transport across blood brain barrier (GO:1903002)|positive regulation of low-density lipoprotein particle receptor catabolic process (GO:0032805)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipid efflux (GO:1902995)|positive regulation of postsynaptic membrane organization (GO:1901628)|positive regulation of presynaptic membrane organization (GO:1901631)|protein import (GO:0017038)|receptor-mediated endocytosis (GO:0006898)|regulation of axon extension (GO:0030516)|regulation of beta-amyloid clearance (GO:1900221)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of neuron death (GO:1901214)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of tau-protein kinase activity (GO:1902947)|response to dietary excess (GO:0002021)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)|response to retinoic acid (GO:0032526)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|triglyceride metabolic process (GO:0006641)|vasodilation (GO:0042311)|very-low-density lipoprotein particle clearance (GO:0034447)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|high-density lipoprotein particle (GO:0034364)|intermediate-density lipoprotein particle (GO:0034363)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	antioxidant activity (GO:0016209)|beta-amyloid binding (GO:0001540)|cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle receptor binding (GO:0050750)|metal chelating activity (GO:0046911)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)|tau protein binding (GO:0048156)|very-low-density lipoprotein particle receptor binding (GO:0070326)			large_intestine(1)|lung(2)|prostate(1)	4	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	TTCCAGGCCCGCCTCAAGAGC	0.706																																							uc002pab.2		NA																	0					0						c.(832-834)CGC>CTC		apolipoprotein E precursor	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)						10.0	12.0	11.0					19																	45412386		2149	4240	6389	SO:0001583	missense	348				anti-apoptosis|Cdc42 protein signal transduction|cell death|cGMP-mediated signaling|cholesterol efflux|cholesterol homeostasis|chylomicron remnant clearance|cytoskeleton organization|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|induction of apoptosis|intracellular transport|negative regulation of blood vessel endothelial cell migration|negative regulation of cholesterol biosynthetic process|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of platelet activation|nitric oxide mediated signal transduction|phospholipid efflux|positive regulation of cGMP biosynthetic process|positive regulation of cholesterol efflux|positive regulation of cholesterol esterification|positive regulation of low-density lipoprotein particle receptor catabolic process|positive regulation of membrane protein ectodomain proteolysis|positive regulation of nitric-oxide synthase activity|receptor-mediated endocytosis|regulation of axon extension|regulation of neuronal synaptic plasticity|response to reactive oxygen species|reverse cholesterol transport|synaptic transmission, cholinergic|triglyceride metabolic process|very-low-density lipoprotein particle clearance|very-low-density lipoprotein particle remodeling	chylomicron|dendrite|high-density lipoprotein particle|intermediate-density lipoprotein particle|low-density lipoprotein particle|neuronal cell body|very-low-density lipoprotein particle	antioxidant activity|beta-amyloid binding|heparin binding|low-density lipoprotein particle receptor binding|metal chelating activity|phosphatidylcholine-sterol O-acyltransferase activator activity|phospholipid binding|protein heterodimerization activity|protein homodimerization activity|tau protein binding|very-low-density lipoprotein particle receptor binding	g.chr19:45412386G>T	K00396	CCDS12647.1	19q13.31	2013-01-24			ENSG00000130203	ENSG00000130203		"""Apolipoproteins"""	613	protein-coding gene	gene with protein product		107741	"""Alzheimer disease 2 (APOE*E4-associated, late onset)"""	AD2		10662539	Standard	NM_000041		Approved		uc002pab.3	P02649	OTTHUMG00000128901	ENST00000252486.4:c.833G>T	19.37:g.45412386G>T	ENSP00000252486:p.Arg278Leu						p.R278L	NM_000041	NP_000032	P02649	APOE_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)	4	916	+	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)	278					B2RC15|C0JYY5|Q9P2S4	Missense_Mutation	SNP	ENST00000252486.4	37	c.833G>T	CCDS12647.1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.445969	0.63178	.	.	ENSG00000130203	ENST00000252486	T	0.74526	-0.85	4.88	0.315	0.15852	Apolipoprotein/apolipophorin (1);	0.456837	0.19675	N	0.108648	T	0.81673	0.4872	M	0.80982	2.52	0.21740	N	0.99956	D	0.76494	0.999	D	0.75020	0.985	T	0.69320	-0.5176	10	0.62326	D	0.03	-17.5358	4.3772	0.11275	0.2693:0.0:0.5703:0.1604	.	278	P02649	APOE_HUMAN	L	278	ENSP00000252486:R278L	ENSP00000252486:R278L	R	+	2	0	APOE	50104226	0.788000	0.28762	0.379000	0.26080	0.935000	0.57460	1.715000	0.37971	0.134000	0.18681	0.549000	0.68633	CGC		0.706	APOE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250865.2	NM_000041		9	9	1	0	3.09899e-07	0.004482	3.81533e-07	9	9				
ZNF473	25888	broad.mit.edu	37	19	50549674	50549674	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:50549674T>A	ENST00000595661.1	+	6	2469	c.1974T>A	c.(1972-1974)agT>agA	p.S658R	ZNF473_ENST00000445728.3_Missense_Mutation_p.S646R|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000601364.1_Intron|ZNF473_ENST00000391821.2_Missense_Mutation_p.S658R|ZNF473_ENST00000270617.3_Missense_Mutation_p.S658R|CTD-2126E3.3_ENST00000599410.1_RNA			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	658					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		TCAGCCACAGTGCACACCTCT	0.453																																							uc002prn.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1972-1974)AGT>AGA		zinc finger protein 473							70.0	65.0	67.0					19																	50549674		2203	4300	6503	SO:0001583	missense	25888				histone mRNA 3'-end processing|regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription	Cajal body	DNA binding|protein binding|zinc ion binding	g.chr19:50549674T>A	AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.1974T>A	19.37:g.50549674T>A	ENSP00000472808:p.Ser658Arg					ZNF473_uc002prm.2_Missense_Mutation_p.S658R|ZNF473_uc010ybo.1_Missense_Mutation_p.S646R	p.S658R	NM_001006656	NP_001006657	Q8WTR7	ZN473_HUMAN		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)	5	2211	+		all_neural(266;0.0459)|Ovarian(192;0.0728)	658			C2H2-type 13.		A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	ENST00000595661.1	37	c.1974T>A	CCDS33077.1	.	.	.	.	.	.	.	.	.	.	T	1.685	-0.505461	0.04261	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.60672	0.17;0.17;0.17	4.45	-5.8	0.02347	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.403740	0.21397	N	0.075206	T	0.22551	0.0544	N	0.04787	-0.16	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.22556	-1.0213	10	0.13470	T	0.59	-1.6467	4.7049	0.12844	0.1149:0.4702:0.234:0.181	.	658	Q8WTR7	ZN473_HUMAN	R	658;658;646	ENSP00000270617:S658R;ENSP00000375697:S658R;ENSP00000388961:S646R	ENSP00000270617:S658R	S	+	3	2	ZNF473	55241486	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-6.828000	0.00052	-1.520000	0.01773	-0.314000	0.08810	AGT		0.453	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	XM_046390		22	28	0	0	0	0.002299	0	22	28				
ZNF71	58491	broad.mit.edu	37	19	57133270	57133270	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:57133270G>T	ENST00000328070.6	+	3	849	c.615G>T	c.(613-615)caG>caT	p.Q205H		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	205					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		CTGTGCACCAGCGCACGCACA	0.657																																							uc002qnm.3		NA																	0				skin(1)	1						c.(613-615)CAG>CAT		zinc finger protein 71							47.0	42.0	43.0					19																	57133270		2203	4300	6503	SO:0001583	missense	58491					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57133270G>T	X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.615G>T	19.37:g.57133270G>T	ENSP00000328245:p.Gln205His						p.Q205H	NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN		GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)	3	853	+			205			C2H2-type 3.		Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	ENST00000328070.6	37	c.615G>T	CCDS12947.1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978902	0.34942	.	.	ENSG00000197951	ENST00000328070	T	0.07567	3.18	3.47	1.23	0.21249	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09069	0.0224	L	0.51422	1.61	0.21256	N	0.999741	P	0.39940	0.696	B	0.38803	0.282	T	0.19778	-1.0295	9	0.52906	T	0.07	.	8.4096	0.32636	0.2051:0.0:0.7949:0.0	.	205	Q9NQZ8	ZNF71_HUMAN	H	205	ENSP00000328245:Q205H	ENSP00000328245:Q205H	Q	+	3	2	ZNF71	61825082	0.001000	0.12720	0.962000	0.40283	0.818000	0.46254	1.096000	0.30976	0.171000	0.19730	0.561000	0.74099	CAG		0.657	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216		12	36	1	0	1.08611e-07	0.010729	1.35763e-07	12	36				
PEG3	5178	broad.mit.edu	37	19	57328601	57328601	+	Silent	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:57328601C>A	ENST00000326441.9	-	10	1572	c.1209G>T	c.(1207-1209)tcG>tcT	p.S403S	ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000593695.1_Silent_p.S277S|PEG3_ENST00000598410.1_Silent_p.S279S|PEG3_ENST00000423103.2_Silent_p.S403S	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	403					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S403S(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GATCGTGAATCGAGCCCTTCC	0.478																																							uc002qnu.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(1207-1209)TCG>TCT		paternally expressed 3 isoform 1							123.0	126.0	125.0					19																	57328601		2203	4300	6503	SO:0001819	synonymous_variant	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57328601C>A	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1209G>T	19.37:g.57328601C>A						ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Silent_p.S374S|PEG3_uc002qnv.2_Silent_p.S403S|PEG3_uc002qnw.2_Silent_p.S279S|PEG3_uc002qnx.2_Silent_p.S277S|PEG3_uc010etr.2_Silent_p.S403S	p.S403S	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	7	1560	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	403					A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	ENST00000326441.9	37	c.1209G>T	CCDS12948.1																																																																																				0.478	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			32	65	1	0	4.74835e-14	0.010818	7.1371e-14	32	65				
NBAS	51594	broad.mit.edu	37	2	15523386	15523386	+	Missense_Mutation	SNP	T	T	C	rs142327626		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:15523386T>C	ENST00000281513.5	-	29	3338	c.3313A>G	c.(3313-3315)Atg>Gtg	p.M1105V	NBAS_ENST00000441750.1_Missense_Mutation_p.M985V	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1105					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TTCTGCTGCATAGTTAACATG	0.358													T|||	1	0.000199681	0.0	0.0	5008	,	,		19063	0.0		0.001	False		,,,				2504	0.0						uc002rcc.1		NA																	0				ovary(2)|liver(1)|skin(1)	4						c.(3313-3315)ATG>GTG		neuroblastoma-amplified protein		T	VAL/MET	1,4405	2.1+/-5.4	0,1,2202	93.0	92.0	92.0		3313	5.9	0.9	2	dbSNP_134	92	1,8599	1.2+/-3.3	0,1,4299	yes	missense	NBAS	NM_015909.2	21	0,2,6501	CC,CT,TT		0.0116,0.0227,0.0154	possibly-damaging	1105/2372	15523386	2,13004	2203	4300	6503	SO:0001583	missense	51594							g.chr2:15523386T>C	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.3313A>G	2.37:g.15523386T>C	ENSP00000281513:p.Met1105Val					NBAS_uc010exl.1_Missense_Mutation_p.M177V|NBAS_uc002rcd.1_RNA	p.M1105V	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN			29	3339	-			1105					O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	c.3313A>G	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	T	16.11	3.029746	0.54790	2.27E-4	1.16E-4	ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000441755	T;T;T	0.16743	2.32;2.32;2.32	5.89	5.89	0.94794	Secretory pathway Sec39 (1);	0.000000	0.85682	D	0.000000	T	0.27169	0.0666	M	0.67953	2.075	0.80722	D	1	B;B	0.26081	0.141;0.01	B;B	0.34093	0.175;0.032	T	0.03306	-1.1050	10	0.87932	D	0	.	16.3109	0.82869	0.0:0.0:0.0:1.0	.	985;1105	A2RRP1-2;A2RRP1	.;NBAS_HUMAN	V	985;1105;152	ENSP00000413201:M985V;ENSP00000281513:M1105V;ENSP00000396501:M152V	ENSP00000281513:M1105V	M	-	1	0	NBAS	15440837	1.000000	0.71417	0.935000	0.37517	0.892000	0.51952	3.445000	0.52921	2.257000	0.74773	0.460000	0.39030	ATG		0.358	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		18	73	0	0	0	0.012319	0	18	73				
DNAJC27	51277	broad.mit.edu	37	2	25174272	25174272	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:25174272C>A	ENST00000264711.2	-	6	869	c.680G>T	c.(679-681)gGg>gTg	p.G227V	DNAJC27_ENST00000534855.1_Missense_Mutation_p.G156V	NM_001198559.1|NM_016544.2	NP_001185488.1|NP_057628.1	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27	227	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				small GTPase mediated signal transduction (GO:0007264)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						CCTTGAGGCCCCAGGTTTGAC	0.443																																							uc002rft.1		NA																	0				skin(1)	1						c.(679-681)GGG>GTG		DnaJ (Hsp40) homolog, subfamily C, member 27							178.0	168.0	171.0					2																	25174272		2203	4300	6503	SO:0001583	missense	51277				protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding	g.chr2:25174272C>A		CCDS1716.1, CCDS74493.1	2p23.3	2011-09-02	2008-08-20	2008-08-20	ENSG00000115137	ENSG00000115137		"""Heat shock proteins / DNAJ (HSP40)"""	30290	protein-coding gene	gene with protein product		613527	"""rab and DnaJ domain containing"""	RBJ		14980719	Standard	NM_016544		Approved	RabJS	uc002rft.2	Q9NZQ0	OTTHUMG00000125524	ENST00000264711.2:c.680G>T	2.37:g.25174272C>A	ENSP00000264711:p.Gly227Val					DNAJC27_uc010ykn.1_Missense_Mutation_p.G156V|DNAJC27_uc002rfu.1_RNA|DNAJC27_uc010eyg.1_Intron	p.G227V	NM_016544	NP_057628	Q9NZQ0	DJC27_HUMAN			6	731	-			227			J.		Q5JV88|Q86Y24	Missense_Mutation	SNP	ENST00000264711.2	37	c.680G>T	CCDS1716.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784485	0.90282	.	.	ENSG00000115137	ENST00000264711;ENST00000534855	T;T	0.32753	1.44;1.44	5.4	5.4	0.78164	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.49321	0.1550	M	0.64404	1.975	0.80722	D	1	D	0.61080	0.989	P	0.57152	0.814	T	0.48736	-0.9009	10	0.87932	D	0	-19.7278	17.9131	0.88940	0.0:1.0:0.0:0.0	.	227	Q9NZQ0	DJC27_HUMAN	V	227;156	ENSP00000264711:G227V;ENSP00000440086:G156V	ENSP00000264711:G227V	G	-	2	0	DNAJC27	25027776	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.459000	0.80802	2.805000	0.96524	0.655000	0.94253	GGG		0.443	DNAJC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246855.3	NM_016544		36	116	1	0	1.49673e-21	0.00623	2.54652e-21	36	116				
C2orf78	388960	broad.mit.edu	37	2	74040695	74040695	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:74040695C>A	ENST00000409561.1	+	2	310	c.189C>A	c.(187-189)agC>agA	p.S63R		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	63	Ser-rich.									cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						TAACAGGAAGCATCTCCAACT	0.507																																							uc002sjr.1		NA																	0				ovary(2)	2						c.(187-189)AGC>AGA		hypothetical protein LOC388960							57.0	56.0	56.0					2																	74040695		1945	4154	6099	SO:0001583	missense	388960							g.chr2:74040695C>A	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.189C>A	2.37:g.74040695C>A	ENSP00000387124:p.Ser63Arg						p.S63R	NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN			2	310	+			63			Ser-rich.			Missense_Mutation	SNP	ENST00000409561.1	37	c.189C>A	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	C	2.955	-0.215923	0.06101	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.33654	1.4	4.76	-4.54	0.03452	.	0.481828	0.14989	U	0.286762	T	0.20455	0.0492	L	0.45137	1.4	0.09310	N	0.999998	B	0.21753	0.06	B	0.21917	0.037	T	0.15983	-1.0418	10	0.28530	T	0.3	-0.0234	2.1953	0.03909	0.1376:0.3831:0.1411:0.3382	.	63	A6NCI8	CB078_HUMAN	R	63	ENSP00000387124:S63R	ENSP00000340692:S63R	S	+	3	2	C2orf78	73894203	0.000000	0.05858	0.047000	0.18901	0.044000	0.14063	-1.745000	0.01831	-0.912000	0.03837	-0.471000	0.05019	AGC		0.507	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474		8	49	1	0	1.12685e-05	0.004482	1.31466e-05	8	49				
ACTG2	72	broad.mit.edu	37	2	74129562	74129562	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:74129562C>G	ENST00000409624.1	+	4	845	c.202C>G	c.(202-204)Ctc>Gtc	p.L68V	ACTG2_ENST00000409918.1_Missense_Mutation_p.L68V|ACTG2_ENST00000409731.3_Intron|ACTG2_ENST00000345517.3_Missense_Mutation_p.L68V			P63267	ACTH_HUMAN	actin, gamma 2, smooth muscle, enteric	68					muscle contraction (GO:0006936)	blood microparticle (GO:0072562)|cell periphery (GO:0071944)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			large_intestine(3)|lung(14)|skin(1)	18						GATCCTAACTCTCAAATACCC	0.483																																							uc002sjw.2		NA																	0					0						c.(202-204)CTC>GTC		actin, gamma 2 propeptide							151.0	126.0	134.0					2																	74129562		2203	4300	6503	SO:0001583	missense	72				muscle contraction	cytoskeleton|cytosol	ATP binding	g.chr2:74129562C>G		CCDS1930.1, CCDS56124.1	2p13.1	2008-05-20			ENSG00000163017	ENSG00000163017			145	protein-coding gene	gene with protein product		102545		ACTL3, ACTA3		1710027, 1673027	Standard	NM_001199893		Approved	ACTSG	uc002sjw.3	P63267	OTTHUMG00000129813	ENST00000409624.1:c.202C>G	2.37:g.74129562C>G	ENSP00000386857:p.Leu68Val					ACTG2_uc010fex.1_Missense_Mutation_p.L68V|ACTG2_uc010fey.2_Missense_Mutation_p.L68V|ACTG2_uc010yrn.1_Intron	p.L68V	NM_001615	NP_001606	P63267	ACTH_HUMAN			3	324	+			68					B2R7E7|B4E315|D6W5H8|E9PG30|P12718|Q504R1|Q6FI22	Missense_Mutation	SNP	ENST00000409624.1	37	c.202C>G	CCDS1930.1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.193476	0.38707	.	.	ENSG00000163017	ENST00000345517;ENST00000409918;ENST00000442912;ENST00000409624	D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.28	3.84	3.84	0.44239	.	0.000000	0.64402	D	0.000006	D	0.94424	0.8206	L	0.61218	1.895	0.39533	D	0.968698	P;B	0.48998	0.918;0.001	P;B	0.54140	0.743;0.043	D	0.95613	0.8674	10	0.87932	D	0	.	15.0246	0.71659	0.0:1.0:0.0:0.0	.	68;68	B8ZZJ2;P63267	.;ACTH_HUMAN	V	68	ENSP00000295137:L68V;ENSP00000387182:L68V;ENSP00000410020:L68V;ENSP00000386857:L68V	ENSP00000295137:L68V	L	+	1	0	ACTG2	73983070	1.000000	0.71417	0.996000	0.52242	0.601000	0.36947	5.858000	0.69532	2.147000	0.66899	0.563000	0.77884	CTC		0.483	ACTG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328086.1	NM_001615		22	35	0	0	0	0.012319	0	22	35				
REG3A	5068	broad.mit.edu	37	2	79386484	79386484	+	Silent	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:79386484G>T	ENST00000409839.3	-	2	84	c.48C>A	c.(46-48)tcC>tcA	p.S16S	REG3A_ENST00000393878.1_Silent_p.S16S|AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000305165.2_Silent_p.S16S	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	16					acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)			breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						GCATGAGGCAGGAAAGCAGCA	0.532																																							uc002sod.1		NA																	0				skin(1)	1						c.(46-48)TCC>TCA		pancreatitis-associated protein precursor							192.0	138.0	157.0					2																	79386484		2203	4300	6503	SO:0001819	synonymous_variant	5068				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding	g.chr2:79386484G>T	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.48C>A	2.37:g.79386484G>T						REG3A_uc002soe.1_Silent_p.S16S|REG3A_uc002sof.1_Silent_p.S16S	p.S16S	NM_138938	NP_620355	Q06141	REG3A_HUMAN			1	303	-			16						Silent	SNP	ENST00000409839.3	37	c.48C>A	CCDS1965.1																																																																																				0.532	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580		11	49	1	0	7.03913e-09	0.001368	9.17333e-09	11	49				
CTNNA2	1496	broad.mit.edu	37	2	80101282	80101283	+	Missense_Mutation	DNP	GG	GG	TT	rs202210209		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:80101282_80101283GG>TT	ENST00000402739.4	+	5	671_672	c.666_667GG>TT	c.(664-669)acGGcc>acTTcc	p.A223S	CTNNA2_ENST00000540488.1_Missense_Mutation_p.A223S|CTNNA2_ENST00000496558.1_Missense_Mutation_p.A223S|CTNNA2_ENST00000361291.4_Missense_Mutation_p.A257S|CTNNA2_ENST00000541047.1_Missense_Mutation_p.A223S|CTNNA2_ENST00000466387.1_Missense_Mutation_p.A223S	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	223					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						TGCTGTACACGGCCTCTCAAGC	0.554																																							uc010ysh.1		NA																	0				pancreas(4)|lung(3)|breast(1)|skin(1)	9						c.(664-669)ACGGCC>ACTTCC		catenin, alpha 2 isoform 1																																				SO:0001583	missense	1496				axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton	g.chr2:80101282_80101283GG>TT		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	Exception_encountered	2.37:g.80101282_80101283delinsTT	ENSP00000384638:p.Ala223Ser					CTNNA2_uc010yse.1_Missense_Mutation_p.A223S|CTNNA2_uc010ysf.1_Missense_Mutation_p.A223S|CTNNA2_uc010ysg.1_Missense_Mutation_p.A223S	p.A223S	NM_004389	NP_004380	P26232	CTNA2_HUMAN			5	671_672	+			223					B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	DNP	ENST00000402739.4	37	c.666_667GG>TT																																																																																					0.554	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389		10	43	0	0	0	0.004672	0	10	43				
SLC9A4	389015	broad.mit.edu	37	2	103141571	103141571	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:103141571G>A	ENST00000295269.4	+	10	2364	c.1907G>A	c.(1906-1908)aGg>aAg	p.R636K		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	636					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						AACACCTTAAGGGAGAGCATG	0.517																																							uc002tbz.3		NA																	0				skin(2)|central_nervous_system(1)	3						c.(1906-1908)AGG>AAG		solute carrier family 9 (sodium/hydrogen							149.0	152.0	151.0					2																	103141571		2203	4300	6503	SO:0001583	missense	389015				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity	g.chr2:103141571G>A		CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.1907G>A	2.37:g.103141571G>A	ENSP00000295269:p.Arg636Lys						p.R636K	NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN			10	2364	+			636			Cytoplasmic (Potential).		Q69YK0	Missense_Mutation	SNP	ENST00000295269.4	37	c.1907G>A	CCDS33264.1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420346	0.42918	.	.	ENSG00000180251	ENST00000295269	T	0.48522	0.81	5.84	5.84	0.93424	.	0.114793	0.64402	D	0.000005	T	0.53498	0.1800	M	0.79926	2.475	0.33946	D	0.643804	B	0.02656	0.0	B	0.06405	0.002	T	0.59247	-0.7490	10	0.27082	T	0.32	.	18.9173	0.92510	0.0:0.0:1.0:0.0	.	636	Q6AI14	SL9A4_HUMAN	K	636	ENSP00000295269:R636K	ENSP00000295269:R636K	R	+	2	0	SLC9A4	102508003	1.000000	0.71417	0.283000	0.24790	0.091000	0.18340	4.378000	0.59568	2.765000	0.95021	0.643000	0.83706	AGG		0.517	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329498.1	NM_001011552.3		43	127	0	0	0	0.00874	0	43	127				
SULT1C3	442038	broad.mit.edu	37	2	108863677	108863677	+	Silent	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:108863677C>A	ENST00000329106.2	+	1	27	c.27C>A	c.(25-27)ccC>ccA	p.P9P	SULT1C3_ENST00000376700.1_Silent_p.P9P	NM_001008743.1	NP_001008743.1	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member 3	9					sulfur compound metabolic process (GO:0006790)	cytoplasm (GO:0005737)	alcohol sulfotransferase activity (GO:0004027)|aryl sulfotransferase activity (GO:0004062)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(4)	16						AAAACGCTCCCACGATGGAAA	0.353																																							uc010ywo.1		NA																	0				skin(1)	1						c.(25-27)CCC>CCA		sulfotransferase family, cytosolic, 1C, member							80.0	86.0	84.0					2																	108863677		2203	4300	6503	SO:0001819	synonymous_variant	442038					cytoplasm	alcohol sulfotransferase activity	g.chr2:108863677C>A	BC146362	CCDS33267.1	2q12.3	2007-07-26			ENSG00000196228	ENSG00000196228		"""Sulfotransferases, cytosolic"""	33543	protein-coding gene	gene with protein product						14676822, 17425406	Standard	NM_001008743		Approved		uc010ywo.2	Q6IMI6	OTTHUMG00000153227	ENST00000329106.2:c.27C>A	2.37:g.108863677C>A							p.P9P	NM_001008743	NP_001008743	Q6IMI6	ST1C3_HUMAN			1	27	+			9					Q6IMI5	Silent	SNP	ENST00000329106.2	37	c.27C>A	CCDS33267.1																																																																																				0.353	SULT1C3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330255.1	NM_001008743		24	52	1	0	1.2476e-16	0.00632	1.95937e-16	24	52				
FBLN7	129804	broad.mit.edu	37	2	112944812	112944812	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:112944812C>T	ENST00000331203.2	+	8	1320	c.1049C>T	c.(1048-1050)aCg>aTg	p.T350M	FBLN7_ENST00000409667.3_Missense_Mutation_p.T216M|FBLN7_ENST00000409450.3_Missense_Mutation_p.T304M|FBLN7_ENST00000409903.1_Intron	NM_001128165.1|NM_153214.2	NP_001121637.1|NP_694946.2	Q53RD9	FBLN7_HUMAN	fibulin 7	350					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						AACCTGAAGACGCCCATCACG	0.657																																							uc002tho.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1048-1050)ACG>ATG		fibulin 7 isoform 1							92.0	93.0	93.0					2																	112944812		2203	4300	6503	SO:0001583	missense	129804				cell adhesion	proteinaceous extracellular matrix	calcium ion binding|heparin binding	g.chr2:112944812C>T		CCDS2095.1, CCDS46391.1	2q13	2010-06-15			ENSG00000144152	ENSG00000144152		"""Fibulins"""	26740	protein-coding gene	gene with protein product		611551				17699513	Standard	NM_153214		Approved	FLJ37440, TM14	uc002tho.1	Q53RD9	OTTHUMG00000153267	ENST00000331203.2:c.1049C>T	2.37:g.112944812C>T	ENSP00000331411:p.Thr350Met					FBLN7_uc002thn.2_Intron|FBLN7_uc010fki.1_Missense_Mutation_p.T304M|FBLN7_uc010fkj.1_Missense_Mutation_p.T216M	p.T350M	NM_153214	NP_694946	Q53RD9	FBLN7_HUMAN			8	1320	+			350					A0JNV1|A0JNV2|Q5H9P5|Q8N9G0	Missense_Mutation	SNP	ENST00000331203.2	37	c.1049C>T	CCDS2095.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.092575	0.76756	.	.	ENSG00000144152	ENST00000331203;ENST00000409667;ENST00000409450;ENST00000441565;ENST00000272559	T;T;T;D;T	0.82619	0.94;0.94;0.94;-1.63;0.94	5.32	4.43	0.53597	.	0.100349	0.64402	D	0.000002	D	0.88400	0.6426	L	0.54323	1.7	0.49213	D	0.999768	P;D;D	0.89917	0.809;1.0;1.0	P;D;D	0.91635	0.51;0.999;0.988	D	0.88832	0.3306	10	0.59425	D	0.04	-6.9877	14.3459	0.66662	0.0:0.9269:0.0:0.0731	.	216;304;350	Q53RD9-4;Q53RD9-2;Q53RD9	.;.;FBLN7_HUMAN	M	350;216;304;244;172	ENSP00000331411:T350M;ENSP00000386822:T216M;ENSP00000387000:T304M;ENSP00000388025:T244M;ENSP00000272559:T172M	ENSP00000272559:T172M	T	+	2	0	FBLN7	112661283	0.998000	0.40836	0.952000	0.39060	0.979000	0.70002	3.712000	0.54875	2.485000	0.83878	0.555000	0.69702	ACG		0.657	FBLN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330505.1	NM_153214		8	162	0	0	0	0.006214	0	8	162				
CNTNAP5	129684	broad.mit.edu	37	2	125285017	125285017	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:125285017T>C	ENST00000431078.1	+	10	1994	c.1630T>C	c.(1630-1632)Tgt>Cgt	p.C544R		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	544	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CATTGATCTGTGTAGCATCAA	0.408																																							uc002tno.2		NA																	0				ovary(10)	10						c.(1630-1632)TGT>CGT		contactin associated protein-like 5 precursor							136.0	132.0	134.0					2																	125285017		1887	4102	5989	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125285017T>C	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1630T>C	2.37:g.125285017T>C	ENSP00000399013:p.Cys544Arg					CNTNAP5_uc010flu.2_Missense_Mutation_p.C545R	p.C544R	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	10	1994	+			544			Laminin G-like 2.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.1630T>C	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.418687	0.62622	.	.	ENSG00000155052	ENST00000431078	D	0.92199	-2.99	5.58	5.58	0.84498	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.48767	D	0.000163	D	0.96355	0.8811	M	0.87971	2.92	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.96614	0.9454	10	0.54805	T	0.06	.	14.9297	0.70906	0.0:0.0:0.0:1.0	.	544	Q8WYK1	CNTP5_HUMAN	R	544	ENSP00000399013:C544R	ENSP00000399013:C544R	C	+	1	0	CNTNAP5	125001487	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.437000	0.80417	2.124000	0.65301	0.528000	0.53228	TGT		0.408	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			32	86	0	0	0	0.009535	0	32	86				
LRP1B	53353	broad.mit.edu	37	2	141081510	141081510	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:141081510C>G	ENST00000389484.3	-	81	13437	c.12466G>C	c.(12466-12468)Gat>Cat	p.D4156H		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4156					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTTGTTTTATCAATATTTAAA	0.269										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(12466-12468)GAT>CAT		low density lipoprotein-related protein 1B							59.0	67.0	64.0					2																	141081510		2202	4288	6490	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141081510C>G	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12466G>C	2.37:g.141081510C>G	ENSP00000374135:p.Asp4156His	TSP Lung(27;0.18)					p.D4156H	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	81	13438	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4156			Extracellular (Potential).		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.12466G>C	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.05|17.05	3.290534|3.290534	0.59976|0.59976	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977	D|.	0.91464|.	-2.85|.	5.37|5.37	5.37|5.37	0.77165|0.77165	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);|.	0.145769|.	0.44902|.	D|.	0.000420|.	T|T	0.44644|0.44644	0.1303|0.1303	N|N	0.04508|0.04508	-0.205|-0.205	0.44762|0.44762	D|D	0.997762|0.997762	P|.	0.46395|.	0.877|.	B|.	0.41723|.	0.365|.	T|T	0.41179|0.41179	-0.9523|-0.9523	10|5	0.11794|.	T|.	0.64|.	.|.	19.4646|19.4646	0.94932|0.94932	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	4156|.	Q9NZR2|.	LRP1B_HUMAN|.	H|F	4156;4094|387	ENSP00000374135:D4156H|.	ENSP00000374135:D4156H|.	D|L	-|-	1|3	0|2	LRP1B|LRP1B	140797980|140797980	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	3.730000|3.730000	0.55006|0.55006	2.679000|2.679000	0.91253|0.91253	0.655000|0.655000	0.94253|0.94253	GAT|TTG		0.269	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		16	64	0	0	0	0.004007	0	16	64				
LRP1B	53353	broad.mit.edu	37	2	141253245	141253245	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:141253245C>A	ENST00000389484.3	-	56	9894	c.8923G>T	c.(8923-8925)Ggc>Tgc	p.G2975C		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2975	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAGGGAAAGCCTGAAGAGCAT	0.433										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(8923-8925)GGC>TGC		low density lipoprotein-related protein 1B							163.0	146.0	152.0					2																	141253245		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141253245C>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8923G>T	2.37:g.141253245C>A	ENSP00000374135:p.Gly2975Cys	TSP Lung(27;0.18)					p.G2975C	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	56	9895	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	2975			Extracellular (Potential).|EGF-like 7.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.8923G>T	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051076	0.75960	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91351	-2.83	5.73	5.73	0.89815	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.228496	0.36893	N	0.002349	D	0.92404	0.7589	M	0.81614	2.55	0.38911	D	0.957544	P	0.48694	0.914	P	0.44990	0.466	D	0.92340	0.5881	10	0.37606	T	0.19	.	19.907	0.97012	0.0:1.0:0.0:0.0	.	2975	Q9NZR2	LRP1B_HUMAN	C	2975;2913	ENSP00000374135:G2975C	ENSP00000374135:G2975C	G	-	1	0	LRP1B	140969715	0.918000	0.31147	0.107000	0.21349	0.983000	0.72400	4.850000	0.62889	2.718000	0.92993	0.585000	0.79938	GGC		0.433	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		14	49	1	0	1.49906e-05	0.00245	1.74061e-05	14	49				
LRP1B	53353	broad.mit.edu	37	2	141625201	141625201	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:141625201G>T	ENST00000389484.3	-	27	5508	c.4537C>A	c.(4537-4539)Cca>Aca	p.P1513T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1513					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGGTCAAATGGCTGTGCACTG	0.448										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(4537-4539)CCA>ACA		low density lipoprotein-related protein 1B							198.0	173.0	182.0					2																	141625201		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141625201G>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4537C>A	2.37:g.141625201G>T	ENSP00000374135:p.Pro1513Thr	TSP Lung(27;0.18)				LRP1B_uc010fnl.1_Missense_Mutation_p.P695T	p.P1513T	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	27	5509	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1513			Extracellular (Potential).|LDL-receptor class B 13.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.4537C>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	18.99	3.740428	0.69304	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.92911	-3.13;-3.13	5.42	5.42	0.78866	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.97448	0.9165	H	0.95294	3.65	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.85130	0.974;0.997	D	0.97837	1.0266	10	0.52906	T	0.07	.	19.2069	0.93734	0.0:0.0:1.0:0.0	.	696;1513	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	T	1513;1451;658	ENSP00000374135:P1513T;ENSP00000413239:P658T	ENSP00000374135:P1513T	P	-	1	0	LRP1B	141341671	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.800000	0.99124	2.547000	0.85894	0.655000	0.94253	CCA		0.448	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		25	86	1	0	4.26978e-12	0.00333	6.04679e-12	25	86				
ORC4	5000	broad.mit.edu	37	2	148733486	148733486	+	Silent	SNP	T	T	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:148733486T>A	ENST00000392857.5	-	2	149	c.42A>T	c.(40-42)acA>acT	p.T14T	ORC4_ENST00000536575.1_Intron|ORC4_ENST00000392858.1_Silent_p.T14T|ORC4_ENST00000540442.1_Intron|ORC4_ENST00000542387.1_5'UTR|ORC4_ENST00000535373.1_Silent_p.T14T|ORC4_ENST00000264169.2_Silent_p.T14T	NM_001190879.2|NM_001190882.2|NM_002552.4|NM_181741.3	NP_001177808.1|NP_001177811.1|NP_002543.2|NP_859525.1	O43929	ORC4_HUMAN	origin recognition complex, subunit 4	14					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	14						AAAGGCACTCTGTGTGAATTA	0.299																																							uc002twi.2		NA																	0					0						c.(40-42)ACA>ACT		origin recognition complex subunit 4							101.0	103.0	102.0					2																	148733486		2202	4299	6501	SO:0001819	synonymous_variant	5000				cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|nucleoside-triphosphatase activity|protein binding	g.chr2:148733486T>A	AF022108	CCDS2187.1, CCDS54404.1, CCDS54405.1	2q22-q23	2010-10-12	2010-10-12	2010-10-12	ENSG00000115947	ENSG00000115947		"""ATPases / AAA-type"""	8490	protein-coding gene	gene with protein product		603056	"""origin recognition complex, subunit 4 (yeast homolog)-like"", ""origin recognition complex, subunit 4-like (yeast)"", ""origin recognition complex, subunit 4-like (S. cerevisiae)"", ""origin recognition complex, subunit 4 homolog (S. cerevisiae)"""	ORC4L		9353276, 9691185	Standard	NM_181742		Approved	HsORC4, Orc4p	uc002twk.3	O43929	OTTHUMG00000131849	ENST00000392857.5:c.42A>T	2.37:g.148733486T>A						ORC4L_uc002twj.2_Silent_p.T14T|ORC4L_uc010zbo.1_Intron|ORC4L_uc010zbp.1_5'UTR|ORC4L_uc010fnr.2_Silent_p.T14T|ORC4L_uc010zbq.1_Intron|ORC4L_uc002twk.2_Silent_p.T14T|ORC4L_uc010zbr.1_Silent_p.T14T	p.T14T	NM_181741	NP_859525	O43929	ORC4_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0963)|COAD - Colon adenocarcinoma(177;0.203)	2	177	-			14					B7Z3D0|B7Z5F1|D3DP86|F5H069|Q96C42	Silent	SNP	ENST00000392857.5	37	c.42A>T	CCDS2187.1																																																																																				0.299	ORC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254797.3	NM_181742		7	53	0	0	0	0.00308	0	7	53				
MARCH7	64844	broad.mit.edu	37	2	160604822	160604822	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:160604822G>T	ENST00000259050.4	+	5	1143	c.1021G>T	c.(1021-1023)Gca>Tca	p.A341S	MARCH7_ENST00000539065.1_Missense_Mutation_p.A285S|MARCH7_ENST00000409175.1_Missense_Mutation_p.A341S|MARCH7_ENST00000409591.1_Missense_Mutation_p.A303S	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	341	Ser-rich.				protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						CGATAATAGGGCATCTGAAGC	0.398																																							uc002uax.2		NA																	0					0						c.(1021-1023)GCA>TCA		axotrophin							53.0	58.0	56.0					2																	160604822		2203	4300	6503	SO:0001583	missense	64844						ligase activity|zinc ion binding	g.chr2:160604822G>T	AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.1021G>T	2.37:g.160604822G>T	ENSP00000259050:p.Ala341Ser					MARCH7_uc010foq.2_Missense_Mutation_p.A341S|MARCH7_uc010zcn.1_Missense_Mutation_p.A285S|MARCH7_uc010for.2_Missense_Mutation_p.A303S|MARCH7_uc002uay.2_RNA	p.A341S	NM_022826	NP_073737	Q9H992	MARH7_HUMAN			5	1143	+			341			Ser-rich.		A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	ENST00000259050.4	37	c.1021G>T	CCDS2210.1	.	.	.	.	.	.	.	.	.	.	G	7.295	0.611844	0.14066	.	.	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000409591	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	5.79	-0.262	0.12958	.	0.512237	0.19385	N	0.115556	T	0.15435	0.0372	N	0.24115	0.695	0.22446	N	0.999098	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.0	T	0.30179	-0.9987	10	0.02654	T	1	-0.001	4.5433	0.12069	0.2747:0.0:0.2848:0.4404	.	285;303;341	F5H6W4;B7Z7P5;Q9H992	.;.;MARH7_HUMAN	S	341;285;341;303	ENSP00000386830:A341S;ENSP00000442992:A285S;ENSP00000259050:A341S;ENSP00000387238:A303S	ENSP00000259050:A341S	A	+	1	0	MARCH7	160313068	0.141000	0.22595	0.974000	0.42286	0.930000	0.56654	-0.426000	0.07008	0.018000	0.15052	-0.140000	0.14226	GCA		0.398	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255040.3	NM_022826		12	51	1	0	4.3838e-07	0.001855	5.31083e-07	12	51				
FAM171B	165215	broad.mit.edu	37	2	187626990	187626990	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:187626990G>C	ENST00000304698.5	+	8	2124	c.1921G>C	c.(1921-1923)Gtt>Ctt	p.V641L		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	641						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						AAATGAGGCTGTTGTAATGAC	0.507																																							uc002ups.2		NA																	0				ovary(6)|breast(3)|central_nervous_system(1)	10						c.(1921-1923)GTT>CTT		KIAA1946							106.0	115.0	112.0					2																	187626990		2203	4300	6503	SO:0001583	missense	165215					integral to membrane	DNA binding	g.chr2:187626990G>C	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.1921G>C	2.37:g.187626990G>C	ENSP00000304108:p.Val641Leu					FAM171B_uc002upr.1_Missense_Mutation_p.V608L|FAM171B_uc002upt.2_Missense_Mutation_p.V110L	p.V641L	NM_177454	NP_803237	Q6P995	F171B_HUMAN			8	2033	+			641			Cytoplasmic (Potential).		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	37	c.1921G>C	CCDS33347.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.819454	0.71028	.	.	ENSG00000144369	ENST00000304698	T	0.31769	1.48	6.03	6.03	0.97812	.	0.058284	0.64402	D	0.000002	T	0.45256	0.1333	L	0.40543	1.245	0.46356	D	0.999006	D;D	0.56746	0.977;0.977	P;P	0.56474	0.799;0.799	T	0.21381	-1.0247	10	0.66056	D	0.02	-18.8002	20.5666	0.99351	0.0:0.0:1.0:0.0	.	641;642	Q6P995;A8K122	F171B_HUMAN;.	L	641	ENSP00000304108:V641L	ENSP00000304108:V641L	V	+	1	0	FAM171B	187335235	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.456000	0.80751	2.854000	0.98071	0.655000	0.94253	GTT		0.507	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454		32	122	0	0	0	0.003755	0	32	122				
RFTN2	130132	broad.mit.edu	37	2	198498578	198498578	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:198498578A>T	ENST00000295049.4	-	4	1118	c.582T>A	c.(580-582)tgT>tgA	p.C194*		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	194					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						TCCAACTTCTACAGTTTTCAT	0.398																																							uc002uuo.3		NA																	0					0						c.(580-582)TGT>TGA		raftlin family member 2							236.0	212.0	220.0					2																	198498578		2203	4300	6503	SO:0001587	stop_gained	130132					plasma membrane		g.chr2:198498578A>T	AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.582T>A	2.37:g.198498578A>T	ENSP00000295049:p.Cys194*						p.C194*	NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN			4	984	-			194					Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Nonsense_Mutation	SNP	ENST00000295049.4	37	c.582T>A	CCDS2323.1	.	.	.	.	.	.	.	.	.	.	A	38	7.184206	0.98121	.	.	ENSG00000162944	ENST00000295049	.	.	.	5.27	-5.89	0.02282	.	0.877101	0.09413	N	0.805536	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.2903	8.9402	0.35725	0.3954:0.1887:0.4159:0.0	.	.	.	.	X	194	.	ENSP00000295049:C194X	C	-	3	2	RFTN2	198206823	0.001000	0.12720	0.000000	0.03702	0.534000	0.34807	0.059000	0.14322	-1.494000	0.01833	-2.096000	0.00365	TGT		0.398	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256106.2	NM_144629		38	111	0	0	0	0.007835	0	38	111				
SATB2	23314	broad.mit.edu	37	2	200213481	200213481	+	Silent	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:200213481C>T	ENST00000417098.1	-	7	1932	c.1116G>A	c.(1114-1116)ctG>ctA	p.L372L	SATB2_ENST00000457245.1_Silent_p.L372L|SATB2_ENST00000428695.1_Silent_p.L254L|SATB2_ENST00000443023.1_Silent_p.L313L|SATB2_ENST00000260926.5_Silent_p.L372L	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	372					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TGGCCCTCTTCAGCTCATCTC	0.488																																					Colon(30;262 767 11040 24421 36230)	Colon(30;262 767 11040 24421 36230)	uc002uuy.1		NA																	0				ovary(1)	1						c.(1114-1116)CTG>CTA		SATB homeobox 2							159.0	153.0	155.0					2																	200213481		2203	4300	6503	SO:0001819	synonymous_variant	23314					cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity	g.chr2:200213481C>T	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1116G>A	2.37:g.200213481C>T						SATB2_uc010fsq.1_Silent_p.L254L|SATB2_uc002uuz.1_Silent_p.L372L|SATB2_uc002uva.1_Silent_p.L372L|SATB2_uc002uvb.1_Silent_p.L115L	p.L372L	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN			7	1933	-			372			CUT 1.		A8K5Z8|Q3ZB87|Q4V763	Silent	SNP	ENST00000417098.1	37	c.1116G>A	CCDS2327.1																																																																																				0.488	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265		23	123	0	0	0	0.003954	0	23	123				
NDUFS1	4719	broad.mit.edu	37	2	207012264	207012264	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:207012264C>G	ENST00000233190.6	-	7	808	c.542G>C	c.(541-543)cGc>cCc	p.R181P	NDUFS1_ENST00000432169.1_Missense_Mutation_p.R70P|NDUFS1_ENST00000440274.1_Missense_Mutation_p.R145P|NDUFS1_ENST00000449699.1_Missense_Mutation_p.R181P|NDUFS1_ENST00000423725.1_Missense_Mutation_p.R124P|NDUFS1_ENST00000455934.2_Missense_Mutation_p.R195P|NDUFS1_ENST00000457011.1_Missense_Mutation_p.R65P	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	181					apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCTGATGCAGCGAGTACACTG	0.348																																							uc002vbe.2		NA																	0				ovary(1)	1						c.(541-543)CGC>CCC		NADH dehydrogenase (ubiquinone) Fe-S protein 1,	NADH(DB00157)						148.0	130.0	136.0					2																	207012264		2203	4300	6503	SO:0001583	missense	4719				apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding	g.chr2:207012264C>G		CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.542G>C	2.37:g.207012264C>G	ENSP00000233190:p.Arg181Pro					NDUFS1_uc010ziq.1_Missense_Mutation_p.R195P|NDUFS1_uc010zir.1_Missense_Mutation_p.R145P|NDUFS1_uc010zis.1_Missense_Mutation_p.R124P|NDUFS1_uc010zit.1_Missense_Mutation_p.R70P|NDUFS1_uc010ziu.1_Missense_Mutation_p.R65P	p.R181P	NM_005006	NP_004997	P28331	NDUS1_HUMAN			7	669	-			181					B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Missense_Mutation	SNP	ENST00000233190.6	37	c.542G>C	CCDS2366.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349055	0.82132	.	.	ENSG00000023228	ENST00000233190;ENST00000423725;ENST00000457011;ENST00000440274;ENST00000455934;ENST00000449699;ENST00000432169	D;D;D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62	5.06	4.18	0.49190	NADH:ubiquinone oxidoreductase, 75kDa subunit, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.94994	0.8380	H	0.99368	4.535	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96480	0.9355	10	0.87932	D	0	-14.0775	13.6244	0.62155	0.0:0.9245:0.0:0.0755	.	70;145;195;181	B4DPG1;E7ENF3;B4DJA0;P28331	.;.;.;NDUS1_HUMAN	P	181;124;65;145;195;181;70	ENSP00000233190:R181P;ENSP00000397760:R124P;ENSP00000400976:R65P;ENSP00000409766:R145P;ENSP00000392709:R195P;ENSP00000399912:R181P;ENSP00000409689:R70P	ENSP00000233190:R181P	R	-	2	0	NDUFS1	206720509	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.776000	0.85560	1.263000	0.44181	0.591000	0.81541	CGC		0.348	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256391.4	NM_005006		9	21	0	0	0	0.004482	0	9	21				
DOCK10	55619	broad.mit.edu	37	2	225658144	225658144	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:225658144G>A	ENST00000258390.7	-	46	5252	c.5185C>T	c.(5185-5187)Ctc>Ttc	p.L1729F	DOCK10_ENST00000409592.3_Missense_Mutation_p.L1723F	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1729	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TCTGCAATGAGAGCAGCAATA	0.383																																							uc010fwz.1		NA																	0				ovary(2)	2						c.(5185-5187)CTC>TTC		dedicator of cytokinesis 10							102.0	96.0	98.0					2																	225658144		1846	4105	5951	SO:0001583	missense	55619						GTP binding	g.chr2:225658144G>A	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.5185C>T	2.37:g.225658144G>A	ENSP00000258390:p.Leu1729Phe					DOCK10_uc002vob.2_Missense_Mutation_p.L1723F|DOCK10_uc002voa.2_Missense_Mutation_p.L385F|DOCK10_uc002voc.2_Missense_Mutation_p.L583F	p.L1729F	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)	46	5424	-		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)	1729			DHR-2.		B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	c.5185C>T	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470630	0.84533	.	.	ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702	T;T	0.39406	3.52;1.08	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	T	0.70263	0.3204	M	0.90198	3.095	0.50632	D	0.999888	D;D;D;D	0.89917	0.987;1.0;1.0;1.0	D;D;D;D	0.85130	0.955;0.997;0.995;0.994	T	0.75536	-0.3283	10	0.87932	D	0	.	13.6832	0.62499	0.0701:0.0:0.9299:0.0	.	1729;583;1723;391	Q96BY6;B4DF07;B3FL70;B4DEY4	DOC10_HUMAN;.;.;.	F	1723;1729;267	ENSP00000386694:L1723F;ENSP00000258390:L1729F	ENSP00000258390:L1729F	L	-	1	0	DOCK10	225366388	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.690000	0.84178	2.861000	0.98227	0.650000	0.86243	CTC		0.383	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1			6	62	0	0	0	0.001984	0	6	62				
DOCK10	55619	broad.mit.edu	37	2	225659622	225659622	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr2:225659622G>A	ENST00000258390.7	-	45	5195	c.5128C>T	c.(5128-5130)Cat>Tat	p.H1710Y	DOCK10_ENST00000409592.3_Missense_Mutation_p.H1704Y	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1710	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TTTCTGGCATGAATCTTGGCC	0.473																																							uc010fwz.1		NA																	0				ovary(2)	2						c.(5128-5130)CAT>TAT		dedicator of cytokinesis 10							124.0	128.0	127.0					2																	225659622		2003	4178	6181	SO:0001583	missense	55619						GTP binding	g.chr2:225659622G>A	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.5128C>T	2.37:g.225659622G>A	ENSP00000258390:p.His1710Tyr					DOCK10_uc002vob.2_Missense_Mutation_p.H1704Y|DOCK10_uc002voa.2_Missense_Mutation_p.H366Y|DOCK10_uc002voc.2_Missense_Mutation_p.H564Y	p.H1710Y	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)	45	5367	-		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)	1710			DHR-2.		B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	c.5128C>T	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	G	19.41	3.822616	0.71028	.	.	ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702	T;T	0.64991	3.62;-0.13	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.82426	0.5034	M	0.86097	2.795	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.999;0.973;0.984	D;D;D;P	0.79784	0.993;0.99;0.929;0.831	D	0.84581	0.0661	10	0.87932	D	0	.	19.7791	0.96410	0.0:0.0:1.0:0.0	.	1710;564;1704;372	Q96BY6;B4DF07;B3FL70;B4DEY4	DOC10_HUMAN;.;.;.	Y	1704;1710;248	ENSP00000386694:H1704Y;ENSP00000258390:H1710Y	ENSP00000258390:H1710Y	H	-	1	0	DOCK10	225367866	1.000000	0.71417	0.994000	0.49952	0.303000	0.27691	9.476000	0.97823	2.683000	0.91414	0.557000	0.71058	CAT		0.473	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1			15	112	0	0	0	0.003163	0	15	112				
PYGB	5834	broad.mit.edu	37	20	25257281	25257281	+	Splice_Site	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr20:25257281G>A	ENST00000216962.4	+	6	770		c.e6-1			NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						TTTGTGGCCAGGTGGTGCTGG	0.682																																							uc002wup.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.e6-1		brain glycogen phosphorylase	Pyridoxal Phosphate(DB00114)						80.0	63.0	69.0					20																	25257281		2203	4300	6503	SO:0001630	splice_region_variant	5834				glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding	g.chr20:25257281G>A		CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.661-1G>A	20.37:g.25257281G>A							p.V221_splice	NM_002862	NP_002853	P11216	PYGB_HUMAN			6	770	+								Q96AK1|Q9NPX8	Splice_Site	SNP	ENST00000216962.4	37	c.661_splice	CCDS13171.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.756756	0.69648	.	.	ENSG00000100994	ENST00000216962	.	.	.	3.7	2.75	0.32379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9258	0.47189	0.0945:0.0:0.9054:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PYGB	25205281	1.000000	0.71417	0.992000	0.48379	0.931000	0.56810	9.488000	0.97947	0.911000	0.36747	0.557000	0.71058	.		0.682	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078415.2	NM_002862	Intron	7	29	0	0	0	0.001984	0	7	29				
CTSA	5476	broad.mit.edu	37	20	44522627	44522627	+	Splice_Site	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr20:44522627G>A	ENST00000372459.2	+	7	886	c.693G>A	c.(691-693)agG>agA	p.R231R	RP3-337O18.9_ENST00000607703.1_RNA|NEURL2_ENST00000372518.4_5'Flank|CTSA_ENST00000354880.5_Splice_Site_p.R232R|CTSA_ENST00000191018.5_Splice_Site_p.R231R|CTSA_ENST00000372484.3_Splice_Site_p.R249R			P10619	PPGB_HUMAN	cathepsin A	231					glycosphingolipid metabolic process (GO:0006687)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|enzyme activator activity (GO:0008047)|serine-type carboxypeptidase activity (GO:0004185)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				TCTCCTACAGGCTTTGGTCTT	0.537																																							uc002xqj.3		NA																	0				ovary(1)	1						c.(691-693)AGG>AGA		cathepsin A isoform b precursor							138.0	118.0	125.0					20																	44522627		2203	4300	6503	SO:0001630	splice_region_variant	5476				intracellular protein transport|proteolysis	endoplasmic reticulum|lysosome|nucleus	enzyme activator activity|protein binding|serine-type carboxypeptidase activity	g.chr20:44522627G>A	M22960	CCDS13385.2, CCDS46609.1, CCDS54467.1	20q13.12	2012-02-10	2006-12-05	2006-12-05	ENSG00000064601	ENSG00000064601	3.4.16.5	"""Cathepsins"""	9251	protein-coding gene	gene with protein product	"""carboxypeptidase C"", ""lysosomal protective protein"", ""carboxypeptidase-L"", ""carboxypeptidase Y-like kininase"", ""deamidase"", ""lysosomal carboxypeptidase A"", ""urinary kininase"""	613111	"""protective protein for beta-galactosidase (galactosialidosis)"""	GSL, PPGB		2071143	Standard	NM_000308		Approved		uc002xqh.3	P10619	OTTHUMG00000033078	ENST00000372459.2:c.693-1G>A	20.37:g.44522627G>A						NEURL2_uc002xqg.1_5'Flank|CTSA_uc002xqh.2_Silent_p.R249R|CTSA_uc002xqi.2_RNA|CTSA_uc010zxi.1_Silent_p.R232R|CTSA_uc002xqk.3_Silent_p.R231R	p.R231R	NM_001127695	NP_001121167	P10619	PPGB_HUMAN			8	1167	+		Myeloproliferative disorder(115;0.0122)	231					B2R798|Q561W6|Q5JZH1|Q96KJ2|Q9BR08|Q9BW68	Silent	SNP	ENST00000372459.2	37	c.693G>A	CCDS46609.1																																																																																				0.537	CTSA-012	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471297.2	NM_000308	Silent	19	76	0	0	0	0.007413	0	19	76				
BHLHE23	128408	broad.mit.edu	37	20	61637730	61637730	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr20:61637730T>A	ENST00000370346.2	-	1	657	c.349A>T	c.(349-351)Aac>Tac	p.N117Y		NM_080606.3	NP_542173	Q8NDY6	BHE23_HUMAN	basic helix-loop-helix family, member e23	117	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)	1						AGCGCGTCGTTTAGGTCGTGC	0.721																																							uc002yeb.2		NA																	0					0						c.(349-351)AAC>TAC		basic helix-loop-helix domain containing, class							15.0	14.0	14.0					20																	61637730		2194	4290	6484	SO:0001583	missense	128408				transcription, DNA-dependent	nucleus	DNA binding	g.chr20:61637730T>A	AL121673	CCDS33507.1, CCDS33507.2	20q13.33	2009-01-12	2009-01-12	2009-01-12	ENSG00000125533	ENSG00000125533		"""Basic helix-loop-helix proteins"""	16093	protein-coding gene	gene with protein product		609331	"""basic helix-loop-helix domain containing, class B, 4"""	BHLHB4		11863370, 18557763	Standard	NM_080606		Approved	bA305P22.3, Beta4, bHLHe23	uc002yeb.2	Q8NDY6	OTTHUMG00000032948	ENST00000370346.2:c.349A>T	20.37:g.61637730T>A	ENSP00000359371:p.Asn117Tyr						p.N117Y	NM_080606	NP_542173	Q8NDY6	BHE23_HUMAN			1	658	-			117			Helix-loop-helix motif.		B2RP69	Missense_Mutation	SNP	ENST00000370346.2	37	c.349A>T	CCDS33507.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.505352	0.85282	.	.	ENSG00000125533	ENST00000370346	D	0.99409	-5.85	3.2	3.2	0.36748	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	U	0.000000	D	0.99667	0.9876	H	0.98089	4.145	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97948	1.0330	10	0.87932	D	0	-16.1776	10.6468	0.45626	0.0:0.0:0.0:1.0	.	117	Q8NDY6	BHE23_HUMAN	Y	117	ENSP00000359371:N117Y	ENSP00000359371:N117Y	N	-	1	0	BHLHE23	61108175	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.391000	0.79828	1.077000	0.40990	0.402000	0.26972	AAC		0.721	BHLHE23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080095.2	NM_080606		7	19	0	0	0	0.00308	0	7	19				
NRIP1	8204	broad.mit.edu	37	21	16338524	16338524	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr21:16338524C>A	ENST00000400202.1	-	3	2702	c.1990G>T	c.(1990-1992)Ggt>Tgt	p.G664C	NRIP1_ENST00000400199.1_Missense_Mutation_p.G664C|NRIP1_ENST00000318948.4_Missense_Mutation_p.G664C|AF127577.10_ENST00000446301.1_RNA			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	664	Repression domain 2.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TCAATCATACCTATCGGTTTA	0.388																																							uc002yjx.2		NA																	0					0						c.(1990-1992)GGT>TGT		nuclear receptor interacting protein 1							122.0	124.0	124.0					21																	16338524		2203	4299	6502	SO:0001583	missense	8204				androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity	g.chr21:16338524C>A	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.1990G>T	21.37:g.16338524C>A	ENSP00000383063:p.Gly664Cys						p.G664C	NM_003489	NP_003480	P48552	NRIP1_HUMAN		Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)	4	2588	-			664			Repression domain 2.		Q8IWE8	Missense_Mutation	SNP	ENST00000400202.1	37	c.1990G>T	CCDS13568.1	.	.	.	.	.	.	.	.	.	.	C	16.69	3.193832	0.58017	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.33216	1.42;1.42;1.42	5.69	5.69	0.88448	.	0.301707	0.30269	N	0.010014	T	0.48241	0.1489	L	0.50333	1.59	0.42866	D	0.994123	D	0.56287	0.975	P	0.56960	0.81	T	0.40175	-0.9577	10	0.72032	D	0.01	6.8086	20.2085	0.98285	0.0:1.0:0.0:0.0	.	664	P48552	NRIP1_HUMAN	C	664	ENSP00000383060:G664C;ENSP00000383063:G664C;ENSP00000327213:G664C	ENSP00000327213:G664C	G	-	1	0	NRIP1	15260395	0.469000	0.25846	0.086000	0.20670	0.831000	0.47069	2.748000	0.47483	2.865000	0.98341	0.655000	0.94253	GGT		0.388	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157926.1	NM_003489		12	45	1	0	1.61879e-10	0.001368	2.20336e-10	12	45				
TIAM1	7074	broad.mit.edu	37	21	32624131	32624131	+	Silent	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr21:32624131C>T	ENST00000286827.3	-	6	1809	c.1338G>A	c.(1336-1338)ctG>ctA	p.L446L	TIAM1_ENST00000541036.1_Silent_p.L446L|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	446	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						TCTTGTGCACCAGGAAGTTCT	0.652																																							uc002yow.1		NA																	0				lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						c.(1336-1338)CTG>CTA		T-cell lymphoma invasion and metastasis 1							75.0	76.0	76.0					21																	32624131		2203	4300	6503	SO:0001819	synonymous_variant	7074				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr21:32624131C>T		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1338G>A	21.37:g.32624131C>T						TIAM1_uc011adk.1_Silent_p.L446L|TIAM1_uc011adl.1_Silent_p.L446L|TIAM1_uc002yox.1_Silent_p.L54L	p.L446L	NM_003253	NP_003244	Q13009	TIAM1_HUMAN			6	1810	-			446			PH 1.		B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	37	c.1338G>A	CCDS13609.1																																																																																				0.652	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253		27	109	0	0	0	0.012213	0	27	109				
DSCAM	1826	broad.mit.edu	37	21	41710051	41710051	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr21:41710051T>C	ENST00000400454.1	-	8	2237	c.1760A>G	c.(1759-1761)cAg>cGg	p.Q587R		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	587	Ig-like C2-type 6.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GTGGACGCTCTGGCTGGTGGA	0.507																																					Melanoma(134;970 1778 1785 21664 32388)	Melanoma(134;970 1778 1785 21664 32388)	uc002yyq.1		NA																	0				ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11						c.(1759-1761)CAG>CGG		Down syndrome cell adhesion molecule isoform							147.0	149.0	148.0					21																	41710051		2088	4211	6299	SO:0001583	missense	1826				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding	g.chr21:41710051T>C	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1760A>G	21.37:g.41710051T>C	ENSP00000383303:p.Gln587Arg					DSCAM_uc002yyr.1_RNA	p.Q587R	NM_001389	NP_001380	O60469	DSCAM_HUMAN			8	2212	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	587			Extracellular (Potential).|Ig-like C2-type 6.		O60468	Missense_Mutation	SNP	ENST00000400454.1	37	c.1760A>G	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	T	8.152	0.787638	0.16258	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.66815	-0.23;-0.23	5.27	5.27	0.74061	Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.46328	0.1387	N	0.13299	0.325	0.40384	D	0.979474	B	0.12630	0.006	B	0.12156	0.007	T	0.45571	-0.9252	10	0.02654	T	1	.	15.4669	0.75409	0.0:0.0:0.0:1.0	.	587	O60469	DSCAM_HUMAN	R	587;339	ENSP00000383303:Q587R;ENSP00000385342:Q339R	ENSP00000383303:Q587R	Q	-	2	0	DSCAM	40631921	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.934000	0.63491	2.114000	0.64651	0.533000	0.62120	CAG		0.507	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		22	87	0	0	0	0.00333	0	22	87				
CRYBB3	1417	broad.mit.edu	37	22	25601313	25601313	+	Missense_Mutation	SNP	C	C	T	rs375275387		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr22:25601313C>T	ENST00000215855.2	+	5	534	c.454C>T	c.(454-456)Cgt>Tgt	p.R152C	CRYBB3_ENST00000404334.1_Intron	NM_004076.3	NP_004067.1	P26998	CRBB3_HUMAN	crystallin, beta B3	152	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(2)|lung(2)|prostate(1)	5						GGCGAGTGTCCGTGCCATCAA	0.572																																							uc003abo.1		NA																	0					0						c.(454-456)CGT>TGT		crystallin, beta B3		C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	94.0	74.0	81.0		454	2.8	0.7	22		81	0,8600		0,0,4300	no	missense	CRYBB3	NM_004076.3	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	152/212	25601313	1,13005	2203	4300	6503	SO:0001583	missense	1417				visual perception		protein binding|structural constituent of eye lens	g.chr22:25601313C>T		CCDS13830.1	22q11.23	2008-06-10			ENSG00000100053	ENSG00000100053			2400	protein-coding gene	gene with protein product		123630		CRYB3		8999933	Standard	NM_004076		Approved		uc003abo.2	P26998	OTTHUMG00000150869	ENST00000215855.2:c.454C>T	22.37:g.25601313C>T	ENSP00000215855:p.Arg152Cys						p.R152C	NM_004076	NP_004067	P26998	CRBB3_HUMAN			5	526	+			152			Beta/gamma crystallin 'Greek key' 3.		Q3B7S9|Q3T1B7|Q6ISK6|Q92965|Q9UH09	Missense_Mutation	SNP	ENST00000215855.2	37	c.454C>T	CCDS13830.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.935057	0.52866	2.27E-4	0.0	ENSG00000100053	ENST00000215855	T	0.78595	-1.19	5.16	2.85	0.33270	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.177207	0.47093	D	0.000249	D	0.87481	0.6188	M	0.91561	3.22	0.80722	D	1	D	0.71674	0.998	D	0.63957	0.92	D	0.87974	0.2738	10	0.72032	D	0.01	.	8.6944	0.34287	0.2295:0.6848:0.0:0.0857	.	152	P26998	CRBB3_HUMAN	C	152	ENSP00000215855:R152C	ENSP00000215855:R152C	R	+	1	0	CRYBB3	23931313	1.000000	0.71417	0.653000	0.29593	0.631000	0.37964	1.954000	0.40362	1.187000	0.43000	0.549000	0.68633	CGT		0.572	CRYBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320352.1	NM_004076		9	21	0	0	0	0.004482	0	9	21				
ENTHD1	150350	broad.mit.edu	37	22	40139897	40139897	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr22:40139897G>T	ENST00000325157.6	-	7	1861	c.1611C>A	c.(1609-1611)gaC>gaA	p.D537E		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	537										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					CCTGGGGGAAGTCTTTGGTTG	0.438																																							uc003ayg.2		NA																	0				ovary(2)|skin(1)	3						c.(1609-1611)GAC>GAA		ENTH domain containing 1							75.0	70.0	72.0					22																	40139897		2203	4300	6503	SO:0001583	missense	150350							g.chr22:40139897G>T	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.1611C>A	22.37:g.40139897G>T	ENSP00000317431:p.Asp537Glu						p.D537E	NM_152512	NP_689725	Q8IYW4	ENTD1_HUMAN			7	1862	-	Melanoma(58;0.0749)		537					B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	ENST00000325157.6	37	c.1611C>A	CCDS13998.1	.	.	.	.	.	.	.	.	.	.	G	7.906	0.735457	0.15574	.	.	ENSG00000176177	ENST00000325157	T	0.28069	1.63	5.62	3.43	0.39272	.	1.676220	0.03063	N	0.156084	T	0.28896	0.0717	L	0.36672	1.1	0.09310	N	1	B	0.23806	0.091	B	0.19148	0.024	T	0.12578	-1.0542	10	0.52906	T	0.07	0.569	9.7711	0.40589	0.0:0.1498:0.6962:0.154	.	537	Q8IYW4	ENTD1_HUMAN	E	537	ENSP00000317431:D537E	ENSP00000317431:D537E	D	-	3	2	ENTHD1	38469843	0.332000	0.24722	0.036000	0.18154	0.023000	0.10783	1.558000	0.36309	2.632000	0.89209	0.555000	0.69702	GAC		0.438	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512		18	21	1	0	5.3912e-06	0.006122	6.38089e-06	18	21				
PARVB	29780	broad.mit.edu	37	22	44553883	44553883	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr22:44553883G>T	ENST00000338758.7	+	11	928	c.865G>T	c.(865-867)Gtt>Ttt	p.V289F	PARVB_ENST00000406477.3_Missense_Mutation_p.V322F|PARVB_ENST00000404989.1_Missense_Mutation_p.V252F	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	289	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				CGTGTACCTGGTTCTGCTCAT	0.498																																							uc003ben.2		NA																	0					0						c.(865-867)GTT>TTT		parvin, beta isoform b							145.0	114.0	124.0					22																	44553883		2203	4300	6503	SO:0001583	missense	29780				cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding	g.chr22:44553883G>T	AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.865G>T	22.37:g.44553883G>T	ENSP00000342492:p.Val289Phe					PARVB_uc003bem.2_Missense_Mutation_p.V322F|PARVB_uc010gzn.2_Missense_Mutation_p.V214F|PARVB_uc003beo.2_Missense_Mutation_p.V252F	p.V289F	NM_013327	NP_037459	Q9HBI1	PARVB_HUMAN			11	917	+		Ovarian(80;0.0246)|all_neural(38;0.0423)	289			CH 2.		B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Missense_Mutation	SNP	ENST00000338758.7	37	c.865G>T	CCDS14056.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877808	0.51801	.	.	ENSG00000188677	ENST00000406477;ENST00000338758;ENST00000404989	D;D;D	0.95001	-3.58;-3.58;-3.58	4.45	2.34	0.29019	Calponin homology domain (5);	0.075257	0.53938	D	0.000057	D	0.95900	0.8665	M	0.77820	2.39	0.80722	D	1	D;P;D;D	0.69078	0.992;0.924;0.978;0.997	P;P;P;D	0.63703	0.88;0.805;0.847;0.917	D	0.94418	0.7638	10	0.87932	D	0	-8.0328	8.2163	0.31514	0.2008:0.0:0.7992:0.0	.	289;252;289;322	A6NG58;B0QYM8;Q9HBI1;Q9HBI1-2	.;.;PARVB_HUMAN;.	F	322;289;252	ENSP00000384515:V322F;ENSP00000342492:V289F;ENSP00000384353:V252F	ENSP00000342492:V289F	V	+	1	0	PARVB	42885216	1.000000	0.71417	0.248000	0.24265	0.471000	0.32888	4.836000	0.62789	0.328000	0.23435	0.514000	0.50259	GTT		0.498	PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319518.2	NM_001003828		18	32	1	0	7.41877e-09	0.012319	9.61693e-09	18	32				
KLHDC7B	113730	broad.mit.edu	37	22	50987893	50987893	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr22:50987893C>A	ENST00000395676.2	+	1	1432	c.1298C>A	c.(1297-1299)cCa>cAa	p.P433Q	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	433										central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCACGCGCGCCACTCCCCGCA	0.672																																							uc003bmi.2		NA																	0				central_nervous_system(1)	1						c.(1297-1299)CCA>CAA		kelch domain containing 7B							72.0	75.0	74.0					22																	50987893		2200	4298	6498	SO:0001583	missense	113730							g.chr22:50987893C>A	BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.1298C>A	22.37:g.50987893C>A	ENSP00000379034:p.Pro433Gln						p.P433Q	NM_138433	NP_612442	Q96G42	KLD7B_HUMAN		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	1	1432	+		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)	433			Kelch 3.			Missense_Mutation	SNP	ENST00000395676.2	37	c.1298C>A	CCDS14097.2	.	.	.	.	.	.	.	.	.	.	C	16.48	3.135218	0.56828	.	.	ENSG00000130487	ENST00000395676	T	0.79749	-1.3	5.35	5.35	0.76521	Kelch-type beta propeller (1);	0.377524	0.19143	U	0.121655	D	0.90345	0.6979	M	0.83012	2.62	0.32285	N	0.56704	D	0.71674	0.998	D	0.76575	0.988	D	0.92061	0.5656	10	0.87932	D	0	.	16.5472	0.84450	0.0:1.0:0.0:0.0	.	433	Q96G42	KLD7B_HUMAN	Q	433	ENSP00000379034:P433Q	ENSP00000379034:P433Q	P	+	2	0	KLHDC7B	49334759	0.960000	0.32886	0.878000	0.34440	0.092000	0.18411	4.489000	0.60309	2.528000	0.85240	0.491000	0.48974	CCA		0.672	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317089.2	NM_138433		47	71	1	0	4.00472e-15	0.00361	6.13223e-15	47	71				
SETD5	55209	broad.mit.edu	37	3	9477415	9477415	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:9477415G>T	ENST00000406341.1	+	6	582	c.392G>T	c.(391-393)gGg>gTg	p.G131V	SETD5_ENST00000402466.1_Missense_Mutation_p.G20V|SETD5_ENST00000407969.1_Missense_Mutation_p.G150V|SETD5_ENST00000402198.1_Missense_Mutation_p.G131V|SETD5_ENST00000302463.6_Missense_Mutation_p.G20V			Q9C0A6	SETD5_HUMAN	SET domain containing 5	131										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		TTTTCAGGTGGGGATAGCAGT	0.423																																							uc003brt.2		NA																	0				ovary(2)	2						c.(391-393)GGG>GTG		SET domain containing 5							46.0	45.0	45.0					3																	9477415		1876	4134	6010	SO:0001583	missense	55209							g.chr3:9477415G>T	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.392G>T	3.37:g.9477415G>T	ENSP00000383939:p.Gly131Val					SETD5_uc003brs.1_Missense_Mutation_p.G112V|SETD5_uc003bru.2_Missense_Mutation_p.G20V|SETD5_uc003brv.2_Missense_Mutation_p.G20V	p.G131V	NM_001080517	NP_001073986	Q9C0A6	SETD5_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.112)	7	827	+	Medulloblastoma(99;0.227)		131					Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	ENST00000406341.1	37	c.392G>T	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170162	0.78452	.	.	ENSG00000168137	ENST00000450326;ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000442373;ENST00000302463	T;D;D;D;D;T;D	0.95482	0.9;-2.97;-3.72;-2.97;-3.03;0.25;-3.72	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.97517	0.9187	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.998;0.999;0.99	D	0.98070	1.0398	10	0.87932	D	0	-6.2815	19.2504	0.93923	0.0:0.0:1.0:0.0	.	20;131;150	Q9C0A6-3;Q9C0A6;E7EWN3	.;SETD5_HUMAN;.	V	131;131;20;131;150;20;20	ENSP00000413786:G131V;ENSP00000385852:G131V;ENSP00000384429:G20V;ENSP00000383939:G131V;ENSP00000384114:G150V;ENSP00000408837:G20V;ENSP00000302028:G20V	ENSP00000302028:G20V	G	+	2	0	SETD5	9452415	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.322000	0.96357	2.622000	0.88805	0.655000	0.94253	GGG		0.423	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614		5	7	1	0	5.9392e-07	0.001168	7.13286e-07	5	7				
ATP2B2	491	broad.mit.edu	37	3	10401703	10401703	+	Silent	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:10401703G>T	ENST00000352432.4	-	12	1833	c.1764C>A	c.(1762-1764)cgC>cgA	p.R588R	ATP2B2_ENST00000397077.1_Silent_p.R543R|ATP2B2_ENST00000360273.2_Silent_p.R588R|ATP2B2_ENST00000343816.4_Silent_p.R574R|ATP2B2_ENST00000383800.4_Silent_p.R543R			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	588					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GCATCTGGCTGCGCACGGGCT	0.612																																					Ovarian(125;1619 1709 15675 19819 38835)	Ovarian(125;1619 1709 15675 19819 38835)	uc003bvt.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1762-1764)CGC>CGA		plasma membrane calcium ATPase 2 isoform 1							85.0	71.0	76.0					3																	10401703		2203	4300	6503	SO:0001819	synonymous_variant	491				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding	g.chr3:10401703G>T	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1764C>A	3.37:g.10401703G>T						ATP2B2_uc003bvv.2_Silent_p.R543R|ATP2B2_uc003bvw.2_Silent_p.R543R|ATP2B2_uc010hdo.2_Silent_p.R293R	p.R588R	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN			13	2203	-			588			Cytoplasmic (Potential).		O00766|Q12994|Q16818	Silent	SNP	ENST00000352432.4	37	c.1764C>A	CCDS33701.1																																																																																				0.612	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		15	28	1	0	3.27435e-08	0.00245	4.15656e-08	15	28				
PPARG	5468	broad.mit.edu	37	3	12475588	12475588	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:12475588G>A	ENST00000287820.6	+	7	1583	c.1462G>A	c.(1462-1464)Gag>Aag	p.E488K	PPARG_ENST00000539812.1_3'UTR|PPARG_ENST00000397015.2_Missense_Mutation_p.E460K|PPARG_ENST00000397010.2_Missense_Mutation_p.E460K|PPARG_ENST00000397026.2_Missense_Mutation_p.E466K|PPARG_ENST00000397000.1_3'UTR|PPARG_ENST00000397012.2_Missense_Mutation_p.E460K|PPARG_ENST00000309576.6_Missense_Mutation_p.E460K	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	488	Ligand-binding.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	CAAGAAGACGGAGACAGACAT	0.512			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																																uc003bwx.2		NA		Dom	yes		3	3p25	5468	T	"""peroxisome proliferative activated receptor, gamma"""	yes	Insulin resistance ; lipodystrophy|familial partial L;diabetes mellitus|insulin-resistantI|with acanthosis nigricans and hypertension	E	PAX8		follicular thyroid		0				ovary(1)|kidney(1)	2						c.(1462-1464)GAG>AAG		peroxisome proliferative activated receptor	Atorvastatin(DB01076)|Icosapent(DB00159)|Pioglitazone(DB01132)|Rosiglitazone(DB00412)|Troglitazone(DB00197)						66.0	58.0	61.0					3																	12475588		2203	4300	6503	SO:0001583	missense	5468				activation of caspase activity|cell fate commitment|cell maturation|cellular response to insulin stimulus|epithelial cell differentiation|glucose homeostasis|induction of apoptosis|innate immune response|lipid homeostasis|lipoprotein transport|long-chain fatty acid transport|low-density lipoprotein particle receptor biosynthetic process|monocyte differentiation|negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|placenta development|positive regulation of fat cell differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to lipid|response to low-density lipoprotein particle stimulus|white fat cell differentiation	cytosol|nucleoplasm	activating transcription factor binding|arachidonic acid binding|drug binding|enzyme binding|prostaglandin receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr3:12475588G>A	X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.1462G>A	3.37:g.12475588G>A	ENSP00000287820:p.Glu488Lys					PPARG_uc003bwr.2_Missense_Mutation_p.E460K|PPARG_uc003bws.2_Missense_Mutation_p.E460K|PPARG_uc003bwu.2_Missense_Mutation_p.E460K|PPARG_uc003bwv.2_3'UTR	p.E488K	NM_015869	NP_056953	P37231	PPARG_HUMAN			7	1553	+			488			Ligand-binding.		A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Missense_Mutation	SNP	ENST00000287820.6	37	c.1462G>A	CCDS2609.1	.	.	.	.	.	.	.	.	.	.	G	35	5.538513	0.96474	.	.	ENSG00000132170	ENST00000397010;ENST00000309576;ENST00000397015;ENST00000397012;ENST00000397026;ENST00000287820	T;T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55;-0.55	5.61	5.61	0.85477	Nuclear hormone receptor, ligand-binding (2);	0.100948	0.64402	D	0.000002	D	0.85358	0.5678	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86464	0.1781	10	0.87932	D	0	.	19.6973	0.96031	0.0:0.0:1.0:0.0	.	488	P37231	PPARG_HUMAN	K	460;460;460;460;466;488	ENSP00000380205:E460K;ENSP00000312472:E460K;ENSP00000380210:E460K;ENSP00000380207:E460K;ENSP00000380221:E466K;ENSP00000287820:E488K	ENSP00000287820:E488K	E	+	1	0	PPARG	12450588	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.814000	0.99346	2.657000	0.90304	0.650000	0.86243	GAG		0.512	PPARG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251979.2	NM_005037		4	50	0	0	0	0.009096	0	4	50				
SATB1	6304	broad.mit.edu	37	3	18457572	18457572	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:18457572C>A	ENST00000338745.6	-	4	2176	c.442G>T	c.(442-444)Gcc>Tcc	p.A148S	SATB1_ENST00000417717.2_Missense_Mutation_p.A148S|SATB1_ENST00000454909.2_Missense_Mutation_p.A148S|SATB1_ENST00000475083.1_5'UTR|TBC1D5_ENST00000414318.2_Intron	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	148	PDZ-like dimerization domain.				activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						GCATCAGGGGCATCTGTCACG	0.408																																							uc003cbh.2		NA																	0				skin(2)|ovary(1)|lung(1)	4						c.(442-444)GCC>TCC		special AT-rich sequence binding protein 1							124.0	115.0	118.0					3																	18457572		2203	4300	6503	SO:0001583	missense	6304				cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding	g.chr3:18457572C>A		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.442G>T	3.37:g.18457572C>A	ENSP00000341024:p.Ala148Ser					SATB1_uc003cbi.2_Missense_Mutation_p.A148S|SATB1_uc003cbj.2_Missense_Mutation_p.A148S	p.A148S	NM_002971	NP_002962	Q01826	SATB1_HUMAN			4	2177	-			148			PDZ-like dimerization domain.		B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	ENST00000338745.6	37	c.442G>T	CCDS2631.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.693317	0.48202	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717;ENST00000440737;ENST00000452260;ENST00000415069	T;T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38;-1.38	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.87888	0.6291	L	0.53249	1.67	0.80722	D	1	D;D	0.76494	0.999;0.99	D;P	0.75484	0.986;0.892	D	0.85414	0.1139	10	0.36615	T	0.2	-3.6105	20.0529	0.97634	0.0:1.0:0.0:0.0	.	148;148	Q01826-2;Q01826	.;SATB1_HUMAN	S	148	ENSP00000341024:A148S;ENSP00000399708:A148S;ENSP00000399518:A148S;ENSP00000402982:A148S;ENSP00000406727:A148S;ENSP00000390529:A148S	ENSP00000341024:A148S	A	-	1	0	SATB1	18432576	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.880000	0.69698	2.814000	0.96858	0.591000	0.81541	GCC		0.408	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010		19	41	1	0	3.32936e-07	0.006122	4.07847e-07	19	41				
LRRFIP2	9209	broad.mit.edu	37	3	37107762	37107762	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:37107762G>A	ENST00000336686.4	-	22	1599	c.1519C>T	c.(1519-1521)Ctc>Ttc	p.L507F	LRRFIP2_ENST00000421307.1_Missense_Mutation_p.L507F|LRRFIP2_ENST00000354379.4_Intron|LRRFIP2_ENST00000396428.2_Intron|LRRFIP2_ENST00000440230.1_Intron|LRRFIP2_ENST00000421276.2_Intron			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	507					Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						TCCTCTCTGAGCATATCTCGC	0.468																																							uc003cgp.2		NA																	1	Whole gene deletion(1)		ovary(1)	ovary(1)	1						c.(1519-1521)CTC>TTC		leucine rich repeat (in FLII) interacting							206.0	186.0	193.0					3																	37107762		2203	4300	6503	SO:0001583	missense	9209				Wnt receptor signaling pathway		LRR domain binding	g.chr3:37107762G>A	AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.1519C>T	3.37:g.37107762G>A	ENSP00000338727:p.Leu507Phe					LRRFIP2_uc011ayf.1_Intron|LRRFIP2_uc003cgr.2_Intron|LRRFIP2_uc003cgs.3_Intron|LRRFIP2_uc003cgt.3_Intron	p.L507F	NM_006309	NP_006300	Q9Y608	LRRF2_HUMAN			23	1942	-			507			Potential.		A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Missense_Mutation	SNP	ENST00000336686.4	37	c.1519C>T	CCDS2664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.189333|5.189333	0.94923|0.94923	.|.	.|.	ENSG00000093167|ENSG00000093167	ENST00000440742|ENST00000421307;ENST00000336686	.|T;T	.|0.60672	.|0.17;0.17	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80037|0.80037	0.4550|0.4550	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.79006|0.79006	-0.1979|-0.1979	5|10	.|0.52906	.|T	.|0.07	-4.4966|-4.4966	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|507	.|Q9Y608	.|LRRF2_HUMAN	V|F	88|507	.|ENSP00000392217:L507F;ENSP00000338727:L507F	.|ENSP00000338727:L507F	A|L	-|-	2|1	0|0	LRRFIP2|LRRFIP2	37082766|37082766	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.979000|0.979000	0.70002|0.70002	9.281000|9.281000	0.95811|0.95811	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCT|CTC		0.468	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253335.3	NM_006309		9	95	0	0	0	0.008291	0	9	95				
TTC21A	199223	broad.mit.edu	37	3	39167856	39167856	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:39167856G>T	ENST00000431162.2	+	12	1655	c.1521G>T	c.(1519-1521)ttG>ttT	p.L507F	TTC21A_ENST00000440121.1_Missense_Mutation_p.L458F|TTC21A_ENST00000301819.6_Missense_Mutation_p.L507F			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	507										NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CCCTGTATTTGATGGCTCAGG	0.542																																							uc003cjc.2		NA																	0				ovary(1)	1						c.(1519-1521)TTG>TTT		tetratricopeptide repeat domain 21A isoform 2							109.0	111.0	111.0					3																	39167856		1977	4175	6152	SO:0001583	missense	199223						binding	g.chr3:39167856G>T	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.1521G>T	3.37:g.39167856G>T	ENSP00000398211:p.Leu507Phe					TTC21A_uc003cje.2_Missense_Mutation_p.L507F|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.L458F	p.L507F	NM_145755	NP_665698	Q8NDW8	TT21A_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)	12	1698	+			507			TPR 7.		A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	ENST00000431162.2	37	c.1521G>T	CCDS46800.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815763	0.50527	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.52754	1.11;0.65;0.65	5.6	1.58	0.23477	.	0.417220	0.20439	N	0.092313	T	0.49729	0.1574	M	0.71036	2.16	0.23585	N	0.997359	P;P;P	0.43973	0.823;0.631;0.498	P;B;B	0.48795	0.59;0.332;0.178	T	0.34925	-0.9809	10	0.33940	T	0.23	-4.8316	6.3757	0.21505	0.2518:0.3931:0.3551:0.0	.	458;507;507	Q8NDW8-6;Q8NDW8-7;Q8NDW8	.;.;TT21A_HUMAN	F	507;489;507;458	ENSP00000301819:L507F;ENSP00000398211:L507F;ENSP00000410882:L458F	ENSP00000301819:L507F	L	+	3	2	TTC21A	39142860	0.996000	0.38824	0.995000	0.50966	0.885000	0.51271	0.233000	0.17911	0.293000	0.22520	0.609000	0.83330	TTG		0.542	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755		29	50	1	0	7.26314e-15	0.007291	1.10526e-14	29	50				
KIF15	56992	broad.mit.edu	37	3	44815917	44815917	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:44815917C>T	ENST00000326047.4	+	2	199	c.50C>T	c.(49-51)tCt>tTt	p.S17F		NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	17					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		AATGGTCAGTCTAACCAACCA	0.323																																							uc003cnx.3		NA																	0				ovary(1)	1						c.(49-51)TCT>TTT		kinesin family member 15							63.0	62.0	62.0					3																	44815917		2203	4300	6503	SO:0001583	missense	56992				blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity	g.chr3:44815917C>T	AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.50C>T	3.37:g.44815917C>T	ENSP00000324020:p.Ser17Phe					KIF15_uc010hiq.2_Intron	p.S17F	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)	2	199	+			17					Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	ENST00000326047.4	37	c.50C>T	CCDS33744.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234827	0.58886	.	.	ENSG00000163808	ENST00000326047;ENST00000396031	T	0.70164	-0.46	5.42	4.55	0.56014	.	0.432100	0.17373	N	0.176612	T	0.54271	0.1848	N	0.24115	0.695	0.80722	D	1	P	0.45902	0.868	B	0.43052	0.406	T	0.56974	-0.7890	10	0.59425	D	0.04	.	10.1923	0.43035	0.0:0.9084:0.0:0.0916	.	17	Q9NS87	KIF15_HUMAN	F	17;16	ENSP00000324020:S17F	ENSP00000324020:S17F	S	+	2	0	KIF15	44790921	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	1.982000	0.40638	1.428000	0.47296	0.655000	0.94253	TCT		0.323	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2			12	7	0	0	0	0.001855	0	12	7				
DAG1	1605	broad.mit.edu	37	3	49569139	49569139	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:49569139G>C	ENST00000539901.1	+	3	1753	c.1195G>C	c.(1195-1197)Ggc>Cgc	p.G399R	DAG1_ENST00000308775.2_Missense_Mutation_p.G399R|DAG1_ENST00000541308.1_Missense_Mutation_p.G399R|DAG1_ENST00000545947.1_Missense_Mutation_p.G399R|DAG1_ENST00000515359.2_Missense_Mutation_p.G399R|DAG1_ENST00000538711.1_Missense_Mutation_p.G399R	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	399	Mucin-like domain.|Required for laminin recognition.|Thr-rich.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CACAGTTCCTGGCCAGATTCG	0.587																																							uc003cxc.3		NA																	0				ovary(2)	2						c.(1195-1197)GGC>CGC		dystroglycan 1 preproprotein							118.0	116.0	117.0					3																	49569139		2203	4300	6503	SO:0001583	missense	1605				cytoskeletal anchoring at plasma membrane|interspecies interaction between organisms|microtubule anchoring|negative regulation of cell migration|negative regulation of MAPKKK cascade|negative regulation of protein kinase B signaling cascade	basement membrane|contractile ring|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|extracellular space|filopodium|integral to membrane|integral to membrane of membrane fraction|lamellipodium|nucleoplasm	actin binding|alpha-actinin binding|calcium ion binding|laminin-1 binding|receptor activity|structural constituent of muscle|tubulin binding|vinculin binding	g.chr3:49569139G>C	L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.1195G>C	3.37:g.49569139G>C	ENSP00000439334:p.Gly399Arg						p.G399R	NM_004393	NP_004384	Q14118	DAG1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	3	1613	+			399			Thr-rich.|Required for laminin recognition.|Mucin-like domain.		A8K6M7|Q969J9	Missense_Mutation	SNP	ENST00000539901.1	37	c.1195G>C	CCDS2799.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.263819	0.39995	.	.	ENSG00000173402	ENST00000515359;ENST00000308775;ENST00000545947;ENST00000541308;ENST00000539901;ENST00000538711	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.74	4.87	0.63330	.	0.089340	0.49305	D	0.000148	T	0.26304	0.0642	N	0.08118	0	0.34613	D	0.717802	B	0.29301	0.241	B	0.36567	0.228	T	0.37820	-0.9689	9	.	.	.	-16.7389	12.0505	0.53503	0.0809:0.0:0.9191:0.0	.	399	Q14118	DAG1_HUMAN	R	399	ENSP00000440705:G399R;ENSP00000312435:G399R;ENSP00000442600:G399R;ENSP00000440590:G399R;ENSP00000439334:G399R;ENSP00000438421:G399R	.	G	+	1	0	DAG1	49544143	1.000000	0.71417	0.981000	0.43875	0.990000	0.78478	5.127000	0.64727	1.426000	0.47256	0.655000	0.94253	GGC		0.587	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1			30	50	0	0	0	0.00632	0	30	50				
SLMAP	7871	broad.mit.edu	37	3	57913021	57913021	+	Splice_Site	SNP	A	A	G			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:57913021A>G	ENST00000428312.1	+	22	2488		c.e22-1		SLMAP_ENST00000295952.3_Splice_Site|SLMAP_ENST00000449503.2_Splice_Site|SLMAP_ENST00000495364.1_Splice_Site|SLMAP_ENST00000442599.2_Splice_Site|SLMAP_ENST00000494088.1_Splice_Site|SLMAP_ENST00000295951.3_Splice_Site			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein						muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		CTTTCCACACAGAAACCCTGG	0.493																																							uc003dje.1		NA																	0					0						c.e22-2		sarcolemma associated protein							97.0	80.0	86.0					3																	57913021		2203	4300	6503	SO:0001630	splice_region_variant	7871				muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding	g.chr3:57913021A>G	AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.2395-1A>G	3.37:g.57913021A>G						SLMAP_uc003djd.1_Splice_Site_p.K782_splice|SLMAP_uc003djf.1_Splice_Site_p.K761_splice|SLMAP_uc003djg.1_Splice_Site|SLMAP_uc011bez.1_Splice_Site_p.K267_splice|SLMAP_uc011bfa.1_Splice_Site_p.K333_splice|SLMAP_uc003dji.1_Splice_Site|SLMAP_uc011bfb.1_Splice_Site_p.K333_splice|SLMAP_uc011bfc.1_Splice_Site	p.K799_splice	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)	22	2600	+								Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Splice_Site	SNP	ENST00000428312.1	37	c.2395_splice		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.88|14.88	2.666615|2.666615	0.47677|0.47677	.|.	.|.	ENSG00000163681|ENSG00000163681	ENST00000295951;ENST00000295952;ENST00000428312;ENST00000449503;ENST00000442599;ENST00000495364|ENST00000537224	.|.	.|.	.|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	.|.	.|.	.|.	.|.	.|T	.|0.52419	.|0.1733	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.44314	.|-0.9336	.|5	.|0.10111	.|T	.|0.7	.|.	15.5028|15.5028	0.75713|0.75713	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	.|R	-1|421	.|.	.|ENSP00000437995:Q421R	.|Q	+|+	.|2	.|0	SLMAP|SLMAP	57888061|57888061	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.686000|7.686000	0.84128|0.84128	2.117000|2.117000	0.64856|0.64856	0.533000|0.533000	0.62120|0.62120	.|CAG		0.493	SLMAP-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351584.1	NM_007159	Intron	5	9	0	0	0	0.000602	0	5	9				
COL6A5	256076	broad.mit.edu	37	3	130095284	130095284	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:130095284G>T	ENST00000432398.2	+	3	766	c.272G>T	c.(271-273)aGc>aTc	p.S91I	COL6A5_ENST00000265379.6_Missense_Mutation_p.S91I	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	91	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						AAAGGCAGAAGCCCCATGCTG	0.517																																							uc010htj.1		NA																	0					0						c.(271-273)AGC>ATC		collagen, type XXIX, alpha 1							100.0	85.0	90.0					3																	130095284		692	1591	2283	SO:0001583	missense	256076				axon guidance|cell adhesion	collagen		g.chr3:130095284G>T	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.272G>T	3.37:g.130095284G>T	ENSP00000390895:p.Ser91Ile					COL29A1_uc010hti.1_RNA	p.S91I	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN			3	766	+			91			Nonhelical region.|VWFA 1.		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37	c.272G>T		.	.	.	.	.	.	.	.	.	.	G	3.678	-0.066082	0.07273	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.79141	-1.24;-1.24	5.14	-2.06	0.07298	.	.	.	.	.	T	0.71316	0.3325	L	0.49126	1.545	0.20074	N	0.999935	B	0.25904	0.137	B	0.33339	0.162	T	0.61317	-0.7087	9	0.40728	T	0.16	.	9.971	0.41754	0.5893:0.0:0.4107:0.0	.	91	A8TX70-2	.	I	91	ENSP00000390895:S91I;ENSP00000265379:S91I	ENSP00000265379:S91I	S	+	2	0	COL6A5	131577974	0.000000	0.05858	0.337000	0.25536	0.002000	0.02628	-0.031000	0.12287	-0.478000	0.06823	-1.031000	0.02408	AGC		0.517	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264		11	5	1	0	3.86212e-05	0.008291	4.44234e-05	11	5				
CLSTN2	64084	broad.mit.edu	37	3	140167426	140167426	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:140167426C>A	ENST00000458420.3	+	6	1043	c.853C>A	c.(853-855)Ctg>Atg	p.L285M	RP11-68L1.2_ENST00000509191.1_RNA|RP11-68L1.2_ENST00000502712.1_RNA	NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	285					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CAGCATCCACCTGGAGACGTG	0.532										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	GBM(45;858 913 3709 36904 37282)	uc003etn.2		NA																	0				skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						c.(853-855)CTG>ATG		calsyntenin 2 precursor							132.0	126.0	128.0					3																	140167426		2203	4300	6503	SO:0001583	missense	64084				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding	g.chr3:140167426C>A	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.853C>A	3.37:g.140167426C>A	ENSP00000402460:p.Leu285Met	HNSCC(16;0.037)				CLSTN2_uc003etm.2_Missense_Mutation_p.L285M	p.L285M	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN			6	1043	+			285			Extracellular (Potential).		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	c.853C>A	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464736	0.63513	.	.	ENSG00000158258	ENST00000458420	T	0.58940	0.3	5.2	5.2	0.72013	.	0.089217	0.46758	D	0.000272	T	0.78515	0.4295	M	0.91140	3.18	0.58432	D	0.999995	D	0.63880	0.993	P	0.59288	0.855	D	0.84202	0.0451	10	0.87932	D	0	-12.6956	16.2424	0.82423	0.0:1.0:0.0:0.0	.	285	Q9H4D0	CSTN2_HUMAN	M	285	ENSP00000402460:L285M	ENSP00000402460:L285M	L	+	1	2	CLSTN2	141650116	0.998000	0.40836	1.000000	0.80357	0.812000	0.45895	2.059000	0.41384	2.425000	0.82216	0.561000	0.74099	CTG		0.532	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131		46	93	1	0	6.61955e-31	0.00361	1.16676e-30	46	93				
SLC7A14	57709	broad.mit.edu	37	3	170198532	170198532	+	Silent	SNP	G	G	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:170198532G>C	ENST00000231706.5	-	7	1854	c.1539C>G	c.(1537-1539)acC>acG	p.T513T	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	513					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)	p.T513T(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TCATGTCCACGGTGCCGTAAT	0.448																																							uc003fgz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5						c.(1537-1539)ACC>ACG		solute carrier family 7 (cationic amino acid							201.0	203.0	202.0					3																	170198532		2203	4300	6503	SO:0001819	synonymous_variant	57709					integral to membrane	amino acid transmembrane transporter activity	g.chr3:170198532G>C	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1539C>G	3.37:g.170198532G>C						CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	p.T513T	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)		7	1855	-	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		513					B3KV33|Q9HCF9	Silent	SNP	ENST00000231706.5	37	c.1539C>G	CCDS33892.1																																																																																				0.448	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949		74	127	0	0	0	0.00361	0	74	127				
CLCN2	1181	broad.mit.edu	37	3	184071086	184071086	+	Silent	SNP	T	T	C	rs546609891		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:184071086T>C	ENST00000265593.4	-	17	2151	c.1980A>G	c.(1978-1980)ctA>ctG	p.L660L	CLCN2_ENST00000434054.2_Silent_p.L616L|CLCN2_ENST00000423355.2_3'UTR|CLCN2_ENST00000344937.7_Silent_p.L643L|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000457512.1_Silent_p.L660L|CLCN2_ENST00000475279.1_5'Flank	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	660					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	CCTGATCAGATAGTGGAGAGG	0.597													T|||	1	0.000199681	0.0	0.0	5008	,	,		18023	0.001		0.0	False		,,,				2504	0.0						uc003foi.2		NA																	0					0						c.(1978-1980)CTA>CTG		chloride channel 2	Lubiprostone(DB01046)						81.0	88.0	86.0					3																	184071086		2203	4300	6503	SO:0001819	synonymous_variant	1181					chloride channel complex	voltage-gated chloride channel activity	g.chr3:184071086T>C	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.1980A>G	3.37:g.184071086T>C						CLCN2_uc003foh.2_Silent_p.L184L|CLCN2_uc010hya.1_Silent_p.L643L|CLCN2_uc011brl.1_Silent_p.L660L|CLCN2_uc011brm.1_Silent_p.L616L	p.L660L	NM_004366	NP_004357	P51788	CLCN2_HUMAN	Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		17	2104	-	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		660			Cytoplasmic (By similarity).		B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Silent	SNP	ENST00000265593.4	37	c.1980A>G	CCDS3263.1																																																																																				0.597	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1			41	71	0	0	0	0.007835	0	41	71				
LSG1	55341	broad.mit.edu	37	3	194390774	194390774	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:194390774C>A	ENST00000265245.5	-	2	504	c.190G>T	c.(190-192)Gct>Tct	p.A64S	AC046143.1_ENST00000408791.1_RNA|LSG1_ENST00000480853.1_5'Flank	NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	64					GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		TCTGCAGTAGCAAGGAAGTCA	0.438																																							uc003fui.2		NA																	0					0						c.(190-192)GCT>TCT		large subunit GTPase 1							131.0	134.0	133.0					3																	194390774		2203	4300	6503	SO:0001583	missense	55341				nuclear export|protein transport	Cajal body|endoplasmic reticulum	GTP binding|hydrolase activity	g.chr3:194390774C>A		CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.190G>T	3.37:g.194390774C>A	ENSP00000265245:p.Ala64Ser						p.A64S	NM_018385	NP_060855	Q9H089	LSG1_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)	2	505	-	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		64					A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Missense_Mutation	SNP	ENST00000265245.5	37	c.190G>T	CCDS33922.1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.018789	0.35606	.	.	ENSG00000041802	ENST00000265245	T	0.29655	1.56	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.27384	0.0672	L	0.37750	1.13	0.80722	D	1	P	0.42827	0.791	B	0.42692	0.395	T	0.02668	-1.1126	10	0.08599	T	0.76	.	17.2586	0.87064	0.0:1.0:0.0:0.0	.	64	Q9H089	LSG1_HUMAN	S	64	ENSP00000265245:A64S	ENSP00000265245:A64S	A	-	1	0	LSG1	195872063	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.410000	0.66381	2.348000	0.79779	0.650000	0.86243	GCT		0.438	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342740.1	NM_018385		23	60	1	0	1.28384e-07	0.012319	1.59665e-07	23	60				
SDHAP1	255812	broad.mit.edu	37	3	195692311	195692311	+	RNA	SNP	T	T	C	rs62282793	byFrequency	TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:195692311T>C	ENST00000427841.1	-	0	2191					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		TTCCCAGTGCTGACGTCCACA	0.607																																					Ovarian(67;1158 1227 12109 20189 43170)	Ovarian(67;1158 1227 12109 20189 43170)	uc003fvy.2		NA																	0					0						c.(232-234)AGC>GGC		Homo sapiens full length insert cDNA clone ZC24D06.																																						255812							g.chr3:195692311T>C	BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195692311T>C						SDHAP1_uc003fvx.3_RNA	p.S78G							3	346	-									Missense_Mutation	SNP	ENST00000427841.1	37	c.232A>G																																																																																					0.607	SDHAP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000341367.1			4	14	0	0	0	0.001168	0	4	14				
PDE6B	5158	broad.mit.edu	37	4	663834	663834	+	Splice_Site	SNP	G	G	A	rs201870319	byFrequency	TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr4:663834G>A	ENST00000496514.1	+	22	2524		c.e22-1		ATP5I_ENST00000506525.1_5'Flank|PDE6B_ENST00000255622.6_Intron|PDE6B_ENST00000429163.2_Splice_Site			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta						cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	TTCTCTTGCAGTAGGCACAGA	0.562																																					GBM(71;463 1194 9848 25922 46834)	GBM(71;463 1194 9848 25922 46834)	uc003gap.2		NA																	0					0						c.e22-1		phosphodiesterase 6B isoform 1							203.0	194.0	197.0					4																	663834		2203	4300	6503	SO:0001630	splice_region_variant	5158				cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr4:663834G>A	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.2504-1G>A	4.37:g.663834G>A						PDE6B_uc003gao.3_Intron|PDE6B_uc011buy.1_Splice_Site_p.V556_splice|PDE6B_uc011buz.1_Intron	p.V835_splice	NM_000283	NP_000274	P35913	PDE6B_HUMAN			22	2557	+								B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Splice_Site	SNP	ENST00000496514.1	37	c.2504_splice	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	G	9.955	1.221206	0.22457	.	.	ENSG00000133256	ENST00000496514;ENST00000429163;ENST00000461490	.	.	.	4.36	4.36	0.52297	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7319	0.57203	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDE6B	653834	0.993000	0.37304	0.883000	0.34634	0.214000	0.24535	4.944000	0.63561	2.135000	0.66039	0.591000	0.81541	.		0.562	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	Intron	60	95	0	0	0	0.00361	0	60	95				
LPHN3	23284	broad.mit.edu	37	4	62849295	62849295	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr4:62849295C>G	ENST00000514591.1	+	18	3335	c.3006C>G	c.(3004-3006)gaC>gaG	p.D1002E	LPHN3_ENST00000507625.1_Missense_Mutation_p.D1070E|LPHN3_ENST00000512091.2_Missense_Mutation_p.D1002E|LPHN3_ENST00000514157.1_Missense_Mutation_p.D1002E|LPHN3_ENST00000504896.1_Missense_Mutation_p.D1002E|LPHN3_ENST00000506720.1_Missense_Mutation_p.D1070E|LPHN3_ENST00000511324.1_Missense_Mutation_p.D1070E|LPHN3_ENST00000545650.1_Missense_Mutation_p.D1002E|LPHN3_ENST00000509896.1_Missense_Mutation_p.D1070E|LPHN3_ENST00000514996.1_Missense_Mutation_p.D1002E|LPHN3_ENST00000507164.1_Missense_Mutation_p.D1070E|LPHN3_ENST00000506746.1_Missense_Mutation_p.D1070E|LPHN3_ENST00000508693.1_Missense_Mutation_p.D1070E|LPHN3_ENST00000506700.1_Missense_Mutation_p.D1002E|LPHN3_ENST00000508946.1_Missense_Mutation_p.D1002E			Q9HAR2	LPHN3_HUMAN	latrophilin 3	989					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CTGCAGTAGACTACAGGAGTT	0.393																																							uc010ihh.2		NA																	0				lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(3004-3006)GAC>GAG		latrophilin 3 precursor							190.0	185.0	187.0					4																	62849295		1887	4129	6016	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62849295C>G	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3006C>G	4.37:g.62849295C>G	ENSP00000422533:p.Asp1002Glu					LPHN3_uc003hcq.3_Missense_Mutation_p.D1002E|LPHN3_uc003hct.2_Missense_Mutation_p.D395E	p.D1002E	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN			16	3179	+			989			Extracellular (Potential).		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.3006C>G	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.1|23.1	4.380086|4.380086	0.82682|0.82682	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.36520|.	1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25|.	5.82|5.82	3.87|3.87	0.44632|0.44632	GPCR, family 2-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70771|0.70771	0.3262|0.3262	M|M	0.75615|0.75615	2.305|2.305	0.51482|0.51482	D|D	0.999928|0.999928	D;D;D|.	0.69078|.	0.997;0.997;0.996|.	D;D;D|.	0.80764|.	0.994;0.994;0.99|.	T|T	0.68618|0.68618	-0.5361|-0.5361	10|5	0.87932|.	D|.	0|.	.|.	10.7141|10.7141	0.46002|0.46002	0.0:0.8255:0.0:0.1745|0.0:0.8255:0.0:0.1745	.|.	1002;989;1002|.	E9PE04;Q9HAR2;Q9HAR2-2|.	.;LPHN3_HUMAN;.|.	E|V	1002;1002;1070;1070;1002;1002;989;1002;1070;1070;1070;1002;1002;1002;1070;1070;1002|460	ENSP00000423388:D1002E;ENSP00000422533:D1002E;ENSP00000423787:D1070E;ENSP00000425033:D1070E;ENSP00000424120:D1002E;ENSP00000439831:D1002E;ENSP00000421476:D1070E;ENSP00000424030:D1070E;ENSP00000421372:D1070E;ENSP00000425201:D1002E;ENSP00000423434:D1002E;ENSP00000421627:D1002E;ENSP00000420931:D1070E;ENSP00000425884:D1070E;ENSP00000424258:D1002E|.	ENSP00000280009:D1002E|.	D|L	+|+	3|1	2|2	LPHN3|LPHN3	62531890|62531890	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.998000|0.998000	0.95712|0.95712	1.756000|1.756000	0.38390|0.38390	0.620000|0.620000	0.30215|0.30215	0.655000|0.655000	0.94253|0.94253	GAC|CTA		0.393	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			39	91	0	0	0	0.007835	0	39	91				
HSP90AB3P	3327	broad.mit.edu	37	4	88814976	88814976	+	IGR	SNP	G	G	T	rs147160765	byFrequency	TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr4:88814976G>T								MEPE (47007 upstream) : SPP1 (81842 downstream)																							GTTTGAAACCGCCCTGCTATC	0.537																																							uc010iko.1		NA																	0					NA						c.(1603-1605)GCC>TCC		SubName: Full=Heat shock protein 90kDa alpha (Cytosolic), class B member 1, isoform CRA_a; SubName: Full=cDNA, FLJ92550, Homo sapiens heat shock 90kDa protein 1, beta (HSPCB), mRNA;																																				SO:0001628	intergenic_variant	0							g.chr4:88814976G>T																													4.37:g.88814976G>T							p.A535S							4	1603	+									Missense_Mutation	SNP		37	c.1603G>T																																																																																				0	0.537									104	180	1	0	1.07394e-59	0.00361	2.02397e-59	104	180				
ADH1C	126	broad.mit.edu	37	4	100260735	100260735	+	RNA	SNP	T	T	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr4:100260735T>A	ENST00000515683.1	-	0	1453					NM_000669.3	NP_000660.1	P00326	ADH1G_HUMAN	alcohol dehydrogenase 1C (class I), gamma polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|zinc ion binding (GO:0008270)								OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	AAAATCTACCTCTTTCCAGAG	0.393																																							uc003huu.2		NA																	0					0						c.(1102-1104)AGT>TGT		class I alcohol dehydrogenase, gamma subunit	Fomepizole(DB01213)|NADH(DB00157)						35.0	38.0	37.0					4																	100260735		2148	4289	6437			126	Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of			ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|zinc ion binding	g.chr4:100260735T>A	M12272		4q23	2010-03-16			ENSG00000248144	ENSG00000248144	1.1.1.1	"""Alcohol dehydrogenases"""	251	protein-coding gene	gene with protein product		103730		ADH3		3006456	Standard	NM_000669		Approved		uc031sgp.1	P00326	OTTHUMG00000161422		4.37:g.100260735T>A							p.S368C	NM_000669	NP_000660	P00326	ADH1G_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	10	1187	-			368					Q4PJ18|Q5WRV0|Q6LBW4|Q6NWV0|Q6NZA7	Missense_Mutation	SNP	ENST00000515683.1	37	c.1102A>T																																																																																					0.393	ADH1C-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000364877.2	NM_000669		9	14	0	0	0	0.006214	0	9	14				
SPATA5	166378	broad.mit.edu	37	4	123859322	123859323	+	Missense_Mutation	DNP	GT	GT	TA			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	GT	GT	-	-	GT	GT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr4:123859322_123859323GT>TA	ENST00000274008.4	+	8	1445_1446	c.1376_1377GT>TA	c.(1375-1377)tGT>tTA	p.C459L	SPATA5_ENST00000422835.2_3'UTR	NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	459					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						GATGCACTTTGTCCGAAAAGAG	0.351																																							uc003iez.3		NA																	0					0						c.(1375-1377)TGT>TTA		spermatogenesis associated 5																																				SO:0001583	missense	166378				cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity	g.chr4:123859322_123859323GT>TA	AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	Exception_encountered	4.37:g.123859322_123859323delinsTA	ENSP00000274008:p.Cys459Leu					SPATA5_uc003iey.2_Missense_Mutation_p.C458L	p.C459L	NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN			8	1449_1450	+			459					C9JT97|Q86XW1|Q8NI20|Q8TDL7	Missense_Mutation	DNP	ENST00000274008.4	37	c.1376_1377GT>TA	CCDS3730.1																																																																																				0.351	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256714.2	NM_145207		28	45	0	0	0	0.004672	0	28	45				
ZNF827	152485	broad.mit.edu	37	4	146791525	146791525	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr4:146791525C>T	ENST00000508784.1	-	5	2080	c.1853G>A	c.(1852-1854)aGc>aAc	p.S618N	ZNF827_ENST00000379448.4_Missense_Mutation_p.S618N|ZNF827_ENST00000511534.1_5'UTR|ZNF827_ENST00000513320.1_Missense_Mutation_p.S268N			Q17R98	ZN827_HUMAN	zinc finger protein 827	618					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					AGATTCCGGGCTGAACACATA	0.522																																							uc003ikn.2		NA																	0					0						c.(1852-1854)AGC>AAC		zinc finger protein 827							100.0	101.0	100.0					4																	146791525		2203	4300	6503	SO:0001583	missense	152485				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:146791525C>T	AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.1853G>A	4.37:g.146791525C>T	ENSP00000421863:p.Ser618Asn					ZNF827_uc003ikm.2_Missense_Mutation_p.S618N|ZNF827_uc010iox.2_Missense_Mutation_p.S268N	p.S618N	NM_178835	NP_849157	Q17R98	ZN827_HUMAN			5	1901	-	all_hematologic(180;0.151)		618					B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	ENST00000508784.1	37	c.1853G>A		.	.	.	.	.	.	.	.	.	.	C	10.18	1.280177	0.23392	.	.	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000281318;ENST00000440280	T;T;T	0.07908	3.22;3.15;3.25	5.14	3.39	0.38822	.	0.388027	0.35646	N	0.003071	T	0.02494	0.0076	N	0.00926	-1.1	0.28470	N	0.915482	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.39057	-0.9632	10	0.21014	T	0.42	-4.7227	8.8186	0.35011	0.0:0.706:0.0:0.294	.	268;618;618	G5E9Z1;Q17R98;Q17R98-2	.;ZN827_HUMAN;.	N	618;268;618;617;268	ENSP00000421863:S618N;ENSP00000423130:S268N;ENSP00000368761:S618N	ENSP00000281318:S617N	S	-	2	0	ZNF827	147010975	0.998000	0.40836	1.000000	0.80357	0.773000	0.43773	0.469000	0.22067	1.297000	0.44761	0.467000	0.42956	AGC		0.522	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835		4	82	0	0	0	0.000602	0	4	82				
NPY2R	4887	broad.mit.edu	37	4	156136042	156136042	+	Silent	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr4:156136042C>T	ENST00000329476.3	+	2	1440	c.951C>T	c.(949-951)tcC>tcT	p.S317S	NPY2R_ENST00000506608.1_Silent_p.S317S	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	317					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	CCATGTGCTCCACTTTTGCCA	0.522																																							uc003ioq.2		NA																	0				lung(2)|skin(1)	3						c.(949-951)TCC>TCT		neuropeptide Y receptor Y2							122.0	98.0	106.0					4																	156136042		2203	4300	6503	SO:0001819	synonymous_variant	4887				cardiac left ventricle morphogenesis|inhibition of adenylate cyclase activity by G-protein signaling pathway|locomotory behavior|outflow tract morphogenesis	integral to plasma membrane	calcium channel regulator activity	g.chr4:156136042C>T	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.951C>T	4.37:g.156136042C>T						NPY2R_uc003ior.2_Silent_p.S317S	p.S317S	NM_000910	NP_000901	P49146	NPY2R_HUMAN			2	1446	+	all_hematologic(180;0.24)	Renal(120;0.0854)	317			Helical; Name=7; (Potential).		Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Silent	SNP	ENST00000329476.3	37	c.951C>T	CCDS3791.1																																																																																				0.522	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910		24	54	0	0	0	0.004656	0	24	54				
DDX60L	91351	broad.mit.edu	37	4	169377304	169377304	+	Splice_Site	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr4:169377304C>A	ENST00000511577.1	-	7	971		c.e7-1		DDX60L_ENST00000260184.7_Splice_Site|DDX60L_ENST00000505890.1_Splice_Site			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TCTGATACGCCTATCAAAAAA	0.348																																							uc003irq.3		NA																	0				ovary(1)	1						c.e7-1		DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like							45.0	40.0	42.0					4																	169377304		1859	4098	5957	SO:0001630	splice_region_variant	91351						ATP binding|ATP-dependent helicase activity|RNA binding	g.chr4:169377304C>A	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.724-1G>T	4.37:g.169377304C>A						DDX60L_uc003irr.1_Splice_Site_p.A242_splice|DDX60L_uc003irs.1_Splice_Site	p.A242_splice	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN		GBM - Glioblastoma multiforme(119;0.175)	7	945	-		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)						Q96ND6	Splice_Site	SNP	ENST00000511577.1	37	c.724_splice		.	.	.	.	.	.	.	.	.	.	C	7.118	0.577344	0.13686	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890	.	.	.	3.62	3.62	0.41486	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9735	0.53078	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DDX60L	169613879	0.626000	0.27120	0.015000	0.15790	0.013000	0.08279	1.716000	0.37981	1.539000	0.49286	0.460000	0.39030	.		0.348	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	Intron	5	9	1	0	0.000602214	0.000602	0.000667613	5	9				
CLPTM1L	81037	broad.mit.edu	37	5	1323018	1323018	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:1323018G>T	ENST00000320895.5	-	13	1546	c.1289C>A	c.(1288-1290)tCc>tAc	p.S430Y	CLPTM1L_ENST00000507807.1_Missense_Mutation_p.S261Y|CLPTM1L_ENST00000320927.6_Missense_Mutation_p.S394Y|CLPTM1L_ENST00000506641.1_5'UTR	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	430					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		GATTAACCAGGAGTACCAGCT	0.373																																							uc003jch.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(1288-1290)TCC>TAC		CLPTM1-like							148.0	146.0	147.0					5																	1323018		2203	4300	6503	SO:0001583	missense	81037				apoptosis	integral to membrane		g.chr5:1323018G>T	AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.1289C>A	5.37:g.1323018G>T	ENSP00000313854:p.Ser430Tyr					CLPTM1L_uc003jcg.2_Missense_Mutation_p.S261Y	p.S430Y	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)	13	1335	-	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		430			Helical; (Potential).		D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	ENST00000320895.5	37	c.1289C>A	CCDS3862.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.353273	0.61293	.	.	ENSG00000049656	ENST00000320895;ENST00000507807;ENST00000320927	T;T;T	0.67865	-0.29;-0.04;-0.14	4.58	3.71	0.42584	.	0.000000	0.85682	D	0.000000	D	0.84723	0.5535	H	0.94222	3.51	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.68353	0.957;0.956	D	0.87784	0.2614	10	0.87932	D	0	-40.5561	11.8962	0.52658	0.088:0.0:0.912:0.0	.	430;261	Q96KA5;G5E9Z2	CLP1L_HUMAN;.	Y	430;261;394	ENSP00000313854:S430Y;ENSP00000423321:S261Y;ENSP00000315196:S394Y	ENSP00000313854:S430Y	S	-	2	0	CLPTM1L	1376018	1.000000	0.71417	0.541000	0.28102	0.905000	0.53344	8.574000	0.90763	1.040000	0.40099	0.491000	0.48974	TCC		0.373	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253649.2	NM_030782		82	85	1	0	9.72016e-57	0.00361	1.81789e-56	82	85				
CDH9	1007	broad.mit.edu	37	5	26988295	26988295	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:26988295C>A	ENST00000231021.4	-	2	318	c.146G>T	c.(145-147)cGt>cTt	p.R49L		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	49					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CTTGGTGCGACGTAGCATTTT	0.393																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	0				ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(145-147)CGT>CTT		cadherin 9, type 2 preproprotein							124.0	118.0	120.0					5																	26988295		2203	4300	6503	SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26988295C>A	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.146G>T	5.37:g.26988295C>A	ENSP00000231021:p.Arg49Leu					CDH9_uc010iug.2_Missense_Mutation_p.R49L	p.R49L	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN			2	315	-			49					Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.146G>T	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.844693	0.51164	.	.	ENSG00000113100	ENST00000231021;ENST00000513289;ENST00000511822	T;T;T	0.00330	8.08;8.08;8.08	5.64	-1.85	0.07784	.	0.314890	0.34156	N	0.004212	T	0.00144	0.0004	N	0.12182	0.205	0.24656	N	0.993495	B;B	0.26120	0.142;0.001	B;B	0.26517	0.07;0.005	T	0.35051	-0.9804	9	.	.	.	.	13.8653	0.63585	0.0:0.1416:0.0:0.8584	.	49;49	E7EPN0;Q9ULB4	.;CADH9_HUMAN	L	49	ENSP00000231021:R49L;ENSP00000426239:R49L;ENSP00000422538:R49L	.	R	-	2	0	CDH9	27024052	0.125000	0.22332	0.714000	0.30535	0.951000	0.60555	-0.100000	0.10990	-0.121000	0.11787	0.591000	0.81541	CGT		0.393	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		15	45	1	0	2.32078e-09	0.003163	3.09018e-09	15	45				
C9	735	broad.mit.edu	37	5	39316014	39316014	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:39316014G>T	ENST00000263408.4	-	6	828	c.733C>A	c.(733-735)Ccc>Acc	p.P245T	C9_ENST00000509186.1_5'UTR	NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	245	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			GTTTCAGTGGGTGTAAATTTT	0.333																																							uc003jlv.3		NA																	0					0						c.(733-735)CCC>ACC		complement component 9 precursor							117.0	116.0	116.0					5																	39316014		2203	4299	6502	SO:0001583	missense	735				complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex		g.chr5:39316014G>T		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.733C>A	5.37:g.39316014G>T	ENSP00000263408:p.Pro245Thr						p.P245T	NM_001737	NP_001728	P02748	CO9_HUMAN	Epithelial(62;0.158)		6	822	-	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	245			MACPF.			Missense_Mutation	SNP	ENST00000263408.4	37	c.733C>A	CCDS3929.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536350	0.27475	.	.	ENSG00000113600	ENST00000263408	T	0.30182	1.54	5.56	2.72	0.32119	Membrane attack complex component/perforin (MACPF) domain (1);	5.913700	0.00465	N	0.000102	T	0.26557	0.0649	N	0.22421	0.69	0.09310	N	0.999994	D	0.59767	0.986	P	0.44597	0.454	T	0.20739	-1.0266	10	0.41790	T	0.15	-4.8456	7.3151	0.26495	0.0721:0.1242:0.6756:0.1281	.	245	P02748	CO9_HUMAN	T	245	ENSP00000263408:P245T	ENSP00000263408:P245T	P	-	1	0	C9	39351771	0.256000	0.24012	0.003000	0.11579	0.453000	0.32348	2.478000	0.45189	0.800000	0.34041	0.655000	0.94253	CCC		0.333	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211576.3			20	65	1	0	1.01871e-10	0.008871	1.39433e-10	20	65				
C7	730	broad.mit.edu	37	5	40955608	40955608	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:40955608G>T	ENST00000313164.9	+	10	1572	c.1213G>T	c.(1213-1215)Gcc>Tcc	p.A405S		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	405	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				GCGATATTCTGCCTGGGCAGA	0.448																																							uc003jmh.2		NA																	0					0						c.(1213-1215)GCC>TCC		complement component 7 precursor							105.0	103.0	103.0					5																	40955608		1869	4111	5980	SO:0001583	missense	730				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex		g.chr5:40955608G>T	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1213G>T	5.37:g.40955608G>T	ENSP00000322061:p.Ala405Ser					C7_uc011cpn.1_RNA	p.A405S	NM_000587	NP_000578	P10643	CO7_HUMAN			10	1327	+		Ovarian(839;0.0112)	405			MACPF.		Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	c.1213G>T	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	G	0.172	-1.070313	0.01918	.	.	ENSG00000112936	ENST00000313164;ENST00000440677	D	0.83837	-1.77	5.26	-10.5	0.00291	Membrane attack complex component/perforin (MACPF) domain (3);	1.572370	0.03343	N	0.195003	T	0.44644	0.1303	N	0.00793	-1.18	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49881	-0.8892	10	0.02654	T	1	12.9035	3.7402	0.08527	0.1872:0.1844:0.0838:0.5447	.	405	P10643	CO7_HUMAN	S	405;245	ENSP00000322061:A405S	ENSP00000322061:A405S	A	+	1	0	C7	40991365	0.000000	0.05858	0.000000	0.03702	0.710000	0.40934	-0.976000	0.03786	-2.516000	0.00500	-0.152000	0.13540	GCC		0.448	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			77	83	1	0	2.43199e-30	0.00361	4.25598e-30	77	83				
HCN1	348980	broad.mit.edu	37	5	45262540	45262540	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:45262540T>C	ENST00000303230.4	-	8	2213	c.2156A>G	c.(2155-2157)tAt>tGt	p.Y719C		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	719					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						GGGGGAGGCATAGTGGAAAGT	0.657																																							uc003jok.2		NA																	0				ovary(1)	1						c.(2155-2157)TAT>TGT		hyperpolarization activated cyclic							40.0	40.0	40.0					5																	45262540		2203	4300	6503	SO:0001583	missense	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45262540T>C	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2156A>G	5.37:g.45262540T>C	ENSP00000307342:p.Tyr719Cys						p.Y719C	NM_021072	NP_066550	O60741	HCN1_HUMAN			8	2181	-			719			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000303230.4	37	c.2156A>G	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.612550	0.66672	.	.	ENSG00000164588	ENST00000303230	T	0.76448	-1.02	5.52	5.52	0.82312	.	0.000000	0.56097	D	0.000023	D	0.84179	0.5415	L	0.55481	1.735	0.58432	D	0.999991	D	0.76494	0.999	D	0.66602	0.945	T	0.83202	-0.0078	10	0.35671	T	0.21	.	15.6564	0.77140	0.0:0.0:0.0:1.0	.	719	O60741	HCN1_HUMAN	C	719	ENSP00000307342:Y719C	ENSP00000307342:Y719C	Y	-	2	0	HCN1	45298297	1.000000	0.71417	0.980000	0.43619	0.989000	0.77384	6.086000	0.71352	2.100000	0.63781	0.533000	0.62120	TAT		0.657	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		29	26	0	0	0	0.007291	0	29	26				
GZMK	3003	broad.mit.edu	37	5	54326372	54326372	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:54326372T>A	ENST00000231009.2	+	3	393	c.323T>A	c.(322-324)gTt>gAt	p.V108D	CTD-2313F11.1_ENST00000609699.1_RNA|CTD-2313F11.1_ENST00000595218.1_RNA|CTD-2313F11.1_ENST00000608466.1_RNA|CTD-2313F11.1_ENST00000596137.1_RNA|CTD-2313F11.1_ENST00000608929.1_RNA|CTD-2313F11.1_ENST00000609792.1_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	108	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				TTCTCAAGAGTTACATCAGAT	0.398																																							uc003jpl.1		NA																	0					0						c.(322-324)GTT>GAT		granzyme K precursor							151.0	147.0	148.0					5																	54326372		2203	4300	6503	SO:0001583	missense	3003				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr5:54326372T>A	BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	ENST00000231009.2:c.323T>A	5.37:g.54326372T>A	ENSP00000231009:p.Val108Asp						p.V108D	NM_002104	NP_002095	P49863	GRAK_HUMAN			3	367	+		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)	108			Peptidase S1.		B2R563	Missense_Mutation	SNP	ENST00000231009.2	37	c.323T>A	CCDS3964.1	.	.	.	.	.	.	.	.	.	.	T	9.962	1.223049	0.22457	.	.	ENSG00000113088	ENST00000231009	D	0.89617	-2.54	4.23	1.72	0.24424	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.459547	0.23086	N	0.052097	T	0.76198	0.3954	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.66901	-0.5806	10	0.87932	D	0	.	6.8321	0.23915	0.3772:0.0:0.0:0.6228	.	108	P49863	GRAK_HUMAN	D	108	ENSP00000231009:V108D	ENSP00000231009:V108D	V	+	2	0	GZMK	54362129	0.001000	0.12720	0.002000	0.10522	0.054000	0.15201	0.611000	0.24268	0.362000	0.24319	-0.327000	0.08410	GTT		0.398	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214098.1	NM_002104		32	52	0	0	0	0.012213	0	32	52				
WDR41	55255	broad.mit.edu	37	5	76736805	76736805	+	Missense_Mutation	SNP	C	C	T	rs375379215		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:76736805C>T	ENST00000296679.4	-	9	1090	c.715G>A	c.(715-717)Ggc>Agc	p.G239S	WDR41_ENST00000507029.1_Missense_Mutation_p.G184S|WDR41_ENST00000414719.2_5'UTR	NM_018268.2	NP_060738.2	Q9HAD4	WDR41_HUMAN	WD repeat domain 41	239						lysosomal membrane (GO:0005765)				NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)	14		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)		ACGTGGGAGCCGGTGACAAAA	0.463																																							uc003kff.1		NA																	0					0						c.(715-717)GGC>AGC		WD repeat domain 41		C	SER/GLY	0,4406		0,0,2203	88.0	85.0	86.0		715	5.9	1.0	5		86	1,8599	1.2+/-3.3	0,1,4299	no	missense	WDR41	NM_018268.2	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	239/460	76736805	1,13005	2203	4300	6503	SO:0001583	missense	55255							g.chr5:76736805C>T	AF115511	CCDS4038.1	5q14	2013-01-09			ENSG00000164253	ENSG00000164253		"""WD repeat domain containing"""	25601	protein-coding gene	gene with protein product						12477932	Standard	NM_018268		Approved	FLJ10904	uc003kff.1	Q9HAD4	OTTHUMG00000102169	ENST00000296679.4:c.715G>A	5.37:g.76736805C>T	ENSP00000296679:p.Gly239Ser					WDR41_uc011csy.1_Missense_Mutation_p.G181S|WDR41_uc011csz.1_Missense_Mutation_p.G184S|WDR41_uc011cta.1_RNA|WDR41_uc011ctb.1_RNA	p.G239S	NM_018268	NP_060738	Q9HAD4	WDR41_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)	9	1002	-		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)	239			WD 4.		B4DT55|Q7Z792|Q8IWG3|Q8IXA9|Q8NDA7|Q9NV62	Missense_Mutation	SNP	ENST00000296679.4	37	c.715G>A	CCDS4038.1	.	.	.	.	.	.	.	.	.	.	C	34	5.410617	0.96072	0.0	1.16E-4	ENSG00000164253	ENST00000296679;ENST00000515253;ENST00000507029;ENST00000507654;ENST00000511791	T;T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.45;2.13	5.95	5.95	0.96441	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83339	0.5233	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;P	0.67725	0.953;0.868	T	0.82566	-0.0393	10	0.54805	T	0.06	-9.4273	20.3775	0.98923	0.0:1.0:0.0:0.0	.	184;239	B4DT55;Q9HAD4	.;WDR41_HUMAN	S	239;174;184;10;31	ENSP00000296679:G239S;ENSP00000426499:G174S;ENSP00000424287:G184S;ENSP00000427291:G10S;ENSP00000423540:G31S	ENSP00000296679:G239S	G	-	1	0	WDR41	76772561	1.000000	0.71417	0.984000	0.44739	0.945000	0.59286	6.949000	0.75971	2.825000	0.97269	0.650000	0.86243	GGC		0.463	WDR41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220014.2	NM_018268		6	49	0	0	0	0.001984	0	6	49				
PPIP5K2	23262	broad.mit.edu	37	5	102465308	102465308	+	Silent	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:102465308C>T	ENST00000358359.3	+	2	524	c.15C>T	c.(13-15)ccC>ccT	p.P5P	PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000414217.1_Silent_p.P5P|PPIP5K2_ENST00000321521.9_Silent_p.P5P	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	5					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GTGAAGCCCCCAGATTCTTCG	0.343																																							uc003kod.3		NA																	0				ovary(1)|skin(1)	2						c.(13-15)CCC>CCT		Histidine acid phosphatase domain containing 1							70.0	67.0	68.0					5																	102465308		2203	4300	6503	SO:0001819	synonymous_variant	23262				inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity	g.chr5:102465308C>T	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.15C>T	5.37:g.102465308C>T						PPIP5K2_uc011cva.1_RNA|PPIP5K2_uc003koe.2_Silent_p.P5P|PPIP5K2_uc010jbo.1_Intron	p.P5P	NM_015216	NP_056031	O43314	VIP2_HUMAN			2	534	+			5					A1NI53|A6NGS8|Q8TB50	Silent	SNP	ENST00000358359.3	37	c.15C>T																																																																																					0.343	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216		8	7	0	0	0	0.00308	0	8	7				
SLC6A7	6534	broad.mit.edu	37	5	149574475	149574475	+	Splice_Site	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:149574475G>T	ENST00000230671.2	+	2	588		c.e2+1		SLC6A7_ENST00000524041.1_Splice_Site	NM_014228.3	NP_055043.2	Q99884	SC6A7_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 7						proline transport (GO:0015824)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)|stomach(1)	16		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	AATGGAGGAGGTATGGGCCTG	0.602																																							uc003lrr.2		NA																	0					0						c.e2+1		solute carrier family 6, member 7	L-Proline(DB00172)						83.0	81.0	82.0					5																	149574475		2203	4300	6503	SO:0001630	splice_region_variant	6534					integral to plasma membrane|membrane fraction	neurotransmitter:sodium symporter activity|proline:sodium symporter activity	g.chr5:149574475G>T	S80071	CCDS4305.1	5q32	2013-07-19	2013-07-19		ENSG00000011083	ENSG00000011083		"""Solute carriers"""	11054	protein-coding gene	gene with protein product	"""brain-specific L-proline transporter"", ""sodium-dependent proline transporter"""	606205	"""solute carrier family 6 (neurotransmitter transporter, L-proline), member 7"""			7651355	Standard	NM_014228		Approved	PROT	uc003lrr.3	Q99884	OTTHUMG00000130046	ENST00000230671.2:c.217+1G>T	5.37:g.149574475G>T							p.G73_splice	NM_014228	NP_055043	Q99884	SC6A7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		2	588	+		all_hematologic(541;0.224)						Q0VG81|Q52LU6	Splice_Site	SNP	ENST00000230671.2	37	c.217_splice	CCDS4305.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166070	0.78339	.	.	ENSG00000011083	ENST00000230671;ENST00000524041	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0852	0.97797	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC6A7	149554668	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	9.751000	0.98889	2.756000	0.94617	0.561000	0.74099	.		0.602	SLC6A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252325.1	NM_014228	Intron	20	74	1	0	4.54149e-19	0.002299	7.56914e-19	20	74				
KIF4B	285643	broad.mit.edu	37	5	154396339	154396339	+	Silent	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:154396339C>A	ENST00000435029.4	+	1	3080	c.2920C>A	c.(2920-2922)Cga>Aga	p.R974R		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	974	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGAGAAGATGCGAGAAGTGTG	0.463																																							uc010jih.1		NA																	0				ovary(1)	1						c.(2920-2922)CGA>AGA		kinesin family member 4B							140.0	137.0	138.0					5																	154396339		2203	4300	6503	SO:0001819	synonymous_variant	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154396339C>A	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2920C>A	5.37:g.154396339C>A							p.R974R	NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	3080	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	974			Interaction with PRC1 (By similarity).|Potential.			Silent	SNP	ENST00000435029.4	37	c.2920C>A	CCDS47324.1																																																																																				0.463	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			21	94	1	0	4.35082e-09	0.010504	5.76189e-09	21	94				
ZBED8	63920	broad.mit.edu	37	5	159821008	159821008	+	Missense_Mutation	SNP	T	T	G			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:159821008T>G	ENST00000408953.3	-	2	1997	c.1490A>C	c.(1489-1491)gAa>gCa	p.E497A	C5orf54_ENST00000523213.1_Missense_Mutation_p.E497A	NM_022090.3	NP_071373.2														breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	12						agctcgtaattcagcaagatc	0.353																																							uc003lye.1		NA																	0				pancreas(1)	1						c.(1489-1491)GAA>GCA		transposon-derived Buster3 transposase-like							72.0	72.0	72.0					5																	159821008		2203	4300	6503	SO:0001583	missense	63920							g.chr5:159821008T>G																												ENST00000408953.3:c.1490A>C	5.37:g.159821008T>G	ENSP00000386184:p.Glu497Ala					C5orf54_uc003lyf.1_Missense_Mutation_p.E497A	p.E497A	NM_022090	NP_071373	Q8IZ13	CE054_HUMAN			2	1954	-			497						Missense_Mutation	SNP	ENST00000408953.3	37	c.1490A>C	CCDS34283.1	.	.	.	.	.	.	.	.	.	.	T	14.17	2.454044	0.43634	.	.	ENSG00000221886	ENST00000408953;ENST00000523213	T;T	0.21734	1.99;1.99	3.01	3.01	0.34805	.	.	.	.	.	T	0.22399	0.0540	L	0.36672	1.1	0.25267	N	0.989545	D	0.61697	0.99	P	0.49953	0.627	T	0.06267	-1.0836	9	0.59425	D	0.04	.	7.8388	0.29387	0.0:0.0:0.0:1.0	.	497	Q8IZ13	CE054_HUMAN	A	497	ENSP00000386184:E497A;ENSP00000428831:E497A	ENSP00000386184:E497A	E	-	2	0	C5orf54	159753586	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.327000	0.43858	1.629000	0.50426	0.533000	0.62120	GAA		0.353	C5orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374143.1			4	68	0	0	0	0.009096	0	4	68				
ATP10B	23120	broad.mit.edu	37	5	160097648	160097648	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:160097648C>A	ENST00000327245.5	-	7	1343	c.497G>T	c.(496-498)tGc>tTc	p.C166F		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	166					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATCCTTCCAGCACTTCTGCAC	0.458																																							uc003lym.1		NA																	0				ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(496-498)TGC>TTC		ATPase, class V, type 10B							124.0	127.0	126.0					5																	160097648		2032	4196	6228	SO:0001583	missense	23120				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr5:160097648C>A	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.497G>T	5.37:g.160097648C>A	ENSP00000313600:p.Cys166Phe					ATP10B_uc003lyp.2_Missense_Mutation_p.C166F|ATP10B_uc011deg.1_Missense_Mutation_p.C210F|ATP10B_uc003lyo.2_Missense_Mutation_p.C138F	p.C166F	NM_025153	NP_079429	O94823	AT10B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		7	1344	-	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	166			Cytoplasmic (Potential).		Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	c.497G>T	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.560872	0.00910	.	.	ENSG00000118322	ENST00000327245	T	0.74315	-0.83	5.13	-0.426	0.12314	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.929827	0.09187	N	0.836644	T	0.64011	0.2560	N	0.16130	0.375	0.30262	N	0.793051	B;B;B;P	0.47484	0.037;0.004;0.007;0.896	B;B;B;P	0.52267	0.055;0.012;0.012;0.694	T	0.60021	-0.7344	9	.	.	.	.	6.9355	0.24464	0.0:0.5718:0.1224:0.3058	.	210;166;138;166	B4DHG1;O94823-2;O94823-3;O94823	.;.;.;AT10B_HUMAN	F	166	ENSP00000313600:C166F	.	C	-	2	0	ATP10B	160030226	0.570000	0.26651	0.182000	0.23118	0.061000	0.15899	1.255000	0.32909	0.044000	0.15775	-1.544000	0.00907	TGC		0.458	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153		28	96	1	0	5.90632e-09	0.012213	7.73823e-09	28	96				
CDHR2	54825	broad.mit.edu	37	5	176012970	176012970	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:176012970C>A	ENST00000510636.1	+	20	3024	c.2750C>A	c.(2749-2751)aCc>aAc	p.T917N	CDHR2_ENST00000506348.1_Missense_Mutation_p.T917N|CDHR2_ENST00000261944.5_Missense_Mutation_p.T917N	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	917	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CTCCTCATTACCATTGAGGAC	0.522																																							uc003mem.1		NA																	0				ovary(2)	2						c.(2749-2751)ACC>AAC		protocadherin LKC precursor							116.0	104.0	108.0					5																	176012970		2203	4300	6503	SO:0001583	missense	54825				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding	g.chr5:176012970C>A	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.2750C>A	5.37:g.176012970C>A	ENSP00000424565:p.Thr917Asn					CDHR2_uc003men.1_Missense_Mutation_p.T917N	p.T917N	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN			20	2816	+			917			Extracellular (Potential).|Cadherin 8.		A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	c.2750C>A	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	C	0.410	-0.913624	0.02415	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.56941	0.43;0.43;0.43	4.72	2.76	0.32466	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.33118	0.0852	L	0.31157	0.91	0.22226	N	0.999274	B	0.09022	0.002	B	0.08055	0.003	T	0.16100	-1.0414	9	0.22706	T	0.39	-29.7096	2.0262	0.03519	0.3369:0.3893:0.1541:0.1197	.	917	Q9BYE9	CDHR2_HUMAN	N	917	ENSP00000424565:T917N;ENSP00000261944:T917N;ENSP00000421078:T917N	ENSP00000261944:T917N	T	+	2	0	CDHR2	175945576	0.991000	0.36638	0.999000	0.59377	0.096000	0.18686	0.318000	0.19504	0.912000	0.36772	0.478000	0.44815	ACC		0.522	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675		18	74	1	0	1.50039e-11	0.012319	2.10055e-11	18	74				
BTN3A2	11118	broad.mit.edu	37	6	26368879	26368879	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr6:26368879A>G	ENST00000356386.2	+	4	360	c.172A>G	c.(172-174)Atg>Gtg	p.M58V	BTN3A2_ENST00000532994.1_Intron|BTN3A2_ENST00000377708.2_Missense_Mutation_p.M58V|BTN3A2_ENST00000396934.3_Missense_Mutation_p.M35V|BTN3A2_ENST00000527422.1_Missense_Mutation_p.M58V|BTN3A2_ENST00000508906.2_Missense_Mutation_p.M16V|BTN3A2_ENST00000396948.1_Missense_Mutation_p.M58V	NM_001197246.2|NM_001197247.1|NM_007047.3	NP_001184175.1|NP_001184176.1|NP_008978.2	P78410	BT3A2_HUMAN	butyrophilin, subfamily 3, member A2	58	Ig-like V-type.				interferon-gamma secretion (GO:0072643)|T cell mediated immunity (GO:0002456)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)	10						GTTCCCGACCATGAGTGCAGA	0.562																																							uc010jqh.1		NA																	0					0						c.(172-174)ATG>GTG		butyrophilin, subfamily 3, member A2 precursor							246.0	185.0	206.0					6																	26368879		2202	4297	6499	SO:0001583	missense	11118					integral to membrane		g.chr6:26368879A>G	U90546	CCDS4605.1, CCDS56399.1, CCDS56400.1	6p22.1	2014-01-14			ENSG00000186470	ENSG00000186470		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1139	protein-coding gene	gene with protein product		613594				9149941	Standard	NM_007047		Approved	BTN3.2	uc010jqi.2	P78410	OTTHUMG00000014450	ENST00000356386.2:c.172A>G	6.37:g.26368879A>G	ENSP00000348751:p.Met58Val					BTN3A2_uc003nho.1_Missense_Mutation_p.M56V|BTN3A2_uc003nhp.2_Missense_Mutation_p.M58V|BTN3A2_uc011dkd.1_Missense_Mutation_p.M16V|BTN3A2_uc011dke.1_Missense_Mutation_p.M35V|BTN3A2_uc010jqi.1_Missense_Mutation_p.M56V	p.M58V	NM_007047	NP_008978	P78410	BT3A2_HUMAN			4	431	+			58			Ig-like V-type.|Extracellular (Potential).		B4DRT7|B4E103|F5H791|F8W6E0|O00477|O15338|O75658|Q76PA0|Q9BU81|Q9NR44	Missense_Mutation	SNP	ENST00000356386.2	37	c.172A>G	CCDS4605.1	.	.	.	.	.	.	.	.	.	.	a	5.212	0.224631	0.09916	.	.	ENSG00000186470	ENST00000532865;ENST00000530653;ENST00000527417;ENST00000535620;ENST00000527422;ENST00000356386;ENST00000396934;ENST00000377708;ENST00000396948;ENST00000508906	T;T;T;T;T;T;T;T;T	0.02446	4.29;4.29;4.29;4.29;4.29;4.29;4.29;4.29;4.29	3.17	-1.29	0.09288	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.02494	0.0076	L	0.41356	1.27	0.09310	N	1	D;D	0.60575	0.986;0.988	D;D	0.74348	0.971;0.983	T	0.43180	-0.9407	9	0.38643	T	0.18	.	6.4221	0.21750	0.6188:0.0:0.3812:0.0	.	35;58	F8W6E0;P78410	.;BT3A2_HUMAN	V	16;16;58;58;58;58;35;58;58;16	ENSP00000435952:M16V;ENSP00000434102:M16V;ENSP00000433749:M58V;ENSP00000432138:M58V;ENSP00000348751:M58V;ENSP00000380140:M35V;ENSP00000366937:M58V;ENSP00000380152:M58V;ENSP00000442687:M16V	ENSP00000348751:M58V	M	+	1	0	BTN3A2	26476858	0.000000	0.05858	0.001000	0.08648	0.162000	0.22319	-0.252000	0.08806	-0.363000	0.08101	0.333000	0.21579	ATG		0.562	BTN3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040113.2			43	168	0	0	0	0.00361	0	43	168				
HIST1H1B	3009	broad.mit.edu	37	6	27834657	27834657	+	Missense_Mutation	SNP	C	C	G	rs200074459		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr6:27834657C>G	ENST00000331442.3	-	1	702	c.651G>C	c.(649-651)aaG>aaC	p.K217N		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	217				Missing (in Ref. 5; AA sequence). {ECO:0000305}.	chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						CCTTCTTGGCCTTTGCAGCTT	0.527																																							uc003njx.2		NA																	0				large_intestine(2)|lung(1)	3						c.(649-651)AAG>AAC		histone cluster 1, H1b							54.0	49.0	51.0					6																	27834657		2203	4300	6503	SO:0001583	missense	3009				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27834657C>G	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.651G>C	6.37:g.27834657C>G	ENSP00000330074:p.Lys217Asn						p.K217N	NM_005322	NP_005313	P16401	H15_HUMAN			1	703	-			217	Missing (in Ref. 5; AA sequence).				Q14529|Q3MJ42	Missense_Mutation	SNP	ENST00000331442.3	37	c.651G>C	CCDS4635.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.208820	0.39003	.	.	ENSG00000184357	ENST00000331442	T	0.04758	3.56	4.79	4.79	0.61399	.	0.053637	0.64402	D	0.000001	T	0.01029	0.0034	N	0.08118	0	0.45899	D	0.998748	P	0.44627	0.839	B	0.38056	0.264	T	0.63717	-0.6574	10	0.21014	T	0.42	-5.6145	9.6232	0.39734	0.0:0.8364:0.0:0.1636	.	217	P16401	H15_HUMAN	N	217	ENSP00000330074:K217N	ENSP00000330074:K217N	K	-	3	2	HIST1H1B	27942636	0.875000	0.30112	0.641000	0.29422	0.763000	0.43281	1.065000	0.30592	2.600000	0.87896	0.655000	0.94253	AAG		0.527	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322		17	24	0	0	0	0.00499	0	17	24				
GRM4	2914	broad.mit.edu	37	6	34008365	34008365	+	Silent	SNP	G	G	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr6:34008365G>C	ENST00000538487.2	-	7	1772	c.1329C>G	c.(1327-1329)ggC>ggG	p.G443G	GRM4_ENST00000374181.4_Silent_p.G443G|GRM4_ENST00000609222.1_Silent_p.G310G|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000374177.3_Silent_p.G327G|GRM4_ENST00000535756.1_Silent_p.G310G|GRM4_ENST00000544773.2_Silent_p.G274G|GRM4_ENST00000455714.2_Silent_p.G303G	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	443					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GCAGCTGGGTGCCATCTACAG	0.657																																							uc003oir.3		NA																	0				lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6						c.(1327-1329)GGC>GGG		glutamate receptor, metabotropic 4 precursor	L-Glutamic Acid(DB00142)						81.0	77.0	78.0					6																	34008365		2202	4300	6502	SO:0001819	synonymous_variant	2914				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:34008365G>C	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.1329C>G	6.37:g.34008365G>C						GRM4_uc011dsn.1_Silent_p.G396G|GRM4_uc010jvh.2_Silent_p.G443G|GRM4_uc010jvi.2_Silent_p.G135G|GRM4_uc003oio.2_Silent_p.G135G|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Silent_p.G303G|GRM4_uc003oiq.2_Silent_p.G310G|GRM4_uc011dsm.1_Silent_p.G274G	p.G443G	NM_000841	NP_000832	Q14833	GRM4_HUMAN			6	1499	-			443			Extracellular (Potential).		B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Silent	SNP	ENST00000538487.2	37	c.1329C>G	CCDS4787.1																																																																																				0.657	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2			13	26	0	0	0	0.001855	0	13	26				
UBR2	23304	broad.mit.edu	37	6	42541664	42541664	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr6:42541664C>G	ENST00000372899.1	+	2	529	c.271C>G	c.(271-273)Caa>Gaa	p.Q91E	UBR2_ENST00000372901.1_Missense_Mutation_p.Q91E|UBR2_ENST00000372903.2_Missense_Mutation_p.Q91E	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	91					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			AAAACTTGAGCAAGCAAACAA	0.398																																							uc011dur.1		NA																	0				ovary(3)|pancreas(1)	4						c.(271-273)CAA>GAA		ubiquitin protein ligase E3 component n-recognin							122.0	117.0	119.0					6																	42541664		2203	4300	6503	SO:0001583	missense	23304				cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding	g.chr6:42541664C>G	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.271C>G	6.37:g.42541664C>G	ENSP00000361990:p.Gln91Glu					UBR2_uc003osf.2_Missense_Mutation_p.Q91E	p.Q91E	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		2	271	+	Colorectal(47;0.196)		91					O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	c.271C>G	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850483	0.32699	.	.	ENSG00000024048	ENST00000372903;ENST00000372899;ENST00000372901	T;T;T	0.71579	-0.58;0.42;0.42	5.53	5.53	0.82687	.	0.056291	0.64402	D	0.000001	T	0.47673	0.1458	L	0.47190	1.495	0.80722	D	1	B;B	0.11235	0.004;0.002	B;B	0.14578	0.005;0.011	T	0.55431	-0.8142	10	0.05620	T	0.96	-13.7698	19.4647	0.94932	0.0:1.0:0.0:0.0	.	91;91	Q8IWV8;Q8IWV8-2	UBR2_HUMAN;.	E	91	ENSP00000361994:Q91E;ENSP00000361990:Q91E;ENSP00000361992:Q91E	ENSP00000361990:Q91E	Q	+	1	0	UBR2	42649642	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.376000	0.44292	2.592000	0.87571	0.655000	0.94253	CAA		0.398	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255		26	65	0	0	0	0.005443	0	26	65				
INTS1	26173	broad.mit.edu	37	7	1526614	1526614	+	Missense_Mutation	SNP	A	A	G	rs570441897		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr7:1526614A>G	ENST00000404767.3	-	21	2855	c.2770T>C	c.(2770-2772)Tcc>Ccc	p.S924P	INTS1_ENST00000389470.4_Missense_Mutation_p.S1067P	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	924					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		TCCTCCCCGGAAGCAGCATCG	0.687													a|||	1	0.000199681	0.0008	0.0	5008	,	,		12923	0.0		0.0	False		,,,				2504	0.0						uc003skn.2		NA																	0					0						c.(2770-2772)TCC>CCC		integrator complex subunit 1							45.0	50.0	48.0					7																	1526614		2186	4266	6452	SO:0001583	missense	26173				snRNA processing	integral to membrane|integrator complex|nuclear membrane		g.chr7:1526614A>G	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.2770T>C	7.37:g.1526614A>G	ENSP00000385722:p.Ser924Pro					INTS1_uc003skp.1_Missense_Mutation_p.S271P	p.S924P	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)	21	2871	-		Ovarian(82;0.0253)	924					A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	37	c.2770T>C	CCDS47526.1	.	.	.	.	.	.	.	.	.	.	A	3.539	-0.094115	0.07053	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.47869	0.83;0.87	4.44	3.26	0.37387	.	0.276491	0.36972	N	0.002315	T	0.22513	0.0543	N	0.04508	-0.205	0.32507	N	0.538121	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.10683	-1.0619	10	0.41790	T	0.15	.	6.5974	0.22681	0.6844:0.1612:0.0:0.1544	.	1073;924	A4D213;Q8N201	.;INT1_HUMAN	P	924;1067	ENSP00000385722:S924P;ENSP00000374121:S1067P	ENSP00000374121:S1067P	S	-	1	0	INTS1	1493140	1.000000	0.71417	0.009000	0.14445	0.014000	0.08584	3.656000	0.54467	0.560000	0.29169	0.529000	0.55759	TCC		0.687	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1			3	14	0	0	0	0.004672	0	3	14				
SNX8	29886	broad.mit.edu	37	7	2297100	2297100	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr7:2297100G>A	ENST00000222990.3	-	9	1076	c.1034C>T	c.(1033-1035)gCc>gTc	p.A345V		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	345					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		CTTGTGCAGGGCCCGCTGGTG	0.672																																							uc003slw.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1033-1035)GCC>GTC		sorting nexin 8							44.0	41.0	42.0					7																	2297100		2201	4296	6497	SO:0001583	missense	29886				cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding	g.chr7:2297100G>A	AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.1034C>T	7.37:g.2297100G>A	ENSP00000222990:p.Ala345Val						p.A345V	NM_013321	NP_037453	Q9Y5X2	SNX8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)	9	1077	-		Ovarian(82;0.11)	345					A4D207|Q96I67	Missense_Mutation	SNP	ENST00000222990.3	37	c.1034C>T	CCDS5331.1	.	.	.	.	.	.	.	.	.	.	G	35	5.507051	0.96386	.	.	ENSG00000106266	ENST00000222990	T	0.22539	1.95	5.16	5.16	0.70880	.	0.061302	0.64402	D	0.000004	T	0.32071	0.0817	M	0.70275	2.135	0.58432	D	0.999998	P	0.38420	0.63	B	0.41466	0.358	T	0.06481	-1.0824	10	0.37606	T	0.19	.	18.6288	0.91352	0.0:0.0:1.0:0.0	.	345	Q9Y5X2	SNX8_HUMAN	V	345	ENSP00000222990:A345V	ENSP00000222990:A345V	A	-	2	0	SNX8	2263626	1.000000	0.71417	0.745000	0.31077	0.868000	0.49771	9.215000	0.95146	2.402000	0.81655	0.561000	0.74099	GCC		0.672	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322949.2			6	4	0	0	0	0.001168	0	6	4				
ABCB5	340273	broad.mit.edu	37	7	20668317	20668317	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr7:20668317T>C	ENST00000404938.2	+	4	767	c.115T>C	c.(115-117)Ttt>Ctt	p.F39L		NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	39					antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						TCAGTTCCGCTTTGCTGATGG	0.473																																							uc010kuh.2		NA																	0				skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						c.(115-117)TTT>CTT		ATP-binding cassette, sub-family B, member 5							146.0	121.0	129.0					7																	20668317		1568	3582	5150	SO:0001583	missense	340273				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity	g.chr7:20668317T>C	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.115T>C	7.37:g.20668317T>C	ENSP00000384881:p.Phe39Leu						p.F39L	NM_001163941	NP_001157413	Q2M3G0	ABCB5_HUMAN			4	352	+			692			Cytoplasmic (Potential).|ABC transporter 2.		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	c.115T>C	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	T	15.42	2.827896	0.50845	.	.	ENSG00000004846	ENST00000404938	T	0.79033	-1.23	4.29	4.29	0.51040	.	.	.	.	.	T	0.73040	0.3536	N	0.08118	0	0.80722	D	1	D	0.64830	0.994	D	0.63488	0.915	T	0.76958	-0.2766	9	0.66056	D	0.02	.	10.4067	0.44260	0.0:0.0:0.0:1.0	.	39	A7BKA4	.	L	39	ENSP00000384881:F39L	ENSP00000384881:F39L	F	+	1	0	ABCB5	20634842	1.000000	0.71417	1.000000	0.80357	0.127000	0.20565	3.709000	0.54853	1.892000	0.54788	0.377000	0.23210	TTT		0.473	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559		15	15	0	0	0	0.00245	0	15	15				
DPY19L2P1	554236	broad.mit.edu	37	7	35142594	35142594	+	RNA	SNP	A	A	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr7:35142594A>T	ENST00000436258.1	-	0	1811							Q6NXN4	D19P1_HUMAN	DPY19L2 pseudogene 1							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										AAATTCTCCTATTATGCTCCA	0.348																																							uc003teq.1		NA																	0					0						c.(961-963)ATA>AAA		RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;																																						554236							g.chr7:35142594A>T	BC066987		7p14.2	2014-03-18	2013-09-12		ENSG00000189212	ENSG00000189212			22305	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 1 (C. elegans)"""				Standard	NR_002833		Approved		uc031swy.1	Q6NXN4	OTTHUMG00000155026		7.37:g.35142594A>T						DPY19L2P1_uc003tep.1_Intron|DPY19L2P1_uc010kwz.1_RNA	p.I321K							19	2069	-								B4E2E3	Missense_Mutation	SNP	ENST00000436258.1	37	c.962T>A																																																																																					0.348	DPY19L2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000338113.1			24	30	0	0	0	0.003954	0	24	30				
ABCA13	154664	broad.mit.edu	37	7	48619942	48619942	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr7:48619942G>T	ENST00000435803.1	+	56	14501	c.14477G>T	c.(14476-14478)cGc>cTc	p.R4826L	ABCA13_ENST00000544596.1_Missense_Mutation_p.R556L	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4826	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGTAGCTTACGCGGGATTCCA	0.547																																							uc003toq.2		NA																	0				ovary(5)|central_nervous_system(4)|skin(1)	10						c.(14476-14478)CGC>CTC		ATP binding cassette, sub-family A (ABC1),							52.0	52.0	52.0					7																	48619942		1898	4104	6002	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48619942G>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14477G>T	7.37:g.48619942G>T	ENSP00000411096:p.Arg4826Leu					ABCA13_uc010kys.1_Missense_Mutation_p.R1901L|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Missense_Mutation_p.R556L	p.R4826L	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN			56	14502	+			4826			ABC transporter 2.		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.14477G>T	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695691	0.48202	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	T;T;T	0.38722	1.12;1.12;1.12	5.4	4.52	0.55395	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.123705	0.37095	N	0.002243	T	0.58666	0.2138	M	0.69463	2.115	0.26132	N	0.980395	D;D;D	0.89917	0.981;0.999;1.0	P;D;D	0.68765	0.838;0.96;0.95	T	0.53975	-0.8362	10	0.87932	D	0	.	10.127	0.42656	0.0922:0.0:0.9078:0.0	.	556;2528;4826	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	L	4826;599;556	ENSP00000411096:R4826L;ENSP00000391042:R599L;ENSP00000442634:R556L	ENSP00000391042:R599L	R	+	2	0	ABCA13	48590488	0.918000	0.31147	0.061000	0.19648	0.149000	0.21700	4.932000	0.63476	1.291000	0.44653	0.637000	0.83480	CGC		0.547	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		5	14	1	0	0.000602214	0.000602	0.000667613	5	14				
LEP	3952	broad.mit.edu	37	7	127894809	127894809	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr7:127894809G>T	ENST00000308868.4	+	3	548	c.497G>T	c.(496-498)gGg>gTg	p.G166V		NM_000230.2	NP_000221.1	P41159	LEP_HUMAN	leptin	166					adipose tissue development (GO:0060612)|adult feeding behavior (GO:0008343)|bile acid metabolic process (GO:0008206)|bone mineralization involved in bone maturation (GO:0035630)|cellular response to L-ascorbic acid (GO:0071298)|cellular response to retinoic acid (GO:0071300)|central nervous system neuron development (GO:0021954)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|eating behavior (GO:0042755)|energy reserve metabolic process (GO:0006112)|fatty acid beta-oxidation (GO:0006635)|female pregnancy (GO:0007565)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process (GO:0006114)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|leptin-mediated signaling pathway (GO:0033210)|leukocyte tethering or rolling (GO:0050901)|negative regulation of apoptotic process (GO:0043066)|negative regulation of appetite (GO:0032099)|negative regulation of cartilage development (GO:0061037)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of glutamine transport (GO:2000486)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vasoconstriction (GO:0045906)|ovulation from ovarian follicle (GO:0001542)|placenta development (GO:0001890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of developmental growth (GO:0048639)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of ion transport (GO:0043270)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of blood pressure (GO:0008217)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis (GO:0006111)|regulation of insulin secretion (GO:0050796)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of lipoprotein lipid oxidation (GO:0060587)|regulation of steroid biosynthetic process (GO:0050810)|response to dietary excess (GO:0002021)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to vitamin E (GO:0033197)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)				endometrium(1)|large_intestine(2)|lung(5)	8						CTCAGCCCTGGGTGCTGAGGC	0.577																																							uc003vml.2		NA																	0					0						c.(496-498)GGG>GTG		leptin precursor							20.0	21.0	21.0					7																	127894809		2202	4296	6498	SO:0001583	missense	3952				adult feeding behavior|energy reserve metabolic process|negative regulation of appetite|placenta development|positive regulation of developmental growth	extracellular space		g.chr7:127894809G>T		CCDS5800.1	7q31	2008-03-06	2008-03-06		ENSG00000174697	ENSG00000174697			6553	protein-coding gene	gene with protein product		164160	"""leptin (murine obesity homolog)"", ""leptin (obesity homolog, mouse)"""	OBS, OB		1686014, 16932309	Standard	NM_000230		Approved		uc003vml.2	P41159	OTTHUMG00000157564	ENST00000308868.4:c.497G>T	7.37:g.127894809G>T	ENSP00000312652:p.Gly166Val					LEP_uc003vmm.2_Missense_Mutation_p.G165V	p.G166V	NM_000230	NP_000221	P41159	LEP_HUMAN			3	554	+			166					O15158|Q56A88	Missense_Mutation	SNP	ENST00000308868.4	37	c.497G>T	CCDS5800.1	.	.	.	.	.	.	.	.	.	.	G	9.412	1.080869	0.20309	.	.	ENSG00000174697	ENST00000308868	T	0.72394	-0.65	5.76	1.83	0.25207	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.432373	0.21938	N	0.066939	T	0.62600	0.2441	M	0.64997	1.995	0.36326	D	0.85855	B;B	0.30179	0.271;0.271	B;B	0.38378	0.272;0.272	T	0.52786	-0.8529	10	0.17832	T	0.49	-36.1154	2.1833	0.03880	0.1726:0.154:0.5143:0.1591	.	166;166	A4D0Y8;P41159	.;LEP_HUMAN	V	166	ENSP00000312652:G166V	ENSP00000312652:G166V	G	+	2	0	LEP	127682045	0.010000	0.17322	0.196000	0.23383	0.220000	0.24768	0.893000	0.28336	0.057000	0.16193	-0.150000	0.13652	GGG		0.577	LEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349174.1			13	18	1	0	9.05144e-12	0.001855	1.27448e-11	13	18				
PRSS1	5644	broad.mit.edu	37	7	142460320	142460320	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr7:142460320G>T	ENST00000311737.7	+	4	499	c.493G>T	c.(493-495)Gtg>Ttg	p.V165L	PRSS1_ENST00000486171.1_Missense_Mutation_p.V179L	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	165	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	GGATGCTCCTGTGCTGAGCCA	0.532																																							uc003wak.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(493-495)GTG>TTG		protease, serine, 1 preproprotein							322.0	313.0	316.0					7																	142460320		2203	4300	6503	SO:0001583	missense	5644	Hereditary_Pancreatitis			digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity	g.chr7:142460320G>T	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.493G>T	7.37:g.142460320G>T	ENSP00000308720:p.Val165Leu					uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc003wam.2_Missense_Mutation_p.V105L	p.V165L	NM_002769	NP_002760	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		4	510	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	165			Peptidase S1.		A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	c.493G>T	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	G	3.128	-0.179070	0.06380	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243;ENST00000492062	D;D;D	0.89050	-2.46;-2.46;-2.46	3.28	-6.56	0.01848	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.336075	0.31301	N	0.007898	T	0.66982	0.2845	N	0.02213	-0.635	0.09310	N	0.999999	B;B	0.09022	0.002;0.001	B;B	0.22880	0.042;0.029	T	0.59101	-0.7517	10	0.27082	T	0.32	.	10.0558	0.42244	0.3086:0.1494:0.542:0.0	.	179;165	E7EQ64;P07477	.;TRY1_HUMAN	L	179;165;155;115	ENSP00000417854:V179L;ENSP00000308720:V165L;ENSP00000419912:V115L	ENSP00000308720:V165L	V	+	1	0	PRSS1	142139894	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.047000	0.14056	-1.068000	0.03156	-0.746000	0.03513	GTG		0.532	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2			15	332	1	0	0.00400662	0.004007	0.0044019	15	332				
EPHB6	2051	broad.mit.edu	37	7	142562336	142562336	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr7:142562336G>T	ENST00000392957.2	+	7	1565	c.778G>T	c.(778-780)Ggc>Tgc	p.G260C	EPHB6_ENST00000442129.1_Missense_Mutation_p.G260C|EPHB6_ENST00000411471.2_Intron	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	260	Cys-rich.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					GGCAGCTGTGGGCACCTGTGT	0.667																																							uc011kst.1		NA																	0				lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(778-780)GGC>TGC		ephrin receptor EphB6 precursor							41.0	52.0	48.0					7																	142562336		2192	4273	6465	SO:0001583	missense	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142562336G>T	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.778G>T	7.37:g.142562336G>T	ENSP00000376684:p.Gly260Cys					EPHB6_uc011ksu.1_Missense_Mutation_p.G260C|EPHB6_uc003wbs.2_5'UTR|EPHB6_uc003wbt.2_5'UTR|EPHB6_uc003wbu.2_5'UTR|EPHB6_uc003wbv.2_5'Flank	p.G260C	NM_004445	NP_004436	O15197	EPHB6_HUMAN			7	1565	+	Melanoma(164;0.059)		260			Extracellular (Potential).|Cys-rich.		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	c.778G>T	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353557	0.82243	.	.	ENSG00000106123	ENST00000392957;ENST00000442129	D;D	0.85411	-1.98;-1.98	5.17	5.17	0.71159	.	0.000000	0.49305	D	0.000154	D	0.93314	0.7869	M	0.86740	2.835	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.94170	0.7422	10	0.87932	D	0	.	17.843	0.88720	0.0:0.0:1.0:0.0	.	260	O15197	EPHB6_HUMAN	C	260	ENSP00000376684:G260C;ENSP00000410789:G260C	ENSP00000376684:G260C	G	+	1	0	EPHB6	142272458	1.000000	0.71417	0.988000	0.46212	0.901000	0.52897	9.646000	0.98474	2.675000	0.91044	0.655000	0.94253	GGC		0.667	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			41	77	1	0	5.44703e-19	0.009718	8.95652e-19	41	77				
OR2A12	346525	broad.mit.edu	37	7	143792935	143792935	+	Nonsense_Mutation	SNP	C	C	A	rs372859417	byFrequency	TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr7:143792935C>A	ENST00000408949.2	+	1	795	c.735C>A	c.(733-735)tgC>tgA	p.C245*		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					CCCACCTCTGCGTGGTGGGGC	0.562																																							uc011kty.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(733-735)TGC>TGA		olfactory receptor, family 2, subfamily A,							137.0	134.0	135.0					7																	143792935		1935	4137	6072	SO:0001587	stop_gained	346525				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143792935C>A		CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.735C>A	7.37:g.143792935C>A	ENSP00000386174:p.Cys245*						p.C245*	NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN			1	735	+	Melanoma(164;0.0783)		245			Helical; Name=6; (Potential).		Q6IF43	Nonsense_Mutation	SNP	ENST00000408949.2	37	c.735C>A	CCDS43670.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.031897	0.54790	.	.	ENSG00000221858	ENST00000408949	.	.	.	4.33	-5.04	0.02964	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-15.3055	13.0729	0.59072	0.0:0.1521:0.0:0.8479	.	.	.	.	X	245	.	ENSP00000386174:C245X	C	+	3	2	OR2A12	143423868	0.000000	0.05858	0.970000	0.41538	0.677000	0.39632	-8.820000	0.00016	-0.825000	0.04290	0.505000	0.49811	TGC		0.562	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1			61	91	1	0	5.86059e-21	0.00361	9.90237e-21	61	91				
UNC5D	137970	broad.mit.edu	37	8	35631947	35631947	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr8:35631947C>A	ENST00000404895.2	+	16	2937	c.2609C>A	c.(2608-2610)gCc>gAc	p.A870D	UNC5D_ENST00000287272.2_Missense_Mutation_p.A801D|UNC5D_ENST00000453357.2_Missense_Mutation_p.A865D|UNC5D_ENST00000449677.1_Missense_Mutation_p.A446D|UNC5D_ENST00000416672.1_Missense_Mutation_p.A875D|UNC5D_ENST00000420357.1_Missense_Mutation_p.A803D	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	870	Death.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		ACCCCCAATGCCAAAGGCAAG	0.473																																							uc003xjr.1		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6						c.(2608-2610)GCC>GAC		unc-5 homolog D precursor							119.0	110.0	113.0					8																	35631947		2203	4300	6503	SO:0001583	missense	137970				apoptosis|axon guidance	integral to membrane	receptor activity	g.chr8:35631947C>A	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2609C>A	8.37:g.35631947C>A	ENSP00000385143:p.Ala870Asp					UNC5D_uc003xjs.1_Missense_Mutation_p.A865D|UNC5D_uc003xju.1_Missense_Mutation_p.A446D	p.A870D	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN		READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)	16	2937	+			870			Death.|Cytoplasmic (Potential).		Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	c.2609C>A	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	C	34	5.388312	0.95988	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	D;D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93;-1.93	5.95	5.95	0.96441	Death (2);DEATH-like (2);	0.099013	0.64402	D	0.000001	D	0.87317	0.6147	L	0.31752	0.955	0.80722	D	1	D;D;D	0.58268	0.982;0.977;0.982	P;P;P	0.57620	0.691;0.73;0.824	D	0.87806	0.2628	10	0.66056	D	0.02	-26.1272	20.4024	0.99000	0.0:1.0:0.0:0.0	.	446;865;870	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	D	870;803;801;875;865;446	ENSP00000385143:A870D;ENSP00000392739:A803D;ENSP00000287272:A801D;ENSP00000412652:A875D;ENSP00000394303:A865D;ENSP00000397211:A446D	ENSP00000287272:A801D	A	+	2	0	UNC5D	35751489	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.814000	0.86154	2.827000	0.97445	0.650000	0.86243	GCC		0.473	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			13	55	1	0	0.000151284	0.001855	0.000170805	13	55				
SNTG1	54212	broad.mit.edu	37	8	51571204	51571204	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr8:51571204T>C	ENST00000522124.1	+	15	1680	c.1019T>C	c.(1018-1020)aTt>aCt	p.I340T	SNTG1_ENST00000517473.1_Missense_Mutation_p.I340T|SNTG1_ENST00000518864.1_Missense_Mutation_p.I340T|SNTG1_ENST00000276467.5_Missense_Mutation_p.I340T	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	340	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				GTTTATGAGATTATGTGCAAG	0.358																																							uc010lxy.1		NA																	0				ovary(5)	5						c.(1018-1020)ATT>ACT		syntrophin, gamma 1							115.0	97.0	103.0					8																	51571204		2203	4300	6503	SO:0001583	missense	54212				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding	g.chr8:51571204T>C	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1019T>C	8.37:g.51571204T>C	ENSP00000429842:p.Ile340Thr					SNTG1_uc003xqs.1_Missense_Mutation_p.I340T|SNTG1_uc010lxz.1_Missense_Mutation_p.I340T|SNTG1_uc011ldl.1_RNA	p.I340T	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN			16	1390	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)	340			PH.		Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	c.1019T>C	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	T	5.971	0.363051	0.11296	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.33216	1.42;1.42;1.42;1.42	4.87	4.87	0.63330	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.18635	0.0447	N	0.25144	0.715	0.58432	D	0.999999	B;B	0.24483	0.104;0.057	B;B	0.29862	0.108;0.027	T	0.04242	-1.0966	10	0.02654	T	1	-19.493	10.8413	0.46718	0.0:0.0:0.0:1.0	.	340;340	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	T	340	ENSP00000429276:I340T;ENSP00000429842:I340T;ENSP00000431123:I340T;ENSP00000276467:I340T	ENSP00000276467:I340T	I	+	2	0	SNTG1	51733757	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.277000	0.72608	1.805000	0.52779	0.482000	0.46254	ATT		0.358	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			19	41	0	0	0	0.00333	0	19	41				
TGS1	96764	broad.mit.edu	37	8	56699163	56699163	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr8:56699163G>T	ENST00000260129.5	+	4	1183	c.706G>T	c.(706-708)Gaa>Taa	p.E236*		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	236					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			TACAAAGGAAGAATGGGAGCA	0.408																																					Esophageal Squamous(34;275 823 4842 34837 48447)	Esophageal Squamous(34;275 823 4842 34837 48447)	uc003xsj.3		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(706-708)GAA>TAA		trimethylguanosine synthase homolog							165.0	165.0	165.0					8																	56699163		2203	4300	6503	SO:0001587	stop_gained	96764				cellular lipid metabolic process|ncRNA metabolic process|regulation of transcription, DNA-dependent|RNA capping|spliceosomal snRNP assembly|transcription, DNA-dependent	Cajal body|cytosol	RNA trimethylguanosine synthase activity	g.chr8:56699163G>T	AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.706G>T	8.37:g.56699163G>T	ENSP00000260129:p.Glu236*					TGS1_uc010lyh.2_Nonsense_Mutation_p.E140*	p.E236*	NM_024831	NP_079107	Q96RS0	TGS1_HUMAN	Epithelial(17;0.00027)|all cancers(17;0.00251)		4	1093	+		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	236					A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Nonsense_Mutation	SNP	ENST00000260129.5	37	c.706G>T	CCDS34894.1	.	.	.	.	.	.	.	.	.	.	G	41	8.725602	0.98929	.	.	ENSG00000137574	ENST00000260129	.	.	.	5.79	2.66	0.31614	.	0.166464	0.51477	D	0.000095	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-15.4525	9.8975	0.41327	0.3203:0.0:0.6797:0.0	.	.	.	.	X	236	.	ENSP00000260129:E236X	E	+	1	0	TGS1	56861717	0.999000	0.42202	0.992000	0.48379	0.998000	0.95712	2.835000	0.48175	0.799000	0.34018	0.655000	0.94253	GAA		0.408	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378152.1	NM_024831		29	91	1	0	2.47511e-08	0.008361	3.15834e-08	29	91				
NOV	4856	broad.mit.edu	37	8	120431548	120431548	+	Missense_Mutation	SNP	G	G	T	rs558076900		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr8:120431548G>T	ENST00000259526.3	+	4	967	c.740G>T	c.(739-741)cGg>cTg	p.R247L	RP11-775B15.2_ENST00000519786.1_RNA	NM_002514.3	NP_002505.1	Q9UIW2	PLXA1_HUMAN	nephroblastoma overexpressed	1567	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(3)	21	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)			TGCATGGTGCGGCCCTGTGAA	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17242	0.0		0.0	False		,,,				2504	0.0						uc003yoq.2		NA																	0				ovary(2)|skin(2)|kidney(1)	5						c.(739-741)CGG>CTG		nephroblastoma overexpressed precursor	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						108.0	102.0	104.0					8																	120431548		2203	4300	6503	SO:0001583	missense	4856				regulation of cell growth		growth factor activity|insulin-like growth factor binding	g.chr8:120431548G>T	X96584	CCDS6328.1	8q24.12	2012-02-27	2012-02-27		ENSG00000136999	ENSG00000136999			7885	protein-coding gene	gene with protein product		164958	"""nephroblastoma overexpressed gene"""			1334251	Standard	NM_002514		Approved	IGFBP9, CCN3	uc003yoq.2	P48745	OTTHUMG00000164984	ENST00000259526.3:c.740G>T	8.37:g.120431548G>T	ENSP00000259526:p.Arg247Leu						p.R247L	NM_002514	NP_002505	P48745	NOV_HUMAN	STAD - Stomach adenocarcinoma(47;0.000507)		4	961	+	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		247			TSP type-1.			Missense_Mutation	SNP	ENST00000259526.3	37	c.740G>T	CCDS6328.1	.	.	.	.	.	.	.	.	.	.	G	36	5.640599	0.96693	.	.	ENSG00000136999	ENST00000259526	T	0.55052	0.54	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.77850	0.4192	M	0.85299	2.745	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.79729	-0.1681	10	0.87932	D	0	-27.1668	20.422	0.99049	0.0:0.0:1.0:0.0	.	247	P48745	NOV_HUMAN	L	247	ENSP00000259526:R247L	ENSP00000259526:R247L	R	+	2	0	NOV	120500729	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.971000	0.88012	2.832000	0.97577	0.655000	0.94253	CGG		0.562	NOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381301.1	NM_002514		34	92	1	0	5.8336e-16	0.003271	8.98888e-16	34	92				
WISP1	8840	broad.mit.edu	37	8	134237699	134237699	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr8:134237699G>T	ENST00000250160.6	+	4	783	c.677G>T	c.(676-678)tGc>tTc	p.C226F	WISP1_ENST00000519433.1_Intron|WISP1_ENST00000220856.6_Missense_Mutation_p.C139F|WISP1_ENST00000517423.1_Intron|WISP1_ENST00000377863.2_Missense_Mutation_p.C54F	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	226	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			TGGAGCCCTTGCTCCACCAGC	0.597																																							uc003yub.2		NA																	0				central_nervous_system(1)|kidney(1)	2						c.(676-678)TGC>TTC		WNT1 inducible signaling pathway protein 1							66.0	69.0	68.0					8																	134237699		2203	4300	6503	SO:0001583	missense	8840				cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding	g.chr8:134237699G>T	AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.677G>T	8.37:g.134237699G>T	ENSP00000250160:p.Cys226Phe					WISP1_uc003yuc.2_Missense_Mutation_p.C139F|WISP1_uc010meb.2_Missense_Mutation_p.C54F|WISP1_uc010mec.2_Intron|WISP1_uc010med.2_Intron|WISP1_uc003yud.2_Intron	p.C226F	NM_003882	NP_003873	O95388	WISP1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0107)		4	753	+	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		226			TSP type-1.		A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Missense_Mutation	SNP	ENST00000250160.6	37	c.677G>T	CCDS6371.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861680	0.91433	.	.	ENSG00000104415	ENST00000250160;ENST00000377863;ENST00000220856	D;D;D	0.98585	-5.01;-5.01;-5.01	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.99515	0.9827	H	0.99182	4.46	0.80722	D	1	D;D;D	0.89917	1.0;0.995;1.0	D;D;D	0.83275	0.995;0.929;0.996	D	0.97957	1.0335	10	0.87932	D	0	-8.4404	19.2688	0.94000	0.0:0.0:1.0:0.0	.	54;139;226	Q5JBS7;O95388-2;O95388	.;.;WISP1_HUMAN	F	226;54;139	ENSP00000250160:C226F;ENSP00000367094:C54F;ENSP00000220856:C139F	ENSP00000220856:C139F	C	+	2	0	WISP1	134306881	1.000000	0.71417	0.985000	0.45067	0.970000	0.65996	9.814000	0.99346	2.795000	0.96236	0.643000	0.83706	TGC		0.597	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378794.2	NM_003882		27	115	1	0	1.30897e-18	0.009535	2.10986e-18	27	115				
ZNF623	9831	broad.mit.edu	37	8	144733134	144733134	+	Silent	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr8:144733134G>A	ENST00000501748.2	+	1	1181	c.1092G>A	c.(1090-1092)caG>caA	p.Q364Q	ZNF623_ENST00000526926.1_Silent_p.Q324Q|ZNF623_ENST00000458270.2_Silent_p.Q324Q	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	364					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ACTTCACCCAGCATCAGAGAA	0.458																																							uc003yzd.2		NA																	0					0						c.(1090-1092)CAG>CAA		zinc finger protein 623 isoform 1							76.0	74.0	75.0					8																	144733134		2203	4300	6503	SO:0001819	synonymous_variant	9831				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:144733134G>A	AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.1092G>A	8.37:g.144733134G>A						ZNF623_uc011lkp.1_Silent_p.Q324Q|ZNF623_uc003yzc.2_Silent_p.Q324Q	p.Q364Q	NM_014789	NP_055604	O75123	ZN623_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)		1	1181	+	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		364			C2H2-type 9.		A4FU80|B4DGP3|E7ENV5	Silent	SNP	ENST00000501748.2	37	c.1092G>A	CCDS34957.1																																																																																				0.458	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382522.3	NM_014789		16	51	0	0	0	0.004007	0	16	51				
KIFC2	90990	broad.mit.edu	37	8	145694127	145694127	+	Silent	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr8:145694127C>T	ENST00000301332.2	+	10	1400	c.1023C>T	c.(1021-1023)gcC>gcT	p.A341A	KIFC2_ENST00000301331.5_Silent_p.A89A	NM_145754.2	NP_665697.1	Q96AC6	KIFC2_HUMAN	kinesin family member C2	341					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(3)|prostate(3)|skin(2)|urinary_tract(1)	19	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CACGGATGGCCAGCCTGCGTC	0.662																																							uc003zcz.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1021-1023)GCC>GCT		kinesin family member C2							90.0	100.0	96.0					8																	145694127		2203	4300	6503	SO:0001819	synonymous_variant	90990				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding	g.chr8:145694127C>T	AY007121	CCDS6427.1	8q24.3	2007-02-13			ENSG00000167702	ENSG00000167702		"""Kinesins"""	29530	protein-coding gene	gene with protein product						9115737	Standard	NM_145754		Approved		uc003zcz.3	Q96AC6	OTTHUMG00000165133	ENST00000301332.2:c.1023C>T	8.37:g.145694127C>T							p.A341A	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)		10	1088	+	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		341			Potential.		E9PHB2|Q96NN6	Silent	SNP	ENST00000301332.2	37	c.1023C>T	CCDS6427.1	.	.	.	.	.	.	.	.	.	.	C	9.321	1.057955	0.19987	.	.	ENSG00000167702	ENST00000528415	.	.	.	4.58	2.35	0.29111	.	.	.	.	.	.	.	.	.	.	.	0.20975	N	0.999811	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.7454	7.397	0.26942	0.0:0.7537:0.0:0.2463	.	.	.	.	X	162	.	.	Q	+	1	0	KIFC2	145664935	0.006000	0.16342	0.998000	0.56505	0.827000	0.46813	0.034000	0.13776	0.915000	0.36847	-0.258000	0.10820	CAG		0.662	KIFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382052.2	NM_145754		45	141	0	0	0	0.00361	0	45	141				
NFX1	4799	broad.mit.edu	37	9	33364014	33364014	+	Silent	SNP	A	A	G			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr9:33364014A>G	ENST00000379540.3	+	20	2942	c.2880A>G	c.(2878-2880)ttA>ttG	p.L960L	NFX1_ENST00000379521.4_Silent_p.L960L	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	960					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		TCAGGAGATTAGCAGAGGCAT	0.393																																							uc003zsq.2		NA																	0				ovary(1)	1						c.(2878-2880)TTA>TTG		nuclear transcription factor, X-box binding 1							106.0	100.0	102.0					9																	33364014		2203	4300	6503	SO:0001819	synonymous_variant	4799				inflammatory response|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|ligase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:33364014A>G	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.2880A>G	9.37:g.33364014A>G						SUGT1P1_uc010mjq.1_Intron|NFX1_uc003zsp.1_Silent_p.L960L|NFX1_uc010mjr.1_Silent_p.L961L|NFX1_uc003zsr.2_Silent_p.L961L	p.L960L	NM_002504	NP_002495	Q12986	NFX1_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)	20	2941	+			960					A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Silent	SNP	ENST00000379540.3	37	c.2880A>G	CCDS6538.1																																																																																				0.393	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1			10	21	0	0	0	0.010729	0	10	21				
GDA	9615	broad.mit.edu	37	9	74810477	74810477	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr9:74810477C>A	ENST00000358399.3	+	2	278	c.185C>A	c.(184-186)cCg>cAg	p.P62Q	GDA_ENST00000477618.1_3'UTR|GDA_ENST00000545168.1_De_novo_Start_OutOfFrame|GDA_ENST00000376989.3_Missense_Mutation_p.P37Q|GDA_ENST00000376986.1_Missense_Mutation_p.P20Q|GDA_ENST00000238018.4_Missense_Mutation_p.P62Q	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	62					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		TGCTTCAAGCCGTGTGAAATA	0.358																																							uc004aiq.2		NA																	0				ovary(2)|central_nervous_system(2)|skin(1)	5						c.(184-186)CCG>CAG		guanine deaminase							72.0	70.0	71.0					9																	74810477		2203	4300	6503	SO:0001583	missense	9615				nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding	g.chr9:74810477C>A	AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.185C>A	9.37:g.74810477C>A	ENSP00000351170:p.Pro62Gln					GDA_uc011lse.1_5'UTR|GDA_uc011lsf.1_5'UTR|GDA_uc004air.2_Missense_Mutation_p.P62Q|GDA_uc010mow.1_RNA|GDA_uc004ais.2_Missense_Mutation_p.P20Q|GDA_uc004ait.1_5'UTR	p.P62Q	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN		Lung(182;0.0583)	2	368	+		Myeloproliferative disorder(762;0.0122)	62					B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Missense_Mutation	SNP	ENST00000358399.3	37	c.185C>A	CCDS6641.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.405065	0.42613	.	.	ENSG00000119125	ENST00000238018;ENST00000376989;ENST00000376986;ENST00000358399	.	.	.	5.22	5.22	0.72569	.	0.363661	0.31834	N	0.006984	T	0.51770	0.1694	N	0.22421	0.69	0.80722	D	1	B;B;B	0.25609	0.13;0.026;0.003	B;B;B	0.30105	0.111;0.016;0.003	T	0.48043	-0.9069	9	0.33940	T	0.23	-5.561	16.9899	0.86351	0.0:1.0:0.0:0.0	.	20;62;62	Q5SZC6;Q9Y2T3-3;Q9Y2T3	.;.;GUAD_HUMAN	Q	62;37;20;62	.	ENSP00000238018:P62Q	P	+	2	0	GDA	74000297	0.631000	0.27164	0.910000	0.35882	0.963000	0.63663	2.307000	0.43682	2.443000	0.82685	0.585000	0.79938	CCG		0.358	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052633.1			3	21	1	0	0.00024832	0.009096	0.000277801	3	21				
PHF2	5253	broad.mit.edu	37	9	96416754	96416754	+	Silent	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr9:96416754C>A	ENST00000359246.4	+	7	1216	c.849C>A	c.(847-849)cgC>cgA	p.R283R	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	283	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		TGTATGAGCGCTGGCGGTCTG	0.577																																							uc004aub.2		NA																	0				ovary(1)	1						c.(847-849)CGC>CGA		PHD finger protein 2							91.0	82.0	85.0					9																	96416754		2203	4300	6503	SO:0001819	synonymous_variant	5253				liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr9:96416754C>A	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.849C>A	9.37:g.96416754C>A						PHF2_uc011lug.1_Silent_p.R166R	p.R283R	NM_005392	NP_005383	O75151	PHF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)	7	996	+		Myeloproliferative disorder(762;0.0255)	283			JmjC.		Q4VXG0|Q8N3K2|Q9Y6N4	Silent	SNP	ENST00000359246.4	37	c.849C>A	CCDS35069.1																																																																																				0.577	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392		4	89	1	0	0.00909568	0.009096	0.00986036	4	89				
TBL1X	6907	broad.mit.edu	37	X	9652091	9652091	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:9652091C>A	ENST00000217964.7	+	6	860	c.220C>A	c.(220-222)Cac>Aac	p.H74N	TBL1X_ENST00000424279.1_Missense_Mutation_p.H23N|TBL1X_ENST00000536365.1_Missense_Mutation_p.H23N|TBL1X_ENST00000407597.2_Missense_Mutation_p.H74N|TBL1X_ENST00000380961.1_Missense_Mutation_p.H23N	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	74	LisH. {ECO:0000255|PROSITE- ProRule:PRU00126}.				canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				AGGTTTTTCCCACTCGGCTTT	0.562																																							uc010ndq.2		NA																	0				ovary(1)	1						c.(220-222)CAC>AAC		transducin beta-like 1X isoform a							121.0	96.0	105.0					X																	9652091		2203	4300	6503	SO:0001583	missense	6907				canonical Wnt receptor signaling pathway|cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|sensory perception of sound|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein C-terminus binding|protein domain specific binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chrX:9652091C>A	Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.220C>A	X.37:g.9652091C>A	ENSP00000217964:p.His74Asn					TBL1X_uc004csq.3_Missense_Mutation_p.H23N|TBL1X_uc010ndr.2_Missense_Mutation_p.H23N|TBL1X_uc004csr.2_Missense_Mutation_p.H74N|TBL1X_uc004css.2_Missense_Mutation_p.H25N	p.H74N	NM_001139466	NP_001132938	O60907	TBL1X_HUMAN			6	588	+		Hepatocellular(5;0.000888)	74			LisH.		A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	37	c.220C>A	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189396	0.78789	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000415293;ENST00000217964;ENST00000422314;ENST00000452824	T;T;T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	4.63	4.63	0.57726	LisH dimerisation motif (2);LisH dimerisation motif, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.89206	0.6649	M	0.85777	2.775	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91419	0.5157	10	0.87932	D	0	.	17.0816	0.86600	0.0:1.0:0.0:0.0	.	37;74	Q59F53;O60907	.;TBL1X_HUMAN	N	74;23;23;23;23;74;23;74	ENSP00000385988:H74N;ENSP00000394097:H23N;ENSP00000445317:H23N;ENSP00000370348:H23N;ENSP00000407069:H23N;ENSP00000217964:H74N;ENSP00000415508:H23N;ENSP00000397878:H74N	ENSP00000217964:H74N	H	+	1	0	TBL1X	9612091	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	7.285000	0.78660	2.042000	0.60477	0.544000	0.68410	CAC		0.562	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647		23	69	1	0	5.35356e-11	0.00278	7.36866e-11	23	69				
MAGEB4	4115	broad.mit.edu	37	X	30260721	30260721	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:30260721C>A	ENST00000378982.2	+	1	665	c.469C>A	c.(469-471)Cgc>Agc	p.R157S	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	157	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.R157C(2)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						AGTCTCTCAGCGCACGGAGCT	0.502																																							uc004dcb.2		NA																	2	Substitution - Missense(2)		upper_aerodigestive_tract(1)|central_nervous_system(1)	ovary(1)	1						c.(469-471)CGC>AGC		melanoma antigen family B, 4							58.0	42.0	48.0					X																	30260721		2202	4300	6502	SO:0001583	missense	4115							g.chrX:30260721C>A		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.469C>A	X.37:g.30260721C>A	ENSP00000368266:p.Arg157Ser					MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	p.R157S	NM_002367	NP_002358	O15481	MAGB4_HUMAN			1	553	+			157			MAGE.		B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	37	c.469C>A	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	C	11.96	1.793536	0.31685	.	.	ENSG00000120289	ENST00000378982	T	0.04706	3.57	3.2	1.39	0.22231	.	0.456808	0.19406	U	0.115053	T	0.10981	0.0268	L	0.57536	1.79	0.09310	N	1	D	0.57257	0.979	D	0.65140	0.932	T	0.18745	-1.0327	10	0.21540	T	0.41	.	5.3622	0.16093	0.0:0.7343:0.0:0.2657	.	157	O15481	MAGB4_HUMAN	S	157	ENSP00000368266:R157S	ENSP00000368266:R157S	R	+	1	0	MAGEB4	30170642	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.432000	0.02430	0.241000	0.21283	0.600000	0.82982	CGC		0.502	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367		9	18	1	0	0.00448238	0.004482	0.0049026	9	18				
ZNF674	641339	broad.mit.edu	37	X	46359634	46359634	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:46359634T>A	ENST00000523374.1	-	6	1600	c.1390A>T	c.(1390-1392)Aca>Tca	p.T464S	ZNF674_ENST00000518795.1_5'Flank|ZNF674_ENST00000414387.2_Missense_Mutation_p.T458S	NM_001039891.2|NM_001146291.1|NM_001190417.1	NP_001034980.1|NP_001139763.1|NP_001177346.1	Q2M3X9	ZN674_HUMAN	zinc finger protein 674	464					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)	2						TTCTCTCCTGTATGCATTCTC	0.418																																							uc004dgr.2		NA																	0				breast(2)	2						c.(1390-1392)ACA>TCA		zinc finger family member 674 isoform 1							80.0	81.0	81.0					X																	46359634		2196	4294	6490	SO:0001583	missense	641339				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:46359634T>A	AY971607	CCDS48099.1, CCDS55406.1	Xp11.3	2013-01-08	2010-09-15		ENSG00000251192	ENSG00000251192		"""Zinc fingers, C2H2-type"", ""-"""	17625	protein-coding gene	gene with protein product		300573		MRX92		16385466	Standard	NM_001039891		Approved	ZNF673B	uc004dgr.3	Q2M3X9	OTTHUMG00000021420	ENST00000523374.1:c.1390A>T	X.37:g.46359634T>A	ENSP00000429148:p.Thr464Ser					ZNF674_uc011mlg.1_Missense_Mutation_p.T458S	p.T464S	NM_001039891	NP_001034980	Q2M3X9	ZN674_HUMAN			6	1617	-			464					B4DHE2|E9PHQ4	Missense_Mutation	SNP	ENST00000523374.1	37	c.1390A>T	CCDS48099.1	.	.	.	.	.	.	.	.	.	.	T	12.41	1.929630	0.34096	.	.	ENSG00000251192	ENST00000523374;ENST00000414387	T;T	0.28069	1.63;1.63	1.92	1.92	0.25849	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33962	0.0881	N	0.16862	0.45	0.24000	N	0.99622	D;D	0.89917	0.998;1.0	D;D	0.91635	0.989;0.999	T	0.10245	-1.0638	9	0.42905	T	0.14	.	7.2932	0.26378	0.0:0.0:0.0:1.0	.	458;464	E9PHQ4;Q2M3X9	.;ZN674_HUMAN	S	464;458	ENSP00000429148:T464S;ENSP00000428248:T458S	ENSP00000428248:T458S	T	-	1	0	ZNF674	46244578	1.000000	0.71417	0.516000	0.27786	0.830000	0.47004	2.570000	0.45981	1.036000	0.39998	0.381000	0.24937	ACA		0.418	ZNF674-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056357.2	NM_001039891		7	73	0	0	0	0.004482	0	7	73				
ZNF674	641339	broad.mit.edu	37	X	46359636	46359636	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:46359636T>A	ENST00000523374.1	-	6	1598	c.1388A>T	c.(1387-1389)cAt>cTt	p.H463L	ZNF674_ENST00000518795.1_5'Flank|ZNF674_ENST00000414387.2_Missense_Mutation_p.H457L	NM_001039891.2|NM_001146291.1|NM_001190417.1	NP_001034980.1|NP_001139763.1|NP_001177346.1	Q2M3X9	ZN674_HUMAN	zinc finger protein 674	463					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)	2						CTCTCCTGTATGCATTCTCTG	0.423																																							uc004dgr.2		NA																	0				breast(2)	2						c.(1387-1389)CAT>CTT		zinc finger family member 674 isoform 1							81.0	83.0	82.0					X																	46359636		2196	4294	6490	SO:0001583	missense	641339				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:46359636T>A	AY971607	CCDS48099.1, CCDS55406.1	Xp11.3	2013-01-08	2010-09-15		ENSG00000251192	ENSG00000251192		"""Zinc fingers, C2H2-type"", ""-"""	17625	protein-coding gene	gene with protein product		300573		MRX92		16385466	Standard	NM_001039891		Approved	ZNF673B	uc004dgr.3	Q2M3X9	OTTHUMG00000021420	ENST00000523374.1:c.1388A>T	X.37:g.46359636T>A	ENSP00000429148:p.His463Leu					ZNF674_uc011mlg.1_Missense_Mutation_p.H457L	p.H463L	NM_001039891	NP_001034980	Q2M3X9	ZN674_HUMAN			6	1615	-			463			C2H2-type 7.		B4DHE2|E9PHQ4	Missense_Mutation	SNP	ENST00000523374.1	37	c.1388A>T	CCDS48099.1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.776431	0.49786	.	.	ENSG00000251192	ENST00000523374;ENST00000414387	T;T	0.67345	-0.26;-0.26	1.92	1.92	0.25849	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.84442	0.5473	H	0.95780	3.72	0.25668	N	0.985929	D;D	0.89917	0.997;1.0	P;D	0.97110	0.687;1.0	T	0.71441	-0.4592	9	0.87932	D	0	.	7.2932	0.26378	0.0:0.0:0.0:1.0	.	457;463	E9PHQ4;Q2M3X9	.;ZN674_HUMAN	L	463;457	ENSP00000429148:H463L;ENSP00000428248:H457L	ENSP00000428248:H457L	H	-	2	0	ZNF674	46244580	1.000000	0.71417	0.114000	0.21550	0.810000	0.45777	3.991000	0.56973	1.036000	0.39998	0.381000	0.24937	CAT		0.423	ZNF674-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056357.2	NM_001039891		7	73	0	0	0	0.004482	0	7	73				
SLC38A5	92745	broad.mit.edu	37	X	48324401	48324401	+	Splice_Site	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:48324401C>T	ENST00000376876.3	-	7	1335		c.e7+1		SLC38A5_ENST00000376875.1_Splice_Site|SLC38A5_ENST00000317669.5_Splice_Site			Q8WUX1	S38A5_HUMAN	solute carrier family 38, member 5						amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)			breast(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	19						TGCTCACTCACCCCTCGGGGT	0.592											OREG0019763	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010nid.2		NA																	0				ovary(3)	3						c.e8+1		solute carrier family 38, member 5							74.0	52.0	59.0					X																	48324401		2202	4299	6501	SO:0001630	splice_region_variant	92745				cellular nitrogen compound metabolic process|ion transport	integral to membrane|plasma membrane		g.chrX:48324401C>T	AF276889	CCDS14293.1	Xp11.23	2013-05-22			ENSG00000017483	ENSG00000017483		"""Solute carriers"""	18070	protein-coding gene	gene with protein product		300649				11243884	Standard	NM_033518		Approved	SN2, JM24	uc010nid.3	Q8WUX1	OTTHUMG00000024117	ENST00000376876.3:c.491+1G>A	X.37:g.48324401C>T			OREG0019763	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	953	SLC38A5_uc004djk.3_Splice_Site_p.G113_splice	p.G164_splice	NM_033518	NP_277053	Q8WUX1	S38A5_HUMAN			8	669	-								B3KT20|B5MDE6|B7WPJ9|Q6PIW9|Q8WYU2|Q96PQ4	Splice_Site	SNP	ENST00000376876.3	37	c.491_splice	CCDS14293.1	.	.	.	.	.	.	.	.	.	.	c	16.13	3.035157	0.54896	.	.	ENSG00000017483	ENST00000376876;ENST00000376875;ENST00000317669;ENST00000440085;ENST00000441948;ENST00000413668;ENST00000416711	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7297	0.51730	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC38A5	48209345	0.997000	0.39634	0.992000	0.48379	0.637000	0.38172	3.356000	0.52269	1.895000	0.54865	0.436000	0.28706	.		0.592	SLC38A5-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060724.1	NM_033518	Intron	7	14	0	0	0	0.00308	0	7	14				
GAGE10	643832	broad.mit.edu	37	X	49161404	49161404	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:49161404G>T	ENST00000407599.3	+	2	159	c.66G>T	c.(64-66)atG>atT	p.M22I		NM_001098413.2	NP_001091883.2	A6NGK3	GAG10_HUMAN	G antigen 10	22										breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	Ovarian(276;0.236)					CCCCTGAAATGATTGGGCCTA	0.408																																							uc010nir.1		NA																	0					0						c.(64-66)ATG>ATT		G antigen 10							196.0	206.0	203.0					X																	49161404		2203	4300	6503	SO:0001583	missense	643832							g.chrX:49161404G>T			Xp11.23	2010-06-03			ENSG00000215274	ENSG00000215274			30968	protein-coding gene	gene with protein product							Standard	XM_006710256		Approved	OTTHUMG00000024136	uc010nir.1	A6NGK3	OTTHUMG00000024136	ENST00000407599.3:c.66G>T	X.37:g.49161404G>T	ENSP00000385415:p.Met22Ile						p.M22I	NM_001098413	NP_001091883	A6NGK3	GAG10_HUMAN			2	182	+	Ovarian(276;0.236)		22						Missense_Mutation	SNP	ENST00000407599.3	37	c.66G>T	CCDS43938.1	.	.	.	.	.	.	.	.	.	.	G	0.292	-0.979288	0.02197	.	.	ENSG00000215274	ENST00000407599	T	0.09445	2.98	1.2	-2.41	0.06562	.	.	.	.	.	T	0.08537	0.0212	L	0.47716	1.5	0.09310	N	1	B	0.16802	0.019	B	0.23574	0.047	T	0.35176	-0.9799	9	0.33940	T	0.23	.	2.8678	0.05607	0.2232:0.0:0.3775:0.3993	.	22	A6NGK3	GAG10_HUMAN	I	22	ENSP00000385415:M22I	ENSP00000385415:M22I	M	+	3	0	GAGE10	49048348	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.592000	0.05747	-2.306000	0.00653	-0.725000	0.03595	ATG		0.408	GAGE10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060816.1	NM_001098413		64	303	1	0	5.80444e-35	0.00361	1.06126e-34	64	303				
MAGED1	9500	broad.mit.edu	37	X	51638238	51638238	+	Silent	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:51638238C>A	ENST00000375722.1	+	3	387	c.135C>A	c.(133-135)gcC>gcA	p.A45A	MAGED1_ENST00000326587.7_Silent_p.A45A|MAGED1_ENST00000375695.2_Silent_p.A101A|MAGED1_ENST00000375772.3_Silent_p.A45A|MAGED1_ENST00000494718.1_3'UTR			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	45					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					CTAACCAGGCCACCGCAGCTG	0.562										Multiple Myeloma(10;0.10)																													uc004dpm.2		NA																	0				ovary(3)	3						c.(133-135)GCC>GCA		melanoma antigen family D, 1 isoform b							40.0	37.0	38.0					X																	51638238		2203	4300	6503	SO:0001819	synonymous_variant	9500				apoptosis|induction of apoptosis by extracellular signals|negative regulation of epithelial cell proliferation|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|plasma membrane|protein complex	protein binding	g.chrX:51638238C>A	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.135C>A	X.37:g.51638238C>A		Multiple Myeloma(10;0.10)				MAGED1_uc004dpn.2_Silent_p.A101A|MAGED1_uc004dpo.2_Silent_p.A45A|MAGED1_uc011mnx.1_Silent_p.A45A	p.A45A	NM_001005332	NP_001005332	Q9Y5V3	MAGD1_HUMAN			3	230	+	Ovarian(276;0.236)		45					Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Silent	SNP	ENST00000375722.1	37	c.135C>A	CCDS14337.1																																																																																				0.562	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332		12	40	1	0	0.000151284	0.001855	0.000170805	12	40				
MAGED2	10916	broad.mit.edu	37	X	54837315	54837315	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:54837315C>T	ENST00000375068.1	+	4	832	c.599C>T	c.(598-600)aCa>aTa	p.T200I	MAGED2_ENST00000375062.4_Missense_Mutation_p.T162I|MAGED2_ENST00000347546.4_Missense_Mutation_p.T182I|MAGED2_ENST00000218439.4_Missense_Mutation_p.T200I|MAGED2_ENST00000396224.1_Missense_Mutation_p.T200I|MAGED2_ENST00000375060.1_Missense_Mutation_p.T162I|MAGED2_ENST00000375053.2_Missense_Mutation_p.T200I|MAGED2_ENST00000497484.1_3'UTR|MAGED2_ENST00000375058.1_Missense_Mutation_p.T200I			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	200						membrane (GO:0016020)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						TCTGGAACCACAGGTGGCCGA	0.577																																							uc004dtk.1		NA																	0				ovary(2)|breast(1)	3						c.(598-600)ACA>ATA		melanoma antigen family D, 2							49.0	47.0	48.0					X																	54837315		2203	4300	6503	SO:0001583	missense	10916							g.chrX:54837315C>T	AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.599C>T	X.37:g.54837315C>T	ENSP00000364209:p.Thr200Ile					MAGED2_uc004dtl.1_Missense_Mutation_p.T200I|MAGED2_uc004dtm.1_Missense_Mutation_p.T162I|MAGED2_uc010nkc.1_Missense_Mutation_p.T200I|MAGED2_uc004dtn.1_Missense_Mutation_p.T200I|MAGED2_uc004dto.1_Missense_Mutation_p.T174I	p.T200I	NM_177433	NP_803182	Q9UNF1	MAGD2_HUMAN			4	693	+			200					A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	Missense_Mutation	SNP	ENST00000375068.1	37	c.599C>T	CCDS14362.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.853483	0.51270	.	.	ENSG00000102316	ENST00000375068;ENST00000375053;ENST00000347546;ENST00000343474;ENST00000375062;ENST00000218439;ENST00000375058;ENST00000375060;ENST00000396224	T;T;T;T;T;T;T;T;T	0.72615	3.99;3.99;4.05;-0.67;3.92;3.99;3.99;3.92;3.99	3.85	2.98	0.34508	.	0.179538	0.28156	N	0.016384	T	0.67590	0.2909	L	0.27053	0.805	0.27558	N	0.950284	D;D;D	0.71674	0.997;0.995;0.998	D;D;D	0.78314	0.991;0.979;0.986	T	0.56384	-0.7988	10	0.25751	T	0.34	.	3.8592	0.08988	0.239:0.6333:0.0:0.1277	.	182;162;200	Q9UNF1-2;Q5H907;Q9UNF1	.;.;MAGD2_HUMAN	I	200;200;144;182;162;200;200;162;200	ENSP00000364209:T200I;ENSP00000364193:T200I;ENSP00000336962:T144I;ENSP00000340290:T182I;ENSP00000364202:T162I;ENSP00000218439:T200I;ENSP00000364198:T200I;ENSP00000364200:T162I;ENSP00000379526:T200I	ENSP00000218439:T200I	T	+	2	0	MAGED2	54854040	1.000000	0.71417	0.987000	0.45799	0.992000	0.81027	1.707000	0.37888	0.986000	0.38683	0.600000	0.82982	ACA		0.577	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056821.2	NM_014599		9	29	0	0	0	0.008291	0	9	29				
EDA2R	60401	broad.mit.edu	37	X	65824988	65824988	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:65824988G>T	ENST00000374719.3	-	3	224	c.168C>A	c.(166-168)caC>caA	p.H56Q	EDA2R_ENST00000253392.5_Missense_Mutation_p.H56Q|EDA2R_ENST00000456230.2_Missense_Mutation_p.H56Q|EDA2R_ENST00000451436.2_Intron|EDA2R_ENST00000450752.1_Missense_Mutation_p.H56Q|EDA2R_ENST00000396050.1_Missense_Mutation_p.H56Q	NM_021783.3	NP_068555	Q9HAV5	TNR27_HUMAN	ectodysplasin A2 receptor	56					cell differentiation (GO:0030154)|embryo development (GO:0009790)|epidermis development (GO:0008544)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						TCTGACATCTGTGGTGGCCCC	0.542																																							uc004dwq.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(166-168)CAC>CAA		X-linked ectodysplasin receptor							127.0	75.0	93.0					X																	65824988		2203	4300	6503	SO:0001583	missense	60401				cell differentiation|embryo development|epidermis development|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity	integral to plasma membrane	tumor necrosis factor receptor activity	g.chrX:65824988G>T	AF298812	CCDS14386.1, CCDS56603.1	Xq11.1	2013-05-22			ENSG00000131080	ENSG00000131080		"""Tumor necrosis factor receptor superfamily"""	17756	protein-coding gene	gene with protein product		300276				11039935	Standard	NM_021783		Approved	XEDAR, EDA-A2R, EDAA2R, TNFRSF27	uc004dwt.2	Q9HAV5	OTTHUMG00000021736	ENST00000374719.3:c.168C>A	X.37:g.65824988G>T	ENSP00000363851:p.His56Gln					EDA2R_uc004dwr.2_Missense_Mutation_p.H56Q|EDA2R_uc004dws.2_Missense_Mutation_p.H56Q|EDA2R_uc011mpb.1_RNA|EDA2R_uc011mpc.1_Intron|EDA2R_uc010nkt.1_Missense_Mutation_p.H56Q|EDA2R_uc004dwt.1_Missense_Mutation_p.H56Q	p.H56Q	NM_021783	NP_068555	Q9HAV5	TNR27_HUMAN			2	179	-			56			Extracellular (Potential).|TNFR-Cys 2.		Q5VYX9|Q5VYY0|Q6UWM2|Q8IZA6	Missense_Mutation	SNP	ENST00000374719.3	37	c.168C>A	CCDS14386.1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.466088	0.26335	.	.	ENSG00000131080	ENST00000374719;ENST00000396050;ENST00000253392;ENST00000456230;ENST00000450752	T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41	4.04	-0.451	0.12214	TNFR/CD27/30/40/95 cysteine-rich region (4);	0.107791	0.40469	N	0.001089	T	0.16300	0.0392	N	0.20483	0.58	0.33420	D	0.579722	D;D;B	0.89917	1.0;0.999;0.43	D;D;B	0.85130	0.996;0.997;0.286	T	0.36138	-0.9760	10	0.12766	T	0.61	-11.2365	3.7708	0.08640	0.4286:0.0:0.3958:0.1756	.	56;56;56	Q9HAV5-2;B2RBZ9;Q9HAV5	.;.;TNR27_HUMAN	Q	56	ENSP00000363851:H56Q;ENSP00000379365:H56Q;ENSP00000253392:H56Q;ENSP00000393935:H56Q;ENSP00000402929:H56Q	ENSP00000253392:H56Q	H	-	3	2	EDA2R	65741713	0.994000	0.37717	0.998000	0.56505	0.979000	0.70002	0.125000	0.15749	-0.103000	0.12175	0.600000	0.82982	CAC		0.542	EDA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057002.1	NM_021783		12	28	1	0	2.68362e-12	0.001368	3.91361e-12	12	28				
KIF4A	24137	broad.mit.edu	37	X	69516981	69516981	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:69516981C>A	ENST00000374403.3	+	4	451	c.369C>A	c.(367-369)ttC>ttA	p.F123L	KIF4A_ENST00000485406.1_3'UTR|KIF4A_ENST00000374388.3_Missense_Mutation_p.F123L	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	123	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						AACTGCTCTTCAAAGAAATTG	0.353																																							uc004dyg.2		NA																	0				ovary(4)	4						c.(367-369)TTC>TTA		kinesin family member 4							61.0	58.0	59.0					X																	69516981		2203	4298	6501	SO:0001583	missense	24137				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding	g.chrX:69516981C>A	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.369C>A	X.37:g.69516981C>A	ENSP00000363524:p.Phe123Leu					KIF4A_uc010nkw.2_Missense_Mutation_p.F123L|KIF4A_uc004dyf.1_Missense_Mutation_p.F123L	p.F123L	NM_012310	NP_036442	O95239	KIF4A_HUMAN			4	496	+			123			Kinesin-motor.		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	37	c.369C>A	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700430	0.68501	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	D;D	0.83591	-1.74;-1.74	5.45	3.69	0.42338	Kinesin, motor domain (4);	0.000000	0.64402	D	0.000013	D	0.89856	0.6836	M	0.87900	2.915	0.58432	D	0.999998	D;D	0.76494	0.973;0.999	D;D	0.71870	0.931;0.975	D	0.88311	0.2956	10	0.87932	D	0	.	6.1466	0.20289	0.0:0.6071:0.0:0.3929	.	123;123	O95239;O95239-2	KIF4A_HUMAN;.	L	123	ENSP00000363509:F123L;ENSP00000363524:F123L	ENSP00000363509:F123L	F	+	3	2	KIF4A	69433706	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.176000	0.31957	0.654000	0.30846	0.538000	0.68166	TTC		0.353	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310		15	43	1	0	1.52009e-12	0.003163	2.23007e-12	15	43				
ITGB1BP2	26548	broad.mit.edu	37	X	70524814	70524814	+	Splice_Site	SNP	G	G	C			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:70524814G>C	ENST00000373829.3	+	11	889		c.e11-1		ITGB1BP2_ENST00000538820.1_Splice_Site	NM_012278.1	NP_036410.1	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein (melusin) 2						muscle organ development (GO:0007517)|signal transduction (GO:0007165)	Z disc (GO:0030018)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)	14	Renal(35;0.156)					CTCCTCCTCAGGTCATAAACG	0.498																																							uc004dzr.1		NA																	0				ovary(1)	1						c.e11-1		integrin beta 1 binding protein 2							53.0	43.0	46.0					X																	70524814		2203	4300	6503	SO:0001630	splice_region_variant	26548				muscle organ development|signal transduction		SH3 domain binding	g.chrX:70524814G>C	AF140690	CCDS14411.1	Xq12.1-q13	2008-02-05			ENSG00000147166	ENSG00000147166			6154	protein-coding gene	gene with protein product		300332				10506186	Standard	XM_005262255		Approved	CHORDC3	uc004dzr.1	Q9UKP3	OTTHUMG00000021793	ENST00000373829.3:c.817-1G>C	X.37:g.70524814G>C						BCYRN1_uc011mpt.1_Intron|ITGB1BP2_uc004dzs.1_Splice_Site_p.V255_splice	p.V273_splice	NM_012278	NP_036410	Q9UKP3	ITBP2_HUMAN			11	846	+	Renal(35;0.156)							Q32N04|Q549J7	Splice_Site	SNP	ENST00000373829.3	37	c.817_splice	CCDS14411.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669653	0.47677	.	.	ENSG00000147166	ENST00000373829;ENST00000538820	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9035	0.52697	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITGB1BP2	70441539	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.885000	0.75606	2.194000	0.70268	0.513000	0.50165	.		0.498	ITGB1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057126.1	NM_012278	Intron	17	39	0	0	0	0.00499	0	17	39				
ERCC6L	54821	broad.mit.edu	37	X	71428457	71428457	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:71428457C>A	ENST00000334463.3	-	2	295	c.160G>T	c.(160-162)Gaa>Taa	p.E54*	ERCC6L_ENST00000373657.1_5'UTR|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	54					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					AGCACTTTTTCATTGGGAAAA	0.398																																							uc004eaq.1		NA																	0				ovary(3)	3						c.(160-162)GAA>TAA		excision repair protein ERCC6-like							108.0	94.0	99.0					X																	71428457		2203	4300	6503	SO:0001587	stop_gained	54821				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding	g.chrX:71428457C>A	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.160G>T	X.37:g.71428457C>A	ENSP00000334675:p.Glu54*					PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_5'UTR	p.E54*	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN			2	257	-	Renal(35;0.156)		54			TPR 1.		Q8NCI1|Q96H93|Q9NXQ8	Nonsense_Mutation	SNP	ENST00000334463.3	37	c.160G>T	CCDS35329.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069980	0.76301	.	.	ENSG00000186871	ENST00000334463	.	.	.	5.02	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-6.6601	8.1623	0.31207	0.0:0.8664:0.0:0.1336	.	.	.	.	X	54	.	ENSP00000334675:E54X	E	-	1	0	ERCC6L	71345182	1.000000	0.71417	0.989000	0.46669	0.974000	0.67602	2.232000	0.43018	0.792000	0.33850	0.600000	0.82982	GAA		0.398	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669		16	39	1	0	6.31663e-08	0.003163	7.97718e-08	16	39				
PHKA1	5255	broad.mit.edu	37	X	71838660	71838660	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:71838660G>A	ENST00000373542.4	-	21	2428	c.2269C>T	c.(2269-2271)Cag>Tag	p.Q757*	PHKA1_ENST00000373545.3_Nonsense_Mutation_p.Q698*|PHKA1_ENST00000541944.1_Nonsense_Mutation_p.Q698*|PHKA1_ENST00000339490.3_Nonsense_Mutation_p.Q757*|PHKA1_ENST00000373539.3_Nonsense_Mutation_p.Q757*	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	757					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					TCCCCAGACTGGTCTCTAGGA	0.388																																							uc004eax.3		NA																	0				ovary(3)|skin(1)	4						c.(2269-2271)CAG>TAG		phosphorylase kinase, alpha 1 (muscle) isoform							130.0	112.0	118.0					X																	71838660		2203	4300	6503	SO:0001587	stop_gained	5255				glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:71838660G>A		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2269C>T	X.37:g.71838660G>A	ENSP00000362643:p.Gln757*					PHKA1_uc004eay.3_Nonsense_Mutation_p.Q757*|PHKA1_uc011mqi.1_Nonsense_Mutation_p.Q698*	p.Q757*	NM_002637	NP_002628	P46020	KPB1_HUMAN			21	2570	-	Renal(35;0.156)		757					B7ZL05|B7ZL07|Q2M3D7	Nonsense_Mutation	SNP	ENST00000373542.4	37	c.2269C>T	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	G	40	8.475402	0.98827	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	.	.	.	5.46	2.38	0.29361	.	0.734945	0.13656	N	0.371896	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-2.1863	7.8636	0.29524	0.0:0.1454:0.4607:0.3939	.	.	.	.	X	698;757;698;757;757	.	ENSP00000342469:Q757X	Q	-	1	0	PHKA1	71755385	0.004000	0.15560	0.603000	0.28903	0.695000	0.40330	-0.205000	0.09411	0.432000	0.26286	0.513000	0.50165	CAG		0.388	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1			27	79	0	0	0	0.00632	0	27	79				
LPAR4	2846	broad.mit.edu	37	X	78010545	78010545	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:78010545C>A	ENST00000435339.3	+	2	565	c.179C>A	c.(178-180)tCt>tAt	p.S60Y		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	60					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						AACAGTGTCTCTCTGTTTGTC	0.383																																							uc010nme.2		NA																	0				ovary(3)	3						c.(178-180)TCT>TAT		lysophosphatidic acid receptor 4							343.0	275.0	298.0					X																	78010545		2203	4300	6503	SO:0001583	missense	2846					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78010545C>A	U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.179C>A	X.37:g.78010545C>A	ENSP00000408205:p.Ser60Tyr						p.S60Y	NM_005296	NP_005287	Q99677	LPAR4_HUMAN			2	584	+			60			Helical; Name=1; (Potential).		B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	ENST00000435339.3	37	c.179C>A	CCDS14441.1	.	.	.	.	.	.	.	.	.	.	C	16.93	3.257408	0.59321	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.71817	-0.6;-0.6	4.17	4.17	0.49024	GPCR, rhodopsin-like superfamily (1);	0.072576	0.56097	D	0.000027	T	0.81664	0.4870	M	0.72479	2.2	0.53688	D	0.999971	D	0.69078	0.997	D	0.67103	0.949	D	0.84535	0.0635	10	0.87932	D	0	.	14.3091	0.66403	0.0:1.0:0.0:0.0	.	60	Q99677	LPAR4_HUMAN	Y	60	ENSP00000408205:S60Y;ENSP00000362398:S60Y	ENSP00000362398:S60Y	S	+	2	0	LPAR4	77897201	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.233000	0.78125	1.920000	0.55613	0.422000	0.28245	TCT		0.383	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296		82	178	1	0	1.52223e-32	0.00361	2.76257e-32	82	178				
ZNF711	7552	broad.mit.edu	37	X	84526494	84526494	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:84526494G>T	ENST00000373165.3	+	9	2252	c.1946G>T	c.(1945-1947)tGc>tTc	p.C649F	ZNF711_ENST00000395402.1_Missense_Mutation_p.C657F|ZNF711_ENST00000542798.1_Missense_Mutation_p.C491F|ZNF711_ENST00000276123.3_Missense_Mutation_p.C649F|ZNF711_ENST00000360700.4_Missense_Mutation_p.C695F	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	649					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						ATTCATCAGTGCAGGCACTGT	0.388																																							uc004eeo.2		NA																	0				ovary(3)|skin(1)	4						c.(1945-1947)TGC>TTC		zinc finger protein 711							86.0	69.0	75.0					X																	84526494		2203	4300	6503	SO:0001583	missense	7552				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding	g.chrX:84526494G>T	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.1946G>T	X.37:g.84526494G>T	ENSP00000362260:p.Cys649Phe					ZNF711_uc004eep.2_Missense_Mutation_p.C649F|ZNF711_uc004eeq.2_Missense_Mutation_p.C695F|ZNF711_uc011mqy.1_Missense_Mutation_p.C248F	p.C649F	NM_021998	NP_068838	Q9Y462	ZN711_HUMAN			9	2293	+			649			C2H2-type 9.		B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	37	c.1946G>T	CCDS35344.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.991561	0.54041	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	5.5	4.64	0.57946	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.47852	D	0.000212	T	0.72622	0.3483	H	0.97758	4.07	0.80722	D	1	D;D	0.65815	0.995;0.985	D;P	0.79108	0.992;0.878	T	0.82297	-0.0527	10	0.87932	D	0	-6.4233	13.68	0.62479	0.0763:0.0:0.9236:0.0	.	695;649	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	F	657;649;649;695;491	ENSP00000378798:C657F;ENSP00000362260:C649F;ENSP00000276123:C649F;ENSP00000353922:C695F;ENSP00000442071:C491F	ENSP00000276123:C649F	C	+	2	0	ZNF711	84413150	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	1.094000	0.41399	0.513000	0.50165	TGC		0.388	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998		12	34	1	0	0.00136819	0.001368	0.00150994	12	34				
PCDH19	57526	broad.mit.edu	37	X	99663476	99663476	+	Silent	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:99663476G>A	ENST00000373034.4	-	1	1795	c.120C>T	c.(118-120)gcC>gcT	p.A40A	PCDH19_ENST00000420881.2_Silent_p.A40A|PCDH19_ENST00000255531.7_Silent_p.A40A	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	40	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TGGCCACGTTGGCAATCACCG	0.642																																							uc010nmz.2		NA																	0				ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						c.(118-120)GCC>GCT		protocadherin 19 isoform b							11.0	12.0	12.0					X																	99663476		2039	4148	6187	SO:0001819	synonymous_variant	57526				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chrX:99663476G>A	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.120C>T	X.37:g.99663476G>A						PCDH19_uc004efw.3_Silent_p.A40A|PCDH19_uc004efx.3_Silent_p.A40A	p.A40A	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN			1	1796	-			40			Cadherin 1.|Extracellular (Potential).		B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Silent	SNP	ENST00000373034.4	37	c.120C>T	CCDS55462.1																																																																																				0.642	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766		4	15	0	0	0	0.001168	0	4	15				
SEPT6	23157	broad.mit.edu	37	X	118763453	118763453	+	Missense_Mutation	SNP	G	G	T	rs150468538		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:118763453G>T	ENST00000343984.5	-	9	1372	c.1108C>A	c.(1108-1110)Cgt>Agt	p.R370S	SEPT6_ENST00000354228.4_Missense_Mutation_p.R370S|SEPT6_ENST00000467310.1_5'UTR|SEPT6_ENST00000394610.1_Missense_Mutation_p.R370S|SEPT6_ENST00000360156.7_Missense_Mutation_p.R370S|SEPT6_ENST00000489216.1_Missense_Mutation_p.R370S|SEPT6_ENST00000394616.4_Missense_Mutation_p.R312S|SEPT6_ENST00000394617.2_Missense_Mutation_p.R400S|SEPT6_ENST00000354416.3_Missense_Mutation_p.R370S	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6	370					cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						TTCTTCAGACGGTCAAACTTC	0.542			T	MLL	AML																																		uc004erv.2		NA		Dom	yes		X	Xq24	23157		septin 6			L					0				lung(1)|ovary(1)|prostate(1)|kidney(1)	4						c.(1108-1110)CGT>AGT		septin 6 isoform B							102.0	94.0	97.0					X																	118763453		2203	4300	6503	SO:0001583	missense	23157				cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding	g.chrX:118763453G>T	D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.1108C>A	X.37:g.118763453G>T	ENSP00000341524:p.Arg370Ser					SEPT6_uc010nqk.2_RNA|SEPT6_uc004ers.2_Missense_Mutation_p.R370S|SEPT6_uc004ert.2_Missense_Mutation_p.R370S|SEPT6_uc004eru.2_Missense_Mutation_p.R370S|SEPT6_uc004erw.2_Missense_Mutation_p.R312S|SEPT6_uc011mtv.1_Missense_Mutation_p.R312S|SEPT6_uc011mtw.1_Missense_Mutation_p.R400S	p.R370S	NM_015129	NP_055944	Q14141	SEPT6_HUMAN			9	1373	-			370			Potential.		Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	Missense_Mutation	SNP	ENST00000343984.5	37	c.1108C>A	CCDS14584.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505756	0.44558	.	.	ENSG00000125354	ENST00000360156;ENST00000354228;ENST00000489216;ENST00000354416;ENST00000394610;ENST00000343984;ENST00000394616;ENST00000394617	D;D;D;D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54	5.6	4.73	0.59995	.	0.047615	0.85682	D	0.000000	T	0.68595	0.3018	L	0.34521	1.04	0.80722	D	1	P;B;B;B	0.45044	0.849;0.087;0.144;0.002	B;B;B;B	0.35727	0.209;0.051;0.071;0.012	T	0.68096	-0.5499	10	0.39692	T	0.17	.	12.5862	0.56419	0.0814:0.0:0.9186:0.0	.	400;312;370;370	F5H1J5;B4E049;Q14141;Q548C9	.;.;SEPT6_HUMAN;.	S	370;370;370;370;370;370;312;400	ENSP00000353278:R370S;ENSP00000346169:R370S;ENSP00000418715:R370S;ENSP00000346397:R370S;ENSP00000378108:R370S;ENSP00000341524:R370S;ENSP00000378114:R312S;ENSP00000378115:R400S	ENSP00000341524:R370S	R	-	1	0	SEPT6	118647481	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.233000	0.72320	1.120000	0.41904	0.600000	0.82982	CGT		0.542	SEPT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058059.1	NM_145802		19	61	1	0	1.00905e-13	0.008871	1.50742e-13	19	61				
MBNL3	55796	broad.mit.edu	37	X	131524889	131524889	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:131524889C>A	ENST00000370853.3	-	4	835	c.757G>T	c.(757-759)Gct>Tct	p.A253S	MBNL3_ENST00000370839.3_Missense_Mutation_p.A253S|RAP2C-AS1_ENST00000421483.2_RNA|MBNL3_ENST00000370849.3_Missense_Mutation_p.A203S|MBNL3_ENST00000538204.1_Missense_Mutation_p.A203S|MBNL3_ENST00000370857.3_Missense_Mutation_p.A253S|MBNL3_ENST00000394311.2_Missense_Mutation_p.A157S|RAP2C-AS1_ENST00000441399.2_RNA|MBNL3_ENST00000370844.1_Missense_Mutation_p.A157S|MBNL3_ENST00000473364.1_5'UTR	NM_018388.3	NP_060858.2	Q9NUK0	MBNL3_HUMAN	muscleblind-like splicing regulator 3	253					mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|negative regulation of myoblast differentiation (GO:0045662)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)	16	Acute lymphoblastic leukemia(192;0.000127)					GCAGAGGCAGCTGAATGGTTC	0.458																																							uc004ewv.3		NA																	0					0						c.(757-759)GCT>TCT		muscleblind-like 3 isoform G							102.0	81.0	88.0					X																	131524889		2203	4300	6503	SO:0001583	missense	55796				mRNA processing|multicellular organismal development|regulation of RNA splicing|RNA splicing	Golgi apparatus|nucleus	nucleic acid binding|zinc ion binding	g.chrX:131524889C>A	AF491305	CCDS14633.1, CCDS14634.1, CCDS55492.1, CCDS55493.1, CCDS55494.1	Xq26.2	2013-01-18	2012-02-23		ENSG00000076770	ENSG00000076770		"""Zinc fingers, CCCH-type domain containing"""	20564	protein-coding gene	gene with protein product		300413	"""muscleblind-like 3 (Drosophila)"""			12297108, 10970838	Standard	NM_018388		Approved	CHCR, FLJ11316, MBLX39, MBXL	uc004ewv.4	Q9NUK0	OTTHUMG00000022426	ENST00000370853.3:c.757G>T	X.37:g.131524889C>A	ENSP00000359890:p.Ala253Ser					uc004ewr.1_Intron|MBNL3_uc004eww.2_Missense_Mutation_p.A157S|MBNL3_uc004ews.2_Missense_Mutation_p.A157S|MBNL3_uc004ewt.2_Missense_Mutation_p.A203S|MBNL3_uc011muz.1_Missense_Mutation_p.A157S|MBNL3_uc004ewu.3_Missense_Mutation_p.A253S|MBNL3_uc004ewx.1_Missense_Mutation_p.A203S	p.A253S	NM_018388	NP_060858	Q9NUK0	MBNL3_HUMAN			4	836	-	Acute lymphoblastic leukemia(192;0.000127)		253					Q5JXN8|Q5JXN9|Q5JXP4|Q6UDQ1|Q8IUR4|Q8TAD9|Q8TAF4|Q9H0Z7|Q9UF37	Missense_Mutation	SNP	ENST00000370853.3	37	c.757G>T	CCDS14633.1	.	.	.	.	.	.	.	.	.	.	C	19.87	3.906852	0.72868	.	.	ENSG00000076770	ENST00000394311;ENST00000538204;ENST00000370857;ENST00000370853;ENST00000370849;ENST00000370839;ENST00000370844;ENST00000442191;ENST00000436215;ENST00000421707	T;T;T;T;T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05	5.74	3.97	0.46021	.	0.221241	0.39475	N	0.001356	T	0.44787	0.1310	M	0.64997	1.995	0.50039	D	0.999849	B;P;B;P;P	0.38504	0.113;0.47;0.259;0.47;0.634	B;B;B;B;B	0.43225	0.074;0.298;0.298;0.412;0.272	T	0.22243	-1.0222	10	0.34782	T	0.22	-4.8048	11.4076	0.49906	0.0:0.8502:0.0:0.1498	.	203;253;253;203;157	Q9NUK0-4;Q9NUK0;Q9NUK0-2;Q9NUK0-3;Q8IUR4	.;MBNL3_HUMAN;.;.;.	S	157;203;253;253;203;253;157;34;157;157	ENSP00000377848:A157S;ENSP00000439618:A203S;ENSP00000359894:A253S;ENSP00000359890:A253S;ENSP00000359886:A203S;ENSP00000359876:A253S;ENSP00000359881:A157S;ENSP00000412065:A34S;ENSP00000406014:A157S;ENSP00000402128:A157S	ENSP00000359876:A253S	A	-	1	0	MBNL3	131352570	0.990000	0.36364	0.756000	0.31282	0.897000	0.52465	2.915000	0.48805	0.564000	0.29238	0.513000	0.50165	GCT		0.458	MBNL3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058319.1	NM_018388		38	74	1	0	4.0492e-12	0.006999	5.87014e-12	38	74				
CT45A5	441521	broad.mit.edu	37	X	134948092	134948092	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:134948092C>A	ENST00000463085.2	-	3	322	c.233G>T	c.(232-234)gGt>gTt	p.G78V	CT45A4_ENST00000420087.2_Intron|CT45A5_ENST00000491480.1_Missense_Mutation_p.G78V|CT45A5_ENST00000370724.3_Missense_Mutation_p.G78V			Q6NSH3	CT455_HUMAN	cancer/testis antigen family 45, member A5	78										endometrium(1)|large_intestine(2)|lung(6)	9						TTTGCTGAAACCAGTGAAGTC	0.448																																							uc004eze.2		NA																	0					0						c.(232-234)GGT>GTT		cancer/testis antigen family 45, member A5							168.0	157.0	161.0					X																	134948092		2190	4264	6454	SO:0001583	missense	441521							g.chrX:134948092C>A	AY743713	CCDS35406.1	Xq26.3	2009-03-12				ENSG00000269586			33270	protein-coding gene	gene with protein product	"""cancer/testis antigen CT45-5"""	300796				15905330	Standard	XM_006724759		Approved	CT45-5, CT45.5	uc022ces.1	Q6NSH3		ENST00000463085.2:c.233G>T	X.37:g.134948092C>A	ENSP00000424778:p.Gly78Val					CT45A5_uc011mvu.1_Missense_Mutation_p.G78V	p.G78V	NM_001007551	NP_001007552	Q6NSH3	CT455_HUMAN			3	478	-			78					A8K842|B7ZMC5	Missense_Mutation	SNP	ENST00000463085.2	37	c.233G>T	CCDS35406.1	.	.	.	.	.	.	.	.	.	.	C	4.897	0.166762	0.09339	.	.	ENSG00000242284	ENST00000370724;ENST00000491480	T;T	0.45668	0.89;0.89	2.4	-2.0	0.07433	.	7.379560	0.00604	U	0.000381	T	0.37732	0.1014	L	0.40543	1.245	0.09310	N	1	P	0.47762	0.9	P	0.47645	0.553	T	0.16217	-1.0410	10	0.32370	T	0.25	.	2.8346	0.05510	0.2043:0.3621:0.0:0.4335	.	78	Q6NSH3	CT455_HUMAN	V	78	ENSP00000359759:G78V;ENSP00000425997:G78V	ENSP00000359759:G78V	G	-	2	0	CT45A5	134775758	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.468000	0.06656	-0.757000	0.04697	-2.166000	0.00325	GGT		0.448	CT45A5-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472589.1	NM_001007551		9	546	1	0	1.12685e-05	0.004482	1.31466e-05	9	546				
SLC9A6	10479	broad.mit.edu	37	X	135095108	135095108	+	Splice_Site	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:135095108G>T	ENST00000370698.3	+	8	981	c.946G>T	c.(946-948)Gtg>Ttg	p.V316L	SLC9A6_ENST00000370695.4_Splice_Site_p.V348L|SLC9A6_ENST00000370701.1_Splice_Site_p.V296L	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	316					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					ACAGTCTTACGTGACAAAGTT	0.423																																							uc004ezj.2		NA																	0				ovary(1)	1						c.(946-948)GTG>TTG		solute carrier family 9 (sodium/hydrogen							222.0	191.0	201.0					X																	135095108		2203	4300	6503	SO:0001630	splice_region_variant	10479				regulation of pH	early endosome membrane|endoplasmic reticulum membrane|integral to membrane|microsome|plasma membrane|recycling endosome membrane	sodium:hydrogen antiporter activity	g.chrX:135095108G>T	AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.946-1G>T	X.37:g.135095108G>T						SLC9A6_uc004ezk.2_Missense_Mutation_p.V348L	p.V316L	NM_006359	NP_006350	Q92581	SL9A6_HUMAN			8	1022	+	Acute lymphoblastic leukemia(192;0.000127)		316					A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	37	c.946G>T	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.909259	0.33721	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.14766	2.48;2.48;2.48	5.81	5.81	0.92471	Cation/H+ exchanger (1);	0.112560	0.64402	D	0.000010	T	0.08980	0.0222	N	0.10782	0.045	0.80722	D	1	B;B	0.22414	0.069;0.002	B;B	0.19391	0.025;0.025	T	0.33189	-0.9878	9	.	.	.	.	17.9197	0.88962	0.0:0.0:1.0:0.0	.	348;316	Q92581-2;Q92581	.;SL9A6_HUMAN	L	296;316;348	ENSP00000359735:V296L;ENSP00000359732:V316L;ENSP00000359729:V348L	.	V	+	1	0	SLC9A6	134922774	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.476000	0.97823	2.452000	0.82932	0.594000	0.82650	GTG		0.423	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	Missense_Mutation	56	147	1	0	5.19286e-32	0.00361	9.2865e-32	56	147				
MAGEA8	4107	broad.mit.edu	37	X	149013681	149013681	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:149013681T>A	ENST00000542674.1	+	3	1156	c.635T>A	c.(634-636)aTc>aAc	p.I212N	MAGEA8_ENST00000535454.1_Missense_Mutation_p.I212N|MAGEA8_ENST00000286482.1_Missense_Mutation_p.I212N	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	212	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					CTGGGCATGATCTTAATGGAG	0.572																																							uc004fdw.1		NA																	0					0						c.(634-636)ATC>AAC		melanoma antigen family A, 8							73.0	66.0	68.0					X																	149013681		2203	4298	6501	SO:0001583	missense	4107							g.chrX:149013681T>A		CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.635T>A	X.37:g.149013681T>A	ENSP00000443776:p.Ile212Asn						p.I212N	NM_005364	NP_005355	P43361	MAGA8_HUMAN			3	850	+	Acute lymphoblastic leukemia(192;6.56e-05)		212			MAGE.		Q9BUN9	Missense_Mutation	SNP	ENST00000542674.1	37	c.635T>A	CCDS14692.1	.	.	.	.	.	.	.	.	.	.	.	12.65	2.001848	0.35320	.	.	ENSG00000156009	ENST00000535454;ENST00000542674;ENST00000286482	T;T;T	0.12879	2.64;2.64;2.64	1.0	1.0	0.19881	.	0.097447	0.64402	D	0.000002	T	0.39784	0.1091	H	0.94183	3.505	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.16217	-1.0410	10	0.87932	D	0	.	3.9106	0.09201	0.0:0.0:0.0:1.0	.	212	P43361	MAGA8_HUMAN	N	212	ENSP00000438293:I212N;ENSP00000443776:I212N;ENSP00000286482:I212N	ENSP00000286482:I212N	I	+	2	0	MAGEA8	148774339	0.011000	0.17503	0.009000	0.14445	0.181000	0.23173	1.327000	0.33746	0.636000	0.30508	0.158000	0.16466	ATC		0.572	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058728.1	NM_005364		31	78	0	0	0	0.012213	0	31	78				
MAMLD1	10046	broad.mit.edu	37	X	149639102	149639102	+	Silent	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:149639102G>A	ENST00000370401.2	+	4	1567	c.1257G>A	c.(1255-1257)ccG>ccA	p.P419P	MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000432680.2_Silent_p.P394P|MAMLD1_ENST00000426613.2_Silent_p.P394P|MAMLD1_ENST00000262858.5_Silent_p.P419P			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	419					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					CTCAACAGCCGCAGTTCGGCC	0.592																																							uc004fee.1		NA																	0					0						c.(1255-1257)CCG>CCA		mastermind-like domain containing 1							101.0	98.0	99.0					X																	149639102		2203	4298	6501	SO:0001819	synonymous_variant	10046				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:149639102G>A	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1257G>A	X.37:g.149639102G>A						MAMLD1_uc011mxt.1_Silent_p.P381P|MAMLD1_uc011mxu.1_Silent_p.P394P|MAMLD1_uc011mxv.1_Silent_p.P394P|MAMLD1_uc011mxw.1_Silent_p.P346P	p.P419P	NM_005491	NP_005482	Q13495	MAMD1_HUMAN			3	1333	+	Acute lymphoblastic leukemia(192;6.56e-05)		419					B2RCQ4|B4DG93|B9EGA5	Silent	SNP	ENST00000370401.2	37	c.1257G>A	CCDS14693.2																																																																																				0.592	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491		73	187	0	0	0	0.00361	0	73	187				
GABRA3	2556	broad.mit.edu	37	X	151358252	151358252	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:151358252G>A	ENST00000370314.4	-	9	1331	c.1093C>T	c.(1093-1095)Cgg>Tgg	p.R365W	GABRA3_ENST00000497894.1_5'UTR|GABRA3_ENST00000535043.1_Missense_Mutation_p.R365W|RP11-329E24.6_ENST00000453915.1_RNA	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	365					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	GCCCAACTCCGCTTGGTGAAA	0.493																																					NSCLC(142;2578 2613 10251 16743)	NSCLC(142;2578 2613 10251 16743)	uc010ntk.1		NA																	0				ovary(1)	1						c.(1093-1095)CGG>TGG		gamma-aminobutyric acid A receptor, alpha 3	Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						80.0	80.0	80.0					X																	151358252		2203	4300	6503	SO:0001583	missense	2556				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chrX:151358252G>A		CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.1093C>T	X.37:g.151358252G>A	ENSP00000359337:p.Arg365Trp						p.R365W	NM_000808	NP_000799	P34903	GBRA3_HUMAN			9	1333	-	Acute lymphoblastic leukemia(192;6.56e-05)		365			Cytoplasmic (Probable).		Q8TAF9	Missense_Mutation	SNP	ENST00000370314.4	37	c.1093C>T	CCDS14706.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564212	0.65651	.	.	ENSG00000011677	ENST00000370314;ENST00000370311;ENST00000535043	D;D;D	0.84800	-1.9;-1.9;-1.9	5.56	3.71	0.42584	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.92260	0.7545	M	0.86502	2.82	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.91584	0.5281	10	0.66056	D	0.02	.	11.0031	0.47618	0.0:0.0:0.5166:0.4834	.	365	P34903	GBRA3_HUMAN	W	365	ENSP00000359337:R365W;ENSP00000359334:R365W;ENSP00000443527:R365W	ENSP00000359334:R365W	R	-	1	2	GABRA3	151108908	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.908000	0.56355	0.478000	0.27488	0.597000	0.82753	CGG		0.493	GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060921.1	NM_000808		9	111	0	0	0	0.004482	0	9	111				
L1CAM	3897	broad.mit.edu	37	X	153128982	153128982	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:153128982C>A	ENST00000370060.1	-	27	3669	c.3480G>T	c.(3478-3480)caG>caT	p.Q1160H	L1CAM_ENST00000370057.3_Missense_Mutation_p.Q1160H|L1CAM_ENST00000361981.3_Missense_Mutation_p.Q1155H|L1CAM_ENST00000361699.4_Missense_Mutation_p.Q1160H|L1CAM_ENST00000538883.1_Missense_Mutation_p.Q1162H|L1CAM_ENST00000543994.1_Missense_Mutation_p.Q1162H|L1CAM_ENST00000370055.1_Missense_Mutation_p.Q1155H	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1160					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGAGTCCACCTGGGTGTCCT	0.652																																							uc004fjb.2		NA																	0				ovary(8)|central_nervous_system(1)	9						c.(3478-3480)CAG>CAT		L1 cell adhesion molecule isoform 1 precursor							50.0	46.0	47.0					X																	153128982		2203	4300	6503	SO:0001583	missense	3897				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		g.chrX:153128982C>A	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3480G>T	X.37:g.153128982C>A	ENSP00000359077:p.Gln1160His					L1CAM_uc004fjc.2_Missense_Mutation_p.Q1160H|L1CAM_uc010nuo.2_Missense_Mutation_p.Q1155H	p.Q1160H	NM_000425	NP_000416	P32004	L1CAM_HUMAN			26	3588	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		1160			Cytoplasmic (Potential).		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	c.3480G>T	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.122640	0.37436	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000370058;ENST00000361699	D;D;D;D;D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06	4.57	3.69	0.42338	.	0.000000	0.53938	D	0.000054	T	0.70185	0.3195	N	0.21373	0.66	0.46823	D	0.999211	B;B;B	0.29378	0.004;0.243;0.004	B;B;B	0.31751	0.022;0.135;0.037	T	0.62987	-0.6737	10	0.06236	T	0.91	.	7.344	0.26654	0.0:0.7926:0.0:0.2074	.	1155;1160;1160	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	H	1160;1162;1160;1162;1155;1155;60;1160	ENSP00000359077:Q1160H;ENSP00000438430:Q1162H;ENSP00000359074:Q1160H;ENSP00000439645:Q1162H;ENSP00000354712:Q1155H;ENSP00000359072:Q1155H;ENSP00000359075:Q60H;ENSP00000355380:Q1160H	ENSP00000355380:Q1160H	Q	-	3	2	L1CAM	152782176	0.000000	0.05858	1.000000	0.80357	0.992000	0.81027	-0.591000	0.05753	2.015000	0.59207	0.529000	0.55759	CAG		0.652	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		13	28	1	0	7.93312e-07	0.00245	9.48105e-07	13	28				
ARHGAP4	393	broad.mit.edu	37	X	153178193	153178193	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:153178193G>T	ENST00000350060.5	-	12	1544	c.1503C>A	c.(1501-1503)aaC>aaA	p.N501K	ARHGAP4_ENST00000370028.3_Missense_Mutation_p.N541K|ARHGAP4_ENST00000393721.1_Missense_Mutation_p.N323K|ARHGAP4_ENST00000537206.1_Missense_Mutation_p.N478K|ARHGAP4_ENST00000467421.1_5'Flank|ARHGAP4_ENST00000370016.1_Missense_Mutation_p.N480K	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	501					apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGAGTCTCTGGTTATACTGGG	0.562																																							uc004fjk.1		NA																	0				central_nervous_system(1)	1						c.(1501-1503)AAC>AAA		Rho GTPase activating protein 4 isoform 2							99.0	102.0	101.0					X																	153178193		2203	4300	6503	SO:0001583	missense	393				apoptosis|cytoskeleton organization|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|Rho protein signal transduction	cytosol|focal adhesion|nucleus	Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity	g.chrX:153178193G>T	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.1503C>A	X.37:g.153178193G>T	ENSP00000203786:p.Asn501Lys					ARHGAP4_uc004fjj.1_5'Flank|ARHGAP4_uc011mzf.1_Missense_Mutation_p.N478K|ARHGAP4_uc004fjl.1_Missense_Mutation_p.N541K|ARHGAP4_uc010nup.1_RNA	p.N501K	NM_001666	NP_001657	P98171	RHG04_HUMAN			12	1545	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		501					Q14144|Q86UY3	Missense_Mutation	SNP	ENST00000350060.5	37	c.1503C>A	CCDS14736.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.81|15.81	2.943787|2.943787	0.53079|0.53079	.|.	.|.	ENSG00000089820|ENSG00000089820	ENST00000393721;ENST00000370028;ENST00000350060;ENST00000370016;ENST00000537206|ENST00000442172	T;T;T;T;T|.	0.53640|.	0.61;0.61;0.61;0.61;0.61|.	5.46|5.46	2.64|2.64	0.31445|0.31445	Rho GTPase-activating protein domain (1);|.	0.272853|.	0.26421|.	N|.	0.024480|.	T|T	0.46328|0.46328	0.1387|0.1387	L|L	0.43152|0.43152	1.355|1.355	0.42468|0.42468	D|D	0.992817|0.992817	P;P|.	0.49307|.	0.922;0.868|.	B;B|.	0.42625|.	0.393;0.393|.	T|T	0.22626|0.22626	-1.0211|-1.0211	10|5	0.05620|.	T|.	0.96|.	.|.	5.5635|5.5635	0.17157|0.17157	0.1585:0.0:0.5671:0.2744|0.1585:0.0:0.5671:0.2744	.|.	541;501|.	Q86UY3;P98171|.	.;RHG04_HUMAN|.	K|N	323;541;501;480;478|16	ENSP00000377322:N323K;ENSP00000359045:N541K;ENSP00000203786:N501K;ENSP00000359033:N480K;ENSP00000444169:N478K|.	ENSP00000203786:N501K|.	N|T	-|-	3|2	2|0	ARHGAP4|ARHGAP4	152831387|152831387	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.993000|0.993000	0.82548|0.82548	1.393000|1.393000	0.34497|0.34497	0.124000|0.124000	0.18369|0.18369	0.525000|0.525000	0.51046|0.51046	AAC|ACC		0.562	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	NM_001666		36	125	1	0	5.04308e-16	0.00623	7.81996e-16	36	125				
HCFC1	3054	broad.mit.edu	37	X	153229610	153229610	+	Silent	SNP	G	G	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:153229610G>T	ENST00000310441.7	-	3	1434	c.468C>A	c.(466-468)gcC>gcA	p.A156A	HCFC1_ENST00000461098.1_5'Flank|HCFC1_ENST00000354233.3_Silent_p.A156A|HCFC1_ENST00000369984.4_Silent_p.A156A	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	156					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGCTATCATTGGCCAGACCCC	0.572																																							uc004fjp.2		NA																	0				ovary(2)	2						c.(466-468)GCC>GCA		host cell factor 1							113.0	118.0	116.0					X																	153229610		1969	4129	6098	SO:0001819	synonymous_variant	3054				cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chrX:153229610G>T		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.468C>A	X.37:g.153229610G>T							p.A156A	NM_005334	NP_005325	P51610	HCFC1_HUMAN			3	996	-	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		156			Kelch 3.		Q6P4G5	Silent	SNP	ENST00000310441.7	37	c.468C>A	CCDS44020.1																																																																																				0.572	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334		40	86	1	0	3.61848e-18	0.007835	5.7943e-18	40	86				
BRCC3	79184	broad.mit.edu	37	X	154348318	154348318	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chrX:154348318C>T	ENST00000369462.1	+	11	869	c.844C>T	c.(844-846)Cct>Tct	p.P282S	BRCC3_ENST00000369459.2_Missense_Mutation_p.P213S|BRCC3_ENST00000340647.4_Missense_Mutation_p.P258S|BRCC3_ENST00000330045.7_Missense_Mutation_p.P257S|BRCC3_ENST00000399042.1_Missense_Mutation_p.P283S|MTCP1_ENST00000362018.2_Intron	NM_024332.3	NP_077308.1	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	282					double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|regulation of catalytic activity (GO:0050790)|response to ionizing radiation (GO:0010212)|response to X-ray (GO:0010165)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|nuclear ubiquitin ligase complex (GO:0000152)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	enzyme regulator activity (GO:0030234)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|polyubiquitin binding (GO:0031593)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.P282S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|skin(1)	22	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AGTCAGCGGGCCTCTCCTACA	0.428																																							uc004fna.2		NA																	1	Substitution - Missense(1)		endometrium(1)	lung(3)|ovary(1)|large_intestine(1)|breast(1)	6						c.(844-846)CCT>TCT		BRCA1/BRCA2-containing complex, subunit 3							61.0	60.0	60.0					X																	154348318		2094	4242	6336	SO:0001583	missense	79184				double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|positive regulation of DNA repair|response to X-ray	BRCA1-A complex|BRISC complex|nuclear ubiquitin ligase complex	enzyme regulator activity|metal ion binding|metallopeptidase activity|polyubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chrX:154348318C>T	X64643	CCDS56610.1, CCDS56611.1, CCDS56612.1	Xq28	2013-05-29	2005-11-21	2005-11-21	ENSG00000185515	ENSG00000185515			24185	protein-coding gene	gene with protein product	"""Lys-63-specific deubiquitinase"""	300617	"""chromosome X open reading frame 53"""	CXorf53		1303175, 14636569	Standard	NM_024332		Approved	C6.1A, BRCC36	uc004fna.3	P46736	OTTHUMG00000022658	ENST00000369462.1:c.844C>T	X.37:g.154348318C>T	ENSP00000358474:p.Pro282Ser					BRCC3_uc004fnb.2_Missense_Mutation_p.P257S	p.P282S	NM_024332	NP_077308	P46736	BRCC3_HUMAN			11	937	+	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		282					A6QRF8|A6QRF9|A8MUX5|A8MWH0|A9Z1Y0|A9Z1Y5|B1B062|B4DQN7|Q16107|Q53YX5|Q9BTZ6	Missense_Mutation	SNP	ENST00000369462.1	37	c.844C>T	CCDS56611.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689753	0.88735	.	.	ENSG00000185515	ENST00000340647;ENST00000330045;ENST00000369459;ENST00000369462;ENST00000399042;ENST00000457026	T;T;T;T;T	0.69175	-0.1;-0.06;0.17;-0.38;-0.27	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.80121	0.4565	M	0.66378	2.025	0.80722	D	1	P;D	0.89917	0.946;1.0	P;D	0.87578	0.509;0.998	T	0.79339	-0.1844	10	0.40728	T	0.16	-13.7679	16.7	0.85346	0.0:1.0:0.0:0.0	.	257;282	P46736-2;P46736	.;BRCC3_HUMAN	S	258;257;213;282;283;214	ENSP00000344103:P258S;ENSP00000328641:P257S;ENSP00000358471:P213S;ENSP00000358474:P282S;ENSP00000381998:P283S	ENSP00000328641:P257S	P	+	1	0	BRCC3	154001512	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.400000	0.79949	2.452000	0.82932	0.594000	0.82650	CCT		0.428	BRCC3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058788.4	NM_024332		22	50	0	0	0	0.012319	0	22	50				
SPRR3	6707	broad.mit.edu	37	1	152975806	152975829	+	In_Frame_Del	DEL	CCAGGCTACACCAAGGTCCCTGAA	CCAGGCTACACCAAGGTCCCTGAA	-	rs1970328|rs561001430|rs72704847|rs527966074|rs200495953	byFrequency	TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	CCAGGCTACACCAAGGTCCCTGAA	CCAGGCTACACCAAGGTCCCTGAA	-	-	CCAGGCTACACCAAGGTCCCTGAA	CCAGGCTACACCAAGGTCCCTGAA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:152975806_152975829delCCAGGCTACACCAAGGTCCCTGAA	ENST00000295367.4	+	2	352_375	c.310_333delCCAGGCTACACCAAGGTCCCTGAA	c.(310-333)ccaggctacaccaaggtccctgaadel	p.PGYTKVPE104del	SPRR3_ENST00000331860.3_In_Frame_Del_p.PGYTKVPE104del|SPRR3_ENST00000542696.1_In_Frame_Del_p.PGYTKVPE96del	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	104	14 X 8 AA approximate tandem repeats.		Missing.		epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)	p.Y106C(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGTCCCTGAGCCAGGCTACACCAAGGTCCCTGAACCAGGCAGCA	0.567														567	0.113219	0.1082	0.062	5008	,	,		23905	0.1528		0.1133	False		,,,				2504	0.1155						uc001fax.3		NA																	1	Substitution - Missense(1)		kidney(1)	skin(1)	1						c.(310-333)CCAGGCTACACCAAGGTCCCTGAAdel		small proline-rich protein 3			,	1170,3096		431,308,1394					,	3.4	0.4		dbSNP_130	84	2304,5950		748,808,2571	no	coding,coding	SPRR3	NM_005416.2,NM_001097589.1	,	1179,1116,3965	A1A1,A1R,RR		27.9137,27.4262,27.7476	,	,		3474,9046				SO:0001651	inframe_deletion	6707				keratinization|peptide cross-linking|wound healing	cytoplasm	protein binding|structural molecule activity	g.chr1:152975806_152975829delCCAGGCTACACCAAGGTCCCTGAA	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.310_333delCCAGGCTACACCAAGGTCCCTGAA	1.37:g.152975806_152975829delCCAGGCTACACCAAGGTCCCTGAA	ENSP00000295367:p.Pro104_Glu111del					SPRR3_uc001faz.3_In_Frame_Del_p.PGYTKVPE104del|SPRR3_uc001fay.2_In_Frame_Del_p.PGYTKVPE96del	p.PGYTKVPE104del	NM_005416	NP_005407	Q9UBC9	SPRR3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		3	460_483	+	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		104_111			9.|14 X 8 AA approximate tandem repeats.		A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	In_Frame_Del	DEL	ENST00000295367.4	37	c.310_333delCCAGGCTACACCAAGGTCCCTGAA	CCDS1033.1																																																																																				0.567	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416		17	79	NA	NA	NA	NA	NA	17	79	---	---	---	---
OR2L8	391190	broad.mit.edu	37	1	248112595	248112595	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr1:248112595delG	ENST00000357191.3	+	1	436	c.436delG	c.(436-438)gggfs	p.G146fs	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GATGATAACAGGGTCTTGGAT	0.433																																							uc001idt.1		NA																	0				ovary(1)|skin(1)	2						c.(436-438)GGGfs		olfactory receptor, family 2, subfamily L,							292.0	232.0	252.0					1																	248112595		2203	4300	6503	SO:0001589	frameshift_variant	391190				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248112595delG	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.436delG	1.37:g.248112595delG	ENSP00000349719:p.Gly146fs					OR2L13_uc001ids.2_Intron	p.G146fs	NM_001001963	NP_001001963	Q8NGY9	OR2L8_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	436	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		146			Helical; Name=4; (Potential).		Q6IF03	Frame_Shift_Del	DEL	ENST00000357191.3	37	c.436delG	CCDS31101.1																																																																																				0.433	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2			118	107	NA	NA	NA	NA	NA	118	107	---	---	---	---
STK11	6794	broad.mit.edu	37	19	1221226	1221226	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:1221226delC	ENST00000326873.7	+	6	1922	c.749delC	c.(748-750)acgfs	p.T250fs		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	250	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		T -> P (in sporadic cancer; somatic mutation; impairs heterotrimeric complex assembly with STRADA and CAB39).		activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(2)|p.Y246fs*3(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		AACATCACCACGGGTCTGTAC	0.592		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		23	Whole gene deletion(20)|Unknown(2)|Deletion - Frameshift(1)	p.0?(19)|p.?(2)|p.Y246fs*3(1)	cervix(14)|lung(5)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(748-750)ACGfs		serine/threonine protein kinase 11							59.0	63.0	62.0					19																	1221226		2004	4158	6162	SO:0001589	frameshift_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1221226delC	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.749delC	19.37:g.1221226delC	ENSP00000324856:p.Thr250fs	TSP Lung(3;<1E-08)					p.T250fs	NM_000455	NP_000446	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	6	1864	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	250		T -> P (in sporadic cancer; somatic mutation; impairs heterotrimeric complex assembly with STRADA and CAB39).	Protein kinase.		B2RBX7|E7EW76	Frame_Shift_Del	DEL	ENST00000326873.7	37	c.749delC	CCDS45896.1																																																																																				0.592	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		14	11	NA	NA	NA	NA	NA	14	11	---	---	---	---
KEAP1	9817	broad.mit.edu	37	19	10602611	10602612	+	Frame_Shift_Ins	INS	-	-	A			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr19:10602611_10602612insA	ENST00000171111.5	-	3	1513_1514	c.966_967insT	c.(964-969)cccaagfs	p.K323fs	KEAP1_ENST00000393623.2_Frame_Shift_Ins_p.K323fs|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	323					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CGGCCCACCTTGGGCGCCCGGC	0.649																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(964-969)CCCAAGfs		kelch-like ECH-associated protein 1																																				SO:0001589	frameshift_variant	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10602611_10602612insA	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.966_967insT	19.37:g.10602611_10602612insA	ENSP00000171111:p.Lys323fs					KEAP1_uc002mop.1_Frame_Shift_Ins_p.P40fs|KEAP1_uc002mor.1_Frame_Shift_Ins_p.P322fs	p.P322fs	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		3	1122_1123	-			322_323					B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Frame_Shift_Ins	INS	ENST00000171111.5	37	c.966_967insT	CCDS12239.1																																																																																				0.649	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		12	31	NA	NA	NA	NA	NA	12	31	---	---	---	---
GPR149	344758	broad.mit.edu	37	3	154146739	154146739	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr3:154146739delC	ENST00000389740.2	-	1	765	c.666delG	c.(664-666)ccgfs	p.P223fs		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	223					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GGAGTCTCGGCGGCTCCTCCG	0.577																																							uc003faa.2		NA																	0				ovary(6)	6						c.(664-666)CCGfs		G protein-coupled receptor 149							52.0	58.0	57.0					3																	154146739		1908	4120	6028	SO:0001589	frameshift_variant	344758					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr3:154146739delC	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.666delG	3.37:g.154146739delC	ENSP00000374390:p.Pro223fs						p.P222fs	NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)		1	766	-			222			Cytoplasmic (Potential).			Frame_Shift_Del	DEL	ENST00000389740.2	37	c.666delG	CCDS43162.1																																																																																				0.577	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580		33	71	NA	NA	NA	NA	NA	33	71	---	---	---	---
NKD2	85409	broad.mit.edu	37	5	1038447	1038449	+	In_Frame_Del	DEL	CAC	CAC	-	rs3840989		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	CAC	CAC	-	-	CAC	CAC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr5:1038447_1038449delCAC	ENST00000296849.5	+	10	1544_1546	c.1315_1317delCAC	c.(1315-1317)cacdel	p.H447del	NKD2_ENST00000382730.2_In_Frame_Del_p.P86del|NKD2_ENST00000274150.4_3'UTR	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	447	His-rich.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			ccaccacgagcaccaccaccacc	0.69																																							uc003jbt.1		NA																	0					0						c.(1315-1317)CACdel		naked cuticle homolog 2																																				SO:0001651	inframe_deletion	85409				exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding	g.chr5:1038447_1038449delCAC	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.1315_1317delCAC	5.37:g.1038456_1038458delCAC	ENSP00000296849:p.His447del					NKD2_uc010itf.1_3'UTR	p.H447del	NM_033120	NP_149111	Q969F2	NKD2_HUMAN	Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)		10	1320_1322	+	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		447			His-rich.		Q96EK8|Q9BSN0	In_Frame_Del	DEL	ENST00000296849.5	37	c.1315_1317delCAC	CCDS3859.1																																																																																				0.690	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120		3	5	NA	NA	NA	NA	NA	3	5	---	---	---	---
TAF11	6882	broad.mit.edu	37	6	34846380	34846381	+	Frame_Shift_Ins	INS	-	-	T	rs139408667		TCGA-55-6970-01A-11D-1945-08	TCGA-55-6970-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8e068c22-e821-49e5-b7f3-d71b9179513e	10b141f3-4486-4931-b615-a05c63f4bea5	g.chr6:34846380_34846381insT	ENST00000361288.4	-	5	753_754	c.622_623insA	c.(622-624)atcfs	p.I208fs	UHRF1BP1_ENST00000452449.2_Intron|TAF11_ENST00000420584.2_3'UTR	NM_005643.3	NP_005634.1	Q15544	TAF11_HUMAN	TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa	208					gene expression (GO:0010467)|positive regulation by host of viral transcription (GO:0043923)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)	p.I208fs*>4(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(1)	6						GAAGAAGATGATTTTTTTGTGC	0.421																																							uc003ojw.1		NA																	1	Deletion - Frameshift(1)		large_intestine(1)		0						c.(622-624)ATCfs		TBP-associated factor 11																																				SO:0001589	frameshift_variant	6882				positive regulation by host of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	transcription factor TFIID complex	protein N-terminus binding|thyroid hormone receptor binding|transcription coactivator activity|vitamin D receptor binding	g.chr6:34846380_34846381insT	X83928	CCDS4797.1, CCDS59014.1	6p21	2008-02-05	2002-08-29	2001-12-07	ENSG00000064995	ENSG00000064995			11544	protein-coding gene	gene with protein product		600772	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, I, 28kD"""	TAF2I		7729427, 8820923	Standard	NM_005643		Approved	TAFII28	uc003ojw.2	Q15544	OTTHUMG00000014556	ENST00000361288.4:c.623dupA	6.37:g.34846387_34846387dupT	ENSP00000354633:p.Ile208fs					UHRF1BP1_uc010jvm.1_Intron|TAF11_uc011dsr.1_3'UTR	p.I208fs	NM_005643	NP_005634	Q15544	TAF11_HUMAN			5	707_708	-			208					B2R8R3|B4DY18|Q9UHS0	Frame_Shift_Ins	INS	ENST00000361288.4	37	c.622_623insA	CCDS4797.1																																																																																				0.421	TAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040259.1	NM_005643		10	130	NA	NA	NA	NA	NA	10	130	---	---	---	---
