#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
TTLL10	254173	broad.mit.edu	37	1	1117798	1117798	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:1117798G>C	ENST00000379290.1	+	10	1061	c.888G>C	c.(886-888)gaG>gaC	p.E296D	TTLL10-AS1_ENST00000379317.1_RNA|TTLL10_ENST00000379289.1_Missense_Mutation_p.E296D|TTLL10_ENST00000379288.3_Missense_Mutation_p.E223D			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10	296	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TCAAACACGAGAGAGAGGCCT	0.617																																							uc001acy.2		NA																	0				large_intestine(1)	1						c.(886-888)GAG>GAC		tubulin tyrosine ligase-like family, member 10							117.0	114.0	115.0					1																	1117798		2203	4300	6503	SO:0001583	missense	254173				protein modification process		ATP binding|tubulin-tyrosine ligase activity	g.chr1:1117798G>C	AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.888G>C	1.37:g.1117798G>C	ENSP00000368592:p.Glu296Asp					uc001acx.1_5'Flank|TTLL10_uc010nyg.1_Missense_Mutation_p.E296D|TTLL10_uc001acz.1_Missense_Mutation_p.E223D	p.E296D	NM_001130045	NP_001123517	Q6ZVT0	TTL10_HUMAN		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	10	1039	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	296			TTL.		B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	Missense_Mutation	SNP	ENST00000379290.1	37	c.888G>C	CCDS44036.1	.	.	.	.	.	.	.	.	.	.	G	6.903	0.536235	0.13188	.	.	ENSG00000162571	ENST00000379290;ENST00000379289;ENST00000379288	T;T;T	0.05996	3.36;3.36;3.36	3.28	2.33	0.28932	.	1.820940	0.03114	N	0.162886	T	0.06050	0.0157	N	0.17379	0.485	0.32702	N	0.512736	B;B	0.21520	0.057;0.04	B;B	0.27608	0.081;0.046	T	0.37641	-0.9697	10	0.16420	T	0.52	.	10.3556	0.43962	0.0:0.2023:0.7977:0.0	.	223;296	Q6ZVT0-3;Q6ZVT0	.;TTL10_HUMAN	D	296;296;223	ENSP00000368592:E296D;ENSP00000368591:E296D;ENSP00000368590:E223D	ENSP00000368590:E223D	E	+	3	2	TTLL10	1107661	1.000000	0.71417	0.219000	0.23793	0.011000	0.07611	1.804000	0.38873	0.717000	0.32145	0.479000	0.44913	GAG		0.617	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002421.3	NM_153254		7	81	0	0	0	0.000157383	0	7	81				
SPEN	23013	broad.mit.edu	37	1	16256410	16256410	+	Silent	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:16256410C>T	ENST00000375759.3	+	11	3879	c.3675C>T	c.(3673-3675)agC>agT	p.S1225S		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1225					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CTCCTCCTAGCAAAAAGAAAA	0.438																																							uc001axk.1		NA																	0				ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(3673-3675)AGC>AGT		spen homolog, transcriptional regulator							94.0	86.0	89.0					1																	16256410		2203	4300	6503	SO:0001819	synonymous_variant	23013				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding	g.chr1:16256410C>T		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.3675C>T	1.37:g.16256410C>T						SPEN_uc010obp.1_Silent_p.S1184S	p.S1225S	NM_015001	NP_055816	Q96T58	MINT_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)	11	3879	+		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	1225					Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	ENST00000375759.3	37	c.3675C>T	CCDS164.1																																																																																				0.438	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001		8	61	0	0	0	0.000274275	0	8	61				
ZNF362	149076	broad.mit.edu	37	1	33745793	33745793	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:33745793A>T	ENST00000539719.1	+	5	588	c.418A>T	c.(418-420)Acg>Tcg	p.T140S	ZNF362_ENST00000373428.5_Missense_Mutation_p.T140S	NM_152493.2	NP_689706.2	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(4)|lung(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GGGCACGGGCACGGGTACCAG	0.697																																					Pancreas(162;1431 2676 35353 38425)	Pancreas(162;1431 2676 35353 38425)	uc001bxc.1		NA																	0					0						c.(418-420)ACG>TCG		zinc finger protein 362							65.0	69.0	68.0					1																	33745793		2203	4299	6502	SO:0001583	missense	149076				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:33745793A>T		CCDS377.1	1p35.1	2013-01-08			ENSG00000160094	ENSG00000160094		"""Zinc fingers, C2H2-type"""	18079	protein-coding gene	gene with protein product	"""rotund homolog (Drosophila)"""						Standard	NM_152493		Approved	FLJ25476, lin-29, RN	uc001bxc.1	Q5T0B9	OTTHUMG00000004124	ENST00000539719.1:c.418A>T	1.37:g.33745793A>T	ENSP00000446335:p.Thr140Ser						p.T140S	NM_152493	NP_689706	Q5T0B9	ZN362_HUMAN			5	588	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	140					Q8WYU4	Missense_Mutation	SNP	ENST00000539719.1	37	c.418A>T	CCDS377.1	.	.	.	.	.	.	.	.	.	.	A	14.15	2.449899	0.43531	.	.	ENSG00000160094	ENST00000483388;ENST00000539719;ENST00000373428	T;T	0.07216	3.21;3.21	5.66	5.66	0.87406	.	0.151463	0.30593	N	0.009294	T	0.10121	0.0248	N	0.05441	-0.05	0.31649	N	0.647064	P	0.52842	0.956	P	0.62184	0.899	T	0.22730	-1.0208	10	0.16896	T	0.51	-9.0793	12.2818	0.54767	1.0:0.0:0.0:0.0	.	140	Q5T0B9	ZN362_HUMAN	S	127;140;140	ENSP00000446335:T140S;ENSP00000362527:T140S	ENSP00000362527:T140S	T	+	1	0	ZNF362	33518380	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.358000	0.73055	2.153000	0.67306	0.533000	0.62120	ACG		0.697	ZNF362-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011857.2	NM_152493		5	79	0	0	0	0.000602214	0	5	79				
LRRC41	10489	broad.mit.edu	37	1	46746150	46746150	+	Silent	SNP	C	C	A	rs141700475	byFrequency	TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:46746150C>A	ENST00000343304.6	-	6	2124	c.1839G>T	c.(1837-1839)tcG>tcT	p.S613S	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	613					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GCAGAGAACCCGAGGCCTTCA	0.562																																							uc001cpn.2		NA																	0				ovary(2)|breast(1)|pancreas(1)	4						c.(1837-1839)TCG>TCT		MUF1 protein							90.0	100.0	97.0					1																	46746150		2203	4300	6503	SO:0001819	synonymous_variant	10489							g.chr1:46746150C>A	AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.1839G>T	1.37:g.46746150C>A						LRRC41_uc010omb.1_Silent_p.S613S	p.S613S	NM_006369	NP_006360	Q15345	LRC41_HUMAN			6	1883	-	Acute lymphoblastic leukemia(166;0.155)		613			LRR 4.		A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Silent	SNP	ENST00000343304.6	37	c.1839G>T	CCDS533.1																																																																																				0.562	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021438.1	NM_006369		16	83	1	0	3.45872e-05	0.000422831	0.000446987	16	83				
CLCA1	1179	broad.mit.edu	37	1	86951204	86951204	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:86951204G>C	ENST00000234701.3	+	7	1265	c.914G>C	c.(913-915)aGa>aCa	p.R305T	CLCA1_ENST00000394711.1_Missense_Mutation_p.R305T			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	305					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		ATTGGACAAAGAATTGTGTGT	0.453																																							uc001dlt.2		NA																	0				ovary(1)	1						c.(913-915)AGA>ACA		chloride channel accessory 1 precursor							214.0	180.0	191.0					1																	86951204		2203	4300	6503	SO:0001583	missense	1179				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity	g.chr1:86951204G>C		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.914G>C	1.37:g.86951204G>C	ENSP00000234701:p.Arg305Thr					CLCA1_uc001dls.1_Missense_Mutation_p.R244T	p.R305T	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN		all cancers(265;0.0249)|Epithelial(280;0.0476)	6	1043	+		Lung NSC(277;0.239)	305					B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	37	c.914G>C	CCDS709.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224298	0.79576	.	.	ENSG00000016490	ENST00000234701;ENST00000394711;ENST00000539889	D;D	0.88896	-2.44;-2.44	5.92	5.92	0.95590	von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	D	0.95085	0.8408	M	0.87097	2.86	0.40559	D	0.981199	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	D	0.94476	0.7689	10	0.54805	T	0.06	-33.5521	19.9164	0.97064	0.0:0.0:1.0:0.0	.	305;68	A8K7I4;B4DUZ6	CLCA1_HUMAN;.	T	305;305;18	ENSP00000234701:R305T;ENSP00000378200:R305T	ENSP00000234701:R305T	R	+	2	0	CLCA1	86723792	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	7.315000	0.78998	2.810000	0.96702	0.650000	0.86243	AGA		0.453	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285		4	81	0	0	0	0.00024832	0	4	81				
COL11A1	1301	broad.mit.edu	37	1	103468337	103468337	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:103468337C>G	ENST00000370096.3	-	22	2321	c.2009G>C	c.(2008-2010)gGt>gCt	p.G670A	COL11A1_ENST00000358392.2_Missense_Mutation_p.G682A|COL11A1_ENST00000461720.1_5'UTR|COL11A1_ENST00000512756.1_Missense_Mutation_p.G554A|COL11A1_ENST00000353414.4_Missense_Mutation_p.G631A	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	670	Collagen-like 4.|Collagen-like 5.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GCCATCTACACCTGCCATACC	0.323																																							uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(2008-2010)GGT>GCT		alpha 1 type XI collagen isoform A							76.0	84.0	81.0					1																	103468337		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103468337C>G	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2009G>C	1.37:g.103468337C>G	ENSP00000359114:p.Gly670Ala					COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Missense_Mutation_p.G682A|COL11A1_uc001dun.2_Missense_Mutation_p.G631A|COL11A1_uc009weh.2_Missense_Mutation_p.G554A	p.G670A	NM_001854	NP_001845	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	22	2327	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	670			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.2009G>C	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.698248	0.88830	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.99158	-5.5;-5.5;-5.5;-5.5	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.99557	0.9841	M	0.93507	3.425	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.998;0.998;0.999	D	0.98455	1.0593	10	0.87932	D	0	.	20.0757	0.97742	0.0:1.0:0.0:0.0	.	554;631;682;670	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	A	670;682;631;554	ENSP00000359114:G670A;ENSP00000351163:G682A;ENSP00000302551:G631A;ENSP00000426533:G554A	ENSP00000302551:G631A	G	-	2	0	COL11A1	103240925	1.000000	0.71417	0.350000	0.25708	0.988000	0.76386	7.185000	0.77714	2.820000	0.97059	0.655000	0.94253	GGT		0.323	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		3	25	0	0	0	6.4e-05	0	3	25				
SV2A	9900	broad.mit.edu	37	1	149884837	149884837	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:149884837C>A	ENST00000369146.3	-	2	1046	c.556G>T	c.(556-558)Gtg>Ttg	p.V186L	SV2A_ENST00000369145.1_Missense_Mutation_p.V186L	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	186					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	ACGAAGCCCACCACAAAGACC	0.582																																							uc001etg.2		NA																	0				ovary(6)|pancreas(1)	7						c.(556-558)GTG>TTG		synaptic vesicle glycoprotein 2	Levetiracetam(DB01202)						119.0	113.0	115.0					1																	149884837		2203	4300	6503	SO:0001583	missense	9900				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr1:149884837C>A	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.556G>T	1.37:g.149884837C>A	ENSP00000358142:p.Val186Leu					SV2A_uc001eth.2_Missense_Mutation_p.V186L	p.V186L	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		2	1047	-	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		186			Helical; (Potential).		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	ENST00000369146.3	37	c.556G>T	CCDS940.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.831757	0.91036	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.58210	0.35;0.35	5.02	5.02	0.67125	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000001	T	0.51449	0.1675	L	0.39326	1.205	0.80722	D	1	D	0.60575	0.988	D	0.69824	0.966	T	0.38067	-0.9678	10	0.12103	T	0.63	-22.9771	17.5091	0.87755	0.0:1.0:0.0:0.0	.	186	Q7L0J3	SV2A_HUMAN	L	186	ENSP00000358142:V186L;ENSP00000358141:V186L	ENSP00000358141:V186L	V	-	1	0	SV2A	148151461	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.651000	0.83577	2.606000	0.88127	0.655000	0.94253	GTG		0.582	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1			17	76	1	0	8.00594e-06	0.000958276	0.000108195	17	76				
MCL1	4170	broad.mit.edu	37	1	150550957	150550957	+	Silent	SNP	C	C	G	rs377705989		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:150550957C>G	ENST00000369026.2	-	2	758	c.699G>C	c.(697-699)cgG>cgC	p.R233R	MCL1_ENST00000464132.1_5'UTR|MCL1_ENST00000307940.3_Intron	NM_001197320.1|NM_021960.4	NP_001184249.1|NP_068779.1	Q07820	MCL1_HUMAN	myeloid cell leukemia 1	233					apoptotic mitochondrial changes (GO:0008637)|cell fate determination (GO:0001709)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|protein transmembrane transport (GO:0071806)|regulation of response to DNA damage stimulus (GO:2001020)|response to cytokine (GO:0034097)	Bcl-2 family protein complex (GO:0097136)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	BH3 domain binding (GO:0051434)|protein channel activity (GO:0015266)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)	8	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TGTCCAGTTTCCGAAGCATGC	0.522																																							uc001euz.2		NA																	0					0						c.(697-699)CGG>CGC		myeloid cell leukemia sequence 1 isoform 1							76.0	80.0	79.0					1																	150550957		2203	4300	6503	SO:0001819	synonymous_variant	4170				anti-apoptosis|apoptosis|cell fate determination|cellular homeostasis|multicellular organismal development|response to cytokine stimulus	integral to membrane|mitochondrial outer membrane|nucleoplasm	BH3 domain binding|protein binding|protein channel activity|protein heterodimerization activity	g.chr1:150550957C>G	BC017197	CCDS956.1, CCDS957.1, CCDS72909.1	1q21	2014-03-07	2014-03-07		ENSG00000143384	ENSG00000143384			6943	protein-coding gene	gene with protein product		159552	"""myeloid cell leukemia sequence 1 (BCL2-related)"""			7682708, 7835896	Standard	NM_021960		Approved	BCL2L3, Mcl-1	uc001euz.3	Q07820	OTTHUMG00000034867	ENST00000369026.2:c.699G>C	1.37:g.150550957C>G						MCL1_uc010pch.1_Silent_p.R123R|MCL1_uc001eva.2_Intron	p.R233R	NM_021960	NP_068779	Q07820	MCL1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		2	829	-	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		233					B2R6B2|D3DV03|D3DV04|Q9HD91|Q9NRQ3|Q9NRQ4|Q9UHR7|Q9UHR8|Q9UHR9|Q9UNJ1	Silent	SNP	ENST00000369026.2	37	c.699G>C	CCDS957.1																																																																																				0.522	MCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084402.1	NM_021960		4	77	0	0	0	3.59834e-05	0	4	77				
FLG2	388698	broad.mit.edu	37	1	152323904	152323904	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:152323904T>A	ENST00000388718.5	-	3	6430	c.6358A>T	c.(6358-6360)Aca>Tca	p.T2120S	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	2120					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGAATGTGTGTGTGAGACC	0.527																																							uc001ezw.3		NA																	0				ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(6358-6360)ACA>TCA		filaggrin family member 2							473.0	435.0	448.0					1																	152323904		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152323904T>A	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.6358A>T	1.37:g.152323904T>A	ENSP00000373370:p.Thr2120Ser					uc001ezv.2_Intron	p.T2120S	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6431	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2120					Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.6358A>T	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.727090	0.30593	.	.	ENSG00000143520	ENST00000388718	T	0.03745	3.82	4.56	0.00951	0.14079	.	.	.	.	.	T	0.00998	0.0033	L	0.29908	0.895	0.09310	N	1	P	0.43973	0.823	P	0.47206	0.541	T	0.22591	-1.0212	9	0.02654	T	1	-0.6254	7.2411	0.26098	0.0:0.3138:0.0:0.6862	.	2120	Q5D862	FILA2_HUMAN	S	2120	ENSP00000373370:T2120S	ENSP00000373370:T2120S	T	-	1	0	FLG2	150590528	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.628000	0.05515	-0.080000	0.12685	0.450000	0.29827	ACA		0.527	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		71	353	0	0	0	0.000781405	0	71	353				
KPRP	448834	broad.mit.edu	37	1	152732194	152732194	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:152732194C>A	ENST00000606109.1	+	1	158	c.130C>A	c.(130-132)Caa>Aaa	p.Q44K	KPRP_ENST00000368773.1_Missense_Mutation_p.Q44K			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	44	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGTGAGATGCAAATTGTGGA	0.567																																							uc001fal.1		NA																	0				ovary(4)|pancreas(1)	5						c.(130-132)CAA>AAA		keratinocyte proline-rich protein							152.0	144.0	147.0					1																	152732194		2203	4300	6503	SO:0001583	missense	448834					cytoplasm		g.chr1:152732194C>A	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.130C>A	1.37:g.152732194C>A	ENSP00000475216:p.Gln44Lys						p.Q44K	NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	188	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		44			Gln-rich.			Missense_Mutation	SNP	ENST00000606109.1	37	c.130C>A	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.536190	0.45176	.	.	ENSG00000203786	ENST00000368773	T	0.12984	2.63	5.78	3.78	0.43462	.	0.147763	0.31976	N	0.006762	T	0.04952	0.0133	L	0.48362	1.52	0.21878	N	0.999499	B	0.28350	0.208	B	0.23574	0.047	T	0.20140	-1.0284	10	0.39692	T	0.17	-4.2479	11.3081	0.49347	0.3284:0.6716:0.0:0.0	.	44	Q5T749	KPRP_HUMAN	K	44	ENSP00000357762:Q44K	ENSP00000357762:Q44K	Q	+	1	0	KPRP	150998818	1.000000	0.71417	0.989000	0.46669	0.944000	0.59088	1.236000	0.32683	1.570000	0.49709	0.655000	0.94253	CAA		0.567	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231		21	89	1	0	1.10923e-09	0.000375601	1.67091e-08	21	89				
CHTOP	26097	broad.mit.edu	37	1	153615717	153615717	+	Silent	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:153615717C>A	ENST00000368694.3	+	5	730	c.418C>A	c.(418-420)Cga>Aga	p.R140R	CHTOP_ENST00000368687.1_Silent_p.R115R|CHTOP_ENST00000368690.3_Intron|CHTOP_ENST00000495554.1_Intron|CHTOP_ENST00000368686.1_3'UTR|CHTOP_ENST00000403433.1_Intron	NM_001206612.1|NM_015607.3	NP_001193541.1|NP_056422.2	Q9Y3Y2	CHTOP_HUMAN	chromatin target of PRMT1	140	Arg/Gly-rich.				mRNA export from nucleus (GO:0006406)|positive regulation of ATPase activity (GO:0032781)|positive regulation of helicase activity (GO:0051096)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|transcription export complex (GO:0000346)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(6)	13						AAACCTGCTCCGAGGTGGACG	0.537																																							uc001fcm.1		NA																	0					0						c.(418-420)CGA>AGA		small protein rich in arginine and glycine							121.0	120.0	120.0					1																	153615717		2203	4300	6503	SO:0001819	synonymous_variant	26097				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	protein binding|RNA binding	g.chr1:153615717C>A		CCDS1048.1, CCDS72917.1, CCDS72918.1	1q21.3	2011-03-24	2011-03-24	2011-03-24	ENSG00000160679	ENSG00000160679			24511	protein-coding gene	gene with protein product	"""small protein rich in arginine and glycine"", ""Friend of Prmt1"""	614206	"""chromosome 1 open reading frame 77"""	C1orf77		19254951	Standard	NM_015607		Approved	DKFZP547E1010, SRAG, FOP	uc001fcn.2	Q9Y3Y2	OTTHUMG00000037052	ENST00000368694.3:c.418C>A	1.37:g.153615717C>A						C1orf77_uc001fcn.1_Silent_p.R141R|C1orf77_uc001fco.1_Silent_p.R115R|C1orf77_uc001fcp.2_5'Flank|C1orf77_uc009woj.1_3'UTR	p.R140R	NM_015607	NP_056422	Q9Y3Y2	CHTOP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		5	730	+	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		140			Arg/Gly-rich.		D3DV55|Q0VAQ8|Q2VPI9|Q5T7Y8|Q5T7Y9|Q5T7Z0|Q6NSM4|Q6PB28|Q8WYT9|Q9BUC5|Q9H034|Q9H2L0	Silent	SNP	ENST00000368694.3	37	c.418C>A	CCDS1048.1																																																																																				0.537	CHTOP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089967.1	NM_015607		7	145	1	0	0.000274275	0.000274275	0.003414	7	145				
TMEM79	84283	broad.mit.edu	37	1	156255160	156255160	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:156255160G>C	ENST00000405535.2	+	2	314	c.143G>C	c.(142-144)aGa>aCa	p.R48T	SMG5_ENST00000368267.5_5'Flank|TMEM79_ENST00000295694.5_Missense_Mutation_p.R48T|TMEM79_ENST00000495881.1_3'UTR|TMEM79_ENST00000357501.2_Intron|SMG5_ENST00000361813.5_5'Flank	NM_032323.2	NP_115699.1	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	48					cornification (GO:0070268)|cuticle development (GO:0042335)|epithelial cell maturation (GO:0002070)|establishment of skin barrier (GO:0061436)|hair follicle morphogenesis (GO:0031069)|positive regulation of epidermis development (GO:0045684)|regulated secretory pathway (GO:0045055)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|urinary_tract(1)	21	Hepatocellular(266;0.158)					GAGTCCCTCAGAGTGGGGTCT	0.627																																							uc010phi.1		NA																	0				central_nervous_system(1)	1						c.(142-144)AGA>ACA		transmembrane protein 79							37.0	41.0	40.0					1																	156255160		2203	4300	6503	SO:0001583	missense	84283					integral to membrane		g.chr1:156255160G>C	BC005094	CCDS1138.1	1q22	2014-04-22			ENSG00000163472	ENSG00000163472			28196	protein-coding gene	gene with protein product	"""mattrin"""	615531					Standard	NM_032323		Approved	MGC13102, FLJ16057, FLJ32254, MATT	uc009wrw.3	Q9BSE2	OTTHUMG00000019788	ENST00000405535.2:c.143G>C	1.37:g.156255160G>C	ENSP00000384748:p.Arg48Thr					SMG5_uc001foc.3_5'Flank|TMEM79_uc001fod.2_Intron|TMEM79_uc009wrw.2_Missense_Mutation_p.R48T	p.R48T	NM_032323	NP_115699	Q9BSE2	TMM79_HUMAN			2	339	+	Hepatocellular(266;0.158)		48					B2RE22|D3DVB8	Missense_Mutation	SNP	ENST00000405535.2	37	c.143G>C	CCDS1138.1	.	.	.	.	.	.	.	.	.	.	G	5.861	0.342968	0.11069	.	.	ENSG00000163472	ENST00000295694;ENST00000405535	T;T	0.56275	0.47;0.47	5.08	-1.98	0.07480	.	1.152270	0.06276	N	0.696484	T	0.13200	0.0320	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16424	-1.0403	9	.	.	.	-4.3377	5.0695	0.14600	0.3283:0.2577:0.4141:0.0	.	48	Q9BSE2	TMM79_HUMAN	T	48	ENSP00000295694:R48T;ENSP00000384748:R48T	.	R	+	2	0	TMEM79	154521784	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	-0.017000	0.12590	-0.460000	0.07003	-0.137000	0.14449	AGA		0.627	TMEM79-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052101.1	NM_032323		5	52	0	0	0	0.000602214	0	5	52				
PEAR1	375033	broad.mit.edu	37	1	156873742	156873742	+	Silent	SNP	C	C	A	rs373675759		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:156873742C>A	ENST00000338302.3	+	3	249	c.24C>A	c.(22-24)ctC>ctA	p.L8L	PEAR1_ENST00000292357.7_Silent_p.L8L			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	8					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TGTGTCCCCTCCTTCTCCTGG	0.642																																							uc001fqj.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(22-24)CTC>CTA		platelet endothelial aggregation receptor 1							118.0	106.0	110.0					1																	156873742		2203	4300	6503	SO:0001819	synonymous_variant	375033					integral to membrane		g.chr1:156873742C>A	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.24C>A	1.37:g.156873742C>A						PEAR1_uc009wsl.1_5'Flank|PEAR1_uc001fqk.1_5'Flank	p.L8L	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN			2	140	+	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		8					Q8TEK2	Silent	SNP	ENST00000338302.3	37	c.24C>A	CCDS30892.1																																																																																				0.642	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471		14	84	1	0	2.23348e-06	0.000422831	3.07104e-05	14	84				
FCRL5	83416	broad.mit.edu	37	1	157494111	157494111	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:157494111G>C	ENST00000361835.3	-	10	2354	c.2197C>G	c.(2197-2199)Ctg>Gtg	p.L733V	FCRL5_ENST00000461387.1_5'Flank|FCRL5_ENST00000368190.3_Missense_Mutation_p.L733V|FCRL5_ENST00000368191.3_Missense_Mutation_p.L648V|FCRL5_ENST00000356953.4_Missense_Mutation_p.L733V	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	733	Ig-like C2-type 7.			L -> P (in Ref. 1; AAK50059). {ECO:0000305}.	negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				TGGGCCTCCAGACCATTGTCT	0.567																																							uc001fqu.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)	6						c.(2197-2199)CTG>GTG		Fc receptor-like 5							55.0	60.0	58.0					1																	157494111		2203	4300	6503	SO:0001583	missense	83416					integral to membrane|plasma membrane	receptor activity	g.chr1:157494111G>C	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2197C>G	1.37:g.157494111G>C	ENSP00000354691:p.Leu733Val					FCRL5_uc009wsm.2_Missense_Mutation_p.L733V|FCRL5_uc010phv.1_Missense_Mutation_p.L733V|FCRL5_uc010phw.1_Missense_Mutation_p.L648V	p.L733V	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN			10	2355	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)	733	L -> P (in Ref. 1; AAK50059).		Extracellular (Potential).|Ig-like C2-type 7.		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	c.2197C>G	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	G	9.930	1.214611	0.22289	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191	T;T;T;T	0.03386	3.95;3.95;3.95;3.95	4.83	-1.14	0.09741	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.03305	0.0096	M	0.70842	2.15	0.09310	N	1	D;P;D;P	0.71674	0.998;0.754;0.969;0.739	D;P;P;P	0.72982	0.979;0.55;0.874;0.667	T	0.29971	-0.9994	9	0.07644	T	0.81	.	4.4546	0.11637	0.0887:0.437:0.3254:0.1489	.	648;733;733;733	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9	.;.;.;FCRL5_HUMAN	V	733;733;733;648	ENSP00000354691:L733V;ENSP00000349434:L733V;ENSP00000357173:L733V;ENSP00000357174:L648V	ENSP00000349434:L733V	L	-	1	2	FCRL5	155760735	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	-0.465000	0.06680	0.014000	0.14944	0.650000	0.86243	CTG		0.567	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281		12	59	0	0	0	0.000978159	0	12	59				
UBE2T	29089	broad.mit.edu	37	1	202301085	202301085	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:202301085C>T	ENST00000367274.4	-	7	621	c.472G>A	c.(472-474)Gat>Aat	p.D158N		NM_014176.3	NP_054895.1	Q9NPD8	UBE2T_HUMAN	ubiquitin-conjugating enzyme E2T (putative)	158					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|protein autoubiquitination (GO:0051865)|protein K11-linked ubiquitination (GO:0070979)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(3)|skin(1)	5						TCTTCCTCATCAGCCTAAAGA	0.423																																							uc001gxx.3		NA																	0					0						c.(472-474)GAT>AAT		ubiquitin-conjugating enzyme E2T							140.0	125.0	130.0					1																	202301085		2203	4300	6503	SO:0001583	missense	29089				DNA repair|protein K11-linked ubiquitination|protein K27-linked ubiquitination|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination	nucleoplasm	ATP binding|ubiquitin-protein ligase activity	g.chr1:202301085C>T	AF161499	CCDS1425.1	1q32.1	2008-02-05			ENSG00000077152	ENSG00000077152		"""Ubiquitin-conjugating enzymes E2"""	25009	protein-coding gene	gene with protein product		610538				11042152	Standard	NM_014176		Approved	HSPC150	uc001gxx.4	Q9NPD8	OTTHUMG00000041392	ENST00000367274.4:c.472G>A	1.37:g.202301085C>T	ENSP00000356243:p.Asp158Asn						p.D158N	NM_014176	NP_054895	Q9NPD8	UBE2T_HUMAN			7	608	-			158					Q2TU36	Missense_Mutation	SNP	ENST00000367274.4	37	c.472G>A	CCDS1425.1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.330383	0.24167	.	.	ENSG00000077152	ENST00000367274	T	0.53206	0.63	5.83	1.9	0.25705	Ubiquitin-conjugating enzyme/RWD-like (1);	1.518660	0.03549	N	0.225167	T	0.31199	0.0789	N	0.19112	0.55	0.09310	N	1	B	0.17667	0.023	B	0.15870	0.014	T	0.16928	-1.0386	10	0.07990	T	0.79	0.0268	7.5381	0.27723	0.0:0.6774:0.0:0.3226	.	158	Q9NPD8	UBE2T_HUMAN	N	158	ENSP00000356243:D158N	ENSP00000356243:D158N	D	-	1	0	UBE2T	200567708	0.000000	0.05858	0.002000	0.10522	0.099000	0.18886	0.132000	0.15891	0.827000	0.34685	0.585000	0.79938	GAT		0.423	UBE2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099163.1	NM_014176		6	79	0	0	0	8.12818e-05	0	6	79				
SLC45A3	85414	broad.mit.edu	37	1	205633646	205633646	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:205633646C>A	ENST00000367145.3	-	2	434	c.139G>T	c.(139-141)Ggg>Tgg	p.G47W	SLC45A3_ENST00000460934.1_5'Flank	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	47					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)			SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			TCCTCTACCCCCACTTCCAGC	0.567			T	"""ETV1, ETV5, ELK4, ERG"""	prostate																																		uc001hda.1		NA		Dom	yes		1	1q32	85414	T	"""solute carrier family 45, member 3"""			E	ETV1|ETV5|ELK4|ERG		prostate 	SLC45A3/BRAF(2)	0				ovary(2)|prostate(2)	4						c.(139-141)GGG>TGG		prostein							179.0	161.0	167.0					1																	205633646		2203	4300	6503	SO:0001583	missense	85414				transmembrane transport	integral to membrane		g.chr1:205633646C>A	AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.139G>T	1.37:g.205633646C>A	ENSP00000356113:p.Gly47Trp					SLC45A3_uc010prn.1_5'Flank|SLC45A3_uc010pro.1_5'Flank|SLC45A3_uc010prp.1_RNA|ELK4_uc010prq.1_Intron	p.G47W	NM_033102	NP_149093	Q96JT2	S45A3_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0194)		2	478	-	Breast(84;0.07)		47					A8K2U9	Missense_Mutation	SNP	ENST00000367145.3	37	c.139G>T	CCDS1458.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.666898	0.88251	.	.	ENSG00000158715	ENST00000367145	D	0.97089	-4.24	5.25	5.25	0.73442	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.98741	0.9577	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99787	1.1030	10	0.87932	D	0	-5.5576	18.4523	0.90709	0.0:1.0:0.0:0.0	.	47	Q96JT2	S45A3_HUMAN	W	47	ENSP00000356113:G47W	ENSP00000356113:G47W	G	-	1	0	SLC45A3	203900269	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.818000	0.86416	2.456000	0.83038	0.561000	0.74099	GGG		0.567	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090619.1	NM_033102		25	129	1	0	1.77063e-15	0.000878237	2.7917e-14	25	129				
GPATCH2	55105	broad.mit.edu	37	1	217671721	217671721	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:217671721C>A	ENST00000366935.3	-	7	1293	c.1183G>T	c.(1183-1185)Ggg>Tgg	p.G395W	GPATCH2_ENST00000489246.2_5'UTR	NM_018040.2	NP_060510.1	Q9NW75	GPTC2_HUMAN	G patch domain containing 2	395					negative regulation of phosphatase activity (GO:0010923)		nucleic acid binding (GO:0003676)	p.G395W(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)	35				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		GTCCTAGCCCCAGGGCTAAAC	0.463																																							uc001hlf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1183-1185)GGG>TGG		G patch domain containing 2							196.0	197.0	197.0					1																	217671721		2203	4300	6503	SO:0001583	missense	55105					intracellular	nucleic acid binding	g.chr1:217671721C>A	AK001114	CCDS1518.1, CCDS73031.1	1q41	2013-01-28		2006-12-13	ENSG00000092978	ENSG00000092978		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""G patch domain containing"""	25499	protein-coding gene	gene with protein product	"""cancer/testis antigen 110"", ""protein phosphatase 1, regulatory subunit 30"""			GPATC2		19432882, 15375528	Standard	XM_005273174		Approved	FLJ10252, CT110, PPP1R30	uc001hlf.1	Q9NW75	OTTHUMG00000000527	ENST00000366935.3:c.1183G>T	1.37:g.217671721C>A	ENSP00000355902:p.Gly395Trp					GPATCH2_uc009xdq.1_RNA	p.G395W	NM_018040	NP_060510	Q9NW75	GPTC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)	7	1279	-			395					Q5VYK7|Q5VYK8|Q86YE7	Missense_Mutation	SNP	ENST00000366935.3	37	c.1183G>T	CCDS1518.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.672775	0.67928	.	.	ENSG00000092978	ENST00000366935	T	0.32753	1.44	5.56	5.56	0.83823	.	0.105150	0.64402	D	0.000005	T	0.55000	0.1893	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.48703	-0.9012	10	0.41790	T	0.15	-37.6587	17.6539	0.88172	0.0:1.0:0.0:0.0	.	395	Q9NW75	GPTC2_HUMAN	W	395	ENSP00000355902:G395W	ENSP00000355902:G395W	G	-	1	0	GPATCH2	215738344	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.142000	0.64820	2.778000	0.95560	0.591000	0.81541	GGG		0.463	GPATCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001272.1	NM_018040		15	123	1	0	3.35478e-16	0.000308642	5.32486e-15	15	123				
ENAH	55740	broad.mit.edu	37	1	225706984	225706984	+	Missense_Mutation	SNP	G	G	A	rs142024814		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:225706984G>A	ENST00000366844.3	-	5	1169	c.718C>T	c.(718-720)Cgg>Tgg	p.R240W	ENAH_ENST00000366843.2_Missense_Mutation_p.R240W|ENAH_ENST00000284563.6_Missense_Mutation_p.R259W|ENAH_ENST00000391874.2_5'UTR	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	240					actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)	p.R240W(1)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		TGCCTCTCCCGTTCCAGTCTC	0.552																																							uc001hpc.1		NA																	1	Substitution - Missense(1)	p.R240W(1)	skin(1)	ovary(1)|skin(1)	2						c.(718-720)CGG>TGG		enabled homolog isoform a							213.0	206.0	209.0					1																	225706984		2203	4300	6503	SO:0001583	missense	55740				axon guidance|intracellular transport|T cell receptor signaling pathway	cytosol|filopodium|focal adhesion|lamellipodium|synapse	actin binding|SH3 domain binding|WW domain binding	g.chr1:225706984G>A	AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.718C>T	1.37:g.225706984G>A	ENSP00000355809:p.Arg240Trp					ENAH_uc001hpd.1_Missense_Mutation_p.R240W	p.R240W	NM_001008493	NP_001008493	Q8N8S7	ENAH_HUMAN		GBM - Glioblastoma multiforme(131;0.19)	5	1171	-	Breast(184;0.206)		240			Potential.		D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	Missense_Mutation	SNP	ENST00000366844.3	37	c.718C>T	CCDS31041.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760817	0.69763	.	.	ENSG00000154380	ENST00000366844;ENST00000366843;ENST00000284563;ENST00000538194	T;T;T	0.58797	0.31;0.31;0.31	5.25	5.25	0.73442	.	0.279316	0.27881	N	0.017467	T	0.51244	0.1663	L	0.46157	1.445	0.44061	D	0.9968	B;B	0.18968	0.03;0.032	B;B	0.12156	0.007;0.005	T	0.50808	-0.8784	10	0.56958	D	0.05	-1.0014	13.191	0.59711	0.0769:0.0:0.9231:0.0	.	240;240	Q8N8S7-2;Q8N8S7	.;ENAH_HUMAN	W	240;240;259;239	ENSP00000355809:R240W;ENSP00000355808:R240W;ENSP00000284563:R259W	ENSP00000284563:R259W	R	-	1	2	ENAH	223773607	0.900000	0.30661	0.823000	0.32752	0.826000	0.46750	2.383000	0.44354	2.438000	0.82558	0.650000	0.86243	CGG		0.552	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357426.2	NM_018212		19	294	0	0	0	0.000132079	0	19	294				
PYCR2	29920	broad.mit.edu	37	1	226109657	226109657	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:226109657C>A	ENST00000343818.6	-	4	589	c.441G>T	c.(439-441)caG>caT	p.Q147H	PYCR2_ENST00000478402.1_5'UTR|RP4-559A3.7_ENST00000432920.2_Intron	NM_013328.2	NP_037460.2	Q96C36	P5CR2_HUMAN	pyrroline-5-carboxylate reductase family, member 2	147					L-proline biosynthetic process (GO:0055129)	cytoplasm (GO:0005737)	pyrroline-5-carboxylate reductase activity (GO:0004735)			kidney(1)|lung(3)	4	Breast(184;0.197)				L-Proline(DB00172)	GCTCCAGGAGCTGCCCATCCT	0.627																																							uc001hpq.2		NA																	0					0						c.(439-441)CAG>CAT		pyrroline-5-carboxylate reductase family, member	L-Proline(DB00172)|NADH(DB00157)						53.0	42.0	46.0					1																	226109657		2203	4300	6503	SO:0001583	missense	29920				proline biosynthetic process	cytoplasm	binding|pyrroline-5-carboxylate reductase activity	g.chr1:226109657C>A	AF151351	CCDS31043.1, CCDS73039.1	1q42.13	2008-02-05			ENSG00000143811	ENSG00000143811			30262	protein-coding gene	gene with protein product						12477932	Standard	NM_013328		Approved	P5CR2	uc001hpq.4	Q96C36	OTTHUMG00000037506	ENST00000343818.6:c.441G>T	1.37:g.226109657C>A	ENSP00000342502:p.Gln147His					LEFTY1_uc010pvj.1_Intron|PYCR2_uc001hpp.2_Missense_Mutation_p.Q111H|PYCR2_uc001hpr.2_Missense_Mutation_p.Q100H|PYCR2_uc001hps.1_Missense_Mutation_p.Q100H	p.Q147H	NM_013328	NP_037460	Q96C36	P5CR2_HUMAN			4	596	-	Breast(184;0.197)		147					A8K798|Q7Z515|Q9Y5J4	Missense_Mutation	SNP	ENST00000343818.6	37	c.441G>T	CCDS31043.1	.	.	.	.	.	.	.	.	.	.	c	16.35	3.097996	0.56183	.	.	ENSG00000143811	ENST00000343818;ENST00000316940;ENST00000316918	T	0.64085	-0.08	4.67	3.74	0.42951	NAD(P)-binding domain (1);	0.323891	0.36234	N	0.002720	T	0.58235	0.2108	L	0.46157	1.445	0.36814	D	0.886046	B;B	0.22983	0.078;0.004	B;B	0.32022	0.139;0.007	T	0.64736	-0.6337	10	0.59425	D	0.04	.	12.9535	0.58413	0.0:0.8361:0.1639:0.0	.	147;146	Q96C36;E7EUS9	P5CR2_HUMAN;.	H	147;146;100	ENSP00000342502:Q147H	ENSP00000321499:Q100H	Q	-	3	2	PYCR2	224176280	0.986000	0.35501	1.000000	0.80357	0.993000	0.82548	1.188000	0.32102	1.291000	0.44653	0.655000	0.94253	CAG		0.627	PYCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091314.1	NM_013328		5	25	1	0	1.23904e-05	0.000602214	0.000161897	5	25				
OBSCN	84033	broad.mit.edu	37	1	228466415	228466415	+	Silent	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:228466415G>T	ENST00000422127.1	+	26	6929	c.6885G>T	c.(6883-6885)ccG>ccT	p.P2295P	OBSCN_ENST00000366707.4_5'UTR|RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.P2295P|RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000359599.6_Silent_p.P1142P|OBSCN_ENST00000570156.2_Silent_p.P2724P	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2295	Ig-like 23.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCGTGCGCCCGCTGCGGGACA	0.667																																							uc009xez.1		NA																	0				stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(6883-6885)CCG>CCT		obscurin, cytoskeletal calmodulin and							42.0	49.0	47.0					1																	228466415		2114	4224	6338	SO:0001819	synonymous_variant	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228466415G>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.6885G>T	1.37:g.228466415G>T						OBSCN_uc001hsn.2_Silent_p.P2295P|OBSCN_uc001hsp.1_5'UTR|OBSCN_uc001hsq.1_5'Flank	p.P2295P	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN			26	6929	+		Prostate(94;0.0405)	2295			Ig-like 23.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	c.6885G>T	CCDS58065.1																																																																																				0.667	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		8	45	1	0	2.27111e-07	0.00010058	3.21627e-06	8	45				
OR2M2	391194	broad.mit.edu	37	1	248343825	248343825	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:248343825G>T	ENST00000359682.2	+	1	538	c.538G>T	c.(538-540)Gaa>Taa	p.E180*		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTTCTTCTGTGAATTCCCTTC	0.423																																							uc010pzf.1		NA																	0				ovary(3)|skin(1)	4						c.(538-540)GAA>TAA		olfactory receptor, family 2, subfamily M,							240.0	234.0	236.0					1																	248343825		2203	4300	6503	SO:0001587	stop_gained	391194				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248343825G>T	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.538G>T	1.37:g.248343825G>T	ENSP00000352710:p.Glu180*						p.E180*	NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	538	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		180			Extracellular (Potential).		A3KFT4	Nonsense_Mutation	SNP	ENST00000359682.2	37	c.538G>T	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	g	15.09	2.729942	0.48833	.	.	ENSG00000198601	ENST00000359682	.	.	.	1.88	1.88	0.25563	.	0.261257	0.19898	U	0.103570	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.6433	0.51246	0.0:0.0:1.0:0.0	.	.	.	.	X	180	.	ENSP00000352710:E180X	E	+	1	0	OR2M2	246410448	1.000000	0.71417	0.198000	0.23420	0.008000	0.06430	5.074000	0.64401	1.056000	0.40484	0.454000	0.30748	GAA		0.423	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688		15	127	1	0	2.23348e-06	0.000422831	3.07104e-05	15	127				
OR2T2	401992	broad.mit.edu	37	1	248616145	248616145	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:248616145C>A	ENST00000342927.3	+	1	69	c.47C>A	c.(46-48)aCa>aAa	p.T16K		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCGTCCTCACAGGCCTCATC	0.502																																							uc001iek.1		NA																	0				skin(1)	1						c.(46-48)ACA>AAA		olfactory receptor, family 2, subfamily T,							88.0	104.0	99.0					1																	248616145		2202	4298	6500	SO:0001583	missense	401992				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248616145C>A	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.47C>A	1.37:g.248616145C>A	ENSP00000343062:p.Thr16Lys						p.T16K	NM_001004136	NP_001004136	Q6IF00	OR2T2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	47	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		16			Extracellular (Potential).		B2RNM1|B9EH01	Missense_Mutation	SNP	ENST00000342927.3	37	c.47C>A	CCDS31116.1	.	.	.	.	.	.	.	.	.	.	c	11.28	1.591007	0.28357	.	.	ENSG00000196240	ENST00000342927	T	0.00346	8.01	3.2	0.419	0.16438	.	0.426320	0.17162	N	0.184642	T	0.00178	0.0005	L	0.35644	1.08	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.43491	-0.9388	10	0.87932	D	0	.	4.3047	0.10940	0.1743:0.1088:0.0:0.7169	.	16	Q6IF00	OR2T2_HUMAN	K	16	ENSP00000343062:T16K	ENSP00000343062:T16K	T	+	2	0	OR2T2	246682768	0.030000	0.19436	0.018000	0.16275	0.236000	0.25371	0.223000	0.17719	0.334000	0.23590	-0.849000	0.03036	ACA		0.502	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136		14	132	1	0	1.02788e-11	0.000566183	1.58885e-10	14	132				
TACC2	10579	broad.mit.edu	37	10	123843455	123843455	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr10:123843455G>T	ENST00000369005.1	+	4	1780	c.1440G>T	c.(1438-1440)gaG>gaT	p.E480D	TACC2_ENST00000358010.1_Intron|TACC2_ENST00000334433.3_Missense_Mutation_p.E480D|TACC2_ENST00000453444.2_Missense_Mutation_p.E480D|TACC2_ENST00000515273.1_Missense_Mutation_p.E480D|TACC2_ENST00000515603.1_Missense_Mutation_p.E480D|TACC2_ENST00000513429.1_Intron	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	480					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GCAAGGGAGAGCATCCAGAAG	0.587																																							uc001lfv.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(1438-1440)GAG>GAT		transforming, acidic coiled-coil containing							101.0	110.0	107.0					10																	123843455		2203	4300	6503	SO:0001583	missense	10579					microtubule organizing center|nucleus	nuclear hormone receptor binding	g.chr10:123843455G>T	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.1440G>T	10.37:g.123843455G>T	ENSP00000358001:p.Glu480Asp					TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Missense_Mutation_p.E480D|TACC2_uc010qtv.1_Missense_Mutation_p.E480D	p.E480D	NM_206862	NP_996744	O95359	TACC2_HUMAN			4	1800	+		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)	480					Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	c.1440G>T	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986037	0.35036	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.03580	3.93;3.88;3.9;3.93;3.88	5.09	1.05	0.20165	.	0.221905	0.22934	N	0.053876	T	0.03095	0.0091	L	0.32530	0.975	0.09310	N	1	B;B;B	0.27498	0.18;0.18;0.18	B;B;B	0.26517	0.07;0.07;0.07	T	0.41858	-0.9485	10	0.38643	T	0.18	-0.7466	7.3598	0.26739	0.3879:0.0:0.6121:0.0	.	480;480;480	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	D	480;480;480;480;480;470	ENSP00000358001:E480D;ENSP00000424467:E480D;ENSP00000427618:E480D;ENSP00000334280:E480D;ENSP00000395048:E480D	ENSP00000334280:E480D	E	+	3	2	TACC2	123833445	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	0.243000	0.18106	0.172000	0.19760	0.561000	0.74099	GAG		0.587	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			18	84	1	0	8.81451e-21	0.000132079	1.42783e-19	18	84				
RHOG	391	broad.mit.edu	37	11	3849357	3849357	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:3849357G>C	ENST00000351018.4	-	2	169	c.12C>G	c.(10-12)atC>atG	p.I4M	RHOG_ENST00000533217.1_Missense_Mutation_p.I4M|RHOG_ENST00000396979.1_Missense_Mutation_p.I4M|RHOG_ENST00000396978.1_Missense_Mutation_p.I4M	NM_001665.3	NP_001656.2	P84095	RHOG_HUMAN	ras homolog family member G	4					actin cytoskeleton organization (GO:0030036)|activation of Rac GTPase activity (GO:0032863)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|GTP catabolic process (GO:0006184)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of transcription, DNA-templated (GO:0045893)|Rac protein signal transduction (GO:0016601)|regulation of ruffle assembly (GO:1900027)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)	2		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0349)|LUSC - Lung squamous cell carcinoma(625;0.194)		CCACGCACTTGATGCTCTGCA	0.577																																							uc001lyu.2		NA																	0					0						c.(10-12)ATC>ATG		ras homolog gene family, member G precursor							42.0	37.0	39.0					11																	3849357		2201	4298	6499	SO:0001583	missense	391				actin cytoskeleton organization|activation of Rac GTPase activity|axon guidance|cell chemotaxis|platelet activation|positive regulation of cell proliferation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of transcription, DNA-dependent|Rac protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|protein binding	g.chr11:3849357G>C	X61587	CCDS7748.1	11p15.5-p15.4	2012-02-27	2012-02-27	2004-03-24	ENSG00000177105	ENSG00000177105			672	protein-coding gene	gene with protein product		179505	"""ras homolog gene family, member G (rho G)"""	ARHG		8325658	Standard	NM_001665		Approved	RhoG, MGC125835, MGC125836	uc001lyu.2	P84095	OTTHUMG00000012287	ENST00000351018.4:c.12C>G	11.37:g.3849357G>C	ENSP00000339467:p.Ile4Met						p.I4M	NM_001665	NP_001656	P84095	RHOG_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0349)|LUSC - Lung squamous cell carcinoma(625;0.194)	2	170	-		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)	4					P35238|Q8NI04	Missense_Mutation	SNP	ENST00000351018.4	37	c.12C>G	CCDS7748.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.685453	0.47991	.	.	ENSG00000177105	ENST00000351018;ENST00000396979;ENST00000396978;ENST00000533217	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52	5.82	4.9	0.64082	Small GTP-binding protein domain (1);	0.099855	0.64402	D	0.000003	T	0.74959	0.3785	L	0.46567	1.45	0.45979	D	0.99879	P	0.45428	0.858	P	0.59643	0.861	T	0.76244	-0.3030	10	0.87932	D	0	.	7.6137	0.28145	0.0816:0.0:0.7527:0.1656	.	4	P84095	RHOG_HUMAN	M	4	ENSP00000339467:I4M;ENSP00000380176:I4M;ENSP00000380175:I4M;ENSP00000436932:I4M	ENSP00000339467:I4M	I	-	3	3	RHOG	3805933	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.811000	0.27198	1.436000	0.47453	0.563000	0.77884	ATC		0.577	RHOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034125.2	NM_001665		4	19	0	0	0	0.00024832	0	4	19				
SYT9	143425	broad.mit.edu	37	11	7437318	7437318	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:7437318C>G	ENST00000318881.6	+	4	1327	c.1090C>G	c.(1090-1092)Cca>Gca	p.P364A		NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	364	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		GTGCTATCTTCCAACGGCTGG	0.443																																							uc001mfe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(1090-1092)CCA>GCA		synaptotagmin IX							180.0	162.0	168.0					11																	7437318		2201	4296	6497	SO:0001583	missense	143425					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr11:7437318C>G	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.1090C>G	11.37:g.7437318C>G	ENSP00000324419:p.Pro364Ala					SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_RNA	p.P364A	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN		Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)	4	1327	+			364			Cytoplasmic (Potential).|C2 2.			Missense_Mutation	SNP	ENST00000318881.6	37	c.1090C>G	CCDS7778.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506102	0.85282	.	.	ENSG00000170743	ENST00000318881	T	0.75154	-0.91	4.85	4.85	0.62838	C2 calcium/lipid-binding domain, CaLB (1);	0.116521	0.38837	N	0.001557	T	0.78227	0.4250	M	0.62266	1.93	0.80722	D	1	D	0.63880	0.993	P	0.50109	0.631	T	0.81618	-0.0851	10	0.87932	D	0	.	15.8291	0.78739	0.0:1.0:0.0:0.0	.	364	Q86SS6	SYT9_HUMAN	A	364	ENSP00000324419:P364A	ENSP00000324419:P364A	P	+	1	0	SYT9	7393894	1.000000	0.71417	0.874000	0.34290	0.994000	0.84299	7.257000	0.78362	2.675000	0.91044	0.655000	0.94253	CCA		0.443	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733		7	111	0	0	0	8.12818e-05	0	7	111				
GALNT18	374378	broad.mit.edu	37	11	11643072	11643072	+	Silent	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:11643072G>A	ENST00000227756.4	-	1	480	c.69C>T	c.(67-69)atC>atT	p.I23I	GALNT18_ENST00000526064.1_5'UTR	NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	23					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										GCAGGCAGATGATGTTAGTCA	0.577																																							uc001mjo.2		NA																	0					0						c.(67-69)ATC>ATT		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							94.0	78.0	84.0					11																	11643072		2201	4294	6495	SO:0001819	synonymous_variant	374378					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr11:11643072G>A	AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.69C>T	11.37:g.11643072G>A							p.I23I	NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN		all cancers(16;3.67e-05)|Epithelial(150;0.000184)	1	490	-			23			Helical; Signal-anchor for type II membrane protein; (Potential).		O95903|Q8NDY9	Silent	SNP	ENST00000227756.4	37	c.69C>T	CCDS7807.1																																																																																				0.577	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385848.1	NM_198516		5	24	0	0	0	0.000602214	0	5	24				
SYT13	57586	broad.mit.edu	37	11	45275886	45275886	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:45275886G>T	ENST00000020926.3	-	3	590	c.479C>A	c.(478-480)cCc>cAc	p.P160H	CTD-2560E9.5_ENST00000531663.1_RNA|CTD-2560E9.5_ENST00000534342.1_RNA	NM_001247987.1|NM_020826.2	NP_001234916.1|NP_065877.1	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	160					vesicle-mediated transport (GO:0016192)	integral component of plasma membrane (GO:0005887)|transport vesicle (GO:0030133)				breast(1)|large_intestine(3)|lung(16)|ovary(1)|skin(2)	23						GTGGAGTTTGGGGGCCTGGTT	0.522																																							uc001myq.2		NA																	0				ovary(1)	1						c.(478-480)CCC>CAC		synaptotagmin XIII							142.0	117.0	126.0					11																	45275886		2203	4299	6502	SO:0001583	missense	57586					transport vesicle		g.chr11:45275886G>T	AB037848	CCDS31470.1	11p12-p11	2013-01-21			ENSG00000019505	ENSG00000019505		"""Synaptotagmins"""	14962	protein-coding gene	gene with protein product		607716				11171101	Standard	NM_020826		Approved	KIAA1427	uc001myq.2	Q7L8C5	OTTHUMG00000166504	ENST00000020926.3:c.479C>A	11.37:g.45275886G>T	ENSP00000020926:p.Pro160His					SYT13_uc009yku.1_Missense_Mutation_p.P16H	p.P160H	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN			3	605	-			160			Cytoplasmic (Potential).		A8K4P4|D3DQP1|Q9BQS3|Q9H041|Q9P2C0	Missense_Mutation	SNP	ENST00000020926.3	37	c.479C>A	CCDS31470.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.5|24.5	4.536431|4.536431	0.85812|0.85812	.|.	.|.	ENSG00000019505|ENSG00000019505	ENST00000020926|ENST00000528101	T|T	0.08193|0.08008	3.12|3.14	5.57|5.57	5.57|5.57	0.84162|0.84162	C2 calcium/lipid-binding domain, CaLB (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.14614|0.14614	0.0353|0.0353	N|N	0.24115|0.24115	0.695|0.695	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.89917|.	1.0|.	D|.	0.70935|.	0.971|.	T|T	0.01363|0.01363	-1.1374|-1.1374	10|8	0.87932|0.66056	D|D	0|0.02	.|.	19.9215|19.9215	0.97087|0.97087	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	160|.	Q7L8C5|.	SYT13_HUMAN|.	H|T	160|120	ENSP00000020926:P160H|ENSP00000432975:P120T	ENSP00000020926:P160H|ENSP00000432975:P120T	P|P	-|-	2|1	0|0	SYT13|SYT13	45232462|45232462	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.380000|6.380000	0.73158|0.73158	2.785000|2.785000	0.95823|0.95823	0.655000|0.655000	0.94253|0.94253	CCC|CCA		0.522	SYT13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390110.1	NM_020826		7	38	1	0	1.06961e-07	0.000157383	1.54246e-06	7	38				
OR5A1	219982	broad.mit.edu	37	11	59210711	59210712	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:59210711_59210712CC>AA	ENST00000302030.2	+	1	95_96	c.70_71CC>AA	c.(70-72)CCa>AAa	p.P24K		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						CACAGACCATCCAGAACTCCAG	0.53																																							uc001nnx.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(70-72)CCA>AAA		olfactory receptor, family 5, subfamily A,																																				SO:0001583	missense	219982				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59210711_59210712CC>AA	AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	Exception_encountered	11.37:g.59210711_59210712delinsAA	ENSP00000303096:p.Pro24Lys						p.P24K	NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN			1	70_71	+			24			Extracellular (Potential).		B9EH58|Q6IFF2|Q96RB1	Missense_Mutation	DNP	ENST00000302030.2	37	c.70_71CC>AA	CCDS31561.1																																																																																				0.530	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394233.1	NM_001004728		15	66	0	0	0	6.4e-05	0	15	66				
OR4D6	219983	broad.mit.edu	37	11	59224585	59224585	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:59224585G>C	ENST00000300127.2	+	1	175	c.152G>C	c.(151-153)tGt>tCt	p.C51S		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						ACTATTACCTGTGAGTCCCGC	0.473																																							uc010rku.1		NA																	0				ovary(1)	1						c.(151-153)TGT>TCT		olfactory receptor, family 4, subfamily D,							167.0	143.0	151.0					11																	59224585		2201	4295	6496	SO:0001583	missense	219983				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59224585G>C	AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.152G>C	11.37:g.59224585G>C	ENSP00000300127:p.Cys51Ser						p.C51S	NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN			1	152	+			51			Cytoplasmic (Potential).		B2RNP7|Q6IFF5|Q96R74	Missense_Mutation	SNP	ENST00000300127.2	37	c.152G>C	CCDS31562.1	.	.	.	.	.	.	.	.	.	.	G	4.929	0.172667	0.09391	.	.	ENSG00000166884	ENST00000300127	T	0.02787	4.16	5.38	-0.58	0.11717	GPCR, rhodopsin-like superfamily (1);	0.744958	0.12336	N	0.477919	T	0.01092	0.0036	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47522	-0.9111	10	0.06494	T	0.89	-0.0025	9.4205	0.38548	0.0:0.2536:0.4304:0.316	.	51	Q8NGJ1	OR4D6_HUMAN	S	51	ENSP00000300127:C51S	ENSP00000300127:C51S	C	+	2	0	OR4D6	58981161	0.000000	0.05858	0.973000	0.42090	0.890000	0.51754	0.082000	0.14847	0.025000	0.15241	0.655000	0.94253	TGT		0.473	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708		18	71	0	0	0	0.000958276	0	18	71				
CD6	923	broad.mit.edu	37	11	60781476	60781476	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:60781476C>G	ENST00000313421.7	+	8	1563	c.1377C>G	c.(1375-1377)atC>atG	p.I459M	CD6_ENST00000344028.5_Intron|CD6_ENST00000352009.5_Intron|CD6_ENST00000452451.2_Missense_Mutation_p.I459M|CD6_ENST00000346437.4_Intron|CD6_ENST00000545105.1_3'UTR	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	459					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						CCATCACCATCCCCAAAGAAG	0.602																																					Pancreas(169;904 2017 4767 38890 42505)	Pancreas(169;904 2017 4767 38890 42505)	uc001nqq.2		NA																	0				pancreas(1)	1						c.(1375-1377)ATC>ATG		CD6 molecule precursor							86.0	68.0	74.0					11																	60781476		2203	4299	6502	SO:0001583	missense	923				cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity	g.chr11:60781476C>G		CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1377C>G	11.37:g.60781476C>G	ENSP00000323280:p.Ile459Met					CD6_uc001nqp.2_Missense_Mutation_p.I459M|CD6_uc001nqr.2_Intron|CD6_uc001nqs.2_RNA|CD6_uc001nqt.2_Missense_Mutation_p.I459M	p.I459M	NM_006725	NP_006716	P30203	CD6_HUMAN			8	1600	+			459			Cytoplasmic (Potential).		A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Missense_Mutation	SNP	ENST00000313421.7	37	c.1377C>G	CCDS7999.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234802	0.58886	.	.	ENSG00000013725	ENST00000313421;ENST00000452451	T;T	0.01787	4.64;4.92	5.32	-1.99	0.07457	.	0.975051	0.08364	N	0.957130	T	0.06371	0.0164	M	0.64997	1.995	0.80722	D	1	D;D;D	0.63880	0.993;0.966;0.981	P;P;P	0.60682	0.878;0.641;0.77	T	0.42666	-0.9438	10	0.66056	D	0.02	.	10.6486	0.45634	0.0:0.3086:0.0:0.6914	.	459;459;459	P30203-5;P30203;Q8N4Q7	.;CD6_HUMAN;.	M	459	ENSP00000323280:I459M;ENSP00000390676:I459M	ENSP00000323280:I459M	I	+	3	3	CD6	60538052	0.003000	0.15002	0.882000	0.34594	0.984000	0.73092	-0.594000	0.05733	-0.439000	0.07222	0.491000	0.48974	ATC		0.602	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396449.1	NM_006725		3	30	0	0	0	0.00024832	0	3	30				
DAK	26007	broad.mit.edu	37	11	61105499	61105499	+	Silent	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:61105499C>T	ENST00000394900.3	+	3	319	c.90C>T	c.(88-90)ctC>ctT	p.L30L	DAK_ENST00000530057.1_3'UTR	NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	30	DhaK. {ECO:0000255|PROSITE- ProRule:PRU00814}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						ACCTGCAGCTCCTGCAGGGCC	0.667																																							uc001nre.2		NA																	0					0						c.(88-90)CTC>CTT		dihydroxyacetone kinase 2							61.0	58.0	59.0					11																	61105499		2203	4299	6502	SO:0001819	synonymous_variant	26007				glycerol metabolic process	cytosol	ATP binding|FAD-AMP lyase (cyclizing) activity|glycerone kinase activity|metal ion binding	g.chr11:61105499C>T		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.90C>T	11.37:g.61105499C>T						DDB1_uc010rlf.1_Intron|DAK_uc009ynm.1_5'UTR	p.L30L	NM_015533	NP_056348	Q3LXA3	DHAK_HUMAN			3	347	+			30			DhaK.		Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Silent	SNP	ENST00000394900.3	37	c.90C>T	CCDS8003.1																																																																																				0.667	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394425.4	NM_015533		8	97	0	0	0	0.000274275	0	8	97				
TRIM49C	642612	broad.mit.edu	37	11	89768527	89768527	+	Missense_Mutation	SNP	G	G	C	rs200118845	byFrequency	TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:89768527G>C	ENST00000448984.1	+	3	477	c.148G>C	c.(148-150)Gtc>Ctc	p.V50L	TRIM49C_ENST00000432771.1_Missense_Mutation_p.V50L	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	50						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|lung(4)	8						CCCATTTCTTGTCCAGTGCTC	0.458																																							uc010rua.1		NA																	0					NA						c.(148-150)GTC>CTC		ring finger protein 18																																				SO:0001583	missense	0							g.chr11:89768527G>C	BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.148G>C	11.37:g.89768527G>C	ENSP00000388299:p.Val50Leu						p.V50L	NM_020358	NP_065091					2	271	+								A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	ENST00000448984.1	37	c.148G>C	CCDS53694.1	.	.	.	.	.	.	.	.	.	.	G	5.269	0.235023	0.09969	.	.	ENSG00000204449	ENST00000448984;ENST00000432771	T;T	0.06528	3.29;3.29	0.731	-0.327	0.12694	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.	.	.	.	T	0.02649	0.0080	N	0.03948	-0.315	0.09310	N	1	B	0.16603	0.018	B	0.22601	0.04	T	0.49485	-0.8935	8	.	.	.	.	6.8727	0.24129	0.2232:0.0:0.7768:0.0	.	50	P0CI26	T49L2_HUMAN	L	50	ENSP00000388299:V50L;ENSP00000396557:V50L	.	V	+	1	0	TRIM49L2	89408175	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.611000	0.00415	-0.639000	0.05502	-1.495000	0.00966	GTC		0.458	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395455.1	NM_001195234		12	56	0	0	0	0.000219431	0	12	56				
CEP57	9702	broad.mit.edu	37	11	95532445	95532445	+	Missense_Mutation	SNP	C	C	T	rs139110744		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:95532445C>T	ENST00000325542.5	+	2	333	c.95C>T	c.(94-96)tCt>tTt	p.S32F	CEP57_ENST00000538658.1_Missense_Mutation_p.S32F|CEP57_ENST00000325486.5_Missense_Mutation_p.S32F|CEP57_ENST00000537677.1_Missense_Mutation_p.S5F|CEP57_ENST00000541150.1_Missense_Mutation_p.S23F	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	32					fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GTTCGGCATTCTTCATCTCCA	0.408									Mosaic Variegated Aneuploidy Syndrome																														uc001pfp.1		NA																	0				ovary(1)	1						c.(94-96)TCT>TTT		translokin							156.0	138.0	144.0					11																	95532445		2201	4298	6499	SO:0001583	missense	9702	Mosaic_Variegated_Aneuploidy_Syndrome	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	fibroblast growth factor receptor signaling pathway|G2/M transition of mitotic cell cycle|protein import into nucleus, translocation|spermatid development	centrosome|cytosol|Golgi apparatus|microtubule|nucleus	fibroblast growth factor binding|protein homodimerization activity	g.chr11:95532445C>T	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.95C>T	11.37:g.95532445C>T	ENSP00000317902:p.Ser32Phe					CEP57_uc001pfo.1_Missense_Mutation_p.S32F|CEP57_uc010ruh.1_Missense_Mutation_p.S23F|CEP57_uc010rui.1_Missense_Mutation_p.S32F|CEP57_uc009ywn.1_5'UTR|CEP57_uc001pfq.1_Missense_Mutation_p.S32F|CEP57_uc001pfr.1_5'UTR	p.S32F	NM_014679	NP_055494	Q86XR8	CEP57_HUMAN			2	316	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	32					A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	ENST00000325542.5	37	c.95C>T	CCDS8304.1	.	.	.	.	.	.	.	.	.	.	C	16.40	3.111952	0.56398	.	.	ENSG00000166037	ENST00000537677;ENST00000325542;ENST00000325486;ENST00000544522;ENST00000541365;ENST00000538658;ENST00000541150	T;T;T;T;T;T	0.55052	1.26;1.27;1.28;0.71;0.54;1.2	4.93	4.01	0.46588	.	0.000000	0.64402	D	0.000006	T	0.69513	0.3119	L	0.61218	1.895	0.47037	D	0.999295	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.87578	0.998;0.994;0.996;0.998	T	0.73827	-0.3860	10	0.87932	D	0	10.51	15.3387	0.74280	0.0:0.8596:0.1403:0.0	.	23;32;32;32	F5H5F7;Q86XR8-2;Q86XR8;Q86XR8-3	.;.;CEP57_HUMAN;.	F	5;32;32;23;5;32;23	ENSP00000441392:S5F;ENSP00000317902:S32F;ENSP00000317487:S32F;ENSP00000445821:S5F;ENSP00000445706:S32F;ENSP00000443436:S23F	ENSP00000317487:S32F	S	+	2	0	CEP57	95172093	1.000000	0.71417	0.998000	0.56505	0.796000	0.44982	1.542000	0.36137	1.186000	0.42985	0.655000	0.94253	TCT		0.408	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395983.1	NM_014679		5	68	0	0	0	0.000602214	0	5	68				
BACE1	23621	broad.mit.edu	37	11	117186290	117186290	+	Silent	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:117186290G>C	ENST00000313005.6	-	1	682	c.222C>G	c.(220-222)ggC>ggG	p.G74G	AP000892.4_ENST00000504906.1_RNA|BACE1_ENST00000428381.2_Silent_p.G74G|BACE1_ENST00000514464.1_5'UTR|BACE1_ENST00000528053.1_Silent_p.G74G|BACE1_ENST00000513780.1_Silent_p.G74G|BACE1_ENST00000445823.2_Silent_p.G74G	NM_012104.4|NM_138971.3|NM_138972.3|NM_138973.3	NP_036236|NP_620427.1|NP_620428.1|NP_620429.1	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1	74					beta-amyloid metabolic process (GO:0050435)|membrane protein ectodomain proteolysis (GO:0006509)|proteolysis (GO:0006508)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	aspartic-type endopeptidase activity (GO:0004190)|beta-amyloid binding (GO:0001540)|beta-aspartyl-peptidase activity (GO:0008798)|enzyme binding (GO:0019899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		CCACGTAGTAGCCCTGCCCCG	0.682																																							uc001pqz.2		NA																	0				ovary(1)	1						c.(220-222)GGC>GGG		beta-site APP-cleaving enzyme 1 isoform A							47.0	45.0	45.0					11																	117186290		2201	4296	6497	SO:0001819	synonymous_variant	23621				beta-amyloid metabolic process|membrane protein ectodomain proteolysis	cell surface|cytoplasmic vesicle membrane|endoplasmic reticulum|endosome|integral to plasma membrane|trans-Golgi network	aspartic-type endopeptidase activity|beta-aspartyl-peptidase activity|protein binding	g.chr11:117186290G>C	AF190725	CCDS8383.1, CCDS44739.1, CCDS44740.1, CCDS44741.1, CCDS55787.1, CCDS55786.1	11q23-q24	2011-07-27	2004-04-02	2004-04-02	ENSG00000186318	ENSG00000186318			933	protein-coding gene	gene with protein product		604252	"""beta-site APP-cleaving enzyme"""	BACE		10531052	Standard	NM_012104		Approved		uc001pqz.3	P56817	OTTHUMG00000160636	ENST00000313005.6:c.222C>G	11.37:g.117186290G>C						BACE1_uc001pqw.2_Silent_p.G74G|BACE1_uc001pqx.2_Silent_p.G74G|BACE1_uc001pqy.2_Silent_p.G74G|BACE1_uc001pra.1_Silent_p.G74G	p.G74G	NM_012104	NP_036236	P56817	BACE1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)	1	683	-	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)	74			Extracellular (Potential).		A0M8W7|B0YIU9|E9PE65|H7BXJ9|Q9BYB9|Q9BYC0|Q9BYC1|Q9UJT5|Q9ULS1	Silent	SNP	ENST00000313005.6	37	c.222C>G	CCDS8383.1																																																																																				0.682	BACE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361505.1			4	29	0	0	0	3.59834e-05	0	4	29				
SORL1	6653	broad.mit.edu	37	11	121461839	121461839	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr11:121461839C>G	ENST00000260197.7	+	31	4472	c.4343C>G	c.(4342-4344)tCt>tGt	p.S1448C	SORL1_ENST00000532694.1_Missense_Mutation_p.S294C|SORL1_ENST00000525532.1_Missense_Mutation_p.S392C|SORL1_ENST00000527934.1_Missense_Mutation_p.S63C|SORL1_ENST00000534286.1_Missense_Mutation_p.S358C	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1448	LDL-receptor class A 9. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GCAGATGGCTCTGACGAGGAA	0.617											OREG0021431	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001pxx.2		NA																	0				ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15						c.(4342-4344)TCT>TGT		sortilin-related receptor containing LDLR class							183.0	155.0	165.0					11																	121461839		2203	4299	6502	SO:0001583	missense	6653				cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity	g.chr11:121461839C>G	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.4343C>G	11.37:g.121461839C>G	ENSP00000260197:p.Ser1448Cys		OREG0021431	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1511	SORL1_uc010rzp.1_Missense_Mutation_p.S294C|SORL1_uc010rzq.1_Missense_Mutation_p.S63C	p.S1448C	NM_003105	NP_003096	Q92673	SORL_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)	31	4423	+		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)	1448			Extracellular (Potential).|LDL-receptor class A 9.		B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	c.4343C>G	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243073	0.79912	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	D;D;D;D;D	0.97870	-4.58;-4.58;-4.58;-4.58;-4.58	5.55	5.55	0.83447	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.134868	0.48286	D	0.000187	D	0.99351	0.9772	H	0.98769	4.325	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98465	1.0598	10	0.72032	D	0.01	.	17.6889	0.88263	0.0:1.0:0.0:0.0	.	63;1448	E9PKB0;Q92673	.;SORL_HUMAN	C	1448;392;294;358;63	ENSP00000260197:S1448C;ENSP00000434634:S392C;ENSP00000432131:S294C;ENSP00000436447:S358C;ENSP00000435405:S63C	ENSP00000260197:S1448C	S	+	2	0	SORL1	120967049	1.000000	0.71417	0.956000	0.39512	0.896000	0.52359	4.375000	0.59549	2.612000	0.88384	0.655000	0.94253	TCT		0.617	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105		6	85	0	0	0	8.12818e-05	0	6	85				
FOXM1	2305	broad.mit.edu	37	12	2977809	2977809	+	Missense_Mutation	SNP	G	G	C	rs137928577		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr12:2977809G>C	ENST00000359843.3	-	4	834	c.766C>G	c.(766-768)Cgc>Ggc	p.R256G	FOXM1_ENST00000342628.2_Missense_Mutation_p.R256G|FOXM1_ENST00000361953.3_Missense_Mutation_p.R256G|FOXM1_ENST00000537018.1_5'UTR	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	256					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			AAAGTCATGCGCTTCCTCTCA	0.502																																							uc001qlf.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(766-768)CGC>GGC		forkhead box M1 isoform 2							258.0	204.0	223.0					12																	2977809		2203	4300	6503	SO:0001583	missense	2305				cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding	g.chr12:2977809G>C	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.766C>G	12.37:g.2977809G>C	ENSP00000352901:p.Arg256Gly					FOXM1_uc001qle.2_Missense_Mutation_p.R256G|FOXM1_uc001qlg.2_Missense_Mutation_p.R256G|FOXM1_uc009zea.2_Missense_Mutation_p.R255G|FOXM1_uc009zeb.2_Missense_Mutation_p.R255G	p.R256G	NM_021953	NP_068772	Q08050	FOXM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000622)		4	1031	-			256			Fork-head.		O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	ENST00000359843.3	37	c.766C>G	CCDS8515.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289408	0.80914	.	.	ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843	D;D;D	0.95447	-3.71;-3.71;-3.71	5.66	5.66	0.87406	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.097447	0.64402	D	0.000002	D	0.96938	0.9000	L	0.49513	1.565	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.998	D;D;D;D;D	0.79784	0.993;0.992;0.989;0.992;0.977	D	0.97355	0.9966	10	0.72032	D	0.01	.	18.7398	0.91769	0.0:0.0:1.0:0.0	.	255;256;256;256;256	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3	.;.;.;FOXM1_HUMAN;.	G	256	ENSP00000342307:R256G;ENSP00000354492:R256G;ENSP00000352901:R256G	ENSP00000342307:R256G	R	-	1	0	FOXM1	2848070	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.924000	0.56476	2.656000	0.90262	0.655000	0.94253	CGC		0.502	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398272.1	NM_021953		20	115	0	0	0	0.000175454	0	20	115				
USP5	8078	broad.mit.edu	37	12	6973060	6973060	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr12:6973060G>A	ENST00000229268.8	+	16	2073	c.2021G>A	c.(2020-2022)cGc>cAc	p.R674H	USP5_ENST00000541969.1_3'UTR|USP5_ENST00000389231.5_Missense_Mutation_p.R651H	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	674	UBA 1. {ECO:0000255|PROSITE- ProRule:PRU00212}.|USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						GACGCCTGCCGCAAAGCTGTC	0.587																																							uc001qri.3		NA																	0				lung(2)|breast(1)|skin(1)	4						c.(2020-2022)CGC>CAC		ubiquitin specific peptidase 5 isoform 1							56.0	59.0	58.0					12																	6973060		2203	4300	6503	SO:0001583	missense	8078				positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding	g.chr12:6973060G>A	U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.2021G>A	12.37:g.6973060G>A	ENSP00000229268:p.Arg674His					USP5_uc001qrh.3_Missense_Mutation_p.R651H	p.R674H	NM_001098536	NP_001092006	P45974	UBP5_HUMAN			16	2080	+			674			UBA 1.		D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	ENST00000229268.8	37	c.2021G>A	CCDS41743.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782987	0.90282	.	.	ENSG00000111667	ENST00000229268;ENST00000389231	T;T	0.26067	1.76;1.76	4.92	4.92	0.64577	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.048065	0.85682	D	0.000000	T	0.58004	0.2092	M	0.87547	2.89	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.947	T	0.65409	-0.6175	10	0.62326	D	0.03	-5.5571	18.3207	0.90237	0.0:0.0:1.0:0.0	.	674;651	P45974;P45974-2	UBP5_HUMAN;.	H	674;651	ENSP00000229268:R674H;ENSP00000373883:R651H	ENSP00000229268:R674H	R	+	2	0	USP5	6843321	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.350000	0.79385	2.552000	0.86080	0.555000	0.69702	CGC		0.587	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402982.1			12	28	0	0	0	0.000219431	0	12	28				
SCAF11	9169	broad.mit.edu	37	12	46320526	46320526	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr12:46320526C>G	ENST00000369367.3	-	11	3191	c.2958G>C	c.(2956-2958)aaG>aaC	p.K986N	SCAF11_ENST00000419565.2_Missense_Mutation_p.K986N|SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000465950.1_Missense_Mutation_p.K671N|SCAF11_ENST00000549162.1_Missense_Mutation_p.K794N	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	986					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						CTGGGTCATTCTTTCTGTACC	0.398																																							uc001rox.2		NA																	0					0						c.(2956-2958)AAG>AAC		splicing factor, arginine/serine-rich 2,							197.0	191.0	193.0					12																	46320526		2203	4300	6503	SO:0001583	missense	9169				spliceosome assembly	nucleus	protein binding|zinc ion binding	g.chr12:46320526C>G	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2958G>C	12.37:g.46320526C>G	ENSP00000358374:p.Lys986Asn					SFRS2IP_uc001row.2_Missense_Mutation_p.K671N|SFRS2IP_uc001roy.1_Missense_Mutation_p.K1060N	p.K986N	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)	11	3245	-	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	986					A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	ENST00000369367.3	37	c.2958G>C	CCDS8748.2	.	.	.	.	.	.	.	.	.	.	C	16.41	3.116134	0.56505	.	.	ENSG00000139218	ENST00000465950;ENST00000369367;ENST00000549162;ENST00000419565;ENST00000547018	T;T;T;T;T	0.54479	1.37;2.11;1.37;2.11;0.57	6.17	5.29	0.74685	.	0.142348	0.49916	D	0.000132	T	0.49287	0.1548	N	0.21142	0.635	0.23298	N	0.997954	D;P	0.56746	0.977;0.651	P;B	0.55923	0.787;0.273	T	0.43798	-0.9369	10	0.59425	D	0.04	-13.2804	7.5478	0.27777	0.0:0.7337:0.0:0.2663	.	794;986	F8VXG7;Q99590	.;SCAFB_HUMAN	N	671;986;794;986;926	ENSP00000449812:K671N;ENSP00000358374:K986N;ENSP00000448864:K794N;ENSP00000413036:K986N;ENSP00000446746:K926N	ENSP00000358374:K986N	K	-	3	2	SCAF11	44606793	0.994000	0.37717	0.999000	0.59377	0.997000	0.91878	1.310000	0.33551	1.626000	0.50381	0.655000	0.94253	AAG		0.398	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719		15	144	0	0	0	0.000308642	0	15	144				
SCYL2	55681	broad.mit.edu	37	12	100691891	100691891	+	Missense_Mutation	SNP	A	A	G	rs568840397		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr12:100691891A>G	ENST00000360820.2	+	4	855	c.418A>G	c.(418-420)Ata>Gta	p.I140V		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	140	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			PISPDIK -> LMSGDIG (in Ref. 4; BAA92598). {ECO:0000305}.	endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						ACCTTCCCCTATATCTCCAGA	0.323													A|||	1	0.000199681	0.0	0.0	5008	,	,		15645	0.0		0.0	False		,,,				2504	0.001						uc001thn.2		NA																	0				lung(3)|ovary(2)|skin(1)	6						c.(418-420)ATA>GTA		SCY1-like 2 protein							65.0	64.0	65.0					12																	100691891		2202	4298	6500	SO:0001583	missense	55681				endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding	g.chr12:100691891A>G	AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.418A>G	12.37:g.100691891A>G	ENSP00000354061:p.Ile140Val					SCYL2_uc009ztw.1_5'UTR|SCYL2_uc001thm.1_Missense_Mutation_p.I140V	p.I140V	NM_017988	NP_060458	Q6P3W7	SCYL2_HUMAN			4	468	+			140	PISPDIK -> LMSGDIG (in Ref. 4; BAA92598).		Protein kinase.		A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	ENST00000360820.2	37	c.418A>G	CCDS9076.1	.	.	.	.	.	.	.	.	.	.	A	0.605	-0.827481	0.02734	.	.	ENSG00000136021	ENST00000549687;ENST00000360820	T;T	0.24538	2.12;1.85	5.64	-1.77	0.07982	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.647058	0.16065	N	0.231283	T	0.07279	0.0184	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36792	-0.9733	10	0.14252	T	0.57	.	5.7285	0.18026	0.1784:0.0973:0.576:0.1484	.	140	Q6P3W7	SCYL2_HUMAN	V	140	ENSP00000448366:I140V;ENSP00000354061:I140V	ENSP00000354061:I140V	I	+	1	0	SCYL2	99216022	0.004000	0.15560	0.459000	0.27081	0.988000	0.76386	-0.075000	0.11431	-0.322000	0.08615	-0.379000	0.06801	ATA		0.323	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2	NM_017988		10	29	0	0	0	0.000151284	0	10	29				
CUX2	23316	broad.mit.edu	37	12	111779685	111779685	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr12:111779685C>A	ENST00000261726.6	+	21	3641	c.3487C>A	c.(3487-3489)Ctg>Atg	p.L1163M	RNA5SP373_ENST00000517271.1_RNA	NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1163					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						GCCCCAGGACCTGAGCCTCCT	0.657																																							uc001tsa.1		NA																	0				ovary(3)|skin(2)|breast(1)	6						c.(3487-3489)CTG>ATG		cut-like 2							43.0	52.0	49.0					12																	111779685		2006	4184	6190	SO:0001583	missense	23316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:111779685C>A	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.3487C>A	12.37:g.111779685C>A	ENSP00000261726:p.Leu1163Met						p.L1163M	NM_015267	NP_056082	O14529	CUX2_HUMAN			21	3640	+			1163					A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	37	c.3487C>A	CCDS41837.1	.	.	.	.	.	.	.	.	.	.	C	18.40	3.614927	0.66672	.	.	ENSG00000111249	ENST00000261726	T	0.46819	0.86	5.1	2.15	0.27550	Homeodomain-related (1);	0.304453	0.31697	N	0.007218	T	0.43322	0.1242	L	0.43152	1.355	0.28679	N	0.905197	D	0.62365	0.991	P	0.51999	0.687	T	0.29088	-1.0023	10	0.32370	T	0.25	-7.0281	5.6213	0.17459	0.0:0.6062:0.1538:0.24	.	1163	O14529	CUX2_HUMAN	M	1163	ENSP00000261726:L1163M	ENSP00000261726:L1163M	L	+	1	2	CUX2	110264068	0.941000	0.31946	1.000000	0.80357	0.930000	0.56654	0.610000	0.24253	0.506000	0.28125	0.462000	0.41574	CTG		0.657	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267		8	36	1	0	0.000274275	0.000274275	0.003414	8	36				
RFC3	5983	broad.mit.edu	37	13	34399957	34399957	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr13:34399957C>G	ENST00000380071.3	+	4	455	c.325C>G	c.(325-327)Cag>Gag	p.Q109E	RFC3_ENST00000434425.1_Missense_Mutation_p.Q109E	NM_002915.3	NP_002906.1	P40938	RFC3_HUMAN	replication factor C (activator 1) 3, 38kDa	109					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to organophosphorus (GO:0046683)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	DNA clamp loader activity (GO:0003689)			lung(2)|skin(1)	3		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		AGTAGTCATTCAGGAGATGTT	0.333																																							uc001uuz.2		NA																	0					0						c.(325-327)CAG>GAG		replication factor C 3 isoform 1							140.0	132.0	135.0					13																	34399957		2203	4300	6503	SO:0001583	missense	5983				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|response to organophosphorus|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding	g.chr13:34399957C>G		CCDS9352.1, CCDS45025.1	13q13.2	2010-04-21	2002-08-29		ENSG00000133119	ENSG00000133119		"""ATPases / AAA-type"""	9971	protein-coding gene	gene with protein product	"""RFC, 38 kD subunit"", ""A1 38 kDa subunit"""	600405	"""replication factor C (activator 1) 3 (38kD)"""			7774928	Standard	NM_002915		Approved	RFC38, MGC5276	uc001uuz.3	P40938	OTTHUMG00000016715	ENST00000380071.3:c.325C>G	13.37:g.34399957C>G	ENSP00000369411:p.Gln109Glu					RFC3_uc001uva.2_Missense_Mutation_p.Q109E|RFC3_uc010ted.1_Missense_Mutation_p.Q109E	p.Q109E	NM_002915	NP_002906	P40938	RFC3_HUMAN		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)	4	435	+		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)	109					C9JU95|O15252|Q5W0E8	Missense_Mutation	SNP	ENST00000380071.3	37	c.325C>G	CCDS9352.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620692	0.87460	.	.	ENSG00000133119	ENST00000380071;ENST00000434425	T;T	0.37915	1.17;1.17	5.15	5.15	0.70609	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.050792	0.85682	D	0.000000	T	0.67590	0.2909	H	0.94264	3.515	0.80722	D	1	P;P;P	0.50156	0.863;0.932;0.932	P;P;P	0.57009	0.627;0.811;0.811	T	0.78061	-0.2351	10	0.87932	D	0	-18.6405	17.9646	0.89096	0.0:1.0:0.0:0.0	.	109;109;109	B4DKE6;C9JU95;P40938	.;.;RFC3_HUMAN	E	109	ENSP00000369411:Q109E;ENSP00000401001:Q109E	ENSP00000369411:Q109E	Q	+	1	0	RFC3	33297957	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.542000	0.82095	2.566000	0.86566	0.563000	0.77884	CAG		0.333	RFC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044450.2	NM_002915		4	26	0	0	0	0.00024832	0	4	26				
CCNA1	8900	broad.mit.edu	37	13	37015312	37015312	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr13:37015312C>G	ENST00000255465.4	+	7	1420	c.1156C>G	c.(1156-1158)Ctg>Gtg	p.L386V	CCNA1_ENST00000440264.1_Missense_Mutation_p.L342V|CCNA1_ENST00000418263.1_Missense_Mutation_p.L385V|CCNA1_ENST00000449823.1_Missense_Mutation_p.L342V			P78396	CCNA1_HUMAN	cyclin A1	386					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		TCTTCCTTCACTGATAGCTGC	0.383																																							uc001uvr.3		NA																	0				lung(2)|skin(2)|ovary(1)	5						c.(1156-1158)CTG>GTG		cyclin A1 isoform a							157.0	136.0	143.0					13																	37015312		2203	4300	6503	SO:0001583	missense	8900				cell division|G2/M transition of mitotic cell cycle|male meiosis I|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|spermatogenesis	cytosol|microtubule cytoskeleton|nucleoplasm	protein kinase binding	g.chr13:37015312C>G	U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.1156C>G	13.37:g.37015312C>G	ENSP00000255465:p.Leu386Val					CCNA1_uc010teo.1_Missense_Mutation_p.L342V|CCNA1_uc010abq.2_Missense_Mutation_p.L342V|CCNA1_uc010abp.2_Missense_Mutation_p.L342V|CCNA1_uc001uvs.3_Missense_Mutation_p.L385V|CCNA1_uc010abr.2_RNA	p.L386V	NM_003914	NP_003905	P78396	CCNA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)	7	1506	+		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	386					B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Missense_Mutation	SNP	ENST00000255465.4	37	c.1156C>G	CCDS9357.1	.	.	.	.	.	.	.	.	.	.	C	2.432	-0.330534	0.05314	.	.	ENSG00000133101	ENST00000440264;ENST00000449823;ENST00000418263;ENST00000255465	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	5.39	-9.52	0.00578	Cyclin, C-terminal (1);Cyclin-like (3);	0.338879	0.28284	N	0.015903	T	0.06462	0.0166	N	0.13003	0.285	0.18873	N	0.999984	B;B	0.17268	0.017;0.021	B;B	0.18263	0.012;0.021	T	0.26292	-1.0107	10	0.09590	T	0.72	.	6.8241	0.23872	0.0744:0.6806:0.1491:0.0959	.	385;386	P78396-2;P78396	.;CCNA1_HUMAN	V	342;342;385;386	ENSP00000400666:L342V;ENSP00000409873:L342V;ENSP00000396479:L385V;ENSP00000255465:L386V	ENSP00000255465:L386V	L	+	1	2	CCNA1	35913312	0.000000	0.05858	0.245000	0.24217	0.158000	0.22134	-0.464000	0.06688	-2.216000	0.00732	-1.307000	0.01316	CTG		0.383	CCNA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044514.2	NM_003914		3	50	0	0	0	0.000602214	0	3	50				
OR11G2	390439	broad.mit.edu	37	14	20666236	20666236	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr14:20666236C>T	ENST00000357366.3	+	1	742	c.742C>T	c.(742-744)Ctc>Ttc	p.L248F		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	248						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TGTCTTTATGCTCTTTCTCTT	0.498																																							uc010tlb.1		NA																	0				ovary(1)|skin(1)	2						c.(742-744)CTC>TTC		olfactory receptor, family 11, subfamily G,							195.0	193.0	193.0					14																	20666236		2203	4300	6503	SO:0001583	missense	390439				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20666236C>T		CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.742C>T	14.37:g.20666236C>T	ENSP00000349930:p.Leu248Phe						p.L248F	NM_001005503	NP_001005503	Q8NGC1	O11G2_HUMAN	Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)	1	742	+	all_cancers(95;0.00108)		248			Helical; Name=5; (Potential).		Q6IF09|Q96R33	Missense_Mutation	SNP	ENST00000357366.3	37	c.742C>T	CCDS32032.1	.	.	.	.	.	.	.	.	.	.	c	3.011	-0.203819	0.06180	.	.	ENSG00000196832	ENST00000357366	T	0.37584	1.19	4.93	4.93	0.64822	GPCR, rhodopsin-like superfamily (1);	0.662303	0.13118	N	0.412391	T	0.24236	0.0587	N	0.24115	0.695	0.09310	N	1	B	0.17038	0.02	B	0.15870	0.014	T	0.06789	-1.0807	10	0.87932	D	0	.	6.2816	0.21011	0.1845:0.7239:0.0:0.0916	.	248	Q8NGC1	O11G2_HUMAN	F	248	ENSP00000349930:L248F	ENSP00000349930:L248F	L	+	1	0	OR11G2	19736076	0.000000	0.05858	0.203000	0.23512	0.002000	0.02628	-0.105000	0.10907	2.565000	0.86533	0.650000	0.86243	CTC		0.498	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395722.1			29	191	0	0	0	0.000339439	0	29	191				
TTC5	91875	broad.mit.edu	37	14	20763529	20763529	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr14:20763529C>A	ENST00000258821.3	-	8	1056	c.1000G>T	c.(1000-1002)Ggt>Tgt	p.G334C		NM_138376.2	NP_612385.2	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	334					DNA repair (GO:0006281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		ATGACGGCACCGCTGTTCACC	0.532																																							uc001vwt.2		NA																	0				ovary(1)	1						c.(1000-1002)GGT>TGT		tetratricopeptide repeat domain 5							85.0	74.0	78.0					14																	20763529		2203	4300	6503	SO:0001583	missense	91875				DNA repair	cytoplasm|nucleus	binding	g.chr14:20763529C>A	BC008647	CCDS9546.1	14q11.2	2013-01-11			ENSG00000136319	ENSG00000136319		"""Tetratricopeptide (TTC) repeat domain containing"""	19274	protein-coding gene	gene with protein product						11511361	Standard	NM_138376		Approved	Strap	uc001vwt.3	Q8N0Z6	OTTHUMG00000029506	ENST00000258821.3:c.1000G>T	14.37:g.20763529C>A	ENSP00000258821:p.Gly334Cys					TTC5_uc001vwu.2_Missense_Mutation_p.G191C	p.G334C	NM_138376	NP_612385	Q8N0Z6	TTC5_HUMAN	Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)	8	1057	-	all_cancers(95;0.00092)		334					A8MQ18|Q96HF9	Missense_Mutation	SNP	ENST00000258821.3	37	c.1000G>T	CCDS9546.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.0|25.0	4.593956|4.593956	0.86953|0.86953	.|.	.|.	ENSG00000136319|ENSG00000136319	ENST00000258821|ENST00000423949	T|.	0.35605|.	1.3|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73560|0.73560	0.3602|0.3602	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.81914|.	0.995|.	T|T	0.70615|0.70615	-0.4823|-0.4823	10|5	0.62326|.	D|.	0.03|.	.|.	18.5541|18.5541	0.91077|0.91077	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	334|.	Q8N0Z6|.	TTC5_HUMAN|.	C|L	334|278	ENSP00000258821:G334C|.	ENSP00000258821:G334C|.	G|R	-|-	1|2	0|0	TTC5|TTC5	19833369|19833369	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.957000|0.957000	0.61999|0.61999	6.592000|6.592000	0.74095|0.74095	2.755000|2.755000	0.94549|0.94549	0.650000|0.650000	0.86243|0.86243	GGT|CGG		0.532	TTC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073529.4	NM_138376		9	38	1	0	0.000442599	0.000442599	0.00539561	9	38				
ARHGEF40	55701	broad.mit.edu	37	14	21542190	21542190	+	Missense_Mutation	SNP	C	C	T	rs148208165		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr14:21542190C>T	ENST00000298694.4	+	3	428	c.301C>T	c.(301-303)Cgc>Tgc	p.R101C	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.R101C			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	101						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						GCAACTGCTGCGCCCAGGAGA	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18977	0.0		0.0	False		,,,				2504	0.0						uc001vzp.2		NA																	0					0						c.(301-303)CGC>TGC		hypothetical protein LOC55701		C	CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	69.0	73.0	72.0		301	3.9	1.0	14	dbSNP_134	72	0,8600		0,0,4300	no	missense	ARHGEF40	NM_018071.3	180	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	101/1520	21542190	2,13004	2203	4300	6503	SO:0001583	missense	55701				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity	g.chr14:21542190C>T		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.301C>T	14.37:g.21542190C>T	ENSP00000298694:p.Arg101Cys					FLJ10357_uc001vzn.1_Missense_Mutation_p.R101C|FLJ10357_uc001vzo.1_Intron|FLJ10357_uc010aij.2_RNA|FLJ10357_uc010tln.1_5'UTR	p.R101C	NM_018071	NP_060541	Q8TER5	ARH40_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)	3	330	+	all_cancers(95;0.00185)		101					A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	37	c.301C>T	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.773330	0.31411	4.54E-4	0.0	ENSG00000165801	ENST00000298694;ENST00000555038;ENST00000298693	T;T	0.03635	3.92;3.86	4.81	3.92	0.45320	.	0.134374	0.34652	N	0.003800	T	0.04588	0.0125	L	0.56199	1.76	0.45528	D	0.998485	B;B	0.22541	0.071;0.038	B;B	0.17098	0.011;0.017	T	0.28106	-1.0054	10	0.87932	D	0	.	6.0	0.19515	0.1869:0.7176:0.0:0.0955	.	101;101	Q8TER5;G3V3N2	ARH40_HUMAN;.	C	101	ENSP00000298694:R101C;ENSP00000298693:R101C	ENSP00000298693:R101C	R	+	1	0	ARHGEF40	20612030	0.000000	0.05858	1.000000	0.80357	0.991000	0.79684	0.076000	0.14712	1.256000	0.44068	0.561000	0.74099	CGC		0.632	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1			10	99	0	0	0	0.000673444	0	10	99				
DLGAP5	9787	broad.mit.edu	37	14	55621352	55621352	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr14:55621352C>G	ENST00000247191.2	-	15	2262	c.2046G>C	c.(2044-2046)ttG>ttC	p.L682F	DLGAP5_ENST00000395425.2_Missense_Mutation_p.L682F	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	682					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						CAGGAATACTCAAAAACAAAG	0.358																																							uc001xbs.2		NA																	0				ovary(1)|skin(1)	2						c.(2044-2046)TTG>TTC		discs large homolog 7 isoform a							145.0	127.0	133.0					14																	55621352		2203	4300	6503	SO:0001583	missense	9787				cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding	g.chr14:55621352C>G	D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.2046G>C	14.37:g.55621352C>G	ENSP00000247191:p.Leu682Phe					DLGAP5_uc001xbt.2_Missense_Mutation_p.L682F	p.L682F	NM_014750	NP_055565	Q15398	DLGP5_HUMAN			15	2263	-			682					A8MTM6|B4DRM8|Q86T11|Q8NG58	Missense_Mutation	SNP	ENST00000247191.2	37	c.2046G>C	CCDS9723.1	.	.	.	.	.	.	.	.	.	.	C	2.078	-0.411390	0.04799	.	.	ENSG00000126787	ENST00000395425;ENST00000247191	T;T	0.33865	1.39;1.39	3.73	2.6	0.31112	.	5.650190	0.00357	N	0.000021	T	0.20861	0.0502	N	0.14661	0.345	0.09310	N	1	P;B	0.41450	0.75;0.347	B;B	0.31016	0.123;0.087	T	0.23440	-1.0188	10	0.59425	D	0.04	-3.4145	5.3098	0.15823	0.0:0.1332:0.0:0.8668	.	682;682	A8MTM6;Q15398	.;DLGP5_HUMAN	F	682	ENSP00000378815:L682F;ENSP00000247191:L682F	ENSP00000247191:L682F	L	-	3	2	DLGAP5	54691105	0.002000	0.14202	0.079000	0.20413	0.013000	0.08279	-0.011000	0.12721	0.805000	0.34159	-0.302000	0.09304	TTG		0.358	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2	NM_014750		3	93	0	0	0	0.00024832	0	3	93				
KIAA0586	9786	broad.mit.edu	37	14	58932631	58932631	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr14:58932631A>C	ENST00000556134.1	+	16	2367	c.2093A>C	c.(2092-2094)cAt>cCt	p.H698P	KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000423743.3_Missense_Mutation_p.H669P|KIAA0586_ENST00000261244.5_Missense_Mutation_p.H637P|KIAA0586_ENST00000354386.6_Missense_Mutation_p.H766P	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	698					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AAAATGAAACATTCTGTTCCT	0.383																																							uc001xdv.3		NA																	0				ovary(1)	1						c.(1909-1911)CAT>CCT		talpid3 protein							146.0	139.0	142.0					14																	58932631		1887	4111	5998	SO:0001583	missense	9786							g.chr14:58932631A>C	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.2093A>C	14.37:g.58932631A>C	ENSP00000452351:p.His698Pro					KIAA0586_uc010trr.1_Missense_Mutation_p.H754P|KIAA0586_uc001xdt.3_Missense_Mutation_p.H669P|KIAA0586_uc001xdu.3_Missense_Mutation_p.H698P|KIAA0586_uc010trs.1_Missense_Mutation_p.H628P|KIAA0586_uc010trt.1_Missense_Mutation_p.H573P|KIAA0586_uc010tru.1_Missense_Mutation_p.H573P	p.H637P	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN			14	2183	+			637					B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	c.1910A>C	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	A	15.82	2.945698	0.53079	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.37	-1.11	0.09840	.	0.592625	0.17054	N	0.188816	T	0.40694	0.1127	L	0.27053	0.805	0.09310	N	1	D;D;D;D;D;D	0.63880	0.988;0.988;0.986;0.974;0.988;0.993	P;P;P;P;P;P	0.57152	0.804;0.804;0.814;0.564;0.804;0.804	T	0.40869	-0.9540	10	0.72032	D	0.01	.	10.991	0.47549	0.5763:0.0:0.4237:0.0	.	573;573;766;637;698;669	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	P	766;698;669;637;573	ENSP00000346359:H766P;ENSP00000452351:H698P;ENSP00000399427:H669P;ENSP00000261244:H637P	ENSP00000261244:H637P	H	+	2	0	KIAA0586	58002384	0.000000	0.05858	0.001000	0.08648	0.114000	0.19823	-0.055000	0.11807	-0.157000	0.11059	0.533000	0.62120	CAT		0.383	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749		25	105	0	0	0	0.000586117	0	25	105				
SIPA1L1	26037	broad.mit.edu	37	14	72055435	72055435	+	Silent	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr14:72055435C>G	ENST00000555818.1	+	2	1194	c.846C>G	c.(844-846)ctC>ctG	p.L282L	SIPA1L1_ENST00000381232.3_Silent_p.L282L|SIPA1L1_ENST00000358550.2_Silent_p.L282L	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	282					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		AAAAACCACTCAAGCGACGTT	0.433																																							uc001xms.2		NA																	0				ovary(3)|breast(1)	4						c.(844-846)CTC>CTG		signal-induced proliferation-associated 1 like							69.0	72.0	71.0					14																	72055435		2203	4300	6503	SO:0001819	synonymous_variant	26037				actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity	g.chr14:72055435C>G	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.846C>G	14.37:g.72055435C>G						SIPA1L1_uc001xmt.2_Silent_p.L282L|SIPA1L1_uc001xmu.2_Silent_p.L282L|SIPA1L1_uc001xmv.2_Silent_p.L282L	p.L282L	NM_015556	NP_056371	O43166	SI1L1_HUMAN		all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)	2	1194	+			282					J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	ENST00000555818.1	37	c.846C>G	CCDS9807.1																																																																																				0.433	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556		5	47	0	0	0	0.000602214	0	5	47				
SEL1L	6400	broad.mit.edu	37	14	81964260	81964260	+	Silent	SNP	A	A	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr14:81964260A>G	ENST00000336735.4	-	10	1220	c.1104T>C	c.(1102-1104)gcT>gcC	p.A368A		NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	368	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		CACCTTTTTCAGCTAGGAACT	0.408																																							uc010tvv.1		NA																	0				ovary(1)	1						c.(1102-1104)GCT>GCC		sel-1 suppressor of lin-12-like precursor							107.0	93.0	98.0					14																	81964260		2203	4300	6503	SO:0001819	synonymous_variant	6400				Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr14:81964260A>G		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.1104T>C	14.37:g.81964260A>G							p.A368A	NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0299)	10	1221	-			368			Lumenal (Potential).|Interaction with ERLEC1, OS9 and SYVN1.		Q6UWT6|Q9P1T9|Q9UHK7	Silent	SNP	ENST00000336735.4	37	c.1104T>C	CCDS9876.1																																																																																				0.408	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065		3	44	0	0	0	6.4e-05	0	3	44				
TRIP11	9321	broad.mit.edu	37	14	92491704	92491704	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr14:92491704G>C	ENST00000267622.4	-	3	635	c.262C>G	c.(262-264)Caa>Gaa	p.Q88E		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	88					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TGCTTTATTTGAATCTCTGAT	0.303			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)	Ovarian(84;609 1888 9852 42686)	uc001xzy.2		NA		Dom	yes		14	14q31-q32	9321	T	thyroid hormone receptor interactor 11			L	PDGFRB		AML		0				ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13						c.(262-264)CAA>GAA		thyroid hormone receptor interactor 11							186.0	162.0	170.0					14																	92491704		2202	4299	6501	SO:0001583	missense	9321				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity	g.chr14:92491704G>C	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.262C>G	14.37:g.92491704G>C	ENSP00000267622:p.Gln88Glu						p.Q88E	NM_004239	NP_004230	Q15643	TRIPB_HUMAN		COAD - Colon adenocarcinoma(157;0.223)	3	1050	-			88			Potential.		B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	c.262C>G	CCDS9899.1	.	.	.	.	.	.	.	.	.	.	g	25.0	4.591723	0.86953	.	.	ENSG00000100815	ENST00000267622	T	0.64618	-0.11	5.35	5.35	0.76521	.	0.063724	0.64402	D	0.000005	T	0.78654	0.4317	M	0.68593	2.085	0.45634	D	0.998569	D	0.76494	0.999	D	0.83275	0.996	T	0.78620	-0.2133	10	0.49607	T	0.09	.	19.0868	0.93206	0.0:0.0:1.0:0.0	.	88	Q15643	TRIPB_HUMAN	E	88	ENSP00000267622:Q88E	ENSP00000267622:Q88E	Q	-	1	0	TRIP11	91561457	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.352000	0.90075	2.506000	0.84524	0.563000	0.77884	CAA		0.303	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1			3	67	0	0	0	0.00024832	0	3	67				
PAPOLA	10914	broad.mit.edu	37	14	96993794	96993794	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr14:96993794C>T	ENST00000216277.8	+	5	579	c.359C>T	c.(358-360)gCa>gTa	p.A120V	PAPOLA_ENST00000392990.2_Missense_Mutation_p.A120V|PAPOLA_ENST00000557320.1_Missense_Mutation_p.A120V|PAPOLA_ENST00000554130.1_3'UTR|PAPOLA_ENST00000557471.1_Missense_Mutation_p.A120V	NM_032632.4	NP_116021.2	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	120					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|RNA polyadenylation (GO:0043631)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		TTGTGTGTTGCACCAAGACAT	0.338																																					NSCLC(19;254 734 11908 35501 39234)	NSCLC(19;254 734 11908 35501 39234)	uc001yfq.2		NA																	0					0						c.(358-360)GCA>GTA		poly(A) polymerase alpha							241.0	267.0	258.0					14																	96993794		2203	4300	6503	SO:0001583	missense	10914				mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding	g.chr14:96993794C>T	X76770	CCDS9946.1, CCDS58334.1, CCDS58335.1	14q32.1-q32.2	2008-02-08				ENSG00000090060	2.7.7.19		14981	protein-coding gene	gene with protein product		605553				8302877, 10429366	Standard	NM_032632		Approved	PAP	uc001yfq.3	P51003		ENST00000216277.8:c.359C>T	14.37:g.96993794C>T	ENSP00000216277:p.Ala120Val					PAPOLA_uc001yfo.2_Missense_Mutation_p.A120V|PAPOLA_uc001yfp.2_Missense_Mutation_p.A120V|PAPOLA_uc001yfr.2_Missense_Mutation_p.A120V|PAPOLA_uc010twv.1_Missense_Mutation_p.A120V|PAPOLA_uc010avp.2_Intron	p.A120V	NM_032632	NP_116021	P51003	PAPOA_HUMAN		COAD - Colon adenocarcinoma(157;0.213)	5	569	+		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)	120					Q86SX4|Q86TV0|Q8IYF5|Q9BVU2	Missense_Mutation	SNP	ENST00000216277.8	37	c.359C>T	CCDS9946.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.224427|4.224427	0.79576|0.79576	.|.	.|.	ENSG00000090060|ENSG00000090060	ENST00000216277;ENST00000557320;ENST00000546064;ENST00000557471;ENST00000556619;ENST00000392990|ENST00000553461	.|.	.|.	.|.	5.39|5.39	5.39|5.39	0.77823|0.77823	Nucleotidyl transferase domain (1);Poly(A) polymerase, central domain (1);|.	0.052094|.	0.85682|.	D|.	0.000000|.	T|T	0.57829|0.57829	0.2080|0.2080	L|L	0.28344|0.28344	0.845|0.845	0.80722|0.80722	D|D	1|1	P;D;P;P;P|.	0.56521|.	0.923;0.976;0.938;0.535;0.938|.	B;P;B;B;B|.	0.51974|.	0.318;0.686;0.446;0.072;0.446|.	T|T	0.51252|0.51252	-0.8729|-0.8729	9|5	0.24483|.	T|.	0.36|.	.|.	19.5215|19.5215	0.95187|0.95187	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	136;136;120;120;136|.	F5H5I8;B4DYF4;P51003;P51003-2;B4DHB8|.	.;.;PAPOA_HUMAN;.;.|.	V|Y	120;120;136;120;134;120|6	.|.	ENSP00000216277:A120V|.	A|H	+|+	2|1	0|0	PAPOLA|PAPOLA	96063547|96063547	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.752000|7.752000	0.85141|0.85141	2.706000|2.706000	0.92434|0.92434	0.555000|0.555000	0.69702|0.69702	GCA|CAC		0.338	PAPOLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413411.2			7	54	0	0	0	0.000274275	0	7	54				
NUTM1	256646	broad.mit.edu	37	15	34640781	34640781	+	Missense_Mutation	SNP	G	G	A	rs371638413		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr15:34640781G>A	ENST00000333756.4	+	2	783	c.628G>A	c.(628-630)Gtt>Att	p.V210I	NUTM1_ENST00000438749.3_Missense_Mutation_p.V228I|NUTM1_ENST00000537011.1_Missense_Mutation_p.V238I	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	210						cytoplasm (GO:0005737)|nucleus (GO:0005634)											TTCCAAGGACGTTTATGAGAA	0.532																																							uc001zif.2		NA								T					BRD3|BRD4		lethal midline carcinoma	BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	0				midline_organs(25)|ovary(2)|lung(2)|skin(1)	30						c.(628-630)GTT>ATT		nuclear protein in testis		G	ILE/VAL	0,4402		0,0,2201	57.0	59.0	58.0		628	5.7	1.0	15		58	1,8595	1.2+/-3.3	0,1,4297	no	missense	C15orf55	NM_175741.1	29	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	210/1133	34640781	1,12997	2201	4298	6499	SO:0001583	missense	256646					cytoplasm|nucleus		g.chr15:34640781G>A	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.628G>A	15.37:g.34640781G>A	ENSP00000329448:p.Val210Ile					C15orf55_uc010ucc.1_Missense_Mutation_p.V238I|C15orf55_uc010ucd.1_Missense_Mutation_p.V228I	p.V210I	NM_175741	NP_786883	Q86Y26	NUT_HUMAN		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)	2	783	+		all_lung(180;2.78e-08)	210					B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	ENST00000333756.4	37	c.628G>A	CCDS32190.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.265387	0.80358	0.0	1.16E-4	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000354999;ENST00000333756	T;T;T	0.33438	1.41;1.41;1.41	5.69	5.69	0.88448	Nuclear Testis  protein, N-terminal (1);	0.000000	0.56097	D	0.000030	T	0.60418	0.2267	M	0.82823	2.61	0.37577	D	0.919643	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.995;0.998	T	0.68387	-0.5422	10	0.72032	D	0.01	.	16.7419	0.85461	0.0:0.0:1.0:0.0	.	228;238;210	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	I	238;228;210;210	ENSP00000444896:V238I;ENSP00000407031:V228I;ENSP00000329448:V210I	ENSP00000329448:V210I	V	+	1	0	C15orf55	32428073	1.000000	0.71417	0.991000	0.47740	0.664000	0.39144	5.442000	0.66575	2.692000	0.91855	0.655000	0.94253	GTT		0.532	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741		6	53	0	0	0	8.12818e-05	0	6	53				
ZSCAN29	146050	broad.mit.edu	37	15	43653495	43653495	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr15:43653495C>A	ENST00000396976.2	-	5	2469	c.2335G>T	c.(2335-2337)Gca>Tca	p.A779S	ZSCAN29_ENST00000568898.1_Missense_Mutation_p.A389S|ZSCAN29_ENST00000396972.1_Missense_Mutation_p.A390S|ZSCAN29_ENST00000562072.1_3'UTR	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	779					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		CTCCGATGTGCACTAAAATGA	0.448																																							uc001zrk.1		NA																	0				skin(1)	1						c.(2335-2337)GCA>TCA		zinc finger protein 690							169.0	157.0	161.0					15																	43653495		2201	4299	6500	SO:0001583	missense	146050				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr15:43653495C>A	AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.2335G>T	15.37:g.43653495C>A	ENSP00000380174:p.Ala779Ser					ZSCAN29_uc001zrj.1_Missense_Mutation_p.A659S|ZSCAN29_uc010bdf.1_3'UTR|ZSCAN29_uc001zrl.1_RNA|ZSCAN29_uc010bdg.1_Missense_Mutation_p.A389S	p.A779S	NM_152455	NP_689668	Q8IWY8	ZSC29_HUMAN		GBM - Glioblastoma multiforme(94;8.97e-07)	5	2482	-		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	779			C2H2-type 4.		B3KVB9|Q32M75|Q32M76|Q8NA40	Missense_Mutation	SNP	ENST00000396976.2	37	c.2335G>T	CCDS10095.2	.	.	.	.	.	.	.	.	.	.	C	17.30	3.355840	0.61293	.	.	ENSG00000140265	ENST00000396976;ENST00000396972	T;T	0.17854	2.25;2.25	5.17	5.17	0.71159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000007	T	0.19046	0.0457	N	0.11698	0.16	0.29332	N	0.866634	D;B	0.54207	0.965;0.039	P;B	0.60541	0.876;0.393	T	0.06197	-1.0840	10	0.08179	T	0.78	-10.5968	16.2243	0.82283	0.0:1.0:0.0:0.0	.	390;779	Q8IWY8-4;Q8IWY8	.;ZSC29_HUMAN	S	779;390	ENSP00000380174:A779S;ENSP00000380170:A390S	ENSP00000380170:A390S	A	-	1	0	ZSCAN29	41440787	0.000000	0.05858	1.000000	0.80357	0.994000	0.84299	-0.457000	0.06745	2.683000	0.91414	0.655000	0.94253	GCA		0.448	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253278.1	NM_152455		8	82	1	0	1.12685e-05	0.000274275	0.000148883	8	82				
IQCH	64799	broad.mit.edu	37	15	67553673	67553673	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr15:67553673G>T	ENST00000335894.4	+	2	181	c.115G>T	c.(115-117)Gag>Tag	p.E39*	IQCH_ENST00000512104.1_Nonsense_Mutation_p.E39*|IQCH_ENST00000358767.3_5'UTR|IQCH_ENST00000546225.1_5'UTR	NM_001031715.2	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H	39										NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(2)|pancreas(2)|skin(5)|upper_aerodigestive_tract(1)	33				Colorectal(3;0.0856)		GGAAAAAGGAGAGACTCTAGA	0.328																																							uc002aqo.1		NA																	0				skin(3)|ovary(1)	4						c.(115-117)GAG>TAG		IQ motif containing H isoform 1							84.0	96.0	92.0					15																	67553673		2201	4299	6500	SO:0001587	stop_gained	64799							g.chr15:67553673G>T	AY014282	CCDS10223.1, CCDS32273.1, CCDS10223.2, CCDS61680.1, CCDS61681.1	15q23	2005-10-24			ENSG00000103599	ENSG00000103599			25721	protein-coding gene	gene with protein product		612523				12477932	Standard	NM_022784		Approved	FLJ12476	uc002aqo.2	Q86VS3	OTTHUMG00000133231	ENST00000335894.4:c.115G>T	15.37:g.67553673G>T	ENSP00000336861:p.Glu39*					IQCH_uc010ujv.1_5'UTR|IQCH_uc002aqn.1_5'UTR|IQCH_uc002aqq.1_5'UTR|IQCH_uc002aqp.1_5'UTR|IQCH_uc002aqm.2_Nonsense_Mutation_p.E39*	p.E39*	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN		Colorectal(3;0.0856)	2	162	+			39					A8K8W3|C9JPR6|D6RJ88|Q4G0S6|Q8NEH9|Q9BWX2|Q9H9Y1|Q9UF88	Nonsense_Mutation	SNP	ENST00000335894.4	37	c.115G>T	CCDS32273.1	.	.	.	.	.	.	.	.	.	.	G	19.90	3.912682	0.72983	.	.	ENSG00000103599	ENST00000512104;ENST00000335894;ENST00000535744	.	.	.	5.57	-2.37	0.06643	.	1.427090	0.04049	N	0.304500	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-17.6199	5.7678	0.18237	0.261:0.3955:0.3435:0.0	.	.	.	.	X	39	.	ENSP00000336861:E39X	E	+	1	0	IQCH	65340727	0.000000	0.05858	0.000000	0.03702	0.172000	0.22775	-0.148000	0.10219	-0.336000	0.08438	0.579000	0.79373	GAG		0.328	IQCH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256969.1	NM_022784		8	117	1	0	0.000442599	0.000442599	0.00539561	8	117				
GLYR1	84656	broad.mit.edu	37	16	4861235	4861235	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr16:4861235C>T	ENST00000321919.9	-	15	1599	c.1523G>A	c.(1522-1524)cGc>cAc	p.R508H	GLYR1_ENST00000381983.3_Missense_Mutation_p.R491H|GLYR1_ENST00000436648.5_Missense_Mutation_p.R427H|GLYR1_ENST00000591451.1_Missense_Mutation_p.R502H	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	508					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						AATGGCTAAGCGGAGATCCTT	0.507																																							uc002cxx.3		NA																	0					0						c.(1522-1524)CGC>CAC		cytokine-like nuclear factor n-pac							158.0	145.0	149.0					16																	4861235		2197	4300	6497	SO:0001583	missense	84656				pentose-phosphate shunt	nucleus	coenzyme binding|DNA binding|methylated histone residue binding|phosphogluconate dehydrogenase (decarboxylating) activity	g.chr16:4861235C>T	AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.1523G>A	16.37:g.4861235C>T	ENSP00000322716:p.Arg508His					GLYR1_uc002cxy.2_RNA|GLYR1_uc002cxz.1_Missense_Mutation_p.R422H|GLYR1_uc002cya.2_Missense_Mutation_p.R502H|GLYR1_uc010uxv.1_Missense_Mutation_p.R427H	p.R508H	NM_032569	NP_115958	Q49A26	GLYR1_HUMAN			15	1560	-			508					B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	ENST00000321919.9	37	c.1523G>A	CCDS10524.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963850	0.74131	.	.	ENSG00000140632	ENST00000321919;ENST00000381983;ENST00000436648	T;T;T	0.32753	1.44;1.44;1.44	5.72	5.72	0.89469	Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.043589	0.85682	D	0.000000	T	0.45478	0.1344	L	0.50333	1.59	0.80722	D	1	P;P;P;D	0.76494	0.638;0.905;0.508;0.999	B;B;B;P	0.54815	0.034;0.255;0.049;0.761	T	0.35126	-0.9801	10	0.72032	D	0.01	-9.9412	18.6366	0.91380	0.0:1.0:0.0:0.0	.	427;502;491;508	Q49A26-5;Q49A26-3;Q49A26-2;Q49A26	.;.;.;GLYR1_HUMAN	H	508;491;427	ENSP00000322716:R508H;ENSP00000371413:R491H;ENSP00000390276:R427H	ENSP00000322716:R508H	R	-	2	0	GLYR1	4801236	1.000000	0.71417	0.985000	0.45067	0.676000	0.39594	7.765000	0.85310	2.700000	0.92200	0.561000	0.74099	CGC		0.507	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251717.2	NM_032569		9	128	0	0	0	0.000442599	0	9	128				
CLEC16A	23274	broad.mit.edu	37	16	11114107	11114107	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr16:11114107C>T	ENST00000409790.1	+	12	1591	c.1361C>T	c.(1360-1362)tCc>tTc	p.S454F	CLEC16A_ENST00000409552.3_Missense_Mutation_p.S436F	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.0?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GCCAGCACCTCCGTGCAGGAG	0.592																																							uc002dao.2		NA																	1	Whole gene deletion(1)	p.0?(1)	haematopoietic_and_lymphoid_tissue(1)	ovary(1)|central_nervous_system(1)	2						c.(1360-1362)TCC>TTC		C-type lectin domain family 16, member A							35.0	39.0	37.0					16																	11114107		1992	4162	6154	SO:0001583	missense	23274							g.chr16:11114107C>T	AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.1361C>T	16.37:g.11114107C>T	ENSP00000387122:p.Ser454Phe					CLEC16A_uc002dan.3_Missense_Mutation_p.S436F	p.S454F	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN			12	1591	+			454						Missense_Mutation	SNP	ENST00000409790.1	37	c.1361C>T	CCDS45409.1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.097396	0.37048	.	.	ENSG00000038532	ENST00000409790;ENST00000542102;ENST00000409552	T	0.46451	0.87	5.39	4.23	0.50019	.	0.195249	0.43747	D	0.000534	T	0.20251	0.0487	N	0.08118	0	0.22961	N	0.998506	P;P	0.36837	0.468;0.571	B;B	0.32533	0.143;0.147	T	0.11591	-1.0581	10	0.37606	T	0.19	-21.4129	9.888	0.41272	0.0:0.8927:0.0:0.1073	.	454;436	Q2KHT3;Q2KHT3-2	CL16A_HUMAN;.	F	454;454;436	ENSP00000387122:S454F	ENSP00000386495:S436F	S	+	2	0	CLEC16A	11021608	0.290000	0.24343	0.557000	0.28306	0.724000	0.41520	1.649000	0.37281	2.526000	0.85167	0.561000	0.74099	TCC		0.592	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226		6	33	0	0	0	3.59834e-05	0	6	33				
CCP110	9738	broad.mit.edu	37	16	19548753	19548753	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr16:19548753C>G	ENST00000381396.5	+	4	2009	c.1762C>G	c.(1762-1764)Ctt>Gtt	p.L588V	CCP110_ENST00000396208.2_Missense_Mutation_p.L588V|CCP110_ENST00000396212.2_Missense_Mutation_p.L588V	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	588					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						TAAACGGAGACTTGATTTAGA	0.363																																							uc002dgl.3		NA																	0					0						c.(1762-1764)CTT>GTT		RecName: Full=Centrosomal protein of 110 kDa;          Short=Cep110;							96.0	103.0	100.0					16																	19548753		2197	4300	6497	SO:0001583	missense	9738				centriole replication|G2/M transition of mitotic cell cycle|regulation of cytokinesis	centriole|cytosol	protein binding	g.chr16:19548753C>G	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.1762C>G	16.37:g.19548753C>G	ENSP00000370803:p.Leu588Val					CP110_uc002dgk.3_Missense_Mutation_p.L588V	p.L588V			O43303	CP110_HUMAN			4	2009	+			588	RRL->ARA: Abolishes interaction with CCNF.				B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	ENST00000381396.5	37	c.1762C>G	CCDS55992.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.653123	0.67472	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.25912	1.77;1.78;1.77	5.54	5.54	0.83059	.	0.079149	0.53938	D	0.000057	T	0.50565	0.1623	L	0.59436	1.845	0.48571	D	0.99967	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.49051	-0.8979	10	0.72032	D	0.01	.	19.4811	0.95009	0.0:1.0:0.0:0.0	.	588;588	O43303;O43303-2	CP110_HUMAN;.	V	588	ENSP00000379515:L588V;ENSP00000370803:L588V;ENSP00000379511:L588V	ENSP00000370803:L588V	L	+	1	0	CCP110	19456254	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.710000	0.47169	2.580000	0.87095	0.563000	0.77884	CTT		0.363	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711		5	111	0	0	0	0.000602214	0	5	111				
CACNG3	10368	broad.mit.edu	37	16	24268164	24268164	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr16:24268164C>A	ENST00000005284.3	+	1	1291	c.89C>A	c.(88-90)aCg>aAg	p.T30K		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	30					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		GCAGTGGGCACGGACTACTGG	0.448																																							uc002dmf.2		NA																	0					0						c.(88-90)ACG>AAG		voltage-dependent calcium channel gamma-3							184.0	178.0	180.0					16																	24268164		2197	4300	6497	SO:0001583	missense	10368				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr16:24268164C>A	AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.89C>A	16.37:g.24268164C>A	ENSP00000005284:p.Thr30Lys						p.T30K	NM_006539	NP_006530	O60359	CCG3_HUMAN		GBM - Glioblastoma multiforme(48;0.0809)	1	1289	+			30						Missense_Mutation	SNP	ENST00000005284.3	37	c.89C>A	CCDS10620.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354064	0.82243	.	.	ENSG00000006116	ENST00000005284	D	0.89050	-2.46	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.95449	0.8522	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95702	0.8750	10	0.87932	D	0	-10.5872	18.1171	0.89559	0.0:1.0:0.0:0.0	.	30	O60359	CCG3_HUMAN	K	30	ENSP00000005284:T30K	ENSP00000005284:T30K	T	+	2	0	CACNG3	24175665	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.320000	0.79064	2.865000	0.98341	0.655000	0.94253	ACG		0.448	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539		25	119	1	0	7.38237e-10	0.00106085	1.11919e-08	25	119				
ITGAD	3681	broad.mit.edu	37	16	31419778	31419778	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr16:31419778C>G	ENST00000389202.2	+	10	1091	c.1042C>G	c.(1042-1044)Cac>Gac	p.H348D		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	348					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CTCCTTCCAGCACGAGATGTC	0.562																																							uc002ebv.1		NA																	0				skin(1)	1						c.(1042-1044)CAC>GAC		integrin, alpha D precursor							82.0	72.0	75.0					16																	31419778		2197	4300	6497	SO:0001583	missense	3681				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr16:31419778C>G	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1042C>G	16.37:g.31419778C>G	ENSP00000373854:p.His348Asp					ITGAD_uc010vfl.1_3'UTR|ITGAD_uc010cap.1_Missense_Mutation_p.H348D|ITGAD_uc002ebw.1_3'UTR	p.H348D	NM_005353	NP_005344	Q13349	ITAD_HUMAN			10	1091	+			348			Extracellular (Potential).|FG-GAP 3.		Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	37	c.1042C>G	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	C	10.17	1.277627	0.23307	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.41400	1.0	5.47	2.43	0.29744	.	.	.	.	.	T	0.44456	0.1294	M	0.85373	2.75	0.09310	N	1	B;B	0.20671	0.047;0.047	B;B	0.20577	0.03;0.03	T	0.49273	-0.8957	9	0.72032	D	0.01	.	4.5181	0.11945	0.3102:0.5242:0.0:0.1656	.	364;348	Q59H14;Q13349	.;ITAD_HUMAN	D	364;348	ENSP00000373854:H348D	ENSP00000373854:H348D	H	+	1	0	ITGAD	31327279	0.947000	0.32204	0.077000	0.20336	0.885000	0.51271	0.479000	0.22228	0.275000	0.22094	0.644000	0.83932	CAC		0.562	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353		3	33	0	0	0	6.4e-05	0	3	33				
TP53	7157	broad.mit.edu	37	17	7578499	7578499	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr17:7578499T>A	ENST00000269305.4	-	5	620	c.431A>T	c.(430-432)cAg>cTg	p.Q144L	TP53_ENST00000413465.2_Missense_Mutation_p.Q144L|TP53_ENST00000455263.2_Missense_Mutation_p.Q144L|TP53_ENST00000445888.2_Missense_Mutation_p.Q144L|TP53_ENST00000420246.2_Missense_Mutation_p.Q144L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.Q144L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	144	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).|Q -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Q144L(8)|p.Q144P(4)|p.Q144R(4)|p.Q144fs*25(3)|p.Q144del(2)|p.Q144_G154del11(1)|p.L137_W146del10(1)|p.Q51fs*25(1)|p.Q144K(1)|p.Q144fs*32(1)|p.Q144fs*16(1)|p.P142_Q144delPVQ(1)|p.Q12fs*25(1)|p.V143_S149del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACCCACAGCTGCACAGGGCA	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		38	Substitution - Missense(17)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)	p.Q144*(29)|p.Q144L(8)|p.0?(7)|p.Q144H(4)|p.Q144P(4)|p.Q144R(4)|p.Q144fs*26(3)|p.Q144K(2)|p.Q144del(2)|p.Q144Q(2)|p.Q144_G154del11(1)|p.L137_W146del10(1)|p.Q144fs*32(1)|p.Q144fs*16(1)|p.Q144fs*4(1)|p.P142_Q144delPVQ(1)|p.V143_S149del(1)	upper_aerodigestive_tract(9)|bone(5)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(3)|large_intestine(2)|central_nervous_system(2)|urinary_tract(2)|lung(2)|liver(2)|stomach(1)|pancreas(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM023462	TP53	M		c.(430-432)CAG>CTG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							57.0	56.0	57.0					17																	7578499		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578499T>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.431A>T	17.37:g.7578499T>A	ENSP00000269305:p.Gln144Leu	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.Q144L|TP53_uc002gih.2_Missense_Mutation_p.Q144L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Q12L|TP53_uc010cng.1_Missense_Mutation_p.Q12L|TP53_uc002gii.1_Missense_Mutation_p.Q12L|TP53_uc010cnh.1_Missense_Mutation_p.Q144L|TP53_uc010cni.1_Missense_Mutation_p.Q144L|TP53_uc002gij.2_Missense_Mutation_p.Q144L|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.Q51L|TP53_uc002gio.2_Missense_Mutation_p.Q12L|TP53_uc010vug.1_Missense_Mutation_p.Q105L	p.Q144L	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	625	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	144		Q -> P (in sporadic cancers; somatic mutation).|Q -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.431A>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	13.43	2.234937	0.39498	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99778	-6.73;-6.73;-6.73;-6.73;-6.73;-6.73;-6.73;-6.73;-6.73	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.121732	0.56097	D	0.000038	D	0.99551	0.9839	M	0.71036	2.16	0.48975	D	0.999737	D;B;P;B;P;P;P	0.62365	0.991;0.248;0.887;0.019;0.67;0.61;0.91	D;B;P;B;P;P;B	0.62955	0.909;0.419;0.533;0.069;0.699;0.7;0.359	D	0.98023	1.0372	10	0.49607	T	0.09	-30.9139	9.1829	0.37152	0.162:0.0:0.0:0.838	.	105;144;144;51;144;144;144	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	144;144;144;144;144;144;133;51;12;51;12;144	ENSP00000410739:Q144L;ENSP00000352610:Q144L;ENSP00000269305:Q144L;ENSP00000398846:Q144L;ENSP00000391127:Q144L;ENSP00000391478:Q144L;ENSP00000425104:Q12L;ENSP00000423862:Q51L;ENSP00000424104:Q144L	ENSP00000269305:Q144L	Q	-	2	0	TP53	7519224	1.000000	0.71417	0.890000	0.34922	0.015000	0.08874	4.034000	0.57289	2.206000	0.71126	0.533000	0.62120	CAG		0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		9	38	0	0	0	0.000442599	0	9	38				
KIAA0100	9703	broad.mit.edu	37	17	26961982	26961982	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr17:26961982C>T	ENST00000528896.2	-	16	2697	c.2623G>A	c.(2623-2625)Gag>Aag	p.E875K	RP11-192H23.7_ENST00000577814.1_RNA|RP11-192H23.7_ENST00000583787.1_RNA|KIAA0100_ENST00000389003.3_Missense_Mutation_p.E732K|KIAA0100_ENST00000544884.1_Missense_Mutation_p.E732K	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	875						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GAGAAGTGCTCAACCTTTAAG	0.473																																							uc002hbu.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(2623-2625)GAG>AAG		hypothetical protein LOC9703 precursor							162.0	180.0	174.0					17																	26961982		2203	4300	6503	SO:0001583	missense	9703					extracellular region		g.chr17:26961982C>T	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2623G>A	17.37:g.26961982C>T	ENSP00000436773:p.Glu875Lys						p.E875K	NM_014680	NP_055495	Q14667	K0100_HUMAN			16	2722	-	Lung NSC(42;0.00431)		875					A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	c.2623G>A	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	c	1.616	-0.522726	0.04141	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.20200	2.1;2.09	5.89	4.92	0.64577	.	0.474372	0.25427	N	0.030748	T	0.05960	0.0155	N	0.01048	-1.04	0.18873	N	0.999986	B	0.02656	0.0	B	0.01281	0.0	T	0.31888	-0.9927	10	0.02654	T	1	.	11.0105	0.47659	0.0:0.1154:0.6419:0.2427	.	875	Q14667	K0100_HUMAN	K	875;845;875;732	ENSP00000436773:E875K;ENSP00000446443:E732K	ENSP00000005905:E875K	E	-	1	0	KIAA0100	23986109	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.798000	0.38814	1.509000	0.48786	-0.234000	0.12200	GAG		0.473	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680		14	280	0	0	0	0.000219431	0	14	280				
TAOK1	57551	broad.mit.edu	37	17	27849370	27849370	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr17:27849370G>C	ENST00000261716.3	+	17	2500	c.1981G>C	c.(1981-1983)Gaa>Caa	p.E661Q	TAOK1_ENST00000536202.1_Intron	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	661					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			ATCTATGCAAGAACTGGAGTT	0.418																																							uc002hdz.1		NA																	0				upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(1981-1983)GAA>CAA		TAO kinase 1							101.0	91.0	94.0					17																	27849370		2203	4300	6503	SO:0001583	missense	57551				mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity	g.chr17:27849370G>C	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.1981G>C	17.37:g.27849370G>C	ENSP00000261716:p.Glu661Gln					TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Missense_Mutation_p.E661Q	p.E661Q	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	Colorectal(6;0.198)		17	2175	+			661					A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	ENST00000261716.3	37	c.1981G>C	CCDS32601.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.595846	0.86953	.	.	ENSG00000160551	ENST00000261716	T	0.50548	0.74	5.96	4.99	0.66335	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.68586	0.3017	M	0.74647	2.275	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.72187	-0.4366	10	0.56958	D	0.05	.	15.3396	0.74284	0.0669:0.0:0.9331:0.0	.	661	Q7L7X3	TAOK1_HUMAN	Q	661	ENSP00000261716:E661Q	ENSP00000261716:E661Q	E	+	1	0	TAOK1	24873496	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	9.863000	0.99569	1.530000	0.49136	-0.163000	0.13421	GAA		0.418	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447790.1	NM_020791		6	61	0	0	0	8.12818e-05	0	6	61				
KRTAP9-4	85280	broad.mit.edu	37	17	39405983	39405983	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr17:39405983G>T	ENST00000334109.2	+	1	45	c.11G>T	c.(10-12)tGt>tTt	p.C4F		NM_033191.2	NP_149461.2	Q9BYQ2	KRA94_HUMAN	keratin associated protein 9-4	4						keratin filament (GO:0045095)				breast(1)|large_intestine(1)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			ATGACCCACTGTTGCTCCCCT	0.577																																							uc002hwi.2		NA																	0					0						c.(10-12)TGT>TTT		keratin associated protein 9-4							146.0	118.0	127.0					17																	39405983		2203	4299	6502	SO:0001583	missense	85280					keratin filament		g.chr17:39405983G>T	AJ406948	CCDS11386.1	17q21.2	2013-06-25			ENSG00000241595	ENSG00000241595		"""Keratin associated proteins"""	18902	protein-coding gene	gene with protein product						11279113	Standard	NM_033191		Approved	KAP9.4	uc002hwi.3	Q9BYQ2	OTTHUMG00000133438	ENST00000334109.2:c.11G>T	17.37:g.39405983G>T	ENSP00000334922:p.Cys4Phe					KRTAP9-9_uc010wfq.1_Intron	p.C4F	NM_033191	NP_149461	Q9BYQ2	KRA94_HUMAN	STAD - Stomach adenocarcinoma(17;0.000397)		1	45	+		Breast(137;0.000496)	4					Q0VAE3	Missense_Mutation	SNP	ENST00000334109.2	37	c.11G>T	CCDS11386.1	.	.	.	.	.	.	.	.	.	.	.	14.97	2.695532	0.48202	.	.	ENSG00000241595;ENSG00000198083	ENST00000334109;ENST00000431129	T	0.01584	4.75	1.96	1.96	0.26148	.	.	.	.	.	T	0.07234	0.0183	M	0.62723	1.935	0.29810	N	0.831706	D	0.67145	0.996	D	0.74348	0.983	T	0.03993	-1.0986	9	0.87932	D	0	.	9.9692	0.41743	0.0:0.0:1.0:0.0	.	4	Q9BYQ2	KRA94_HUMAN	F	4	ENSP00000334922:C4F	ENSP00000334922:C4F	C	+	2	0	KRTAP9-4;KRTAP9-9	36659509	1.000000	0.71417	0.901000	0.35422	0.667000	0.39255	2.843000	0.48238	1.390000	0.46547	0.400000	0.26472	TGT		0.577	KRTAP9-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257306.1			14	105	1	0	1.67942e-08	0.00074312	2.45174e-07	14	105				
SPPL2C	162540	broad.mit.edu	37	17	43922672	43922672	+	Missense_Mutation	SNP	C	C	G	rs140064060	byFrequency	TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr17:43922672C>G	ENST00000329196.5	+	1	417	c.400C>G	c.(400-402)Ctg>Gtg	p.L134V	MAPT-AS1_ENST00000579244.1_RNA|MAPT-AS1_ENST00000581125.1_RNA|MAPT-AS1_ENST00000579599.1_RNA	NM_175882.2	NP_787078.2	Q8IUH8	SPP2C_HUMAN	signal peptide peptidase like 2C	134	PA.					endoplasmic reticulum membrane (GO:0005789)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)										AGACACCACCCTGGCACCCCA	0.637																																						NSCLC(24;34 1393 18470)	uc010wka.1		NA																	0				pancreas(2)	2						c.(400-402)CTG>GTG		intramembrane protease 5 precursor							54.0	51.0	52.0					17																	43922672		2203	4300	6503	SO:0001583	missense	162540					integral to membrane	aspartic-type endopeptidase activity	g.chr17:43922672C>G		CCDS32673.1	17q21.31	2014-02-12			ENSG00000185294	ENSG00000185294			28902	protein-coding gene	gene with protein product	"""intramembrane protease 5"""	608284				12139484	Standard	NM_175882		Approved	IMP5	uc010wka.2	Q8IUH8		ENST00000329196.5:c.400C>G	17.37:g.43922672C>G	ENSP00000332488:p.Leu134Val					LOC100128977_uc010wjz.1_Intron	p.L134V	NM_175882	NP_787078	Q8IUH8	IMP5_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.148)	1	400	+	Colorectal(2;0.0416)		134			Extracellular (Potential).		Q8TC67|Q8WVZ6	Missense_Mutation	SNP	ENST00000329196.5	37	c.400C>G	CCDS32673.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.728153	0.00091	.	.	ENSG00000185294	ENST00000329196	T	0.06294	3.32	4.65	1.85	0.25348	Protease-associated domain, PA (1);	4.303060	0.00848	N	0.001817	T	0.03827	0.0108	N	0.14661	0.345	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.36480	-0.9746	10	0.02654	T	1	-13.7614	4.2409	0.10647	0.0:0.6078:0.2032:0.189	.	134	Q8IUH8	IMP5_HUMAN	V	134	ENSP00000332488:L134V	ENSP00000332488:L134V	L	+	1	2	AC217771.1	41278452	0.002000	0.14202	0.005000	0.12908	0.075000	0.17131	0.671000	0.25172	0.250000	0.21479	0.655000	0.94253	CTG		0.637	SPPL2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441156.1	NM_175882		4	25	0	0	0	0.00024832	0	4	25				
PRR11	55771	broad.mit.edu	37	17	57278969	57278969	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr17:57278969A>T	ENST00000262293.4	+	10	1372	c.1060A>T	c.(1060-1062)Agc>Tgc	p.S354C	CTD-2510F5.6_ENST00000577660.1_Intron|CTD-2510F5.4_ENST00000577678.1_RNA	NM_018304.3	NP_060774.2	Q96HE9	PRR11_HUMAN	proline rich 11	354						cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|pancreas(1)	16	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					ACTTTCTACAAGCAGCTTTGA	0.408																																							uc002ixf.1		NA																	0				ovary(2)	2						c.(1060-1062)AGC>TGC		proline rich 11							103.0	97.0	99.0					17																	57278969		2203	4300	6503	SO:0001583	missense	55771							g.chr17:57278969A>T		CCDS11614.1	17q23.2	2005-12-13				ENSG00000068489			25619	protein-coding gene	gene with protein product		615920				11799066	Standard	NM_018304		Approved	FLJ11029	uc002ixf.2	Q96HE9		ENST00000262293.4:c.1060A>T	17.37:g.57278969A>T	ENSP00000262293:p.Ser354Cys					PRR11_uc002ixg.1_RNA	p.S354C	NM_018304	NP_060774	Q96HE9	PRR11_HUMAN			10	1139	+	Medulloblastoma(34;0.0922)|all_neural(34;0.101)		354					Q9NUZ7|Q9NXE9	Missense_Mutation	SNP	ENST00000262293.4	37	c.1060A>T	CCDS11614.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.389680	0.82902	.	.	ENSG00000068489	ENST00000262293	.	.	.	5.58	4.51	0.55191	.	0.151462	0.47093	D	0.000252	T	0.50034	0.1592	L	0.51422	1.61	0.26880	N	0.96755	D	0.63046	0.992	P	0.57620	0.824	T	0.44406	-0.9330	9	0.62326	D	0.03	-7.5646	10.2225	0.43205	0.9227:0.0:0.0773:0.0	.	354	Q96HE9	PRR11_HUMAN	C	354	.	ENSP00000262293:S354C	S	+	1	0	PRR11	54633751	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.733000	0.47360	2.122000	0.65172	0.459000	0.35465	AGC		0.408	PRR11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445949.1	NM_018304		16	61	0	0	0	0.00074312	0	16	61				
CBX4	8535	broad.mit.edu	37	17	77808599	77808599	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr17:77808599G>C	ENST00000269397.4	-	5	1019	c.842C>G	c.(841-843)tCc>tGc	p.S281C		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	281	Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CACCTCGCCGGACTTGATCTT	0.582											OREG0024799	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002jxe.2		NA																	0				skin(2)	2						c.(841-843)TCC>TGC		chromobox homolog 4							148.0	131.0	137.0					17																	77808599		2202	4298	6500	SO:0001583	missense	8535				anti-apoptosis|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|PcG protein complex	enzyme binding|transcription corepressor activity	g.chr17:77808599G>C	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.842C>G	17.37:g.77808599G>C	ENSP00000269397:p.Ser281Cys		OREG0024799	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1178		p.S281C	NM_003655	NP_003646	O00257	CBX4_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		5	1005	-			281			Interaction with BMI1.		B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	ENST00000269397.4	37	c.842C>G	CCDS32758.1	.	.	.	.	.	.	.	.	.	.	g	16.56	3.156646	0.57259	.	.	ENSG00000141582	ENST00000269397	.	.	.	3.89	3.89	0.44902	.	22.498400	0.00559	U	0.000267	T	0.79015	0.4375	L	0.53249	1.67	0.80722	D	1	D	0.76494	0.999	D	0.66602	0.945	T	0.63207	-0.6689	9	0.72032	D	0.01	-48.215	15.8665	0.79069	0.0:0.0:1.0:0.0	.	281	O00257	CBX4_HUMAN	C	281	.	ENSP00000269397:S281C	S	-	2	0	CBX4	75423194	1.000000	0.71417	0.963000	0.40424	0.658000	0.38924	6.652000	0.74377	1.725000	0.51514	0.306000	0.20318	TCC		0.582	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655		6	193	0	0	0	0.000157383	0	6	193				
EPB41L3	23136	broad.mit.edu	37	18	5398126	5398127	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr18:5398126_5398127CC>AA	ENST00000341928.2	-	17	2705_2706	c.2365_2366GG>TT	c.(2365-2367)GGg>TTg	p.G789L	EPB41L3_ENST00000400111.3_Intron|EPB41L3_ENST00000342933.3_Missense_Mutation_p.G789L|EPB41L3_ENST00000542146.1_Missense_Mutation_p.G94L|EPB41L3_ENST00000542652.2_Intron|EPB41L3_ENST00000540638.2_Intron|EPB41L3_ENST00000427684.2_Missense_Mutation_p.G86L|EPB41L3_ENST00000544123.1_Missense_Mutation_p.G620L	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	789	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GAGCTTTTCCCCAGAAGACTGC	0.426																																							uc002kmt.1		NA																	0				ovary(5)	5						c.(2365-2367)GGG>TTG		erythrocyte membrane protein band 4.1-like 3																																				SO:0001583	missense	23136				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity	g.chr18:5398126_5398127CC>AA	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2365_2366delinsAA	18.37:g.5398126_5398127delinsAA	ENSP00000343158:p.Gly789Leu					EPB41L3_uc010wzh.1_Missense_Mutation_p.G620L|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc002kms.1_Intron|EPB41L3_uc010wze.1_Missense_Mutation_p.G94L|EPB41L3_uc010wzf.1_Missense_Mutation_p.G86L|EPB41L3_uc010wzg.1_Missense_Mutation_p.G61L|EPB41L3_uc010dkr.2_Missense_Mutation_p.G181L	p.G789L	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN			17	2451_2452	-			789			Spectrin--actin-binding (Potential).		B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	DNP	ENST00000341928.2	37	c.2365_2366GG>TT	CCDS11838.1																																																																																				0.426	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307		11	265	0	0	0	6.4e-05	0	11	265				
SLC25A52	147407	broad.mit.edu	37	18	29340372	29340372	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr18:29340372G>C	ENST00000579441.2	-	1	252	c.253C>G	c.(253-255)Ctt>Gtt	p.L85V	SLC25A52_ENST00000269205.5_Missense_Mutation_p.L95V			Q3SY17	S2552_HUMAN	solute carrier family 25, member 52	85					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											AATGGGGGAAGGATTCCACGA	0.473																																							uc002kxa.2		NA																	0				skin(1)	1						c.(253-255)CTT>GTT		mitochondrial carrier triple repeat 2							123.0	110.0	114.0					18																	29340372		2203	4298	6501	SO:0001583	missense	147407				transport	integral to membrane|mitochondrial inner membrane		g.chr18:29340372G>C		CCDS32812.1, CCDS32812.2	18q12.1	2013-07-15	2012-03-29	2012-03-29	ENSG00000141437	ENSG00000141437		"""Solute carriers"""	23324	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 2"""	MCART2			Standard	NM_001034172		Approved		uc002kxa.3	Q3SY17	OTTHUMG00000179617	ENST00000579441.2:c.253C>G	18.37:g.29340372G>C	ENSP00000462754:p.Leu85Val						p.L85V	NM_001034172	NP_001029344	Q3SY17	MCAR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.0539)		1	472	-			85			Solcar 1.|Helical; Name=2; (Potential).			Missense_Mutation	SNP	ENST00000579441.2	37	c.253C>G		.	.	.	.	.	.	.	.	.	.	G	14.31	2.497751	0.44455	.	.	ENSG00000141437	ENST00000269205;ENST00000535708	T	0.79749	-1.3	1.03	1.03	0.20045	Mitochondrial carrier domain (2);	0.084263	0.48767	D	0.000164	T	0.75347	0.3837	L	0.42487	1.325	0.52501	D	0.999954	P	0.37398	0.593	P	0.46452	0.517	T	0.67189	-0.5733	10	0.25106	T	0.35	.	7.9599	0.30066	0.0:0.0:1.0:0.0	.	85	Q3SY17	MCAR2_HUMAN	V	95;85	ENSP00000372612:L95V	ENSP00000372612:L95V	L	-	1	0	MCART2	27594370	1.000000	0.71417	0.018000	0.16275	0.071000	0.16799	2.477000	0.45180	0.877000	0.35895	0.505000	0.49811	CTT		0.473	SLC25A52-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_084000		7	74	0	0	0	8.12818e-05	0	7	74				
SLC14A2	8170	broad.mit.edu	37	18	43249420	43249420	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr18:43249420C>T	ENST00000255226.6	+	16	3002	c.2186C>T	c.(2185-2187)tCc>tTc	p.S729F	SLC14A2_ENST00000586448.1_Missense_Mutation_p.S729F|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A2_ENST00000589658.1_Missense_Mutation_p.S206F	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	729					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CAGCCTGCATCCGCCATGCCC	0.547																																							uc010dnj.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.(2185-2187)TCC>TTC		solute carrier family 14 (urea transporter),							175.0	150.0	158.0					18																	43249420		2203	4300	6503	SO:0001583	missense	8170					apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity	g.chr18:43249420C>T	X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.2186C>T	18.37:g.43249420C>T	ENSP00000255226:p.Ser729Phe					SLC14A2_uc002lbe.2_Missense_Mutation_p.S729F	p.S729F	NM_007163	NP_009094	Q15849	UT2_HUMAN			17	2507	+			729					A8K8Q7|Q2TBD6|Q96PH5	Missense_Mutation	SNP	ENST00000255226.6	37	c.2186C>T	CCDS11924.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.099735	0.37048	.	.	ENSG00000132874	ENST00000255226	T	0.51325	0.71	5.76	4.89	0.63831	.	0.519131	0.17785	N	0.162114	T	0.49541	0.1563	M	0.76574	2.34	0.80722	D	1	B	0.13145	0.007	B	0.22152	0.038	T	0.49072	-0.8977	10	0.52906	T	0.07	-23.8141	10.7664	0.46297	0.1308:0.8008:0.0:0.0684	.	729	Q15849	UT2_HUMAN	F	729	ENSP00000255226:S729F	ENSP00000255226:S729F	S	+	2	0	SLC14A2	41503418	0.002000	0.14202	0.004000	0.12327	0.005000	0.04900	1.763000	0.38461	1.398000	0.46701	0.655000	0.94253	TCC		0.547	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255858.1			11	95	0	0	0	0.000978159	0	11	95				
ADNP2	22850	broad.mit.edu	37	18	77895022	77895022	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr18:77895022C>G	ENST00000262198.4	+	4	2181	c.1726C>G	c.(1726-1728)Ctg>Gtg	p.L576V		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	576					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CACCAACATTCTGCCTGTGAA	0.547																																							uc002lnw.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(1726-1728)CTG>GTG		ADNP homeobox 2							104.0	97.0	99.0					18																	77895022		2203	4300	6503	SO:0001583	missense	22850				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:77895022C>G	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.1726C>G	18.37:g.77895022C>G	ENSP00000262198:p.Leu576Val						p.L576V	NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)	4	2181	+		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)	576					A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	c.1726C>G	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.470169	0.26423	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.07	3.17	0.36434	.	0.435749	0.18889	N	0.128369	T	0.34571	0.0902	N	0.19112	0.55	0.34812	D	0.737839	B	0.14805	0.011	B	0.19946	0.027	T	0.36648	-0.9739	8	.	.	.	-12.2206	10.3862	0.44140	0.2354:0.6379:0.1267:0.0	.	576	Q6IQ32	ADNP2_HUMAN	V	576	.	.	L	+	1	2	ADNP2	75996013	0.291000	0.24352	0.989000	0.46669	0.684000	0.39900	0.618000	0.24373	1.343000	0.45638	0.650000	0.86243	CTG		0.547	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913		10	74	0	0	0	0.000673444	0	10	74				
TMPRSS9	360200	broad.mit.edu	37	19	2405397	2405397	+	Silent	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr19:2405397G>A	ENST00000332578.3	+	6	594	c.594G>A	c.(592-594)agG>agA	p.R198R		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	198					plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCCTGGAGGATGGCCGGCA	0.627																																							uc010xgx.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(592-594)AGG>AGA		transmembrane protease, serine 9							77.0	75.0	76.0					19																	2405397		2203	4300	6503	SO:0001819	synonymous_variant	360200				proteolysis	integral to plasma membrane	serine-type endopeptidase activity	g.chr19:2405397G>A	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.594G>A	19.37:g.2405397G>A						TMPRSS9_uc002lvv.1_Silent_p.R232R	p.R198R	NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	6	594	+			198			Extracellular (Potential).		Q6ZND6|Q7Z411	Silent	SNP	ENST00000332578.3	37	c.594G>A	CCDS12088.1																																																																																				0.627	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451330.3	NM_182973		8	58	0	0	0	0.000274275	0	8	58				
APBA3	9546	broad.mit.edu	37	19	3760138	3760138	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr19:3760138C>A	ENST00000316757.3	-	2	325	c.125G>T	c.(124-126)gGa>gTa	p.G42V	MRPL54_ENST00000330133.4_5'Flank	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	42					in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCGGGGCCTCCTGGCATAGG	0.632																																							uc002lyp.1		NA																	0					0						c.(124-126)GGA>GTA		amyloid beta (A4) precursor protein-binding,							44.0	48.0	47.0					19																	3760138		2203	4298	6501	SO:0001583	missense	9546				intracellular signal transduction|protein transport	intracellular|membrane	protein binding	g.chr19:3760138C>A	AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132			580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262				10049767	Standard	NM_004886		Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.125G>T	19.37:g.3760138C>A	ENSP00000315136:p.Gly42Val					MRPL54_uc002lyq.3_5'Flank	p.G42V	NM_004886	NP_004877	O96018	APBA3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)	2	302	-		Hepatocellular(1079;0.137)	42					O60483|Q9UPZ2	Missense_Mutation	SNP	ENST00000316757.3	37	c.125G>T	CCDS12110.1	.	.	.	.	.	.	.	.	.	.	C	9.714	1.157936	0.21454	.	.	ENSG00000011132	ENST00000316757	T	0.44881	0.91	4.62	-0.714	0.11219	.	0.961499	0.08512	N	0.934799	T	0.26991	0.0661	N	0.24115	0.695	0.09310	N	0.999999	B	0.20671	0.047	B	0.24701	0.055	T	0.30707	-0.9969	10	0.38643	T	0.18	.	6.0312	0.19681	0.0:0.5701:0.1439:0.286	.	42	O96018	APBA3_HUMAN	V	42	ENSP00000315136:G42V	ENSP00000315136:G42V	G	-	2	0	APBA3	3711138	0.000000	0.05858	0.000000	0.03702	0.629000	0.37895	-0.123000	0.10611	0.063000	0.16370	0.561000	0.74099	GGA		0.632	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453634.2			14	57	1	0	9.16793e-09	0.000566183	1.35513e-07	14	57				
FFAR3	2865	broad.mit.edu	37	19	35850463	35850463	+	Missense_Mutation	SNP	C	C	T	rs376071323		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr19:35850463C>T	ENST00000327809.4	+	2	872	c.671C>T	c.(670-672)gCg>gTg	p.A224V	FFAR3_ENST00000594310.1_Missense_Mutation_p.A224V	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	224					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			AGGAGGGTGGCGGGGCTGTTG	0.642																																					Esophageal Squamous(185;1742 2042 21963 24215 27871)	Esophageal Squamous(185;1742 2042 21963 24215 27871)	uc002nzd.2		NA																	0					0						c.(670-672)GCG>GTG		free fatty acid receptor 3		C	VAL/ALA	0,4402		0,0,2201	65.0	54.0	58.0		671	-1.5	0.1	19		58	1,8595	1.2+/-3.3	0,1,4297	no	missense	FFAR3	NM_005304.3	64	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	benign	224/347	35850463	1,12997	2201	4298	6499	SO:0001583	missense	2865					integral to plasma membrane	G-protein coupled receptor activity|lipid binding	g.chr19:35850463C>T	AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.671C>T	19.37:g.35850463C>T	ENSP00000328230:p.Ala224Val					FFAR3_uc010xsu.1_Intron	p.A224V	NM_005304	NP_005295	O14843	FFAR3_HUMAN	Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)		2	746	+	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		224			Helical; Name=6; (Potential).		B2RWM8|Q14CM7	Missense_Mutation	SNP	ENST00000327809.4	37	c.671C>T	CCDS12459.1	.	.	.	.	.	.	.	.	.	.	C	0.076	-1.192517	0.01607	0.0	1.16E-4	ENSG00000185897	ENST00000327809	T	0.72835	-0.69	5.13	-1.48	0.08745	GPCR, rhodopsin-like superfamily (1);	0.506856	0.21152	N	0.079312	T	0.37019	0.0988	N	0.05330	-0.07	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.33497	-0.9866	10	0.02654	T	1	-6.205	4.8424	0.13496	0.146:0.3399:0.0:0.5141	.	224	O14843	FFAR3_HUMAN	V	224	ENSP00000328230:A224V	ENSP00000328230:A224V	A	+	2	0	FFAR3	40542303	0.001000	0.12720	0.104000	0.21259	0.518000	0.34316	0.575000	0.23729	-0.545000	0.06224	0.455000	0.32223	GCG		0.642	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418873.2	NM_005304		9	89	0	0	0	0.000274275	0	9	89				
DYRK1B	9149	broad.mit.edu	37	19	40316653	40316653	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr19:40316653G>A	ENST00000593685.1	-	11	2060	c.1592C>T	c.(1591-1593)tCt>tTt	p.S531F	DYRK1B_ENST00000323039.5_Missense_Mutation_p.S531F|DYRK1B_ENST00000430012.2_Missense_Mutation_p.S491F|DYRK1B_ENST00000348817.3_Missense_Mutation_p.S503F|DYRK1B_ENST00000597639.1_Missense_Mutation_p.S503F			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	531					adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			TGACGAGGCAGAGGCAGGGGC	0.657																																							uc002omj.2		NA																	0				ovary(4)|stomach(1)|central_nervous_system(1)|skin(1)	7						c.(1591-1593)TCT>TTT		dual-specificity tyrosine-(Y)-phosphorylation							16.0	21.0	20.0					19																	40316653		2144	4240	6384	SO:0001583	missense	9149				positive regulation of transcription, DNA-dependent	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|transcription coactivator activity	g.chr19:40316653G>A	Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.1592C>T	19.37:g.40316653G>A	ENSP00000469863:p.Ser531Phe					DYRK1B_uc002omi.2_Missense_Mutation_p.S503F|DYRK1B_uc002omk.2_Missense_Mutation_p.S491F	p.S531F	NM_004714	NP_004705	Q9Y463	DYR1B_HUMAN	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)		11	1872	-	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		531					O75258|O75788|O75789	Missense_Mutation	SNP	ENST00000593685.1	37	c.1592C>T	CCDS12543.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606781	0.28623	.	.	ENSG00000105204	ENST00000323039;ENST00000348817;ENST00000430012	T;T;T	0.58506	0.33;0.38;0.35	4.62	3.59	0.41128	.	0.523001	0.18940	N	0.126954	T	0.44519	0.1297	N	0.14661	0.345	0.36866	D	0.888661	B;P;P	0.45902	0.0;0.868;0.794	B;B;P	0.46110	0.001;0.307;0.504	T	0.53690	-0.8403	10	0.62326	D	0.03	.	10.1535	0.42809	0.0994:0.0:0.9006:0.0	.	491;531;503	Q9Y463-2;Q9Y463;Q9Y463-3	.;DYR1B_HUMAN;.	F	531;503;491	ENSP00000312789:S531F;ENSP00000221803:S503F;ENSP00000403182:S491F	ENSP00000312789:S531F	S	-	2	0	DYRK1B	45008493	0.981000	0.34729	0.910000	0.35882	0.360000	0.29518	1.162000	0.31786	0.905000	0.36596	0.462000	0.41574	TCT		0.657	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462874.2	NM_004714		17	27	0	0	0	0.00074312	0	17	27				
ARHGEF1	9138	broad.mit.edu	37	19	42396885	42396885	+	Silent	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr19:42396885G>T	ENST00000354532.3	+	7	727	c.579G>T	c.(577-579)gtG>gtT	p.V193V	ARHGEF1_ENST00000337665.4_Silent_p.V208V|ARHGEF1_ENST00000599846.1_Silent_p.V193V|ARHGEF1_ENST00000378152.4_Silent_p.V175V|ARHGEF1_ENST00000347545.4_Silent_p.V160V	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	193	RGSL.				cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		AGCGGCACGTGGCGGAGCGGC	0.701																																							uc002orx.2		NA																	0				ovary(3)|large_intestine(1)	4						c.(577-579)GTG>GTT		Rho guanine nucleotide exchange factor 1 isoform							13.0	16.0	15.0					19																	42396885		2195	4281	6476	SO:0001819	synonymous_variant	9138				cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr19:42396885G>T	U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.579G>T	19.37:g.42396885G>T						ARHGEF1_uc002orw.1_Silent_p.V193V|ARHGEF1_uc002ory.2_Silent_p.V160V|ARHGEF1_uc002orz.2_Silent_p.V31V|ARHGEF1_uc002osa.2_Silent_p.V208V|ARHGEF1_uc002osb.2_Silent_p.V175V|ARHGEF1_uc002osc.2_5'Flank	p.V193V	NM_004706	NP_004697	Q92888	ARHG1_HUMAN		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)	7	688	+		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)	193			RGSL.		O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Silent	SNP	ENST00000354532.3	37	c.579G>T	CCDS12591.1																																																																																				0.701	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000463360.1	NM_199002		5	6	1	0	0.000602214	0.000602214	0.00722963	5	6				
PSG1	5669	broad.mit.edu	37	19	43382154	43382155	+	Missense_Mutation	DNP	CG	CG	AT	rs142473373|rs145766399		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr19:43382154_43382155CG>AT	ENST00000436291.2	-	2	456_457	c.340_341CG>AT	c.(340-342)CGg>ATg	p.R114M	PSG1_ENST00000244296.2_Missense_Mutation_p.R114M|PSG1_ENST00000312439.6_Missense_Mutation_p.R114M|PSG1_ENST00000595356.1_Missense_Mutation_p.R114M|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000403380.3_Missense_Mutation_p.R114M|PSG1_ENST00000595124.1_Missense_Mutation_p.R114M	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	114	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				TGCGTCCTCCCGGGTGACATTC	0.45																																							uc002ovb.2		NA																	0				ovary(2)	2						c.(340-342)CGG>ATG		pregnancy specific beta-1-glycoprotein 1																																				SO:0001583	missense	5669				female pregnancy	extracellular region		g.chr19:43382154_43382155CG>AT		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.340_341delinsAT	19.37:g.43382154_43382155delinsAT	ENSP00000413041:p.Arg114Met					PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Missense_Mutation_p.R114M|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_RNA|PSG1_uc002our.1_Missense_Mutation_p.R114M|PSG1_uc010eio.1_Missense_Mutation_p.R114M|PSG1_uc002oux.1_Missense_Mutation_p.R43M|PSG1_uc002ouy.1_Missense_Mutation_p.R114M|PSG1_uc002ouz.1_Missense_Mutation_p.R114M|PSG1_uc002ova.1_Missense_Mutation_p.R114M|PSG1_uc002ovc.2_Missense_Mutation_p.R114M|PSG1_uc002ovd.1_Missense_Mutation_p.R114M	p.R114M	NM_006905	NP_008836	P11464	PSG1_HUMAN			2	478_479	-		Prostate(69;0.00682)	114			Ig-like V-type.		O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	DNP	ENST00000436291.2	37	c.340_341CG>AT	CCDS54275.1																																																																																				0.450	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1			11	497	0	0	0	6.4e-05	0	11	497				
PSG6	5675	broad.mit.edu	37	19	43421914	43421914	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr19:43421914G>T	ENST00000292125.2	-	1	75	c.31C>A	c.(31-33)Cag>Aag	p.Q11K	PSG6_ENST00000402603.4_Missense_Mutation_p.Q11K|PSG6_ENST00000601833.1_Intron|PSG6_ENST00000187910.2_Missense_Mutation_p.Q11K	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	11					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GTGATGTGCTGAGTGCAGGGA	0.597																																							uc002ovj.1		NA																	0				ovary(1)|skin(1)	2						c.(31-33)CAG>AAG		pregnancy specific beta-1-glycoprotein 6 isoform							135.0	118.0	124.0					19																	43421914		2201	4300	6501	SO:0001583	missense	5675				female pregnancy	extracellular region		g.chr19:43421914G>T		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.31C>A	19.37:g.43421914G>T	ENSP00000292125:p.Gln11Lys					PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG6_uc002ovf.1_Missense_Mutation_p.Q11K|PSG6_uc002ovg.1_Missense_Mutation_p.Q11K	p.Q11K	NM_002782	NP_002773	Q00889	PSG6_HUMAN			1	83	-		Prostate(69;0.00899)	11					O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	37	c.31C>A	CCDS12613.1	.	.	.	.	.	.	.	.	.	.	g	0.027	-1.361759	0.01235	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125;ENST00000402456	T;T;T	0.28666	1.6;1.93;1.63	1.47	-2.95	0.05564	.	.	.	.	.	T	0.22282	0.0537	L	0.44542	1.39	0.09310	N	1	B;B;B	0.33964	0.434;0.125;0.077	B;B;B	0.38378	0.272;0.096;0.103	T	0.18524	-1.0334	9	0.27785	T	0.31	.	3.8078	0.08785	0.0:0.3166:0.3559:0.3275	.	11;11;11	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	K	11	ENSP00000187910:Q11K;ENSP00000385736:Q11K;ENSP00000292125:Q11K	ENSP00000187910:Q11K	Q	-	1	0	PSG6	48113754	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.476000	0.00986	-1.863000	0.01150	-1.141000	0.01876	CAG		0.597	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782		51	104	1	0	6.3091e-27	0.000781405	1.02904e-25	51	104				
SYNGR4	23546	broad.mit.edu	37	19	48869140	48869140	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr19:48869140A>C	ENST00000344846.2	+	2	291	c.41A>C	c.(40-42)gAa>gCa	p.E14A	TMEM143_ENST00000435956.3_5'Flank|TMEM143_ENST00000293261.3_5'Flank|TMEM143_ENST00000436660.2_5'Flank|TMEM143_ENST00000377431.2_5'Flank|TMEM143_ENST00000598012.1_5'Flank|TMEM143_ENST00000541566.1_5'Flank	NM_012451.3	NP_036583.2	O95473	SNG4_HUMAN	synaptogyrin 4	14						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(2)|skin(1)	10		all_epithelial(76;5.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|Prostate(7;0.0143)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		GCCAACAGCGAAGCCGTGCAG	0.647																																							uc002piz.2		NA																	0					0						c.(40-42)GAA>GCA		synaptogyrin 4							106.0	103.0	104.0					19																	48869140		2203	4300	6503	SO:0001583	missense	23546					integral to membrane		g.chr19:48869140A>C	AJ011733	CCDS12717.1	19q13.3	2008-07-04				ENSG00000105467			11502	protein-coding gene	gene with protein product		608373					Standard	NM_012451		Approved		uc002piz.3	O95473		ENST00000344846.2:c.41A>C	19.37:g.48869140A>C	ENSP00000344041:p.Glu14Ala					TMEM143_uc002piw.1_5'Flank|TMEM143_uc002pix.1_5'Flank|TMEM143_uc002piy.1_5'Flank|TMEM143_uc010xzn.1_5'Flank|TMEM143_uc010elw.1_5'Flank|TMEM143_uc010xzo.1_5'Flank|TMEM143_uc010xzp.1_5'Flank|TMEM143_uc010xzq.1_5'Flank	p.E14A	NM_012451	NP_036583	O95473	SNG4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)	2	286	+		all_epithelial(76;5.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|Prostate(7;0.0143)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)	14					Q3KP58	Missense_Mutation	SNP	ENST00000344846.2	37	c.41A>C	CCDS12717.1	.	.	.	.	.	.	.	.	.	.	a	12.60	1.985556	0.35036	.	.	ENSG00000105467	ENST00000344846	T	0.50277	0.75	4.9	4.9	0.64082	.	0.110737	0.64402	D	0.000015	T	0.47414	0.1444	L	0.44542	1.39	0.40255	D	0.978119	P	0.46784	0.884	P	0.46419	0.516	T	0.52830	-0.8523	10	0.59425	D	0.04	-20.6984	13.8174	0.63301	1.0:0.0:0.0:0.0	.	14	O95473	SNG4_HUMAN	A	14	ENSP00000344041:E14A	ENSP00000344041:E14A	E	+	2	0	SYNGR4	53560952	0.951000	0.32395	0.318000	0.25279	0.206000	0.24218	3.270000	0.51600	1.965000	0.57142	0.409000	0.27619	GAA		0.647	SYNGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465704.1			3	81	0	0	0	6.4e-05	0	3	81				
CAD	790	broad.mit.edu	37	2	27449776	27449776	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:27449776C>T	ENST00000403525.1	+	14	2188	c.2044C>T	c.(2044-2046)Ctt>Ttt	p.L682F	CAD_ENST00000264705.4_Missense_Mutation_p.L745F			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCGATGGGACCTTAGCAAGTT	0.577																																							uc002rji.2		NA																	0				ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10						c.(2233-2235)CTT>TTT		carbamoylphosphate synthetase 2/aspartate	L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)						127.0	129.0	128.0					2																	27449776		2203	4300	6503	SO:0001583	missense	790				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity	g.chr2:27449776C>T	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.2044C>T	2.37:g.27449776C>T	ENSP00000384510:p.Leu682Phe					CAD_uc010eyw.2_Missense_Mutation_p.L682F	p.L745F	NM_004341	NP_004332	P27708	PYR1_HUMAN			15	2395	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		745			CPSase (Carbamoyl-phosphate synthase).|CPSase A.		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37	c.2233C>T		.	.	.	.	.	.	.	.	.	.	C	22.6	4.316489	0.81469	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.93712	-3.27;-3.27	4.38	4.38	0.52667	ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.94775	0.8313	L	0.39514	1.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.95469	0.8550	10	0.87932	D	0	0.8848	15.7152	0.77663	0.0:1.0:0.0:0.0	.	682;745	F8VPD4;P27708	.;PYR1_HUMAN	F	745;682	ENSP00000264705:L745F;ENSP00000384510:L682F	ENSP00000264705:L745F	L	+	1	0	CAD	27303280	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.283000	0.65621	2.281000	0.76405	0.485000	0.47835	CTT		0.577	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1			19	111	0	0	0	0.000132079	0	19	111				
AAK1	22848	broad.mit.edu	37	2	69736403	69736403	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:69736403G>A	ENST00000409085.4	-	14	2342	c.1966C>T	c.(1966-1968)Ctc>Ttc	p.L656F	AAK1_ENST00000406297.3_Missense_Mutation_p.L656F|AAK1_ENST00000409068.1_Missense_Mutation_p.L656F	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	656					endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)	p.L656F(2)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						GCTGCCTGGAGCAGCTGGGTT	0.552																																							uc002sfp.2		NA																	2	Substitution - Missense(2)		endometrium(2)		0						c.(1966-1968)CTC>TTC		AP2 associated kinase 1							77.0	79.0	79.0					2																	69736403		1946	4143	6089	SO:0001583	missense	22848					coated pit|mitochondrion|plasma membrane	ATP binding|protein serine/threonine kinase activity	g.chr2:69736403G>A	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.1966C>T	2.37:g.69736403G>A	ENSP00000386456:p.Leu656Phe					AAK1_uc010fdk.2_Missense_Mutation_p.L656F|AAK1_uc010yqm.1_Missense_Mutation_p.L657F	p.L656F	NM_014911	NP_055726	Q2M2I8	AAK1_HUMAN			14	2471	-			656					Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	ENST00000409085.4	37	c.1966C>T	CCDS1893.2	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903852	0.72754	.	.	ENSG00000115977	ENST00000409068;ENST00000409085;ENST00000406297	T;T;T	0.33654	1.4;1.4;1.4	5.52	5.52	0.82312	.	0.059047	0.64402	D	0.000001	T	0.48021	0.1477	L	0.34521	1.04	0.58432	D	0.999996	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.85130	0.994;0.997;0.982	T	0.19844	-1.0293	10	0.11182	T	0.66	-11.8708	18.4358	0.90645	0.0:0.0:1.0:0.0	.	656;656;656	B7ZLC4;Q2M2I8-2;Q2M2I8	.;.;AAK1_HUMAN	F	656	ENSP00000386342:L656F;ENSP00000386456:L656F;ENSP00000385181:L656F	ENSP00000385181:L656F	L	-	1	0	AAK1	69589907	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.097000	0.76967	2.588000	0.87417	0.655000	0.94253	CTC		0.552	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251847.4	NM_014911		6	87	0	0	0	0.000157383	0	6	87				
MPHOSPH10	10199	broad.mit.edu	37	2	71365639	71365639	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:71365639C>G	ENST00000244230.2	+	5	1470	c.1118C>G	c.(1117-1119)tCt>tGt	p.S373C	MPHOSPH10_ENST00000498451.2_Missense_Mutation_p.S373C	NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	373					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						AAAATTGCATCTTTAGAAAAA	0.338																																							uc002sht.1		NA																	0				skin(2)|ovary(1)	3						c.(1117-1119)TCT>TGT		M-phase phosphoprotein 10							23.0	25.0	24.0					2																	71365639		2203	4300	6503	SO:0001583	missense	10199				RNA splicing, via transesterification reactions|rRNA processing	chromosome|nucleolus|small nucleolar ribonucleoprotein complex	protein binding	g.chr2:71365639C>G	X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1118C>G	2.37:g.71365639C>G	ENSP00000244230:p.Ser373Cys					MPHOSPH10_uc010feb.1_Missense_Mutation_p.S373C	p.S373C	NM_005791	NP_005782	O00566	MPP10_HUMAN			5	1470	+			373			Potential.		A0AVJ8	Missense_Mutation	SNP	ENST00000244230.2	37	c.1118C>G	CCDS1916.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.099848	0.56183	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.10668	2.85;2.85	3.53	3.53	0.40419	.	0.363923	0.28453	N	0.015299	T	0.27027	0.0662	M	0.69823	2.125	0.32231	N	0.573917	D;D	0.63046	0.992;0.986	P;P	0.59948	0.866;0.813	T	0.29971	-0.9994	10	0.72032	D	0.01	.	13.4494	0.61161	0.0:1.0:0.0:0.0	.	373;373	B3KPV5;O00566	.;MPP10_HUMAN	C	373;233	ENSP00000244230:S373C;ENSP00000393034:S233C	ENSP00000244230:S373C	S	+	2	0	MPHOSPH10	71219147	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.398000	0.44486	2.274000	0.75844	0.461000	0.40582	TCT		0.338	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791		3	25	0	0	0	0.000602214	0	3	25				
ZNF638	27332	broad.mit.edu	37	2	71653619	71653619	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:71653619A>C	ENST00000409544.1	+	24	5250	c.4620A>C	c.(4618-4620)gaA>gaC	p.E1540D	ZNF638_ENST00000264447.4_Missense_Mutation_p.E1540D|ZNF638_ENST00000409407.1_Missense_Mutation_p.E480D|ZNF638_ENST00000355812.3_Missense_Mutation_p.N1132T	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1540					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						ATTTGGATGAATTTGTTACTG	0.343																																							uc002shx.2		NA																	0				pancreas(2)|ovary(1)|skin(1)	4						c.(4618-4620)GAA>GAC		zinc finger protein 638							64.0	66.0	65.0					2																	71653619		2203	4300	6503	SO:0001583	missense	27332				RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr2:71653619A>C	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.4620A>C	2.37:g.71653619A>C	ENSP00000386433:p.Glu1540Asp					ZNF638_uc002shy.2_Missense_Mutation_p.E1540D|ZNF638_uc002shz.2_Missense_Mutation_p.E1540D|ZNF638_uc002sia.2_Missense_Mutation_p.E1540D|ZNF638_uc002sib.1_Missense_Mutation_p.N1132T|ZNF638_uc010fed.2_Intron|ZNF638_uc002sic.2_Missense_Mutation_p.E637D|ZNF638_uc002sid.2_5'UTR	p.E1540D	NM_014497	NP_055312	Q14966	ZN638_HUMAN			24	4939	+			1540					B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	c.4620A>C	CCDS1917.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.85|18.85	3.710845|3.710845	0.68730|0.68730	.|.	.|.	ENSG00000075292|ENSG00000075292	ENST00000264447;ENST00000409544;ENST00000409407;ENST00000462695|ENST00000355812	T;T;T|T	0.58652|0.55760	0.32;0.32;0.67|0.5	5.53|5.53	3.11|3.11	0.35812|0.35812	.|.	0.124148|.	0.36444|.	N|.	0.002597|.	T|T	0.34135|0.34135	0.0887|0.0887	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	B;D|B	0.64830|0.16396	0.04;0.994|0.017	B;D|B	0.70716|0.14578	0.043;0.97|0.011	T|T	0.28933|0.28933	-1.0028|-1.0028	10|9	0.39692|0.87932	T|D	0.17|0	-15.6287|-15.6287	2.6871|2.6871	0.05110|0.05110	0.5303:0.259:0.2106:0.0|0.5303:0.259:0.2106:0.0	.|.	1540;1540|1132	Q14966-3;Q14966|Q14966-4	.;ZN638_HUMAN|.	D|T	1540;1540;480;480|1132	ENSP00000264447:E1540D;ENSP00000386433:E1540D;ENSP00000386813:E480D|ENSP00000348066:N1132T	ENSP00000264447:E1540D|ENSP00000348066:N1132T	E|N	+|+	3|2	2|0	ZNF638|ZNF638	71507127|71507127	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.215000|1.215000	0.32431|0.32431	0.885000|0.885000	0.36088|0.36088	0.533000|0.533000	0.62120|0.62120	GAA|AAT		0.343	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		9	68	0	0	0	0.000151284	0	9	68				
ZNF638	27332	broad.mit.edu	37	2	71653631	71653631	+	Silent	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:71653631G>T	ENST00000409544.1	+	24	5262	c.4632G>T	c.(4630-4632)gtG>gtT	p.V1544V	ZNF638_ENST00000264447.4_Silent_p.V1544V|ZNF638_ENST00000409407.1_Silent_p.V484V|ZNF638_ENST00000355812.3_Missense_Mutation_p.W1136L	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1544					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TTGTTACTGTGGATGAGGTTA	0.348																																							uc002shx.2		NA																	0				pancreas(2)|ovary(1)|skin(1)	4						c.(4630-4632)GTG>GTT		zinc finger protein 638							68.0	70.0	69.0					2																	71653631		2203	4300	6503	SO:0001819	synonymous_variant	27332				RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr2:71653631G>T	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.4632G>T	2.37:g.71653631G>T						ZNF638_uc002shy.2_Silent_p.V1544V|ZNF638_uc002shz.2_Silent_p.V1544V|ZNF638_uc002sia.2_Silent_p.V1544V|ZNF638_uc002sib.1_Missense_Mutation_p.W1136L|ZNF638_uc010fed.2_Intron|ZNF638_uc002sic.2_Silent_p.V641V|ZNF638_uc002sid.2_5'UTR	p.V1544V	NM_014497	NP_055312	Q14966	ZN638_HUMAN			24	4951	+			1544					B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Silent	SNP	ENST00000409544.1	37	c.4632G>T	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	8.675	0.903657	0.17760	.	.	ENSG00000075292	ENST00000355812	T	0.53857	0.6	5.53	2.79	0.32731	.	.	.	.	.	T	0.67841	0.2936	.	.	.	0.80722	D	1	D	0.64830	0.994	D	0.70227	0.968	T	0.66508	-0.5906	8	0.87932	D	0	-6.6618	7.7327	0.28796	0.3242:0.0:0.6758:0.0	.	1136	Q14966-4	.	L	1136	ENSP00000348066:W1136L	ENSP00000348066:W1136L	W	+	2	0	ZNF638	71507139	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.787000	0.47798	0.311000	0.23014	-0.136000	0.14681	TGG		0.348	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		9	70	1	0	6.42651e-13	0.000978159	1.00654e-11	9	70				
LCT	3938	broad.mit.edu	37	2	136558235	136558235	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:136558235G>C	ENST00000264162.2	-	12	4818	c.4808C>G	c.(4807-4809)gCt>gGt	p.A1603G		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1603	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TCTGGGTTCAGCCCAGTCACT	0.517																																							uc002tuu.1		NA																	0				ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(4807-4809)GCT>GGT		lactase-phlorizin hydrolase preproprotein							113.0	107.0	109.0					2																	136558235		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136558235G>C	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4808C>G	2.37:g.136558235G>C	ENSP00000264162:p.Ala1603Gly						p.A1603G	NM_002299	NP_002290	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	12	4819	-			1603			Extracellular (Potential).|4.|4 X approximate repeats.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.4808C>G	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.613173	0.66672	.	.	ENSG00000115850	ENST00000264162	T	0.35789	1.29	5.73	5.73	0.89815	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.110413	0.64402	D	0.000008	T	0.35278	0.0926	L	0.39397	1.21	0.58432	D	0.999999	B	0.18968	0.032	B	0.22601	0.04	T	0.05354	-1.0890	10	0.30854	T	0.27	-18.6536	19.9019	0.96988	0.0:0.0:1.0:0.0	.	1603	P09848	LPH_HUMAN	G	1603	ENSP00000264162:A1603G	ENSP00000264162:A1603G	A	-	2	0	LCT	136274705	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.019000	0.88732	2.706000	0.92434	0.563000	0.77884	GCT		0.517	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		16	57	0	0	0	0.00074312	0	16	57				
LCT	3938	broad.mit.edu	37	2	136570244	136570244	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:136570244G>T	ENST00000264162.2	-	7	2000	c.1990C>A	c.(1990-1992)Ccc>Acc	p.P664T	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	664	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GTGAACTCGGGGAGTTGAGCC	0.557																																							uc002tuu.1		NA																	0				ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(1990-1992)CCC>ACC		lactase-phlorizin hydrolase preproprotein							121.0	109.0	113.0					2																	136570244		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136570244G>T	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1990C>A	2.37:g.136570244G>T	ENSP00000264162:p.Pro664Thr						p.P664T	NM_002299	NP_002290	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	7	2001	-			664			Extracellular (Potential).|4 X approximate repeats.|2.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.1990C>A	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239053	0.58995	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.74632	-0.86	5.49	5.49	0.81192	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.312597	0.35585	N	0.003120	D	0.90594	0.7051	M	0.94142	3.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92862	0.6306	10	0.87932	D	0	-17.8491	19.3929	0.94592	0.0:0.0:1.0:0.0	.	664	P09848	LPH_HUMAN	T	664;96	ENSP00000264162:P664T	ENSP00000264162:P664T	P	-	1	0	LCT	136286714	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	9.869000	0.99810	2.583000	0.87209	0.655000	0.94253	CCC		0.557	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		12	71	1	0	6.31663e-08	0.000308642	9.16492e-07	12	71				
KYNU	8942	broad.mit.edu	37	2	143799696	143799696	+	Silent	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:143799696C>G	ENST00000264170.4	+	14	1611	c.1353C>G	c.(1351-1353)acC>acG	p.T451T	KYNU_ENST00000409512.1_Silent_p.T451T	NM_003937.2	NP_003928.1			kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		ataaaTTTACCAATCTGCTCA	0.363																																							uc002tvl.2		NA																	0				skin(2)	2						c.(1351-1353)ACC>ACG		kynureninase (L-kynurenine hydrolase) isoform a	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)						100.0	100.0	100.0					2																	143799696		2203	4299	6502	SO:0001819	synonymous_variant	8942				anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity	g.chr2:143799696C>G	U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.1353C>G	2.37:g.143799696C>G						KYNU_uc010fnm.2_Silent_p.T451T	p.T451T	NM_003937	NP_003928	Q16719	KYNU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.072)	14	1483	+			451						Silent	SNP	ENST00000264170.4	37	c.1353C>G	CCDS2183.1																																																																																				0.363	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254772.1	NM_001032998		3	30	0	0	0	6.4e-05	0	3	30				
ACVR1	90	broad.mit.edu	37	2	158622640	158622640	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:158622640C>T	ENST00000263640.3	-	8	1288	c.859G>A	c.(859-861)Gaa>Aaa	p.E287K	ACVR1_ENST00000410057.2_Missense_Mutation_p.E287K|ACVR1_ENST00000409283.2_Missense_Mutation_p.E287K|ACVR1_ENST00000434821.1_Missense_Mutation_p.E287K	NM_001105.4	NP_001096.1	Q04771	ACVR1_HUMAN	activin A receptor, type I	287	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|acute inflammatory response (GO:0002526)|atrial septum primum morphogenesis (GO:0003289)|BMP signaling pathway (GO:0030509)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to glucocorticoid stimulus (GO:0071385)|determination of left/right symmetry (GO:0007368)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion cell fate commitment (GO:0061445)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation with mouth forming second (GO:0001702)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|mesoderm formation (GO:0001707)|mitral valve morphogenesis (GO:0003183)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of signal transduction (GO:0009968)|neural crest cell migration (GO:0001755)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of bone mineralization (GO:0030501)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of ossification (GO:0030278)|regulation of skeletal muscle tissue development (GO:0048641)|smooth muscle cell differentiation (GO:0051145)|transforming growth factor beta receptor signaling pathway (GO:0007179)|urogenital system development (GO:0001655)	activin receptor complex (GO:0048179)|apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	19				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	GATCCCATTTCATGATAATGT	0.403																																							uc002tzm.3		NA																	0				ovary(2)|skin(1)	3						c.(859-861)GAA>AAA		activin A receptor, type I precursor	Adenosine triphosphate(DB00171)						96.0	86.0	89.0					2																	158622640		2203	4300	6503	SO:0001583	missense	90				BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding	g.chr2:158622640C>T		CCDS2206.1	2q23-q24	2008-06-13			ENSG00000115170	ENSG00000115170			171	protein-coding gene	gene with protein product		102576		ACVRLK2		8397373	Standard	NM_001105		Approved	SKR1, ALK2, ACVR1A	uc010fog.2	Q04771	OTTHUMG00000131967	ENST00000263640.3:c.859G>A	2.37:g.158622640C>T	ENSP00000263640:p.Glu287Lys					ACVR1_uc002tzn.3_Missense_Mutation_p.E287K|ACVR1_uc010fog.2_Missense_Mutation_p.E287K	p.E287K	NM_001111067	NP_001104537	Q04771	ACVR1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.104)	9	1198	-			287			Cytoplasmic (Potential).|Protein kinase.			Missense_Mutation	SNP	ENST00000263640.3	37	c.859G>A	CCDS2206.1	.	.	.	.	.	.	.	.	.	.	C	37	6.028813	0.97216	.	.	ENSG00000115170	ENST00000263640;ENST00000409283;ENST00000434821;ENST00000410057	D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.31	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95661	0.8589	L	0.52905	1.665	0.80722	D	1	D	0.65815	0.995	P	0.62435	0.902	D	0.95382	0.8474	10	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	287	Q04771	ACVR1_HUMAN	K	287	ENSP00000263640:E287K;ENSP00000387273:E287K;ENSP00000405004:E287K;ENSP00000387127:E287K	ENSP00000263640:E287K	E	-	1	0	ACVR1	158330886	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.750000	0.85110	2.941000	0.99782	0.655000	0.94253	GAA		0.403	ACVR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254927.1	NM_001105		8	71	0	0	0	0.000157383	0	8	71				
TTN	7273	broad.mit.edu	37	2	179613587	179613587	+	Intron	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:179613587C>A	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.A4514S|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTTCTCTGCCTGATACATA	0.323																																							uc002unb.2		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(13540-13542)GCA>TCA		titin isoform novex-3							112.0	108.0	109.0					2																	179613587		2203	4297	6500	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179613587C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+4263G>T	2.37:g.179613587C>A						TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.A4514S	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	13764	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.13540G>T		.	.	.	.	.	.	.	.	.	.	C	6.771	0.511122	0.12883	.	.	ENSG00000155657	ENST00000360870	T	0.57436	0.4	6.04	4.23	0.50019	.	.	.	.	.	T	0.38348	0.1037	N	0.24115	0.695	0.09310	N	0.999999	B	0.23249	0.082	B	0.24394	0.053	T	0.15549	-1.0433	9	0.12103	T	0.63	.	14.0392	0.64665	0.0:0.8154:0.0:0.1846	.	4514	Q8WZ42-6	.	S	4514	ENSP00000354117:A4514S	ENSP00000354117:A4514S	A	-	1	0	TTN	179321832	0.000000	0.05858	0.225000	0.23894	0.014000	0.08584	0.313000	0.19415	0.904000	0.36572	-1.119000	0.02030	GCA		0.323	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		6	44	1	0	8.12818e-05	8.12818e-05	0.00104474	6	44				
ORC2	4999	broad.mit.edu	37	2	201822819	201822819	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:201822819T>A	ENST00000234296.2	-	3	277	c.28A>T	c.(28-30)Aag>Tag	p.K10*	ORC2_ENST00000467605.1_Intron	NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	10					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						TCCAGCATCTTGTCTTCCTTT	0.343																																							uc002uwr.2		NA																	0					0						c.(28-30)AAG>TAG		origin recognition complex, subunit 2							173.0	149.0	157.0					2																	201822819		2203	4299	6502	SO:0001587	stop_gained	4999				cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding	g.chr2:201822819T>A		CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.28A>T	2.37:g.201822819T>A	ENSP00000234296:p.Lys10*					ORC2L_uc010zhj.1_Nonsense_Mutation_p.K10*	p.K10*	NM_006190	NP_006181	Q13416	ORC2_HUMAN			3	285	-			10					Q13204|Q53TX5	Nonsense_Mutation	SNP	ENST00000234296.2	37	c.28A>T	CCDS2334.1	.	.	.	.	.	.	.	.	.	.	T	36	5.788832	0.96945	.	.	ENSG00000115942	ENST00000234296;ENST00000410039;ENST00000457595	.	.	.	6.01	4.83	0.62350	.	0.467666	0.24350	N	0.039291	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.158	10.2015	0.43087	0.0:0.0:0.167:0.833	.	.	.	.	X	10	.	ENSP00000234296:K10X	K	-	1	0	ORC2	201531064	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	3.060000	0.49955	1.058000	0.40530	0.533000	0.62120	AAG		0.343	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2	NM_006190		6	63	0	0	0	8.12818e-05	0	6	63				
ADAM23	8745	broad.mit.edu	37	2	207426992	207426992	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:207426992A>T	ENST00000264377.3	+	13	1648	c.1320A>T	c.(1318-1320)caA>caT	p.Q440H	ADAM23_ENST00000374415.3_Missense_Mutation_p.Q440H|ADAM23_ENST00000374416.1_Missense_Mutation_p.Q440H	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	440	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		TTGGAATCCAATGGGAACCTT	0.413																																					Melanoma(194;1127 2130 19620 24042 27855)	Melanoma(194;1127 2130 19620 24042 27855)	uc002vbq.2		NA																	0				skin(2)|ovary(1)	3						c.(1318-1320)CAA>CAT		ADAM metallopeptidase domain 23 preproprotein							204.0	201.0	202.0					2																	207426992		2203	4300	6503	SO:0001583	missense	8745				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr2:207426992A>T	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1320A>T	2.37:g.207426992A>T	ENSP00000264377:p.Gln440His					ADAM23_uc010ziv.1_RNA	p.Q440H	NM_003812	NP_003803	O75077	ADA23_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)	13	1543	+			440			Peptidase M12B.|Extracellular (Potential).		A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	c.1320A>T	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	A	11.00	1.510323	0.27036	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.63913	-0.07;-0.07;-0.07	5.83	-2.26	0.06867	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.56097	D	0.000024	T	0.54806	0.1881	L	0.55213	1.73	0.58432	D	0.999994	B	0.30793	0.295	B	0.37304	0.246	T	0.47686	-0.9098	10	0.15499	T	0.54	.	14.1285	0.65238	0.3374:0.0:0.6626:0.0	.	440	O75077	ADA23_HUMAN	H	440;440;334;440	ENSP00000264377:Q440H;ENSP00000363537:Q440H;ENSP00000363536:Q440H	ENSP00000264377:Q440H	Q	+	3	2	ADAM23	207135237	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	1.693000	0.37742	-0.311000	0.08754	-1.024000	0.02432	CAA		0.413	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812		41	138	0	0	0	0.000374591	0	41	138				
SMARCAL1	50485	broad.mit.edu	37	2	217303159	217303159	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:217303159T>A	ENST00000357276.4	+	10	1991	c.1661T>A	c.(1660-1662)cTc>cAc	p.L554H	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.L554H	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	554	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		TCTCACTTCCTCAAAAACAGT	0.468									Schimke Immuno-Osseous Dysplasia																														uc002vgc.3		NA																	0				ovary(3)|breast(3)|skin(1)	7						c.(1660-1662)CTC>CAC		SWI/SNF-related matrix-associated							104.0	91.0	96.0					2																	217303159		2203	4300	6503	SO:0001583	missense	50485	Schimke_Immuno-Osseous_Dysplasia	Familial Cancer Database	SIOD	chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity	g.chr2:217303159T>A	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.1661T>A	2.37:g.217303159T>A	ENSP00000349823:p.Leu554His					SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.L554H|SMARCAL1_uc010fvg.2_Intron	p.L554H	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)	10	1991	+		Renal(323;0.0458)	554			Helicase ATP-binding.		A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	c.1661T>A	CCDS2403.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.4|22.4	4.283083|4.283083	0.80803|0.80803	.|.	.|.	ENSG00000138375|ENSG00000138375	ENST00000357276;ENST00000358207|ENST00000445153	D;D|.	0.95482|.	-3.72;-3.72|.	4.84|4.84	4.84|4.84	0.62591|0.62591	DEAD-like helicase (2);SNF2-related (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87229|0.87229	0.6125|0.6125	H|H	0.96970|0.96970	3.915|3.915	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.91193|0.91193	0.4985|0.4985	10|5	0.87932|.	D|.	0|.	-18.2438|-18.2438	13.6754|13.6754	0.62451|0.62451	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	554|.	Q9NZC9|.	SMAL1_HUMAN|.	H|T	554|112	ENSP00000349823:L554H;ENSP00000350940:L554H|.	ENSP00000349823:L554H|.	L|S	+|+	2|1	0|0	SMARCAL1|SMARCAL1	217011404|217011404	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	6.670000|6.670000	0.74467|0.74467	2.155000|2.155000	0.67459|0.67459	0.459000|0.459000	0.35465|0.35465	CTC|TCA		0.468	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2			6	25	0	0	0	0.000442599	0	6	25				
SAG	6295	broad.mit.edu	37	2	234238166	234238166	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:234238166G>T	ENST00000409110.1	+	9	906	c.676G>T	c.(676-678)Gtg>Ttg	p.V226L	SAG_ENST00000449594.2_Missense_Mutation_p.V92L	NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	226					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		GCCCATCCCTGTGACCGTGAC	0.443																																							uc002vuh.2		NA																	0				ovary(1)	1						c.(676-678)GTG>TTG		S-arrestin							89.0	89.0	89.0					2																	234238166		1898	4127	6025	SO:0001583	missense	6295				rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway		protein phosphatase inhibitor activity	g.chr2:234238166G>T		CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.676G>T	2.37:g.234238166G>T	ENSP00000386444:p.Val226Leu					SAG_uc010zmq.1_Missense_Mutation_p.V92L	p.V226L	NM_000541	NP_000532	P10523	ARRS_HUMAN		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)	9	1064	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)	226					A0FDN6|Q53SV3|Q99858	Missense_Mutation	SNP	ENST00000409110.1	37	c.676G>T	CCDS46545.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622929	0.87460	.	.	ENSG00000130561	ENST00000252857;ENST00000409110;ENST00000449594	T;T	0.08370	3.1;3.1	4.7	4.7	0.59300	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.37544	0.1007	M	0.89840	3.065	0.58432	D	0.999997	D;D	0.76494	0.992;0.999	D;D	0.80764	0.984;0.994	T	0.47548	-0.9109	10	0.87932	D	0	-27.9638	18.1951	0.89818	0.0:0.0:1.0:0.0	.	92;226	B7Z7L5;P10523	.;ARRS_HUMAN	L	226;226;92	ENSP00000386444:V226L;ENSP00000392889:V92L	ENSP00000252857:V226L	V	+	1	0	SAG	233902905	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.464000	0.73534	2.590000	0.87494	0.561000	0.74099	GTG		0.443	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330126.1	NM_000541		12	30	1	0	0.000151284	0.000151284	0.00192359	12	30				
PASK	23178	broad.mit.edu	37	2	242047654	242047654	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:242047654C>G	ENST00000405260.1	-	16	4293	c.3595G>C	c.(3595-3597)Gag>Cag	p.E1199Q	PASK_ENST00000358649.4_Missense_Mutation_p.E1206Q|PASK_ENST00000544142.1_Missense_Mutation_p.E1013Q|PASK_ENST00000234040.4_Missense_Mutation_p.E1199Q|PASK_ENST00000539818.1_Missense_Mutation_p.E983Q|PASK_ENST00000475666.1_5'UTR	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1199	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GGGTTCTCCTCAAAGACCAGC	0.597																																							uc002wao.1		NA																	0				ovary(4)|lung(1)|skin(1)	6						c.(3595-3597)GAG>CAG		PAS domain containing serine/threonine kinase							136.0	116.0	123.0					2																	242047654		2203	4300	6503	SO:0001583	missense	23178				regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity	g.chr2:242047654C>G	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3595G>C	2.37:g.242047654C>G	ENSP00000384016:p.Glu1199Gln					PASK_uc010zol.1_Missense_Mutation_p.E1013Q|PASK_uc010zom.1_Missense_Mutation_p.E1164Q|PASK_uc010fzl.1_Missense_Mutation_p.E1206Q|PASK_uc010zon.1_Missense_Mutation_p.E980Q	p.E1199Q	NM_015148	NP_055963	Q96RG2	PASK_HUMAN		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)	16	3687	-		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)	1199			Protein kinase.		G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	37	c.3595G>C	CCDS2545.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953756	0.53293	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818	T;T;T;T;T	0.39056	1.87;1.87;1.87;1.1;1.87	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.108377	0.40469	N	0.001082	T	0.27731	0.0682	N	0.02721	-0.515	0.37598	D	0.920447	B;B;B;B	0.26041	0.14;0.115;0.115;0.14	B;B;B;B	0.32864	0.154;0.057;0.096;0.154	T	0.30937	-0.9961	10	0.46703	T	0.11	.	19.6451	0.95773	0.0:1.0:0.0:0.0	.	1164;1013;1206;1199	B7Z7R6;F5GYW7;Q96RG2-2;Q96RG2	.;.;.;PASK_HUMAN	Q	1199;1013;1199;1206;983	ENSP00000234040:E1199Q;ENSP00000441374:E1013Q;ENSP00000384016:E1199Q;ENSP00000351475:E1206Q;ENSP00000443083:E983Q	ENSP00000234040:E1199Q	E	-	1	0	PASK	241696327	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	4.340000	0.59328	2.720000	0.93068	0.655000	0.94253	GAG		0.597	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148		6	68	0	0	0	8.12818e-05	0	6	68				
HDLBP	3069	broad.mit.edu	37	2	242203865	242203865	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:242203865G>A	ENST00000391975.1	-	4	459	c.232C>T	c.(232-234)Cag>Tag	p.Q78*	HDLBP_ENST00000427183.2_Nonsense_Mutation_p.Q114*|HDLBP_ENST00000310931.4_Nonsense_Mutation_p.Q78*|HDLBP_ENST00000391976.2_Nonsense_Mutation_p.Q78*	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	78					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		GTTTCTACCTGAGTGATGACA	0.398																																							uc002waz.2		NA																	0				breast(3)|skin(1)	4						c.(232-234)CAG>TAG		high density lipoprotein binding protein							105.0	111.0	109.0					2																	242203865		2203	4300	6503	SO:0001587	stop_gained	3069				cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding	g.chr2:242203865G>A		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.232C>T	2.37:g.242203865G>A	ENSP00000375836:p.Gln78*					HDLBP_uc002wba.2_Nonsense_Mutation_p.Q78*|HDLBP_uc002wbb.2_Nonsense_Mutation_p.Q99*|HDLBP_uc010fzn.1_5'UTR|uc010zoo.1_5'Flank	p.Q78*	NM_203346	NP_976221	Q00341	VIGLN_HUMAN		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)	4	460	-		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)	78					B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Nonsense_Mutation	SNP	ENST00000391975.1	37	c.232C>T	CCDS2547.1	.	.	.	.	.	.	.	.	.	.	G	37	6.276715	0.97435	.	.	ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000422933;ENST00000428482;ENST00000442714;ENST00000452065;ENST00000444092;ENST00000430918;ENST00000441124;ENST00000426343;ENST00000413241;ENST00000423693;ENST00000425989	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-26.6931	19.7012	0.96054	0.0:0.0:1.0:0.0	.	.	.	.	X	78;78;78;114;78;78;78;78;78;78;78;78;78;78;78	.	ENSP00000312042:Q78X	Q	-	1	0	HDLBP	241852538	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	9.787000	0.99055	2.637000	0.89404	0.563000	0.77884	CAG		0.398	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346		25	85	0	0	0	0.00047179	0	25	85				
PLCB1	23236	broad.mit.edu	37	20	8628584	8628584	+	Missense_Mutation	SNP	C	C	A	rs142186851		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr20:8628584C>A	ENST00000338037.6	+	6	529	c.502C>A	c.(502-504)Cgt>Agt	p.R168S	PLCB1_ENST00000378641.3_Missense_Mutation_p.R168S|PLCB1_ENST00000378637.2_Missense_Mutation_p.R168S	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	168					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.R168C(2)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TCCAGAAGGGCGTATTCCTCT	0.348																																							uc002wnb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(502-504)CGT>AGT		phosphoinositide-specific phospholipase C beta 1							92.0	89.0	90.0					20																	8628584		2203	4300	6503	SO:0001583	missense	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8628584C>A	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.502C>A	20.37:g.8628584C>A	ENSP00000338185:p.Arg168Ser					PLCB1_uc010zrb.1_Missense_Mutation_p.R67S|PLCB1_uc010gbv.1_Missense_Mutation_p.R168S|PLCB1_uc002wmz.1_Missense_Mutation_p.R168S|PLCB1_uc002wna.2_Missense_Mutation_p.R168S|PLCB1_uc002wnc.1_Missense_Mutation_p.R67S	p.R168S	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN			6	505	+			168					D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	c.502C>A	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.653078	0.67472	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000404098;ENST00000441163;ENST00000535719	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.89	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.64505	0.2604	M	0.75264	2.295	0.58432	D	0.999996	P;B;D;D	0.76494	0.956;0.426;0.996;0.999	P;B;D;D	0.81914	0.714;0.112;0.918;0.995	T	0.66002	-0.6031	10	0.56958	D	0.05	.	16.0838	0.81023	0.1346:0.8654:0.0:0.0	.	67;168;168;167	B4DRC6;Q9NQ66;Q9NQ66-2;B1AK73	.;PLCB1_HUMAN;.;.	S	168;168;168;167;88;88	ENSP00000367908:R168S;ENSP00000338185:R168S;ENSP00000367904:R168S;ENSP00000384001:R167S	ENSP00000338185:R168S	R	+	1	0	PLCB1	8576584	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.986000	0.56937	2.793000	0.96121	0.561000	0.74099	CGT		0.348	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			9	55	1	0	2.80697e-09	0.000978159	4.17515e-08	9	55				
PLCB4	5332	broad.mit.edu	37	20	9319651	9319651	+	Silent	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr20:9319651C>A	ENST00000378493.1	+	4	351	c.336C>A	c.(334-336)acC>acA	p.T112T	PLCB4_ENST00000414679.2_Silent_p.T112T|PLCB4_ENST00000378473.3_Silent_p.T112T|PLCB4_ENST00000378501.2_Silent_p.T112T|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000278655.4_Silent_p.T112T|PLCB4_ENST00000334005.3_Silent_p.T112T			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	112					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						TTAGTTTTACCTACATGGTGG	0.408																																							uc002wnf.2		NA																	0				skin(11)|ovary(3)|pancreas(1)	15						c.(334-336)ACC>ACA		phospholipase C beta 4 isoform b							126.0	114.0	118.0					20																	9319651		2203	4300	6503	SO:0001819	synonymous_variant	5332				intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity	g.chr20:9319651C>A		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.336C>A	20.37:g.9319651C>A						PLCB4_uc010gbw.1_Silent_p.T112T|PLCB4_uc010gbx.2_Silent_p.T112T|PLCB4_uc002wne.2_Silent_p.T112T	p.T112T	NM_182797	NP_877949	Q15147	PLCB4_HUMAN			6	472	+			112					B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	ENST00000378493.1	37	c.336C>A	CCDS13105.1																																																																																				0.408	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2			5	29	1	0	0.000602214	0.000602214	0.00722963	5	29				
SEL1L2	80343	broad.mit.edu	37	20	13868493	13868493	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr20:13868493A>C	ENST00000284951.5	-	8	741	c.667T>G	c.(667-669)Tac>Gac	p.Y223D	SEL1L2_ENST00000378072.5_Missense_Mutation_p.Y223D|SEL1L2_ENST00000486903.1_5'UTR			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	223						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						AAATATCTGTACCCCTAAAAC	0.313																																							uc010gcf.2		NA																	0				ovary(2)	2						c.(667-669)TAC>GAC		sel-1 suppressor of lin-12-like 2 precursor							130.0	126.0	127.0					20																	13868493		1831	4079	5910	SO:0001583	missense	80343					integral to membrane	binding	g.chr20:13868493A>C	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.667T>G	20.37:g.13868493A>C	ENSP00000284951:p.Tyr223Asp					SEL1L2_uc002woq.3_Missense_Mutation_p.Y84D|SEL1L2_uc010zrl.1_Missense_Mutation_p.Y223D|SEL1L2_uc002wor.2_RNA	p.Y223D	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN			8	749	-			223			Sel1-like 4.|Extracellular (Potential).		B4DXX5	Missense_Mutation	SNP	ENST00000284951.5	37	c.667T>G		.	.	.	.	.	.	.	.	.	.	A	18.62	3.663085	0.67700	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	T;T	0.51071	0.72;0.72	5.69	5.69	0.88448	Tetratricopeptide-like helical (1);	0.000000	0.56097	D	0.000036	T	0.68174	0.2972	M	0.79258	2.445	0.46874	D	0.999233	D;D	0.89917	0.999;1.0	D;D	0.91635	0.995;0.999	T	0.71560	-0.4556	10	0.59425	D	0.04	-5.069	12.349	0.55136	1.0:0.0:0.0:0.0	.	223;223	B4DXX5;Q5TEA6	.;SE1L2_HUMAN	D	223	ENSP00000367312:Y223D;ENSP00000284951:Y223D	ENSP00000284951:Y223D	Y	-	1	0	SEL1L2	13816493	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.050000	0.64251	2.161000	0.67846	0.528000	0.53228	TAC		0.313	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078067.3	NM_025229		7	155	0	0	0	0.000157383	0	7	155				
ITCH	83737	broad.mit.edu	37	20	33026420	33026420	+	Silent	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr20:33026420C>T	ENST00000262650.6	+	9	922	c.786C>T	c.(784-786)ccC>ccT	p.P262P	ITCH_ENST00000374864.4_Silent_p.P221P|ITCH_ENST00000535650.1_Silent_p.P111P|ITCH-AS1_ENST00000454205.1_RNA			Q96J02	ITCH_HUMAN	itchy E3 ubiquitin protein ligase	262	Arg/Pro-rich (PRR domain).				apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of defense response to virus (GO:0050687)|negative regulation of JNK cascade (GO:0046329)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cell growth (GO:0001558)|regulation of protein deubiquitination (GO:0090085)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	CXCR chemokine receptor binding (GO:0045236)|ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(9)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(13)|skin(1)|upper_aerodigestive_tract(1)	36						CACCACCACCCACCCCACGTA	0.438																																							uc010geu.1		NA																	0				breast(4)|lung(1)|central_nervous_system(1)	6						c.(784-786)CCC>CCT		itchy homolog E3 ubiquitin protein ligase							148.0	130.0	136.0					20																	33026420		2203	4300	6503	SO:0001819	synonymous_variant	83737				apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity	g.chr20:33026420C>T	AF095745	CCDS13234.1, CCDS58768.1, CCDS58769.1	20q11.22	2014-09-17	2012-02-23		ENSG00000078747	ENSG00000078747			13890	protein-coding gene	gene with protein product		606409	"""itchy (mouse homolog) E3 ubiquitin protein ligase"", ""itchy E3 ubiquitin protein ligase homolog (mouse)"""			11318614	Standard	NM_001257137		Approved	AIP4	uc010geu.2	Q96J02	OTTHUMG00000032300	ENST00000262650.6:c.786C>T	20.37:g.33026420C>T						ITCH_uc002xak.2_Silent_p.P221P|ITCH_uc010zuj.1_Silent_p.P111P	p.P262P	NM_031483	NP_113671	Q96J02	ITCH_HUMAN			9	978	+			262			Arg/Pro-rich (PRR domain).		A6NEW4|B4E234|E1P5P3|F5H217|O43584|Q5QP37|Q5TEL0|Q96F66|Q9BY75|Q9H451|Q9H4U5	Silent	SNP	ENST00000262650.6	37	c.786C>T	CCDS58768.1																																																																																				0.438	ITCH-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078783.2			8	83	0	0	0	0.000274275	0	8	83				
CTCFL	140690	broad.mit.edu	37	20	56089661	56089661	+	Silent	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr20:56089661C>G	ENST00000608263.1	-	6	1978	c.1317G>C	c.(1315-1317)cgG>cgC	p.R439R	CTCFL_ENST00000608858.1_5'UTR|CTCFL_ENST00000243914.3_Silent_p.R439R|CTCFL_ENST00000422869.2_Silent_p.R439R|CTCFL_ENST00000423479.3_Silent_p.R439R|CTCFL_ENST00000608425.1_Silent_p.R439R|CTCFL_ENST00000609232.1_Silent_p.R439R|CTCFL_ENST00000539382.1_Silent_p.R234R|CTCFL_ENST00000608903.1_Silent_p.R177R|CTCFL_ENST00000432255.2_Intron|CTCFL_ENST00000502686.2_Silent_p.R177R|CTCFL_ENST00000371196.2_Silent_p.R439R|CTCFL_ENST00000433949.3_Silent_p.R234R|CTCFL_ENST00000608440.1_Silent_p.R439R|CTCFL_ENST00000429804.3_Intron	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	439					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GGTCGCTTTTCCGTGCAATGA	0.488											OREG0026065	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010gix.1		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(1315-1317)CGG>CGC		CCCTC-binding factor-like protein							224.0	206.0	212.0					20																	56089661		2203	4300	6503	SO:0001819	synonymous_variant	140690				cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding	g.chr20:56089661C>G		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1317G>C	20.37:g.56089661C>G			OREG0026065	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1012	CTCFL_uc010giw.1_Silent_p.R439R|CTCFL_uc002xym.2_Silent_p.R439R|CTCFL_uc010giz.1_Silent_p.R27R|CTCFL_uc010giy.1_Silent_p.R109R|CTCFL_uc010gja.1_Intron|CTCFL_uc010gjb.1_Silent_p.R439R|CTCFL_uc010gjc.1_Silent_p.R439R|CTCFL_uc010gjd.1_Silent_p.R439R|CTCFL_uc010gje.2_Silent_p.R439R|CTCFL_uc010gjf.2_Silent_p.R234R|CTCFL_uc010gjg.2_Silent_p.R171R|CTCFL_uc010gjh.1_Intron|CTCFL_uc010gji.1_Silent_p.R234R|CTCFL_uc010gjj.1_Silent_p.R439R	p.R439R	NM_080618	NP_542185	Q8NI51	CTCFL_HUMAN	BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)		6	1979	-	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		439			C2H2-type 7.		A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Silent	SNP	ENST00000608263.1	37	c.1317G>C	CCDS13459.1																																																																																				0.488	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618		15	178	0	0	0	0.00074312	0	15	178				
DYRK1A	1859	broad.mit.edu	37	21	38853104	38853104	+	Missense_Mutation	SNP	G	G	T	rs1049775		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr21:38853104G>T	ENST00000398960.2	+	4	567	c.492G>T	c.(490-492)ttG>ttT	p.L164F	DYRK1A_ENST00000451934.1_Missense_Mutation_p.L164F|DYRK1A_ENST00000339659.4_Missense_Mutation_p.L155F|DYRK1A_ENST00000462274.1_3'UTR|DYRK1A_ENST00000398956.2_Missense_Mutation_p.L164F|DYRK1A_ENST00000321219.8_Missense_Mutation_p.L164F|DYRK1A_ENST00000338785.3_Missense_Mutation_p.L164F	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	164	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TTGACTCCTTGATAGGCAAAG	0.348																																					Melanoma(114;464 1602 31203 43785 45765)	Melanoma(114;464 1602 31203 43785 45765)	uc002ywk.2		NA																	0				ovary(2)|lung(1)|breast(1)	4						c.(490-492)TTG>TTT		dual-specificity tyrosine-(Y)-phosphorylation							105.0	106.0	106.0					21																	38853104		2203	4300	6503	SO:0001583	missense	1859				nervous system development|peptidyl-tyrosine phosphorylation|protein autophosphorylation	nuclear speck	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein self-association|protein serine/threonine kinase activity	g.chr21:38853104G>T	U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.492G>T	21.37:g.38853104G>T	ENSP00000381932:p.Leu164Phe					DYRK1A_uc002ywh.1_Missense_Mutation_p.L126F|DYRK1A_uc002ywi.2_Missense_Mutation_p.L164F|DYRK1A_uc002ywj.2_Missense_Mutation_p.L155F|DYRK1A_uc002ywl.2_Missense_Mutation_p.L164F|DYRK1A_uc002ywm.2_Missense_Mutation_p.L164F	p.L164F	NM_001396	NP_001387	Q13627	DYR1A_HUMAN			4	567	+			164			Protein kinase.		O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	ENST00000398960.2	37	c.492G>T	CCDS42925.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294809	0.81025	.	.	ENSG00000157540	ENST00000338785;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956	T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98	5.24	-2.37	0.06643	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.28797	0.0714	L	0.31926	0.97	0.80722	D	1	D;D;D;D;D	0.69078	0.979;0.979;0.997;0.997;0.979	P;P;D;D;P	0.68765	0.847;0.847;0.96;0.933;0.847	T	0.02232	-1.1191	10	0.87932	D	0	.	12.5711	0.56337	0.8327:0.0:0.1673:0.0	.	164;164;164;155;164	Q13627-3;Q13627-4;Q13627;Q13627-2;Q13627-5	.;.;DYR1A_HUMAN;.;.	F	164;155;164;164;164;164	ENSP00000342690:L164F;ENSP00000340373:L155F;ENSP00000319032:L164F;ENSP00000416089:L164F;ENSP00000381932:L164F;ENSP00000381929:L164F	ENSP00000319032:L164F	L	+	3	2	DYRK1A	37774974	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	0.801000	0.27055	-0.290000	0.09025	0.655000	0.94253	TTG		0.348	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194804.1	NM_001396		10	66	1	0	1.61879e-10	0.00010058	2.46996e-09	10	66				
ITGB2	3689	broad.mit.edu	37	21	46314930	46314930	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr21:46314930C>G	ENST00000397850.2	-	10	1491	c.1039G>C	c.(1039-1041)Gag>Cag	p.E347Q	ITGB2_ENST00000302347.5_Missense_Mutation_p.E347Q|ITGB2_ENST00000397854.3_Missense_Mutation_p.E290Q|ITGB2_ENST00000355153.4_Missense_Mutation_p.E347Q|ITGB2_ENST00000397852.1_Missense_Mutation_p.E347Q|ITGB2_ENST00000397857.1_Missense_Mutation_p.E347Q			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	347	VWFA.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	CTGGAGTCCTCAGACAGCTCC	0.572																																							uc002zgd.2		NA																	0				ovary(4)|central_nervous_system(3)|breast(2)	9						c.(1039-1041)GAG>CAG		integrin, beta 2 precursor	Simvastatin(DB00641)						129.0	104.0	112.0					21																	46314930		2203	4300	6503	SO:0001583	missense	3689				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity	g.chr21:46314930C>G	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1039G>C	21.37:g.46314930C>G	ENSP00000380948:p.Glu347Gln					ITGB2_uc002zge.2_Missense_Mutation_p.E347Q|ITGB2_uc002zgf.3_Missense_Mutation_p.E347Q|ITGB2_uc011afl.1_Missense_Mutation_p.E269Q|ITGB2_uc010gpw.2_Missense_Mutation_p.E290Q|ITGB2_uc002zgg.2_Missense_Mutation_p.E347Q	p.E347Q	NM_001127491	NP_001120963	P05107	ITB2_HUMAN		Colorectal(79;0.0669)	8	1083	-			347			Extracellular (Potential).|VWFA.		B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	37	c.1039G>C	CCDS13716.1	.	.	.	.	.	.	.	.	.	.	C	5.678	0.309682	0.10733	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347;ENST00000545414	T;T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04	5.28	4.36	0.52297	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	.	.	.	.	T	0.57344	0.2047	L	0.58354	1.805	0.09310	N	1	B;B	0.28026	0.198;0.128	B;B	0.31337	0.128;0.036	T	0.49476	-0.8936	9	0.32370	T	0.25	.	8.6239	0.33877	0.1732:0.6593:0.1675:0.0	.	290;347	A8MYE6;P05107	.;ITB2_HUMAN	Q	347;347;290;347;347;347;290	ENSP00000380950:E347Q;ENSP00000380955:E347Q;ENSP00000380952:E290Q;ENSP00000347279:E347Q;ENSP00000380948:E347Q;ENSP00000303242:E347Q	ENSP00000303242:E347Q	E	-	1	0	ITGB2	45139358	0.098000	0.21812	0.016000	0.15963	0.247000	0.25773	0.800000	0.27042	1.168000	0.42723	0.585000	0.79938	GAG		0.572	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211		4	58	0	0	0	3.59834e-05	0	4	58				
TOM1	10043	broad.mit.edu	37	22	35719782	35719782	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr22:35719782C>T	ENST00000449058.2	+	6	648	c.523C>T	c.(523-525)Caa>Taa	p.Q175*	TOM1_ENST00000447733.1_Nonsense_Mutation_p.Q142*|TOM1_ENST00000436462.2_Nonsense_Mutation_p.Q137*|TOM1_ENST00000411850.1_Nonsense_Mutation_p.Q175*|TOM1_ENST00000382034.5_Nonsense_Mutation_p.Q108*|TOM1_ENST00000425375.1_Nonsense_Mutation_p.Q130*	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	175					endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						CTCAGAGACACAATCAGGACA	0.597																																							uc003ann.2		NA																	0				ovary(1)	1						c.(523-525)CAA>TAA		target of myb1 isoform 1							83.0	76.0	79.0					22																	35719782		2203	4300	6503	SO:0001587	stop_gained	10043				endocytosis|endosome transport|intracellular protein transport	cytosol|early endosome|membrane	protein binding	g.chr22:35719782C>T	AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.523C>T	22.37:g.35719782C>T	ENSP00000394466:p.Gln175*					TOM1_uc011ami.1_Nonsense_Mutation_p.Q142*|TOM1_uc011amj.1_Nonsense_Mutation_p.Q18*|TOM1_uc003ans.2_Nonsense_Mutation_p.Q18*|TOM1_uc011amk.1_Nonsense_Mutation_p.Q137*|TOM1_uc003anp.2_Nonsense_Mutation_p.Q175*|TOM1_uc011aml.1_Nonsense_Mutation_p.Q130*|TOM1_uc003ano.2_RNA|TOM1_uc003anq.2_Nonsense_Mutation_p.Q169*|TOM1_uc003anr.2_Nonsense_Mutation_p.Q18*	p.Q175*	NM_005488	NP_005479	O60784	TOM1_HUMAN			6	648	+			175					B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Nonsense_Mutation	SNP	ENST00000449058.2	37	c.523C>T	CCDS13913.1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.113725	0.37339	.	.	ENSG00000100284	ENST00000447733;ENST00000456128;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000451197;ENST00000436462;ENST00000382034;ENST00000443206	.	.	.	4.74	2.63	0.31362	.	0.821065	0.11138	N	0.595608	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.517	7.2629	0.26214	0.0:0.7006:0.141:0.1584	.	.	.	.	X	142;169;175;175;130;184;137;108;142	.	ENSP00000371465:Q108X	Q	+	1	0	TOM1	34049782	0.000000	0.05858	0.137000	0.22149	0.008000	0.06430	0.140000	0.16056	0.433000	0.26313	-1.147000	0.01851	CAA		0.597	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488		10	54	0	0	0	0.000673444	0	10	54				
FOXRED2	80020	broad.mit.edu	37	22	36886232	36886232	+	Silent	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr22:36886232C>G	ENST00000397224.4	-	9	1971	c.1878G>C	c.(1876-1878)gtG>gtC	p.V626V	FOXRED2_ENST00000397223.4_Silent_p.V626V|FOXRED2_ENST00000366463.3_Silent_p.V178V|FOXRED2_ENST00000216187.6_Silent_p.V626V	NM_001102371.1	NP_001095841.1	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	626					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	flavin adenine dinucleotide binding (GO:0050660)|glycoprotein binding (GO:0001948)|oxidoreductase activity (GO:0016491)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TCTCGGTACTCACGAGTCCCT	0.612																																							uc003apn.3		NA																	0				lung(1)|kidney(1)	2						c.(1876-1878)GTG>GTC		FAD-dependent oxidoreductase domain containing 2							99.0	101.0	100.0					22																	36886232		2203	4300	6503	SO:0001819	synonymous_variant	80020				ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding	g.chr22:36886232C>G	BC027716	CCDS13929.1	22q12.3	2006-07-05			ENSG00000100350	ENSG00000100350			26264	protein-coding gene	gene with protein product		613777				12477932	Standard	NM_024955		Approved	FLJ23322	uc003app.4	Q8IWF2	OTTHUMG00000044614	ENST00000397224.4:c.1878G>C	22.37:g.36886232C>G						FOXRED2_uc003apm.3_Silent_p.V178V|FOXRED2_uc003apo.3_Silent_p.V626V|FOXRED2_uc003app.3_Silent_p.V626V	p.V626V	NM_024955	NP_079231	Q8IWF2	FXRD2_HUMAN			8	1986	-			626					B2RDI4|Q8N378|Q96BD1|Q9H5L5|Q9H6M8	Silent	SNP	ENST00000397224.4	37	c.1878G>C	CCDS13929.1																																																																																				0.612	FOXRED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104098.2	NM_024955		11	135	0	0	0	0.000673444	0	11	135				
TRMU	55687	broad.mit.edu	37	22	46752863	46752863	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr22:46752863A>G	ENST00000290846.4	+	11	1566	c.1226A>G	c.(1225-1227)gAc>gGc	p.D409G	TRMU_ENST00000381019.3_3'UTR	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	409					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		AGCCCCAGTGACAGCCCAGAA	0.642																																							uc003bhp.2		NA																	0				ovary(1)	1						c.(1225-1227)GAC>GGC		tRNA 5-methylaminomethyl-2-thiouridylate							52.0	54.0	53.0					22																	46752863		2203	4300	6503	SO:0001583	missense	55687					mitochondrion	ATP binding|sulfurtransferase activity|tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase activity|tRNA binding	g.chr22:46752863A>G	AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.1226A>G	22.37:g.46752863A>G	ENSP00000290846:p.Asp409Gly					TRMU_uc003bhq.2_Missense_Mutation_p.D191G|TRMU_uc003bhs.2_3'UTR|TRMU_uc003bhr.2_Missense_Mutation_p.D295G|TRMU_uc003bht.2_Missense_Mutation_p.D262G|TRMU_uc003bhu.2_Missense_Mutation_p.D191G|TRMU_uc003bhv.2_3'UTR	p.D409G	NM_018006	NP_060476	O75648	MTU1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)	11	1590	+		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)	409					A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Missense_Mutation	SNP	ENST00000290846.4	37	c.1226A>G	CCDS14075.1	.	.	.	.	.	.	.	.	.	.	A	8.283	0.816005	0.16607	.	.	ENSG00000100416	ENST00000290846	T	0.71579	-0.58	2.52	-2.33	0.06724	.	0.586122	0.13845	U	0.358740	T	0.41305	0.1153	N	0.08118	0	0.09310	N	1	B;B	0.26845	0.161;0.075	B;B	0.27380	0.079;0.027	T	0.30031	-0.9992	10	0.87932	D	0	-10.1767	0.4426	0.00488	0.4297:0.2095:0.1538:0.2069	.	255;409	O75648-4;O75648	.;MTU1_HUMAN	G	409	ENSP00000290846:D409G	ENSP00000290846:D409G	D	+	2	0	TRMU	45131527	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.255000	0.18333	-0.564000	0.06070	0.260000	0.18958	GAC		0.642	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318042.2	NM_018006		3	32	0	0	0	6.4e-05	0	3	32				
CNTN4	152330	broad.mit.edu	37	3	3067833	3067833	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:3067833G>C	ENST00000397461.1	+	14	1918	c.1534G>C	c.(1534-1536)Gga>Cga	p.G512R	CNTN4_ENST00000358480.3_Missense_Mutation_p.G293R|CNTN4_ENST00000448906.2_Missense_Mutation_p.G184R|CNTN4_ENST00000397459.2_Missense_Mutation_p.G184R|CNTN4_ENST00000418658.1_Missense_Mutation_p.G512R|CNTN4_ENST00000427331.1_Missense_Mutation_p.G512R	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	512	Ig-like C2-type 6.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		TGTCACTGTTGGAGAGAGTAT	0.418																																							uc003bpc.2		NA																	0				large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7						c.(1534-1536)GGA>CGA		contactin 4 isoform a precursor							184.0	155.0	165.0					3																	3067833		2203	4300	6503	SO:0001583	missense	152330				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding	g.chr3:3067833G>C	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.1534G>C	3.37:g.3067833G>C	ENSP00000380602:p.Gly512Arg					CNTN4_uc003bpb.1_Missense_Mutation_p.G184R|CNTN4_uc003bpd.1_Missense_Mutation_p.G512R|CNTN4_uc003bpe.2_Missense_Mutation_p.G184R|CNTN4_uc003bpf.2_Missense_Mutation_p.G184R	p.G512R	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)	14	1755	+		Ovarian(110;0.156)	512			Ig-like C2-type 6.		B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	37	c.1534G>C	CCDS43041.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.644456	0.67244	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53	4.99	4.99	0.66335	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83422	0.5251	H	0.98133	4.155	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.90293	0.4324	10	0.87932	D	0	.	18.2793	0.90092	0.0:0.0:1.0:0.0	.	512;512;512	Q8IWV2-3;B3KTK4;Q8IWV2	.;.;CNTN4_HUMAN	R	512;512;512;293;184;184	ENSP00000396010:G512R;ENSP00000380602:G512R;ENSP00000413642:G512R;ENSP00000351267:G293R;ENSP00000380600:G184R;ENSP00000392077:G184R	ENSP00000351267:G293R	G	+	1	0	CNTN4	3042833	1.000000	0.71417	0.977000	0.42913	0.259000	0.26198	9.247000	0.95444	2.301000	0.77427	0.561000	0.74099	GGA		0.418	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2			3	26	0	0	0	6.4e-05	0	3	26				
PLCL2	23228	broad.mit.edu	37	3	17053011	17053011	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:17053011G>T	ENST00000418129.2	+	2	2260	c.1795G>T	c.(1795-1797)Ggc>Tgc	p.G599C	PLCL2_ENST00000432376.1_Missense_Mutation_p.G599C|PLCL2_ENST00000396755.2_Missense_Mutation_p.G599C	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	725					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						CGGAAACTGTGGCTATGTCCT	0.488																																							uc011awc.1		NA																	0				skin(2)|ovary(1)|lung(1)	4						c.(2149-2151)GGC>TGC		phospholipase C-like 2 isoform 1							69.0	70.0	69.0					3																	17053011		2203	4300	6503	SO:0001583	missense	23228				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr3:17053011G>T	AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.1795G>T	3.37:g.17053011G>T	ENSP00000409637:p.Gly599Cys					PLCL2_uc011awd.1_Missense_Mutation_p.G599C	p.G717C	NM_001144382	NP_001137854	Q9UPR0	PLCL2_HUMAN			5	2254	+			725			PI-PLC Y-box.		A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Missense_Mutation	SNP	ENST00000418129.2	37	c.2149G>T	CCDS33713.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543011	0.65198	.	.	ENSG00000154822	ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376	D;D;D	0.87029	-2.2;-2.2;-2.2	4.95	4.95	0.65309	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.000000	0.85682	D	0.000000	D	0.93795	0.8016	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94568	0.7768	9	0.87932	D	0	.	18.5508	0.91063	0.0:0.0:1.0:0.0	.	725	Q9UPR0	PLCL2_HUMAN	C	599;726;599;599	ENSP00000409637:G599C;ENSP00000379979:G599C;ENSP00000412836:G599C	ENSP00000285094:G726C	G	+	1	0	PLCL2	17028015	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.813000	0.99286	2.445000	0.82738	0.555000	0.69702	GGC		0.488	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3			12	45	1	0	9.31168e-06	0.000151284	0.000125126	12	45				
CNOT10	25904	broad.mit.edu	37	3	32754764	32754764	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:32754764A>G	ENST00000328834.5	+	5	792	c.476A>G	c.(475-477)tAt>tGt	p.Y159C	CNOT10_ENST00000538368.1_Intron|CNOT10_ENST00000454516.2_Missense_Mutation_p.Y219C|CNOT10_ENST00000331889.6_Missense_Mutation_p.Y159C	NM_015442.2	NP_056257.1	Q9H9A5	CNO10_HUMAN	CCR4-NOT transcription complex, subunit 10	159					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(3)	23						GTAGACCTGTATATATTAACC	0.353																																							uc003cfc.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(475-477)TAT>TGT		CCR4-NOT transcription complex, subunit 10							110.0	110.0	110.0					3																	32754764		2203	4300	6503	SO:0001583	missense	25904				nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding	g.chr3:32754764A>G	BC002928	CCDS2655.1, CCDS58821.1, CCDS58822.1	3p23	2013-01-10			ENSG00000182973	ENSG00000182973		"""Tetratricopeptide (TTC) repeat domain containing"""	23817	protein-coding gene	gene with protein product							Standard	NR_046352		Approved	FLJ12890, FLJ13165	uc011axj.2	Q9H9A5	OTTHUMG00000130748	ENST00000328834.5:c.476A>G	3.37:g.32754764A>G	ENSP00000330060:p.Tyr159Cys					CNOT10_uc011axi.1_Intron|CNOT10_uc003cfd.1_Missense_Mutation_p.Y158C|CNOT10_uc003cfe.1_Missense_Mutation_p.Y159C|CNOT10_uc010hfv.1_RNA|CNOT10_uc011axj.1_Missense_Mutation_p.Y219C|CNOT10_uc010hfw.1_5'UTR	p.Y159C	NM_015442	NP_056257	Q9H9A5	CNOTA_HUMAN			5	731	+			159					B7Z7L1|F8WAF2|Q9BU30|Q9H5J7|Q9H8X1|Q9H9W0|Q9HAH3|Q9UFJ2	Missense_Mutation	SNP	ENST00000328834.5	37	c.476A>G	CCDS2655.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.050889	0.75960	.	.	ENSG00000182973	ENST00000331889;ENST00000328834;ENST00000540405;ENST00000454516	T;T;T	0.34275	1.4;1.39;1.37	5.28	5.28	0.74379	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.54240	0.1846	L	0.52759	1.655	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.999;0.998	T	0.53486	-0.8432	10	0.46703	T	0.11	-17.7994	15.2061	0.73180	1.0:0.0:0.0:0.0	.	219;159;158;159	F8WAF2;Q9H9A5-3;Q9H9A5-2;Q9H9A5	.;.;.;CNOTA_HUMAN	C	159;159;59;219	ENSP00000329376:Y159C;ENSP00000330060:Y159C;ENSP00000399862:Y219C	ENSP00000330060:Y159C	Y	+	2	0	CNOT10	32729768	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.445000	0.90326	1.980000	0.57719	0.477000	0.44152	TAT		0.353	CNOT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253248.2	NM_015442		6	58	0	0	0	3.59834e-05	0	6	58				
NISCH	11188	broad.mit.edu	37	3	52526236	52526236	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:52526236G>T	ENST00000479054.1	+	22	4325	c.4253G>T	c.(4252-4254)cGa>cTa	p.R1418L	NISCH_ENST00000345716.4_Missense_Mutation_p.R1418L			Q9Y2I1	NISCH_HUMAN	nischarin	1418					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	GACCTGGACCGAGTGCTCATG	0.632																																							uc011beg.1		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(4252-4254)CGA>CTA		nischarin							93.0	92.0	92.0					3																	52526236		2203	4299	6502	SO:0001583	missense	11188				apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity	g.chr3:52526236G>T	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.4253G>T	3.37:g.52526236G>T	ENSP00000418232:p.Arg1418Leu					NISCH_uc003ded.3_Missense_Mutation_p.R1418L|NISCH_uc003dee.3_Missense_Mutation_p.R907L|NISCH_uc003deg.1_Intron|NISCH_uc003deh.3_Missense_Mutation_p.R167L	p.R1418L	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN		BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	22	4325	+			1418					C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	37	c.4253G>T	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.770922	0.90108	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000433196;ENST00000414197	T;T	0.33216	1.42;1.42	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.27697	0.0681	L	0.32530	0.975	0.53005	D	0.999962	P	0.37122	0.583	B	0.33890	0.172	T	0.10086	-1.0645	10	0.87932	D	0	-17.3609	19.116	0.93340	0.0:0.0:1.0:0.0	.	1418	Q9Y2I1	NISCH_HUMAN	L	1418;1418;342;762	ENSP00000418232:R1418L;ENSP00000339958:R1418L	ENSP00000339958:R1418L	R	+	2	0	NISCH	52501276	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	9.090000	0.94144	2.535000	0.85469	0.561000	0.74099	CGA		0.632	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184		20	79	1	0	4.54149e-19	0.000295444	7.25717e-18	20	79				
PRICKLE2	166336	broad.mit.edu	37	3	64084971	64084971	+	Missense_Mutation	SNP	C	C	G	rs546936479		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:64084971C>G	ENST00000295902.6	-	8	2876	c.2291G>C	c.(2290-2292)cGc>cCc	p.R764P	PRICKLE2-AS1_ENST00000476308.1_RNA|PRICKLE2-AS1_ENST00000460946.1_RNA|RP11-129B22.1_ENST00000482609.1_RNA|PRICKLE2_ENST00000564377.1_Missense_Mutation_p.R820P	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	764					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GGGTCCCCAGCGGTCCCCAAA	0.597																																							uc003dmf.2		NA																	0				ovary(4)|skin(1)	5						c.(2290-2292)CGC>CCC		prickle-like 2							59.0	62.0	61.0					3																	64084971		2203	4300	6503	SO:0001583	missense	166336					cytoplasm|nuclear membrane	zinc ion binding	g.chr3:64084971C>G	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.2291G>C	3.37:g.64084971C>G	ENSP00000295902:p.Arg764Pro						p.R764P	NM_198859	NP_942559	Q7Z3G6	PRIC2_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)	8	2877	-		Lung NSC(201;0.136)	764					Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	37	c.2291G>C	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.842973	0.71488	.	.	ENSG00000163637	ENST00000295902	D	0.86432	-2.12	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000005	D	0.91643	0.7359	L	0.49126	1.545	0.58432	D	0.999993	D	0.76494	0.999	D	0.66084	0.941	D	0.91584	0.5281	10	0.62326	D	0.03	-22.3221	19.9066	0.97010	0.0:1.0:0.0:0.0	.	764	Q7Z3G6	PRIC2_HUMAN	P	764	ENSP00000295902:R764P	ENSP00000295902:R764P	R	-	2	0	PRICKLE2	64060011	1.000000	0.71417	0.923000	0.36655	0.839000	0.47603	7.238000	0.78173	2.779000	0.95612	0.655000	0.94253	CGC		0.597	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859		4	29	0	0	0	0.00024832	0	4	29				
ROBO2	6092	broad.mit.edu	37	3	77542452	77542452	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:77542452T>C	ENST00000461745.1	+	5	1625	c.725T>C	c.(724-726)gTa>gCa	p.V242A	ROBO2_ENST00000487694.3_Missense_Mutation_p.V258A|ROBO2_ENST00000332191.8_Missense_Mutation_p.V242A	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	242	Ig-like C2-type 3.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GAAGAAGCTGTAGAATTTCGT	0.408																																							uc003dpy.3		NA																	0				lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(724-726)GTA>GCA		roundabout, axon guidance receptor, homolog 2							135.0	123.0	126.0					3																	77542452		1881	4133	6014	SO:0001583	missense	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77542452T>C	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.725T>C	3.37:g.77542452T>C	ENSP00000417164:p.Val242Ala					ROBO2_uc003dpz.2_Missense_Mutation_p.V242A|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.V242A	p.V242A	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	5	1368	+			242			Ig-like C2-type 3.|Extracellular (Potential).		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	c.725T>C	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.157063	0.38119	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	T;T;T	0.73258	-0.73;-0.73;-0.73	5.88	4.69	0.59074	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.421193	0.16835	N	0.197578	T	0.49167	0.1541	N	0.04132	-0.27	0.41988	D	0.990835	B;B;B	0.21606	0.023;0.058;0.023	B;B;B	0.26770	0.052;0.073;0.052	T	0.53365	-0.8449	9	0.21540	T	0.41	.	12.1685	0.54144	0.0:0.0675:0.0:0.9325	.	258;242;242	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	A	258;258;258;242;242	ENSP00000417335:V258A;ENSP00000417164:V242A;ENSP00000327536:V242A	ENSP00000327536:V242A	V	+	2	0	ROBO2	77625142	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.111000	0.64628	1.012000	0.39366	0.402000	0.26972	GTA		0.408	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		3	37	0	0	0	0.00024832	0	3	37				
CMSS1	84319	broad.mit.edu	37	3	99895214	99895214	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:99895214G>C	ENST00000421999.2	+	9	857	c.711G>C	c.(709-711)tgG>tgC	p.W237C	CMSS1_ENST00000489081.1_Missense_Mutation_p.W219C	NM_032359.3	NP_115735.2	Q9BQ75	CMS1_HUMAN	cms1 ribosomal small subunit homolog (yeast)	237							poly(A) RNA binding (GO:0044822)										TTTTTGACTGGAACTGGAGAG	0.403																																							uc003dtl.2		NA																	0				skin(1)	1						c.(709-711)TGG>TGC		hypothetical protein LOC84319							94.0	95.0	95.0					3																	99895214		2203	4300	6503	SO:0001583	missense	84319						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr3:99895214G>C		CCDS2935.1, CCDS54618.1	3q12.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000184220	ENSG00000184220			28666	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 26"""	C3orf26		12477932	Standard	NM_032359		Approved	MGC4308	uc003dtl.3	Q9BQ75	OTTHUMG00000159054	ENST00000421999.2:c.711G>C	3.37:g.99895214G>C	ENSP00000410396:p.Trp237Cys						p.W237C	NM_032359	NP_115735	Q9BQ75	CC026_HUMAN			9	854	+			237					A8K5S7|B4DUM1|E9PHS3	Missense_Mutation	SNP	ENST00000421999.2	37	c.711G>C	CCDS2935.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667330	0.47677	.	.	ENSG00000184220	ENST00000421999;ENST00000489081;ENST00000478909	T;T;T	0.28895	1.59;1.59;1.59	4.84	4.84	0.62591	.	0.057336	0.85682	D	0.000000	T	0.50973	0.1647	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.44877	-0.9299	9	.	.	.	.	16.8586	0.86012	0.0:0.0:1.0:0.0	.	237	Q9BQ75	CC026_HUMAN	C	237;219;193	ENSP00000410396:W237C;ENSP00000419161:W219C;ENSP00000417293:W193C	.	W	+	3	0	C3orf26	101377904	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	7.994000	0.88315	2.373000	0.80994	0.591000	0.81541	TGG		0.403	CMSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353060.1	NM_032359		3	46	0	0	0	6.4e-05	0	3	46				
CBLB	868	broad.mit.edu	37	3	105459348	105459348	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:105459348T>C	ENST00000264122.4	-	7	1294	c.973A>G	c.(973-975)Agg>Ggg	p.R325G	CBLB_ENST00000403724.1_Missense_Mutation_p.R325G|CBLB_ENST00000405772.1_Missense_Mutation_p.R325G|CBLB_ENST00000394027.3_Missense_Mutation_p.R347G|CBLB_ENST00000545639.1_3'UTR	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	325	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|SH2-like.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						AATCCTTCCCTGCTGCCATCA	0.418			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)	GBM(93;588 1337 9788 29341 43499)	uc003dwc.2		NA		Rec	yes		3	3q13.11	868	Mis S	Cas-Br-M (murine) ecotropic retroviral transforming sequence b			L			AML		0				lung(4)|ovary(3)|breast(1)|skin(1)	9						c.(973-975)AGG>GGG		Cas-Br-M (murine) ecotropic retroviral							136.0	119.0	125.0					3																	105459348		2203	4300	6503	SO:0001583	missense	868				cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding	g.chr3:105459348T>C	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.973A>G	3.37:g.105459348T>C	ENSP00000264122:p.Arg325Gly					CBLB_uc011bhi.1_Missense_Mutation_p.R347G|CBLB_uc003dwd.1_Missense_Mutation_p.R325G|CBLB_uc003dwe.1_Missense_Mutation_p.R325G|CBLB_uc011bhj.1_RNA	p.R325G	NM_170662	NP_733762	Q13191	CBLB_HUMAN			7	1295	-			325			Cbl-PTB.|SH2-like.		A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	ENST00000264122.4	37	c.973A>G	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	T	16.93	3.257908	0.59321	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	5.73	4.57	0.56435	Adaptor protein Cbl, PTB domain (1);SH2 motif (2);Adaptor protein Cbl, SH2-like (1);	0.045393	0.85682	D	0.000000	D	0.88422	0.6432	M	0.75447	2.3	0.80722	D	1	D;D;D	0.71674	0.99;0.99;0.998	P;P;D	0.71870	0.841;0.637;0.975	D	0.89140	0.3516	10	0.87932	D	0	-15.1659	13.5603	0.61784	0.0:0.0:0.4199:0.5801	.	347;325;325	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	G	325;347;325;325	ENSP00000264122:R325G;ENSP00000377595:R347G;ENSP00000384816:R325G;ENSP00000384938:R325G	ENSP00000264122:R325G	R	-	1	2	CBLB	106942038	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.538000	0.23160	0.979000	0.38497	0.528000	0.53228	AGG		0.418	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662		17	70	0	0	0	0.000132079	0	17	70				
GTPBP8	29083	broad.mit.edu	37	3	112710081	112710081	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:112710081G>C	ENST00000383678.2	+	1	317	c.235G>C	c.(235-237)Gcc>Ccc	p.A79P	GTPBP8_ENST00000467752.1_5'Flank|GTPBP8_ENST00000383677.3_Missense_Mutation_p.A79P|GTPBP8_ENST00000473129.1_5'Flank|RP11-484K9.4_ENST00000609673.1_RNA	NM_014170.2	NP_054889.2	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 (putative)	79					barrier septum assembly (GO:0000917)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	6						GGAGGACATAGCCAGGGCGGA	0.632																																							uc003dzn.2		NA																	0					0						c.(235-237)GCC>CCC		GTP-binding protein 8 isoform 1							52.0	50.0	51.0					3																	112710081		2203	4300	6503	SO:0001583	missense	29083				barrier septum formation		GTP binding	g.chr3:112710081G>C	BC037163	CCDS33820.1, CCDS33821.1	3q13.2	2008-02-05			ENSG00000163607	ENSG00000163607			25007	protein-coding gene	gene with protein product							Standard	NM_014170		Approved	HSPC135	uc003dzn.3	Q8N3Z3	OTTHUMG00000159268	ENST00000383678.2:c.235G>C	3.37:g.112710081G>C	ENSP00000373176:p.Ala79Pro					GTPBP8_uc011bhy.1_RNA|GTPBP8_uc003dzp.2_RNA|GTPBP8_uc003dzo.2_Missense_Mutation_p.A79P	p.A79P	NM_014170	NP_054889	Q8N3Z3	GTPB8_HUMAN			1	282	+			79					A6NE99|A6NN11|A8K0P6|Q5I0Y4	Missense_Mutation	SNP	ENST00000383678.2	37	c.235G>C	CCDS33820.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.310902	0.40895	.	.	ENSG00000163607	ENST00000383678;ENST00000383677;ENST00000305485	T;T	0.49432	0.81;0.78	6.17	3.32	0.38043	.	0.664737	0.15785	N	0.244756	T	0.54549	0.1865	M	0.61703	1.905	0.09310	N	0.999994	D;D	0.59357	0.985;0.974	P;P	0.53809	0.735;0.451	T	0.45026	-0.9289	10	0.54805	T	0.06	2.9513	8.9363	0.35702	0.0674:0.0:0.5308:0.4018	.	79;79	Q8N3Z3-2;Q8N3Z3	.;GTPB8_HUMAN	P	79	ENSP00000373176:A79P;ENSP00000373175:A79P	ENSP00000295864:A79P	A	+	1	0	GTPBP8	114192771	0.001000	0.12720	0.002000	0.10522	0.007000	0.05969	0.678000	0.25277	0.416000	0.25844	0.655000	0.94253	GCC		0.632	GTPBP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354260.2	NM_014170		6	43	0	0	0	3.59834e-05	0	6	43				
FSTL1	11167	broad.mit.edu	37	3	120134836	120134836	+	Silent	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:120134836C>A	ENST00000295633.3	-	3	458	c.102G>T	c.(100-102)gtG>gtT	p.V34V	FSTL1_ENST00000424703.2_Intron	NM_007085.4	NP_009016.1	Q12841	FSTL1_HUMAN	follistatin-like 1	34	Follistatin-like.				BMP signaling pathway (GO:0030509)|response to starvation (GO:0042594)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(1)	20				GBM - Glioblastoma multiforme(114;0.189)		CTCCACAAAACACATTGGCAC	0.498																																							uc003eds.2		NA																	0				central_nervous_system(1)	1						c.(100-102)GTG>GTT		follistatin-like 1 precursor							143.0	140.0	141.0					3																	120134836		2203	4300	6503	SO:0001819	synonymous_variant	11167				BMP signaling pathway	extracellular space	calcium ion binding|heparin binding	g.chr3:120134836C>A	U06863	CCDS2998.1	3q13.33	2013-01-10			ENSG00000163430	ENSG00000163430		"""EF-hand domain containing"""	3972	protein-coding gene	gene with protein product		605547				7957230, 9786430	Standard	NM_007085		Approved	FRP, FSL1	uc003eds.3	Q12841	OTTHUMG00000159440	ENST00000295633.3:c.102G>T	3.37:g.120134836C>A						FSTL1_uc011bjh.1_Intron|FSTL1_uc010hrb.2_Silent_p.V34V	p.V34V	NM_007085	NP_009016	Q12841	FSTL1_HUMAN		GBM - Glioblastoma multiforme(114;0.189)	3	277	-			34			Follistatin-like.		A8K523|B4DTT5|D3DN90|Q549Z0	Silent	SNP	ENST00000295633.3	37	c.102G>T	CCDS2998.1	.	.	.	.	.	.	.	.	.	.	C	10.12	1.262149	0.23051	.	.	ENSG00000163430	ENST00000539471	.	.	.	6.17	2.23	0.28157	.	.	.	.	.	T	0.56790	0.2009	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56529	-0.7964	5	0.87932	D	0	-21.252	2.7517	0.05282	0.1844:0.513:0.1043:0.1984	.	.	.	.	F	2	.	ENSP00000438051:C2F	C	-	2	0	FSTL1	121617526	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.544000	0.23253	0.478000	0.27488	0.655000	0.94253	TGT		0.498	FSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355399.1	NM_007085		6	106	1	0	1.12685e-05	0.000274275	0.000148883	6	106				
KCNAB1	7881	broad.mit.edu	37	3	156175289	156175289	+	Silent	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:156175289C>G	ENST00000490337.1	+	4	469	c.405C>G	c.(403-405)ctC>ctG	p.L135L	KCNAB1_ENST00000389636.5_Silent_p.L135L|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000389634.5_Silent_p.L117L|KCNAB1_ENST00000471742.1_Silent_p.L124L|KCNAB1_ENST00000302490.8_Silent_p.L117L	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	135					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GTGTTAACCTCTTTGATACTG	0.468																																							uc003far.2		NA																	0				ovary(3)|skin(1)	4						c.(403-405)CTC>CTG		potassium voltage-gated channel, shaker-related							254.0	220.0	232.0					3																	156175289		2203	4300	6503	SO:0001819	synonymous_variant	7881					cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity	g.chr3:156175289C>G	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.405C>G	3.37:g.156175289C>G						KCNAB1_uc011bon.1_Silent_p.L135L|KCNAB1_uc003fas.2_Silent_p.L124L|KCNAB1_uc003fat.2_Silent_p.L117L|KCNAB1_uc010hvt.1_Silent_p.L117L|KCNAB1_uc011boo.1_Silent_p.L11L	p.L135L	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)		4	469	+			135					A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Silent	SNP	ENST00000490337.1	37	c.405C>G	CCDS3174.1																																																																																				0.468	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471		14	102	0	0	0	0.000566183	0	14	102				
SENP5	205564	broad.mit.edu	37	3	196630482	196630482	+	Splice_Site	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr3:196630482G>A	ENST00000323460.5	+	6	2133		c.e6+1		SENP5_ENST00000445299.2_Splice_Site|SENP5_ENST00000489744.1_Splice_Site|SENP5_ENST00000419026.1_Splice_Site	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5						cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		GACTAAAAAGGTATTCTCTTT	0.328																																					Ovarian(47;891 1095 11174 13858 51271)	Ovarian(47;891 1095 11174 13858 51271)	uc003fwz.3		NA																	0				breast(2)|lung(1)	3						c.e6+1		SUMO1/sentrin specific peptidase 5							96.0	92.0	93.0					3																	196630482		2203	4300	6503	SO:0001630	splice_region_variant	205564				cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity	g.chr3:196630482G>A	BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.1884+1G>A	3.37:g.196630482G>A						SENP5_uc011bty.1_Splice_Site_p.K628_splice	p.K628_splice	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)	6	2133	+	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)							B4DY82|Q96SA5	Splice_Site	SNP	ENST00000323460.5	37	c.1884_splice	CCDS3322.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153647	0.78114	.	.	ENSG00000119231	ENST00000323460;ENST00000445299;ENST00000419026	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0461	0.86504	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SENP5	198114879	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.032000	0.93736	2.689000	0.91719	0.655000	0.94253	.		0.328	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340524.1	NM_152699	Intron	6	53	0	0	0	8.12818e-05	0	6	53				
HS3ST1	9957	broad.mit.edu	37	4	11401343	11401343	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr4:11401343T>A	ENST00000002596.5	-	2	1461	c.287A>T	c.(286-288)tAc>tTc	p.Y96F		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	96					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						GCCGTGGCTGTAATGCTCCTC	0.647																																							uc003gmq.2		NA																	0				skin(1)	1						c.(286-288)TAC>TTC		heparan sulfate D-glucosaminyl							85.0	74.0	77.0					4																	11401343		2203	4300	6503	SO:0001583	missense	9957					Golgi lumen|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity	g.chr4:11401343T>A	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.287A>T	4.37:g.11401343T>A	ENSP00000002596:p.Tyr96Phe						p.Y96F	NM_005114	NP_005105	O14792	HS3S1_HUMAN			2	610	-			96					B3KUA6|Q6PEY8	Missense_Mutation	SNP	ENST00000002596.5	37	c.287A>T	CCDS3408.1	.	.	.	.	.	.	.	.	.	.	T	12.69	2.012377	0.35511	.	.	ENSG00000002587	ENST00000002596	D	0.83075	-1.68	5.81	4.62	0.57501	Sulfotransferase domain (1);	0.195098	0.45867	N	0.000336	T	0.78387	0.4275	L	0.48986	1.54	0.53005	D	0.999963	B	0.27997	0.197	B	0.27500	0.08	T	0.74931	-0.3496	10	0.52906	T	0.07	.	11.621	0.51117	0.1333:0.0:0.0:0.8667	.	96	O14792	HS3S1_HUMAN	F	96	ENSP00000002596:Y96F	ENSP00000002596:Y96F	Y	-	2	0	HS3ST1	11010441	1.000000	0.71417	0.716000	0.30569	0.466000	0.32739	3.945000	0.56637	1.009000	0.39289	0.533000	0.62120	TAC		0.647	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207073.3	NM_005114		16	66	0	0	0	0.00074312	0	16	66				
TEC	7006	broad.mit.edu	37	4	48178124	48178124	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr4:48178124G>T	ENST00000381501.3	-	3	375	c.218C>A	c.(217-219)cCc>cAc	p.P73H		NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	73	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						ATTTTGACAGGGAATGACACC	0.373																																							uc003gxz.2		NA																	0				lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9						c.(217-219)CCC>CAC		tec protein tyrosine kinase							205.0	184.0	191.0					4																	48178124		2203	4300	6503	SO:0001583	missense	7006				intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr4:48178124G>T	D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.218C>A	4.37:g.48178124G>T	ENSP00000370912:p.Pro73His						p.P73H	NM_003215	NP_003206	P42680	TEC_HUMAN			3	309	-			73			PH.		B7ZKZ6|Q3MIS5	Missense_Mutation	SNP	ENST00000381501.3	37	c.218C>A	CCDS3481.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432500	0.62844	.	.	ENSG00000135605	ENST00000381501	T	0.76186	-1.0	5.42	5.42	0.78866	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.87884	0.6290	M	0.84326	2.69	0.54753	D	0.999984	D	0.89917	1.0	D	0.97110	1.0	D	0.89311	0.3633	10	0.87932	D	0	.	19.1992	0.93704	0.0:0.0:1.0:0.0	.	73	P42680	TEC_HUMAN	H	73	ENSP00000370912:P73H	ENSP00000370912:P73H	P	-	2	0	TEC	47872881	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	8.105000	0.89553	2.530000	0.85305	0.579000	0.79373	CCC		0.373	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250492.3			22	109	1	0	1.64113e-05	0.000175454	0.000213257	22	109				
KIAA0922	23240	broad.mit.edu	37	4	154547372	154547372	+	Silent	SNP	T	T	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr4:154547372T>C	ENST00000409663.3	+	30	4168	c.4116T>C	c.(4114-4116)aaT>aaC	p.N1372N	KIAA0922_ENST00000440693.1_Silent_p.N1289N|KIAA0922_ENST00000409959.3_Silent_p.N1373N	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1372						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				ACATCTGCAATCCCATGTAAG	0.343																																							uc003inm.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(4114-4116)AAT>AAC		hypothetical protein LOC23240 isoform 2							206.0	216.0	212.0					4																	154547372		2203	4299	6502	SO:0001819	synonymous_variant	23240					integral to membrane		g.chr4:154547372T>C	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.4116T>C	4.37:g.154547372T>C						KIAA0922_uc010ipp.2_Silent_p.N1373N|KIAA0922_uc010ipq.2_Silent_p.N1141N	p.N1372N	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN			30	4168	+	all_hematologic(180;0.093)	Renal(120;0.118)	1372			Cytoplasmic (Potential).		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Silent	SNP	ENST00000409663.3	37	c.4116T>C	CCDS3783.2																																																																																				0.343	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196		3	49	0	0	0	0.000602214	0	3	49				
FNIP2	57600	broad.mit.edu	37	4	159772518	159772518	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr4:159772518C>G	ENST00000264433.6	+	8	848	c.773C>G	c.(772-774)tCc>tGc	p.S258C	FNIP2_ENST00000379346.3_Missense_Mutation_p.S281C	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	258	Ser-rich.				intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TCTCCAAGCTCCTCTACATCT	0.448																																							uc003iqe.3		NA																	0					0						c.(772-774)TCC>TGC		folliculin interacting protein 2							322.0	320.0	321.0					4																	159772518		1898	4116	6014	SO:0001583	missense	57600				DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding	g.chr4:159772518C>G	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.773C>G	4.37:g.159772518C>G	ENSP00000264433:p.Ser258Cys						p.S258C	NM_020840	NP_065891	Q9P278	FNIP2_HUMAN		COAD - Colon adenocarcinoma(41;0.00936)	8	956	+	all_hematologic(180;0.24)		258			Ser-rich.		Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	37	c.773C>G	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.629391	0.87660	.	.	ENSG00000052795	ENST00000264433;ENST00000512986;ENST00000379346;ENST00000504715	T;T;T;T	0.41758	1.53;1.57;1.52;0.99	5.32	5.32	0.75619	.	.	.	.	.	T	0.64649	0.2617	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	T	0.64193	-0.6465	8	.	.	.	.	19.0001	0.92830	0.0:1.0:0.0:0.0	.	258	Q9P278	FNIP2_HUMAN	C	258;281;281;123	ENSP00000264433:S258C;ENSP00000421488:S281C;ENSP00000368651:S281C;ENSP00000420841:S123C	.	S	+	2	0	FNIP2	159991968	1.000000	0.71417	0.986000	0.45419	0.977000	0.68977	5.859000	0.69539	2.476000	0.83614	0.655000	0.94253	TCC		0.448	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840		39	359	0	0	0	0.000509022	0	39	359				
IRX1	79192	broad.mit.edu	37	5	3600760	3600760	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr5:3600760G>T	ENST00000302006.3	+	3	1402	c.1350G>T	c.(1348-1350)caG>caT	p.Q450H	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	450					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CGCCGGCACAGCAGTTAAAGT	0.627																																							uc003jde.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1348-1350)CAG>CAT		iroquois homeobox protein 1							51.0	55.0	54.0					5																	3600760		2203	4300	6503	SO:0001583	missense	79192					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:3600760G>T	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1350G>T	5.37:g.3600760G>T	ENSP00000305244:p.Gln450His						p.Q450H	NM_024337	NP_077313	P78414	IRX1_HUMAN			3	1402	+			450					Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	37	c.1350G>T	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	G	9.287	1.049727	0.19827	.	.	ENSG00000170549	ENST00000302006	T	0.60040	0.22	4.45	2.62	0.31277	.	0.183542	0.48767	D	0.000171	T	0.55513	0.1925	L	0.57536	1.79	0.42333	D	0.992309	P	0.43094	0.799	P	0.45946	0.498	T	0.49835	-0.8897	10	0.34782	T	0.22	.	9.2641	0.37630	0.1702:0.0:0.8298:0.0	.	450	P78414	IRX1_HUMAN	H	450	ENSP00000305244:Q450H	ENSP00000305244:Q450H	Q	+	3	2	IRX1	3653760	1.000000	0.71417	0.823000	0.32752	0.021000	0.10359	1.808000	0.38912	0.298000	0.22638	0.563000	0.77884	CAG		0.627	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337		9	64	1	0	1.33987e-11	0.000673444	2.05766e-10	9	64				
AMACR	23600	broad.mit.edu	37	5	33989575	33989575	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr5:33989575G>C	ENST00000335606.6	-	5	860	c.772C>G	c.(772-774)Cag>Gag	p.Q258E	AMACR_ENST00000382085.3_Missense_Mutation_p.Q258E|RP11-1084J3.4_ENST00000382079.3_3'UTR|AMACR_ENST00000502637.1_Missense_Mutation_p.Q243E|AMACR_ENST00000514195.1_5'UTR|AMACR_ENST00000382072.2_3'UTR	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	258					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)			endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						ATGCTCATCTGATTGGGAAGT	0.368																																							uc003jig.2		NA																	0					0						c.(772-774)CAG>GAG		alpha-methylacyl-CoA racemase isoform 1							54.0	55.0	54.0					5																	33989575		2203	4300	6503	SO:0001583	missense	23600				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	mitochondrion|peroxisomal matrix	alpha-methylacyl-CoA racemase activity	g.chr5:33989575G>C	AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.772C>G	5.37:g.33989575G>C	ENSP00000334424:p.Gln258Glu					AMACR_uc003jih.2_3'UTR|AMACR_uc003jii.2_Missense_Mutation_p.Q243E|AMACR_uc003jij.2_Missense_Mutation_p.Q258E	p.Q258E	NM_014324	NP_055139	Q9UHK6	AMACR_HUMAN			5	854	-			258					A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Missense_Mutation	SNP	ENST00000335606.6	37	c.772C>G	CCDS3902.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.652058	0.67472	.	.	ENSG00000242110	ENST00000335606;ENST00000382085;ENST00000502637	T;T;T	0.51325	0.71;0.71;0.71	5.84	5.84	0.93424	CoA-transferase family III domain (2);	0.104929	0.64402	D	0.000002	T	0.72566	0.3476	M	0.80028	2.48	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.997	D;D;D	0.72075	0.976;0.968;0.91	T	0.73824	-0.3861	10	0.72032	D	0.01	-30.1348	20.5224	0.99228	0.0:0.0:1.0:0.0	.	258;243;258	F8W9N1;D6RB81;Q9UHK6	.;.;AMACR_HUMAN	E	258;258;243	ENSP00000334424:Q258E;ENSP00000371517:Q258E;ENSP00000424351:Q243E	ENSP00000334424:Q258E	Q	-	1	0	AMACR	34025332	1.000000	0.71417	0.975000	0.42487	0.207000	0.24258	9.446000	0.97590	2.927000	0.99377	0.637000	0.83480	CAG		0.368	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207467.1	NM_014324		3	52	0	0	0	6.4e-05	0	3	52				
OXCT1	5019	broad.mit.edu	37	5	41862832	41862832	+	Silent	SNP	G	G	A	rs182901792		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr5:41862832G>A	ENST00000196371.5	-	2	259	c.99C>T	c.(97-99)tcC>tcT	p.S33S		NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	33					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	GAGCACTGGTGGAAAAGGAAC	0.368																																							uc003jmn.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(97-99)TCC>TCT		3-oxoacid CoA transferase 1 precursor	Succinic acid(DB00139)						101.0	93.0	96.0					5																	41862832		2203	4300	6503	SO:0001819	synonymous_variant	5019				cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity	g.chr5:41862832G>A	U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.99C>T	5.37:g.41862832G>A							p.S33S	NM_000436	NP_000427	P55809	SCOT1_HUMAN			2	430	-			33					B2R5V2|B7Z528	Silent	SNP	ENST00000196371.5	37	c.99C>T	CCDS3937.1																																																																																				0.368	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436		9	73	0	0	0	0.000442599	0	9	73				
GPR98	84059	broad.mit.edu	37	5	90124896	90124896	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr5:90124896G>T	ENST00000405460.2	+	77	16600	c.16504G>T	c.(16504-16506)Gtg>Ttg	p.V5502L	GPR98_ENST00000425867.2_Missense_Mutation_p.V1163L	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5502					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTATTTTTCTGTGGGTTCTCG	0.438																																							uc003kju.2		NA																	0				ovary(11)|central_nervous_system(3)|pancreas(2)	16						c.(16504-16506)GTG>TTG		G protein-coupled receptor 98 precursor							166.0	162.0	163.0					5																	90124896		1870	4090	5960	SO:0001583	missense	84059				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr5:90124896G>T	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.16504G>T	5.37:g.90124896G>T	ENSP00000384582:p.Val5502Leu					GPR98_uc003kjt.2_Missense_Mutation_p.V3208L|GPR98_uc003kjw.2_Missense_Mutation_p.V1163L	p.V5502L	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)	77	16600	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	5502			Extracellular (Potential).		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	c.16504G>T	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073637	0.76415	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.26810	1.71;1.71	5.81	4.94	0.65067	.	0.249192	0.39687	N	0.001285	T	0.29321	0.0730	M	0.61703	1.905	0.52501	D	0.999956	P;B;P	0.39352	0.539;0.214;0.669	B;B;B	0.38880	0.147;0.087;0.284	T	0.04178	-1.0971	9	.	.	.	.	14.6346	0.68680	0.0694:0.0:0.9306:0.0	.	1163;5502;1163	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	L	5502;5502;1163	ENSP00000384582:V5502L;ENSP00000392618:V1163L	.	V	+	1	0	GPR98	90160652	1.000000	0.71417	0.999000	0.59377	0.923000	0.55619	4.979000	0.63806	1.455000	0.47813	0.655000	0.94253	GTG		0.438	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		6	74	1	0	5.9392e-07	3.59834e-05	8.36084e-06	6	74				
PCDHGB4	8641	broad.mit.edu	37	5	140769504	140769504	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr5:140769504G>C	ENST00000519479.1	+	1	2053	c.2053G>C	c.(2053-2055)Gag>Cag	p.E685Q	PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_5'Flank|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	685					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTCCAGGCTGAGCTGCAGTT	0.617																																							uc003lkc.1		NA																	0					0						c.(2053-2055)GAG>CAG		protocadherin gamma subfamily B, 4 isoform 1							143.0	155.0	151.0					5																	140769504		2140	4236	6376	SO:0001583	missense	8641				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140769504G>C	AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.2053G>C	5.37:g.140769504G>C	ENSP00000428288:p.Glu685Gln					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.E685Q	p.E685Q	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2053	+			685			Extracellular (Potential).		O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	ENST00000519479.1	37	c.2053G>C	CCDS54928.1	.	.	.	.	.	.	.	.	.	.	.	14.23	2.474740	0.43942	.	.	ENSG00000253953	ENST00000519479	T	0.46451	0.87	5.4	5.4	0.78164	.	.	.	.	.	T	0.60637	0.2284	M	0.88704	2.975	0.25196	N	0.9901	P;P	0.42941	0.794;0.568	P;B	0.48952	0.596;0.21	T	0.61048	-0.7141	9	0.72032	D	0.01	.	12.2149	0.54400	0.0785:0.0:0.9215:0.0	.	685;685	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	Q	685	ENSP00000428288:E685Q	ENSP00000428288:E685Q	E	+	1	0	PCDHGB4	140749688	0.626000	0.27120	0.950000	0.38849	0.374000	0.29953	2.217000	0.42880	2.536000	0.85505	0.563000	0.77884	GAG		0.617	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736		8	130	0	0	0	0.000274275	0	8	130				
NHP2	55651	broad.mit.edu	37	5	177580545	177580545	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr5:177580545C>G	ENST00000274606.3	-	2	326	c.177G>C	c.(175-177)caG>caC	p.Q59H	NHP2_ENST00000314397.4_Missense_Mutation_p.Q59H	NM_017838.3	NP_060308.1	Q9NX24	NHP2_HUMAN	NHP2 ribonucleoprotein	59					rRNA pseudouridine synthesis (GO:0031118)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			endometrium(1)|kidney(1)|ovary(2)	4						CGCGCCGAATCTGCTTCTGCT	0.572																																							uc003mir.2		NA																	0					0						c.(175-177)CAG>CAC		nucleolar protein family A, member 2 isoform a							94.0	111.0	105.0					5																	177580545		2203	4300	6503	SO:0001583	missense	55651				rRNA pseudouridine synthesis	Cajal body|nucleolus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding	g.chr5:177580545C>G	AF161404	CCDS4432.1, CCDS34308.1	5q35.3	2014-09-17	2012-12-10	2008-10-13	ENSG00000145912	ENSG00000145912			14377	protein-coding gene	gene with protein product		606470	"""nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs)"", ""NHP2 ribonucleoprotein homolog (yeast)"""	NOLA2		11074001	Standard	NM_017838		Approved	FLJ20479	uc003mir.2	Q9NX24	OTTHUMG00000130886	ENST00000274606.3:c.177G>C	5.37:g.177580545C>G	ENSP00000274606:p.Gln59His					NHP2_uc003mis.2_Missense_Mutation_p.Q59H	p.Q59H	NM_017838	NP_060308	Q9NX24	NHP2_HUMAN			2	320	-			59					A6NKY8|Q9P095	Missense_Mutation	SNP	ENST00000274606.3	37	c.177G>C	CCDS4432.1	.	.	.	.	.	.	.	.	.	.	c	17.24	3.340138	0.60963	.	.	ENSG00000145912	ENST00000274606;ENST00000314397;ENST00000502263;ENST00000514354;ENST00000511078	T;T;T;T;T	0.58797	0.31;0.31;0.31;0.31;0.31	5.07	5.07	0.68467	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.229252	0.45867	D	0.000324	T	0.62575	0.2439	L	0.43923	1.385	0.43010	D	0.994544	D;P	0.60160	0.987;0.927	P;P	0.60789	0.879;0.77	T	0.59364	-0.7468	10	0.29301	T	0.29	-0.6275	11.1119	0.48237	0.1845:0.8154:0.0:0.0	.	59;59	D6RC52;Q9NX24	.;NHP2_HUMAN	H	59;59;12;59;59	ENSP00000274606:Q59H;ENSP00000366276:Q59H;ENSP00000431126:Q12H;ENSP00000423803:Q59H;ENSP00000423849:Q59H	ENSP00000274606:Q59H	Q	-	3	2	NHP2	177513151	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.588000	0.46137	2.343000	0.79666	0.561000	0.74099	CAG		0.572	NHP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253471.1	NM_017838		10	125	0	0	0	0.000673444	0	10	125				
F13A1	2162	broad.mit.edu	37	6	6182302	6182302	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr6:6182302G>T	ENST00000264870.3	-	11	1643	c.1378C>A	c.(1378-1380)Cac>Aac	p.H460N		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	460					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	TTCCCAATGTGGGTGGCATCC	0.413																																							uc003mwv.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6						c.(1378-1380)CAC>AAC		coagulation factor XIII A1 subunit precursor	L-Glutamine(DB00130)						152.0	133.0	139.0					6																	6182302		2203	4300	6503	SO:0001583	missense	2162				peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr6:6182302G>T	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1378C>A	6.37:g.6182302G>T	ENSP00000264870:p.His460Asn					F13A1_uc011dib.1_Missense_Mutation_p.H397N	p.H460N	NM_000129	NP_000120	P00488	F13A_HUMAN			11	1501	-	Ovarian(93;0.0816)	all_hematologic(90;0.152)	460					Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	c.1378C>A	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835121	0.50951	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.78595	-1.19	5.12	4.24	0.50183	.	0.105175	0.64402	D	0.000004	T	0.79616	0.4476	M	0.72894	2.215	0.48901	D	0.999722	P;D	0.71674	0.921;0.998	P;P	0.62184	0.697;0.899	T	0.78344	-0.2240	10	0.28530	T	0.3	.	13.286	0.60243	0.0777:0.0:0.9223:0.0	.	397;460	F5H080;P00488	.;F13A_HUMAN	N	460;397	ENSP00000264870:H460N	ENSP00000264870:H460N	H	-	1	0	F13A1	6127301	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	5.141000	0.64814	1.269000	0.44280	0.563000	0.77884	CAC		0.413	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129		11	51	1	0	0.000151284	0.000151284	0.00192359	11	51				
PPP1R10	5514	broad.mit.edu	37	6	30570127	30570127	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr6:30570127G>T	ENST00000376511.2	-	19	2851	c.2299C>A	c.(2299-2301)Cat>Aat	p.H767N		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	767	Gly-rich.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						TGGGGACGATGTCCACTGCTG	0.672																																							uc003nqn.1		NA																	0				ovary(2)|lung(1)|kidney(1)	4						c.(2299-2301)CAT>AAT		protein phosphatase 1, regulatory subunit 10							148.0	158.0	154.0					6																	30570127		1510	2709	4219	SO:0001583	missense	5514				protein import into nucleus|transcription, DNA-dependent	PTW/PP1 phosphatase complex	DNA binding|protein phosphatase inhibitor activity|RNA binding|zinc ion binding	g.chr6:30570127G>T	Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.2299C>A	6.37:g.30570127G>T	ENSP00000365694:p.His767Asn					PPP1R10_uc010jsc.1_Missense_Mutation_p.H421N	p.H767N	NM_002714	NP_002705	Q96QC0	PP1RA_HUMAN			19	2851	-			767			Gly-rich.		O00405	Missense_Mutation	SNP	ENST00000376511.2	37	c.2299C>A	CCDS4681.1	.	.	.	.	.	.	.	.	.	.	G	5.472	0.272053	0.10349	.	.	ENSG00000204569	ENST00000376511	T	0.47528	0.84	3.17	3.17	0.36434	.	0.205390	0.34959	N	0.003558	T	0.08447	0.0210	N	0.08118	0	0.33572	D	0.598791	P	0.43477	0.808	B	0.30179	0.112	T	0.08932	-1.0698	10	0.15952	T	0.53	-11.3713	10.4456	0.44493	0.0:0.2005:0.7995:0.0	.	767	Q96QC0	PP1RA_HUMAN	N	767	ENSP00000365694:H767N	ENSP00000365694:H767N	H	-	1	0	PPP1R10	30678106	0.224000	0.23674	1.000000	0.80357	0.546000	0.35178	1.669000	0.37492	2.100000	0.63781	0.485000	0.47835	CAT		0.672	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076556.2	NM_002714		16	109	1	0	4.14922e-12	0.000422831	6.45585e-11	16	109				
GUCA1A	2978	broad.mit.edu	37	6	42146104	42146104	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr6:42146104C>G	ENST00000394237.1	+	4	1264	c.288C>G	c.(286-288)ttC>ttG	p.F96L	GUCA1A_ENST00000053469.4_Missense_Mutation_p.F96L|GUCA1A_ENST00000372958.1_Missense_Mutation_p.F96L|GUCA1A_ENST00000541991.1_Missense_Mutation_p.F96L			P43080	GUC1A_HUMAN	guanylate cyclase activator 1A (retina)	96	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				phototransduction, visible light (GO:0007603)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;5.54e-05)|Epithelial(12;0.000167)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GCTGGTACTTCAAGCTCTATG	0.607																																							uc003orx.2		NA																	0					0						c.(286-288)TTC>TTG		guanylate cyclase activator 1A (retina)							128.0	119.0	122.0					6																	42146104		2203	4300	6503	SO:0001583	missense	2978				signal transduction|visual perception	membrane	calcium ion binding|calcium sensitive guanylate cyclase activator activity	g.chr6:42146104C>G		CCDS4864.1	6p21.1	2013-06-06			ENSG00000048545	ENSG00000048545		"""EF-hand domain containing"""	4678	protein-coding gene	gene with protein product	"""cone dystrophy 3"""	600364	"""chromosome 6 open reading frame 131"""	GUCA, GUCA1, C6orf131		9425234	Standard	NM_000409		Approved	GCAP, GCAP1, COD3, dJ139D8.6, CORD14	uc003orx.3	P43080	OTTHUMG00000014696	ENST00000394237.1:c.288C>G	6.37:g.42146104C>G	ENSP00000377784:p.Phe96Leu					GUCA1A_uc011duo.1_RNA|GUCA1A_uc010jxt.2_Missense_Mutation_p.F96L	p.F96L	NM_000409	NP_000400	P43080	GUC1A_HUMAN	STAD - Stomach adenocarcinoma(11;5.54e-05)|Epithelial(12;0.000167)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)		4	933	+	Colorectal(47;0.196)		96			EF-hand 3.		B3KWT4|Q7Z6T1|Q9NU14	Missense_Mutation	SNP	ENST00000394237.1	37	c.288C>G	CCDS4864.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.201817	0.79015	.	.	ENSG00000048545	ENST00000541991;ENST00000372965;ENST00000053469;ENST00000394237;ENST00000372958	D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96	4.57	3.42	0.39159	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.94817	0.8326	M	0.91920	3.255	0.58432	D	0.999996	D	0.89917	1.0	D	0.71656	0.974	D	0.94285	0.7523	9	.	.	.	.	4.6498	0.12589	0.0:0.7204:0.0:0.2796	.	96	P43080	GUC1A_HUMAN	L	96;92;96;96;96	ENSP00000437476:F96L;ENSP00000053469:F96L;ENSP00000377784:F96L;ENSP00000362049:F96L	.	F	+	3	2	GUCA1A	42254082	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.293000	0.43558	2.242000	0.73789	0.655000	0.94253	TTC		0.607	GUCA1A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316582.1			10	85	0	0	0	0.000442599	0	10	85				
CASP8AP2	9994	broad.mit.edu	37	6	90578514	90578514	+	RNA	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr6:90578514G>C	ENST00000551025.1	+	0	6942									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CTCACAAAAAGAGAAGAAACA	0.343																																					Colon(187;1656 2025 17045 31481 39901)	Colon(187;1656 2025 17045 31481 39901)	uc003pnr.2		NA																	0				ovary(2)	2						c.(5503-5505)AAG>AAC		caspase 8 associated protein 2							48.0	44.0	46.0					6																	90578514		1822	4081	5903			9994				cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity	g.chr6:90578514G>C	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90578514G>C						CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.K1835N|CASP8AP2_uc011dzz.1_Missense_Mutation_p.K1835N	p.K1835N	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0953)	8	5701	+		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)	1835			NCOA2-binding.			Missense_Mutation	SNP	ENST00000551025.1	37	c.5505G>C																																																																																					0.343	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667		3	23	0	0	0	6.4e-05	0	3	23				
AIM1	202	broad.mit.edu	37	6	106968959	106968959	+	Silent	SNP	G	G	T	rs199971648		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr6:106968959G>T	ENST00000369066.3	+	2	3139	c.2652G>T	c.(2650-2652)ccG>ccT	p.P884P		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AGGGTGCCCCGCCCTGTGGTT	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		19501	0.0		0.001	False		,,,				2504	0.0						uc003prh.2		NA																	0				breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9						c.(2650-2652)CCG>CCT		absent in melanoma 1		G		0,4406		0,0,2203	72.0	77.0	75.0		2652	-1.0	1.0	6		75	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	AIM1	NM_001624.2		0,1,6502	TT,TG,GG		0.0116,0.0,0.0077		884/1724	106968959	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	202						sugar binding	g.chr6:106968959G>T	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.2652G>T	6.37:g.106968959G>T							p.P884P	NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)	2	3139	+	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	884					Q6P2P0|Q9BTM3	Silent	SNP	ENST00000369066.3	37	c.2652G>T	CCDS34506.1																																																																																				0.473	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			13	84	1	0	2.27111e-07	0.00010058	3.21627e-06	13	84				
COL10A1	1300	broad.mit.edu	37	6	116442718	116442718	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr6:116442718C>G	ENST00000327673.4	-	2	968	c.561G>C	c.(559-561)caG>caC	p.Q187H	NT5DC1_ENST00000319550.4_Intron|AL121963.1_ENST00000430695.1_Intron|COL10A1_ENST00000243222.4_Missense_Mutation_p.Q187H			Q03692	COAA1_HUMAN	collagen, type X, alpha 1	187	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	cell cortex (GO:0005938)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	13		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		TTTCCCCTTTCTGTCCATTCA	0.602																																							uc003pwm.2		NA																	0				central_nervous_system(1)	1						c.(559-561)CAG>CAC		type X collagen alpha 1 precursor							51.0	50.0	50.0					6																	116442718		2203	4300	6503	SO:0001583	missense	1300				skeletal system development	collagen	metal ion binding	g.chr6:116442718C>G		CCDS5105.1	6q21-q22	2013-01-16	2008-07-29		ENSG00000123500	ENSG00000123500		"""Collagens"""	2185	protein-coding gene	gene with protein product	"""Schmid metaphyseal chondrodysplasia"""	120110				2037056	Standard	XM_006715332		Approved		uc003pwm.3	Q03692	OTTHUMG00000015426	ENST00000327673.4:c.561G>C	6.37:g.116442718C>G	ENSP00000327368:p.Gln187His					NT5DC1_uc003pwj.2_Intron|NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Intron	p.Q187H	NM_000493	NP_000484	Q03692	COAA1_HUMAN		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)	3	657	-		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)	187			Triple-helical region.		A1L4P2	Missense_Mutation	SNP	ENST00000327673.4	37	c.561G>C	CCDS5105.1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.177404	0.38413	.	.	ENSG00000123500	ENST00000243222;ENST00000327673;ENST00000452729	D;D;D	0.94280	-3.21;-3.21;-3.39	5.42	1.12	0.20585	.	0.550489	0.19473	N	0.113391	D	0.82309	0.5009	L	0.48260	1.515	0.33725	D	0.617537	B	0.26876	0.162	B	0.30855	0.121	T	0.71915	-0.4448	10	0.46703	T	0.11	.	5.3872	0.16224	0.0:0.4463:0.1439:0.4098	.	187	Q03692	COAA1_HUMAN	H	187	ENSP00000243222:Q187H;ENSP00000327368:Q187H;ENSP00000411285:Q187H	ENSP00000243222:Q187H	Q	-	3	2	COL10A1	116549411	0.217000	0.23597	0.994000	0.49952	0.949000	0.60115	0.258000	0.18387	0.365000	0.24400	0.563000	0.77884	CAG		0.602	COL10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041926.1			5	35	0	0	0	0.000602214	0	5	35				
NCOA7	135112	broad.mit.edu	37	6	126249891	126249891	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr6:126249891G>C	ENST00000368357.3	+	17	3155	c.2803G>C	c.(2803-2805)Gat>Cat	p.D935H	NCOA7_ENST00000392477.2_Missense_Mutation_p.D935H|NCOA7_ENST00000229634.9_Missense_Mutation_p.D820H	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	935	TLD.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		CATAGTTCAGGATCTGGAGGT	0.398																																							uc010kes.2		NA																	0				lung(2)|ovary(1)	3						c.(2803-2805)GAT>CAT		nuclear receptor coactivator 7 isoform 1							91.0	93.0	92.0					6																	126249891		2203	4300	6503	SO:0001583	missense	135112				cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding	g.chr6:126249891G>C	AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.2803G>C	6.37:g.126249891G>C	ENSP00000357341:p.Asp935His					NCOA7_uc003qae.3_Missense_Mutation_p.D935H|NCOA7_uc003qah.2_Missense_Mutation_p.D924H|NCOA7_uc003qai.2_Missense_Mutation_p.D935H|NCOA7_uc010ket.2_Missense_Mutation_p.D820H|NCOA7_uc003qak.2_Missense_Mutation_p.D212H	p.D935H	NM_181782	NP_861447	Q8NI08	NCOA7_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)	18	3252	+			935			TLD.		B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Missense_Mutation	SNP	ENST00000368357.3	37	c.2803G>C	CCDS5132.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.47|19.47	3.833839|3.833839	0.71258|0.71258	.|.	.|.	ENSG00000111912|ENSG00000111912	ENST00000368357;ENST00000392477;ENST00000229634|ENST00000438495	T;T;T|.	0.48522|.	0.81;0.81;0.81|.	6.17|6.17	6.17|6.17	0.99709|0.99709	TLDc (2);|.	0.088957|.	0.85682|.	D|.	0.000000|.	T|T	0.55893|0.55893	0.1949|0.1949	L|L	0.31578|0.31578	0.945|0.945	0.54753|0.54753	D|D	0.999988|0.999988	D;D;D;D|.	0.89917|.	1.0;0.998;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.993;0.984;0.999;0.996|.	T|T	0.48790|0.48790	-0.9004|-0.9004	10|5	0.54805|.	T|.	0.06|.	-18.2041|-18.2041	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	924;229;924;935|.	B3KXK4;Q5JVL0;Q8NI08-2;Q8NI08|.	.;.;.;NCOA7_HUMAN|.	H|A	935;935;820|229	ENSP00000357341:D935H;ENSP00000376269:D935H;ENSP00000229634:D820H|.	ENSP00000229634:D820H|.	D|G	+|+	1|2	0|0	NCOA7|NCOA7	126291584|126291584	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	3.900000|3.900000	0.56295|0.56295	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAT|GGA		0.398	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748		8	86	0	0	0	0.000274275	0	8	86				
REPS1	85021	broad.mit.edu	37	6	139251120	139251120	+	Silent	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr6:139251120G>A	ENST00000450536.2	-	9	1825	c.1251C>T	c.(1249-1251)agC>agT	p.S417S	REPS1_ENST00000409812.2_Silent_p.S417S|REPS1_ENST00000258062.5_Silent_p.S417S|REPS1_ENST00000415951.2_Silent_p.S417S|REPS1_ENST00000367663.4_Silent_p.S417S			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	417					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		TAACCTCACTGCTCTGATTCA	0.448																																							uc003qii.2		NA																	0				lung(1)|breast(1)	2						c.(1249-1251)AGC>AGT		RALBP1 associated Eps domain containing 1							173.0	148.0	157.0					6																	139251120		2203	4300	6503	SO:0001819	synonymous_variant	85021					coated pit|plasma membrane	calcium ion binding|SH3 domain binding	g.chr6:139251120G>A		CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.1251C>T	6.37:g.139251120G>A						REPS1_uc003qig.3_Silent_p.S417S|REPS1_uc011edr.1_Silent_p.S417S|REPS1_uc003qij.2_Silent_p.S417S|REPS1_uc003qik.2_Silent_p.S50S	p.S417S	NM_031922	NP_114128	Q96D71	REPS1_HUMAN		GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)	9	1830	-			417					B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Silent	SNP	ENST00000450536.2	37	c.1251C>T																																																																																					0.448	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000042447.3			8	59	0	0	0	0.000157383	0	8	59				
SHPRH	257218	broad.mit.edu	37	6	146276124	146276124	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr6:146276124C>A	ENST00000367505.2	-	2	599	c.335G>T	c.(334-336)tGg>tTg	p.W112L	SHPRH_ENST00000275233.7_Missense_Mutation_p.W112L|SHPRH_ENST00000367503.3_Missense_Mutation_p.W112L|SHPRH_ENST00000438092.2_Missense_Mutation_p.W112L			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	112					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		AAATGCTTTCCAGGAATTATC	0.328																																							uc003qlf.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(334-336)TGG>TTG		SNF2 histone linker PHD RING helicase isoform a							79.0	73.0	75.0					6																	146276124		1800	4068	5868	SO:0001583	missense	257218				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr6:146276124C>A	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.335G>T	6.37:g.146276124C>A	ENSP00000356475:p.Trp112Leu					SHPRH_uc003qld.2_Missense_Mutation_p.W112L|SHPRH_uc003qle.2_Missense_Mutation_p.W112L|SHPRH_uc003qlg.1_5'UTR|SHPRH_uc003qlj.1_Intron|SHPRH_uc003qlk.1_Missense_Mutation_p.W112L	p.W112L	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)	2	734	-		Ovarian(120;0.0365)	112					Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	c.335G>T	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523624	0.85600	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000001	T	0.71134	0.3304	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.995;0.998	T	0.72257	-0.4346	10	0.66056	D	0.02	-10.651	19.7365	0.96208	0.0:1.0:0.0:0.0	.	112;112	Q149N8;Q149N8-4	SHPRH_HUMAN;.	L	112	ENSP00000356475:W112L;ENSP00000356473:W112L;ENSP00000412797:W112L;ENSP00000275233:W112L	ENSP00000275233:W112L	W	-	2	0	SHPRH	146317817	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	6.977000	0.76141	2.672000	0.90937	0.655000	0.94253	TGG		0.328	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082		8	27	1	0	1.12685e-05	0.000274275	0.000148883	8	27				
IGF2BP3	10643	broad.mit.edu	37	7	23401202	23401202	+	Missense_Mutation	SNP	C	C	T	rs267601463		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr7:23401202C>T	ENST00000258729.3	-	5	708	c.352G>A	c.(352-354)Gaa>Aaa	p.E118K	IGF2BP3_ENST00000491719.1_5'UTR	NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	118	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						ACTGCAGTTTCCGAGTCAGTG	0.338																																							uc003swg.2		NA																	0				ovary(2)	2						c.(352-354)GAA>AAA		insulin-like growth factor 2 mRNA binding							120.0	120.0	120.0					7																	23401202		2203	4300	6503	SO:0001583	missense	10643				anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity	g.chr7:23401202C>T	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.352G>A	7.37:g.23401202C>T	ENSP00000258729:p.Glu118Lys						p.E118K	NM_006547	NP_006538	O00425	IF2B3_HUMAN			5	618	-			118			RRM 2.		A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Missense_Mutation	SNP	ENST00000258729.3	37	c.352G>A	CCDS5382.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.952573	0.92660	.	.	ENSG00000136231	ENST00000258729	T	0.15139	2.45	5.32	4.43	0.53597	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.48169	0.1485	M	0.88105	2.93	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.58008	-0.7712	10	0.49607	T	0.09	-18.8311	16.0115	0.80406	0.0:0.8652:0.1348:0.0	.	118	O00425	IF2B3_HUMAN	K	118	ENSP00000258729:E118K	ENSP00000258729:E118K	E	-	1	0	IGF2BP3	23367727	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.767000	0.85331	1.208000	0.43306	0.563000	0.77884	GAA		0.338	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547		10	181	0	0	0	0.000673444	0	10	181				
PKD1L1	168507	broad.mit.edu	37	7	47897302	47897302	+	Silent	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr7:47897302C>A	ENST00000289672.2	-	28	4541	c.4491G>T	c.(4489-4491)ggG>ggT	p.G1497G		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1497	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CAGGACTGTGCCCAGCAAGGT	0.562																																							uc003tny.1		NA																	0				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(4489-4491)GGG>GGT		polycystin-1L1							74.0	74.0	74.0					7																	47897302		2203	4300	6503	SO:0001819	synonymous_variant	168507				cell-cell adhesion	integral to membrane		g.chr7:47897302C>A	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.4491G>T	7.37:g.47897302C>A							p.G1497G	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN			28	4491	-			1497			Extracellular (Potential).|REJ.		Q6UWK1	Silent	SNP	ENST00000289672.2	37	c.4491G>T	CCDS34633.1																																																																																				0.562	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		17	70	1	0	0.000566183	0.000566183	0.00686679	17	70				
PKD1L1	168507	broad.mit.edu	37	7	47968881	47968882	+	Missense_Mutation	DNP	CC	CC	AA	rs376405760		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr7:47968881_47968882CC>AA	ENST00000289672.2	-	7	1029_1030	c.979_980GG>TT	c.(979-981)GGg>TTg	p.G327L		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	327					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AGAACTGTCCCCGAAATCCATC	0.51																																							uc003tny.1		NA																	0				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(979-981)GGG>TTG		polycystin-1L1																																				SO:0001583	missense	168507				cell-cell adhesion	integral to membrane		g.chr7:47968881_47968882CC>AA	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.979_980delinsAA	7.37:g.47968881_47968882delinsAA	ENSP00000289672:p.Gly327Leu						p.G327L	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN			7	979_980	-			327			Extracellular (Potential).		Q6UWK1	Missense_Mutation	DNP	ENST00000289672.2	37	c.979_980GG>TT	CCDS34633.1																																																																																				0.510	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		8	235	0	0	0	6.4e-05	0	8	235				
MEPCE	56257	broad.mit.edu	37	7	100030679	100030679	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr7:100030679C>G	ENST00000310512.2	+	2	2197	c.1809C>G	c.(1807-1809)atC>atG	p.I603M	RP11-758P17.2_ENST00000492523.1_RNA|PPP1R35_ENST00000476185.1_5'Flank|MEPCE_ENST00000414441.1_Missense_Mutation_p.I134M	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	603	Bin3-type SAM. {ECO:0000255|PROSITE- ProRule:PRU00848}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTCGCCGGATCTACCGGCACC	0.592																																							uc003uuw.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(1807-1809)ATC>ATG		bin3, bicoid-interacting 3							84.0	78.0	80.0					7																	100030679		2203	4300	6503	SO:0001583	missense	56257						methyltransferase activity	g.chr7:100030679C>G	AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.1809C>G	7.37:g.100030679C>G	ENSP00000308546:p.Ile603Met					MEPCE_uc003uuv.2_Missense_Mutation_p.I134M	p.I603M	NM_019606	NP_062552	Q7L2J0	MEPCE_HUMAN			2	1922	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		603			Bin3-type SAM.		B3KP86|D6W5V7|Q9NPD4	Missense_Mutation	SNP	ENST00000310512.2	37	c.1809C>G	CCDS5693.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.831214	0.32329	.	.	ENSG00000146834	ENST00000414441;ENST00000425355;ENST00000310512	T;T	0.47177	0.85;0.87	5.37	3.54	0.40534	Bin3-type S-adenosyl-L-methionine binding domain (1);Bicoid-interacting 3 (1);	0.150767	0.44483	D	0.000443	T	0.26412	0.0645	N	0.21324	0.655	0.41536	D	0.988487	B	0.34349	0.45	B	0.34180	0.177	T	0.05131	-1.0904	10	0.12103	T	0.63	-17.5095	4.5753	0.12230	0.1576:0.607:0.1524:0.0831	.	603	Q7L2J0	MEPCE_HUMAN	M	134;134;603	ENSP00000400875:I134M;ENSP00000308546:I603M	ENSP00000308546:I603M	I	+	3	3	MEPCE	99868615	1.000000	0.71417	0.964000	0.40570	0.880000	0.50808	0.935000	0.28924	0.736000	0.32559	0.462000	0.41574	ATC		0.592	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339135.1			4	67	0	0	0	0.00024832	0	4	67				
PUS7	54517	broad.mit.edu	37	7	105146653	105146653	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr7:105146653T>A	ENST00000356362.2	-	3	680	c.466A>T	c.(466-468)Att>Ttt	p.I156F	PUS7_ENST00000469408.1_Missense_Mutation_p.I156F	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	156					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						TCCACTGGAATGGACAAGTCA	0.348																																					Colon(138;2387 3051 17860)	Colon(138;2387 3051 17860)	uc003vcx.2		NA																	0				breast(1)	1						c.(466-468)ATT>TTT		pseudouridylate synthase 7 homolog							71.0	69.0	69.0					7																	105146653		2203	4300	6503	SO:0001583	missense	54517				pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding	g.chr7:105146653T>A	AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.466A>T	7.37:g.105146653T>A	ENSP00000348722:p.Ile156Phe					PUS7_uc010lji.2_Missense_Mutation_p.I156F|PUS7_uc003vcy.2_Missense_Mutation_p.I156F|PUS7_uc003vcz.1_Missense_Mutation_p.I156F	p.I156F	NM_019042	NP_061915	Q96PZ0	PUS7_HUMAN			3	685	-			156					Q75MG4|Q9NX19	Missense_Mutation	SNP	ENST00000356362.2	37	c.466A>T	CCDS34725.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.30|14.30	2.493532|2.493532	0.44352|0.44352	.|.	.|.	ENSG00000091127|ENSG00000091127	ENST00000482157|ENST00000356362;ENST00000544995;ENST00000469408	.|T;T	.|0.42900	.|0.96;0.96	5.55|5.55	2.76|2.76	0.32466|0.32466	.|Pseudouridine synthase, catalytic domain (1);	.|0.241534	.|0.41294	.|D	.|0.000904	T|T	0.23133|0.23133	0.0559|0.0559	N|N	0.17723|0.17723	0.515|0.515	0.40424|0.40424	D|D	0.979876|0.979876	.|B;B	.|0.28552	.|0.215;0.07	.|B;B	.|0.25291	.|0.027;0.059	T|T	0.05683|0.05683	-1.0870|-1.0870	5|10	.|0.11485	.|T	.|0.65	-0.9667|-0.9667	9.9136|9.9136	0.41421|0.41421	0.0:0.7746:0.0:0.2254|0.0:0.7746:0.0:0.2254	.|.	.|156;156	.|B3KY42;Q96PZ0	.|.;PUS7_HUMAN	L|F	30|156	.|ENSP00000348722:I156F;ENSP00000417402:I156F	.|ENSP00000348722:I156F	H|I	-|-	2|1	0|0	PUS7|PUS7	104933889|104933889	0.984000|0.984000	0.35163|0.35163	0.953000|0.953000	0.39169|0.39169	0.886000|0.886000	0.51366|0.51366	1.393000|1.393000	0.34497|0.34497	0.378000|0.378000	0.24764|0.24764	-0.468000|-0.468000	0.05107|0.05107	CAT|ATT		0.348	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1	NM_019042		18	59	0	0	0	0.000958276	0	18	59				
PNPLA8	50640	broad.mit.edu	37	7	108154644	108154644	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr7:108154644C>T	ENST00000422087.1	-	5	1556	c.1150G>A	c.(1150-1152)Gaa>Aaa	p.E384K	PNPLA8_ENST00000257694.8_Missense_Mutation_p.E384K|PNPLA8_ENST00000436062.1_Missense_Mutation_p.E384K|PNPLA8_ENST00000453144.1_Missense_Mutation_p.E284K|PNPLA8_ENST00000483879.1_Intron|PNPLA8_ENST00000388728.5_Missense_Mutation_p.E384K|PNPLA8_ENST00000426128.2_Missense_Mutation_p.E384K	NM_015723.3	NP_056538.1	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	384					arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|cell death (GO:0008219)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|linoleic acid metabolic process (GO:0043651)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine catabolic process (GO:0034638)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylethanolamine catabolic process (GO:0046338)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)			breast(5)|endometrium(1)|kidney(3)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(3)	29						GTCAGTTCTTCAACCCTAGTA	0.378																																							uc003vff.1		NA																	0				breast(2)	2						c.(1150-1152)GAA>AAA		patatin-like phospholipase domain containing 8							250.0	273.0	265.0					7																	108154644		2203	4300	6503	SO:0001583	missense	50640				fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity	g.chr7:108154644C>T	AF217519	CCDS34733.1, CCDS59075.1, CCDS59508.1	7q31	2012-07-31			ENSG00000135241	ENSG00000135241		"""Patatin-like phospholipase domain containing"""	28900	protein-coding gene	gene with protein product		612123				10744668, 10833412, 16799181, 19029121	Standard	NM_015723		Approved	IPLA2G, IPLA2-2, iPLA2gamma	uc003vfj.2	Q9NP80	OTTHUMG00000154870	ENST00000422087.1:c.1150G>A	7.37:g.108154644C>T	ENSP00000410804:p.Glu384Lys					PNPLA8_uc003vfg.1_RNA|PNPLA8_uc003vfh.1_Missense_Mutation_p.E384K|PNPLA8_uc003vfi.1_Missense_Mutation_p.E284K|PNPLA8_uc003vfj.1_Missense_Mutation_p.E384K|PNPLA8_uc003vfk.1_Missense_Mutation_p.E284K	p.E384K	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN			5	1557	-			384					A4D0S1|C9JZI4|O95035|Q8N3I3|Q9H7T5|Q9NR17|Q9NUN2|Q9NZ79	Missense_Mutation	SNP	ENST00000422087.1	37	c.1150G>A	CCDS34733.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.868527	0.91587	.	.	ENSG00000135241	ENST00000426128;ENST00000257694;ENST00000388728;ENST00000422087;ENST00000453144;ENST00000436062;ENST00000453085	T;T;T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29;2.29;2.29	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.44180	0.1281	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.41840	-0.9486	10	0.87932	D	0	.	18.7104	0.91655	0.0:1.0:0.0:0.0	.	384	Q9NP80	PLPL8_HUMAN	K	384;384;384;384;284;384;284	ENSP00000394988:E384K;ENSP00000257694:E384K;ENSP00000373380:E384K;ENSP00000410804:E384K;ENSP00000387789:E284K;ENSP00000406779:E384K;ENSP00000402274:E284K	ENSP00000257694:E384K	E	-	1	0	PNPLA8	107941880	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.270000	0.78493	2.421000	0.82119	0.655000	0.94253	GAA		0.378	PNPLA8-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337475.1	NM_015723		15	311	0	0	0	0.000958276	0	15	311				
BRAF	673	broad.mit.edu	37	7	140494148	140494148	+	Missense_Mutation	SNP	G	G	C	rs267601317		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr7:140494148G>C	ENST00000288602.6	-	8	1160	c.1100C>G	c.(1099-1101)cCc>cGc	p.P367R		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	367					activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	ATGCACATTGGGAGCTGATGA	0.398		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	Colon(40;35 892 2973 5743 27438)	uc003vwc.3		61		Dom	yes		7	7q34	673	Mis|T|O	v-raf murine sarcoma viral oncogene homolog B1	yes	Cardio-facio-cutaneous syndrome	E	AKAP9|KIAA1549		melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	0				thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290						c.(1099-1101)CCC>CGC		B-Raf	Sorafenib(DB00398)						175.0	160.0	165.0					7																	140494148		2203	4300	6503	SO:0001583	missense	673	Cardiofaciocutaneous_syndrome	Familial Cancer Database	CFC, CFCS	activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	g.chr7:140494148G>C	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1100C>G	7.37:g.140494148G>C	ENSP00000288602:p.Pro367Arg						p.P367R	NM_004333	NP_004324	P15056	BRAF_HUMAN			8	1161	-	Melanoma(164;0.00956)		367					A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	c.1100C>G	CCDS5863.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.676527	0.88445	.	.	ENSG00000157764	ENST00000288602	T	0.81078	-1.45	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.90116	0.6912	M	0.76727	2.345	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90432	0.4425	10	0.87932	D	0	.	19.949	0.97192	0.0:0.0:1.0:0.0	.	367	P15056	BRAF_HUMAN	R	367	ENSP00000288602:P367R	ENSP00000288602:P367R	P	-	2	0	BRAF	140140617	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.357000	0.97099	2.706000	0.92434	0.655000	0.94253	CCC		0.398	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333		10	110	0	0	0	0.000673444	0	10	110				
ZNF425	155054	broad.mit.edu	37	7	148802569	148802569	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr7:148802569C>G	ENST00000378061.2	-	4	526	c.394G>C	c.(394-396)Gag>Cag	p.E132Q		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	132					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			ATCTTTCTCTCTTTCCCTCGT	0.433																																							uc003wfj.2		NA																	0				breast(2)|ovary(1)	3						c.(394-396)GAG>CAG		zinc finger protein 425							126.0	120.0	122.0					7																	148802569		2203	4300	6503	SO:0001583	missense	155054				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	g.chr7:148802569C>G	AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.394G>C	7.37:g.148802569C>G	ENSP00000367300:p.Glu132Gln						p.E132Q	NM_001001661	NP_001001661	Q6IV72	ZN425_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)		4	467	-	Melanoma(164;0.15)		132					B3KPM1|Q08AG3	Missense_Mutation	SNP	ENST00000378061.2	37	c.394G>C	CCDS34773.1	.	.	.	.	.	.	.	.	.	.	C	8.717	0.913359	0.17907	.	.	ENSG00000204947	ENST00000378061	T	0.08193	3.12	2.85	-0.404	0.12396	.	.	.	.	.	T	0.03053	0.0090	N	0.08118	0	0.09310	N	1	B	0.26400	0.148	B	0.19946	0.027	T	0.46884	-0.9159	9	0.13108	T	0.6	.	3.7206	0.08454	0.0:0.4043:0.1942:0.4015	.	132	Q6IV72	ZN425_HUMAN	Q	132	ENSP00000367300:E132Q	ENSP00000367300:E132Q	E	-	1	0	ZNF425	148433502	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.712000	0.05013	-0.024000	0.13941	-0.140000	0.14226	GAG		0.433	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352726.1	XM_088140		4	122	0	0	0	0.00024832	0	4	122				
SGK223	157285	broad.mit.edu	37	8	8235009	8235009	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr8:8235009C>A	ENST00000520004.1	-	3	1174	c.910G>T	c.(910-912)Ggc>Tgc	p.G304C	SGK223_ENST00000330777.4_Missense_Mutation_p.G304C			Q86YV5	SG223_HUMAN		304							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										AAGCTCGGGCCCCGCTTCTCC	0.677																																					GBM(34;731 755 10259 33573 33867)	GBM(34;731 755 10259 33573 33867)	uc003wsh.3		NA																	0					0						c.(910-912)GGC>TGC		pragmin							12.0	17.0	15.0					8																	8235009		1899	4053	5952	SO:0001583	missense	157285						ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr8:8235009C>A																												ENST00000520004.1:c.910G>T	8.37:g.8235009C>A	ENSP00000428054:p.Gly304Cys						p.G304C	NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN			2	910	-			304					Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	c.910G>T	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	5.875	0.345614	0.11126	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.58652	0.32;0.32	5.28	3.49	0.39957	.	3.149230	0.01121	N	0.005792	T	0.50309	0.1608	N	0.24115	0.695	0.09310	N	1	P	0.41748	0.761	B	0.40702	0.338	T	0.47711	-0.9096	10	0.62326	D	0.03	.	9.1041	0.36687	0.0:0.8335:0.0:0.1665	.	304	Q86YV5	SG223_HUMAN	C	304	ENSP00000330930:G304C;ENSP00000428054:G304C	ENSP00000330930:G304C	G	-	1	0	AC068353.1	8272419	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.390000	0.20768	0.733000	0.32492	0.655000	0.94253	GGC		0.677	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1			6	14	1	0	0.000157383	0.000157383	0.00199044	6	14				
UNC5D	137970	broad.mit.edu	37	8	35406824	35406824	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr8:35406824G>A	ENST00000404895.2	+	2	446	c.118G>A	c.(118-120)Gaa>Aaa	p.E40K	UNC5D_ENST00000420357.1_Missense_Mutation_p.E40K|UNC5D_ENST00000416672.1_Missense_Mutation_p.E40K|UNC5D_ENST00000453357.2_Missense_Mutation_p.E35K|UNC5D_ENST00000287272.2_Missense_Mutation_p.E40K	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	40					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGACAATGGCGAAGCCCTTCC	0.463																																							uc003xjr.1		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6						c.(118-120)GAA>AAA		unc-5 homolog D precursor							59.0	57.0	58.0					8																	35406824		2203	4300	6503	SO:0001583	missense	137970				apoptosis|axon guidance	integral to membrane	receptor activity	g.chr8:35406824G>A	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.118G>A	8.37:g.35406824G>A	ENSP00000385143:p.Glu40Lys					UNC5D_uc003xjs.1_Missense_Mutation_p.E35K	p.E40K	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN		READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)	2	446	+			40			Extracellular (Potential).		Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	c.118G>A	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	G	16.41	3.114444	0.56505	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357	T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94	6.06	6.06	0.98353	.	0.226096	0.45361	D	0.000378	T	0.22282	0.0537	L	0.50333	1.59	0.80722	D	1	P;P	0.39624	0.681;0.553	B;B	0.31751	0.135;0.064	T	0.01352	-1.1377	10	0.34782	T	0.22	-14.9077	20.6397	0.99537	0.0:0.0:1.0:0.0	.	35;40	Q6UXZ4-2;Q6UXZ4	.;UNC5D_HUMAN	K	40;40;40;40;35	ENSP00000385143:E40K;ENSP00000392739:E40K;ENSP00000287272:E40K;ENSP00000412652:E40K;ENSP00000394303:E35K	ENSP00000287272:E40K	E	+	1	0	UNC5D	35526366	1.000000	0.71417	0.966000	0.40874	0.082000	0.17680	9.174000	0.94824	2.880000	0.98712	0.650000	0.86243	GAA		0.463	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			6	23	0	0	0	8.12818e-05	0	6	23				
KCNB2	9312	broad.mit.edu	37	8	73479988	73479988	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr8:73479988C>A	ENST00000523207.1	+	2	607	c.19C>A	c.(19-21)Ccg>Acg	p.P7T		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	7					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	AAAGGCTCCCCCGGGCTTAAA	0.498																																							uc003xzb.2		NA																	0				skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7						c.(19-21)CCG>ACG		potassium voltage-gated channel, Shab-related							80.0	82.0	81.0					8																	73479988		2203	4300	6503	SO:0001583	missense	9312				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding	g.chr8:73479988C>A	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.19C>A	8.37:g.73479988C>A	ENSP00000430846:p.Pro7Thr						p.P7T	NM_004770	NP_004761	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)		2	607	+	Breast(64;0.137)		7			Cytoplasmic (Potential).		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	c.19C>A	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	C	9.817	1.184739	0.21870	.	.	ENSG00000182674	ENST00000523207	D	0.96651	-4.08	6.11	6.11	0.99139	.	0.000000	0.31624	U	0.007339	D	0.91425	0.7294	N	0.08118	0	0.37565	D	0.919204	B	0.24533	0.105	B	0.18263	0.021	D	0.87255	0.2275	10	0.31617	T	0.26	.	20.7342	0.99715	0.0:1.0:0.0:0.0	.	7	Q92953	KCNB2_HUMAN	T	7	ENSP00000430846:P7T	ENSP00000430846:P7T	P	+	1	0	KCNB2	73642542	0.773000	0.28580	0.983000	0.44433	0.892000	0.51952	2.734000	0.47368	2.906000	0.99361	0.655000	0.94253	CCG		0.498	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		6	76	1	0	0.000442599	0.000442599	0.00539561	6	76				
CSMD3	114788	broad.mit.edu	37	8	113364700	113364700	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr8:113364700C>A	ENST00000297405.5	-	39	6444	c.6200G>T	c.(6199-6201)aGa>aTa	p.R2067I	CSMD3_ENST00000343508.3_Missense_Mutation_p.R2027I|CSMD3_ENST00000455883.2_Missense_Mutation_p.R1963I|CSMD3_ENST00000352409.3_Missense_Mutation_p.R1997I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2067	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R2067K(1)|p.R2027K(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AACCATATATCTGTCTCCAAT	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(6199-6201)AGA>ATA		CUB and Sushi multiple domains 3 isoform 1							110.0	103.0	105.0					8																	113364700		2203	4299	6502	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113364700C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6200G>T	8.37:g.113364700C>A	ENSP00000297405:p.Arg2067Ile	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.R1269I|CSMD3_uc003ynt.2_Missense_Mutation_p.R2027I|CSMD3_uc011lhx.1_Missense_Mutation_p.R1963I	p.R2067I	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			39	6359	-			2067			Extracellular (Potential).|Sushi 11.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.6200G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	33	5.220143	0.95139	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81	4.96	4.96	0.65561	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.42040	0.1185	L	0.56280	1.765	0.80722	D	1	P;B;P	0.52061	0.846;0.452;0.95	P;B;P	0.55785	0.637;0.296;0.784	T	0.11966	-1.0566	10	0.46703	T	0.11	.	18.7468	0.91795	0.0:1.0:0.0:0.0	.	1963;2067;2027	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	I	2027;2067;1337;1963;1997	ENSP00000345799:R2027I;ENSP00000297405:R2067I;ENSP00000341558:R1337I;ENSP00000412263:R1963I;ENSP00000343124:R1997I	ENSP00000297405:R2067I	R	-	2	0	CSMD3	113433876	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.609000	0.82925	2.731000	0.93534	0.655000	0.94253	AGA		0.343	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		9	89	1	0	7.48243e-07	0.000442599	1.0471e-05	9	89				
WDYHV1	55093	broad.mit.edu	37	8	124440236	124440236	+	Silent	SNP	T	T	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr8:124440236T>G	ENST00000287387.2	+	2	281	c.156T>G	c.(154-156)gcT>gcG	p.A52A	WDYHV1_ENST00000517609.1_3'UTR|WDYHV1_ENST00000518125.1_5'Flank|WDYHV1_ENST00000523984.1_5'UTR|WDYHV1_ENST00000523356.1_Silent_p.A52A	NM_018024.1	NP_060494.1	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1	52					cellular protein modification process (GO:0006464)	cytosol (GO:0005829)|nucleus (GO:0005634)	protein-N-terminal glutamine amidohydrolase activity (GO:0070773)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(3)	17						AATGTTATGCTGTCTTCATAT	0.299																																							uc003yqn.1		NA																	0				ovary(1)|skin(1)	2						c.(154-156)GCT>GCG		WDYHV motif containing 1							132.0	147.0	142.0					8																	124440236		2203	4299	6502	SO:0001819	synonymous_variant	55093				protein modification process	cytosol|nucleus	protein binding|protein N-terminal glutamine amidohydrolase activity	g.chr8:124440236T>G	AK001066	CCDS6344.1, CCDS64965.1	8q24.13	2008-10-01	2008-10-01	2008-10-01		ENSG00000156795			25490	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 32"""	C8orf32		12477932	Standard	NM_018024		Approved	FLJ10204	uc003yqn.1	Q96HA8		ENST00000287387.2:c.156T>G	8.37:g.124440236T>G						WDYHV1_uc011lij.1_5'UTR|WDYHV1_uc003yqo.1_5'Flank	p.A52A	NM_018024	NP_060494	Q96HA8	NTAQ1_HUMAN			2	281	+			52					B4DE68|Q9NW95	Silent	SNP	ENST00000287387.2	37	c.156T>G	CCDS6344.1																																																																																				0.299	WDYHV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381772.1	NM_018024		16	296	0	0	0	0.00074312	0	16	296				
FER1L6	654463	broad.mit.edu	37	8	125072866	125072866	+	Missense_Mutation	SNP	C	C	G	rs369624500		TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr8:125072866C>G	ENST00000522917.1	+	24	3269	c.3063C>G	c.(3061-3063)tgC>tgG	p.C1021W	FER1L6-AS2_ENST00000601180.1_RNA|FER1L6-AS2_ENST00000520031.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.C1021W	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1021						integral component of membrane (GO:0016021)		p.C1021C(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TCATTGAGTGCGGAGGACAAG	0.547																																							uc003yqw.2		NA																	1	Substitution - coding silent(1)		kidney(1)	ovary(5)|skin(5)|central_nervous_system(1)	11						c.(3061-3063)TGC>TGG		fer-1-like 6		C	TRP/CYS	0,4406		0,0,2203	144.0	126.0	132.0		3063	-1.1	1.0	8		132	1,8599	1.2+/-3.3	0,1,4299	no	missense	FER1L6	NM_001039112.2	215	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	probably-damaging	1021/1858	125072866	1,13005	2203	4300	6503	SO:0001583	missense	654463					integral to membrane		g.chr8:125072866C>G	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3063C>G	8.37:g.125072866C>G	ENSP00000428280:p.Cys1021Trp					uc003yqy.1_RNA	p.C1021W	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		24	3269	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		1021			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000522917.1	37	c.3063C>G	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.690610	0.29962	0.0	1.16E-4	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.81659	-1.52;-1.52	5.81	-1.09	0.09904	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	D	0.89076	0.6612	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87941	0.2717	10	0.87932	D	0	-16.6038	10.24	0.43305	0.0:0.3373:0.0:0.6627	.	1021	Q2WGJ9	FR1L6_HUMAN	W	1021	ENSP00000428280:C1021W;ENSP00000381982:C1021W	ENSP00000381982:C1021W	C	+	3	2	FER1L6	125142047	0.997000	0.39634	0.976000	0.42696	0.045000	0.14185	0.342000	0.19926	-0.117000	0.11872	-1.202000	0.01658	TGC		0.547	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		8	60	0	0	0	0.000157383	0	8	60				
ASAP1	50807	broad.mit.edu	37	8	131414163	131414164	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr8:131414163_131414164GG>TT	ENST00000518721.1	-	2	253_254	c.26_27CC>AA	c.(25-27)tCC>tAA	p.S9*	ASAP1_ENST00000357668.1_Nonsense_Mutation_p.S9*|ASAP1_ENST00000520625.1_5'Flank	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	9					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						ACGAAAAACTGGAGAGCCTGGA	0.52																																							uc003yta.1		NA																	0				ovary(4)	4						c.(25-27)TCC>TAA		development and differentiation enhancing factor																																				SO:0001587	stop_gained	50807				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding	g.chr8:131414163_131414164GG>TT	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.26_27delinsTT	8.37:g.131414163_131414164delinsTT	ENSP00000429900:p.Ser9*					ASAP1_uc011liw.1_5'UTR	p.S9*	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN			1	54_55	-			9					B2RNV3	Nonsense_Mutation	DNP	ENST00000518721.1	37	c.26_27CC>AA	CCDS6362.1																																																																																				0.520	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482		14	57	0	0	0	6.4e-05	0	14	57				
CYP11B2	1585	broad.mit.edu	37	8	143993991	143993991	+	Silent	SNP	G	G	A	rs371126595	byFrequency	TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr8:143993991G>A	ENST00000323110.2	-	8	1355	c.1353C>T	c.(1351-1353)ctC>ctT	p.L451L		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	451					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	GGCGCCGCCCGAGGCACTGGC	0.687									Familial Hyperaldosteronism type I				.|||	5	0.000998403	0.0	0.0	5008	,	,		12756	0.0		0.0	False		,,,				2504	0.0051						uc003yxk.1		NA																	0					0						c.(1351-1353)CTC>CTT		cytochrome P450, family 11, subfamily B,	Candesartan(DB00796)|Metyrapone(DB01011)	G		2,4404		0,2,2201	55.0	63.0	60.0		1353	0.4	1.0	8		60	1,8599		0,1,4299	no	coding-synonymous	CYP11B2	NM_000498.3		0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231		451/504	143993991	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	1585	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143993991G>A	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1353C>T	8.37:g.143993991G>A							p.L451L	NM_000498	NP_000489	P19099	C11B2_HUMAN			8	1356	-	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		451					B0ZBE4|Q16726	Silent	SNP	ENST00000323110.2	37	c.1353C>T	CCDS6393.1																																																																																				0.687	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1			6	59	0	0	0	3.59834e-05	0	6	59				
TOPORS	10210	broad.mit.edu	37	9	32542697	32542697	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr9:32542697C>A	ENST00000360538.2	-	3	1942	c.1826G>T	c.(1825-1827)gGg>gTg	p.G609V	TOPORS_ENST00000379858.1_Missense_Mutation_p.G544V	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	609	Arg-rich.|Interaction with SUMO1.|Interaction with TOP1.|Interaction with p53/TP53.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		CTGATCATGCCCACTTCTACT	0.413																																							uc003zrb.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(1825-1827)GGG>GTG		topoisomerase I binding, arginine/serine-rich							249.0	249.0	249.0					9																	32542697		2203	4300	6503	SO:0001583	missense	10210				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:32542697C>A	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.1826G>T	9.37:g.32542697C>A	ENSP00000353735:p.Gly609Val					TOPORS_uc003zrc.2_Missense_Mutation_p.G542V	p.G609V	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)	3	1993	-			609			Arg-rich.|Interaction with TOP1.|Interaction with SUMO1.|Interaction with p53/TP53.		O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	37	c.1826G>T	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	C	9.994	1.231720	0.22626	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.14391	2.51;2.52	5.9	5.9	0.94986	.	0.000000	0.45867	D	0.000324	T	0.19725	0.0474	N	0.19112	0.55	0.53688	D	0.999972	D	0.76494	0.999	D	0.66196	0.942	T	0.02805	-1.1108	10	0.27785	T	0.31	-19.0203	12.3824	0.55313	0.0:0.9226:0.0:0.0774	.	609	Q9NS56	TOPRS_HUMAN	V	609;544	ENSP00000353735:G609V;ENSP00000369187:G544V	ENSP00000353735:G609V	G	-	2	0	TOPORS	32532697	1.000000	0.71417	0.999000	0.59377	0.913000	0.54294	3.225000	0.51246	2.788000	0.95919	0.650000	0.86243	GGG		0.413	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802		8	235	1	0	0.000274275	0.000274275	0.003414	8	235				
RECK	8434	broad.mit.edu	37	9	36102158	36102158	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr9:36102158G>A	ENST00000377966.3	+	12	1932	c.1366G>A	c.(1366-1368)Gaa>Aaa	p.E456K		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	456					blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			CCACACAGCTGAAAGTATTTG	0.353																																							uc003zyv.2		NA																	0				skin(2)|ovary(1)	3						c.(1366-1368)GAA>AAA		RECK protein precursor							129.0	132.0	131.0					9																	36102158		2203	4300	6503	SO:0001583	missense	8434					anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity	g.chr9:36102158G>A	E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.1366G>A	9.37:g.36102158G>A	ENSP00000367202:p.Glu456Lys					RECK_uc003zyw.2_Missense_Mutation_p.E328K|RECK_uc003zyx.2_RNA	p.E456K	NM_021111	NP_066934	O95980	RECK_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)		12	1452	+			456					B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	ENST00000377966.3	37	c.1366G>A	CCDS6597.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862328	0.91511	.	.	ENSG00000122707	ENST00000377966	T	0.44881	0.91	5.46	4.56	0.56223	.	0.106892	0.64402	D	0.000006	T	0.46483	0.1395	L	0.46157	1.445	0.46749	D	0.999182	D;D	0.57257	0.979;0.979	P;P	0.49999	0.628;0.628	T	0.49062	-0.8978	10	0.59425	D	0.04	-20.6166	14.435	0.67274	0.0:0.1484:0.8515:0.0	.	456;456	A8K9D8;O95980	.;RECK_HUMAN	K	456	ENSP00000367202:E456K	ENSP00000367202:E456K	E	+	1	0	RECK	36092158	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.523000	0.98034	1.427000	0.47276	0.655000	0.94253	GAA		0.353	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052409.1			6	86	0	0	0	3.59834e-05	0	6	86				
ZNF483	158399	broad.mit.edu	37	9	114304223	114304223	+	Silent	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr9:114304223G>A	ENST00000309235.5	+	6	1166	c.1008G>A	c.(1006-1008)aaG>aaA	p.K336K	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						ATGAAAGCAAGAAACCCTTCA	0.403																																							uc004bff.2		NA																	0				skin(1)	1						c.(1006-1008)AAG>AAA		zinc finger protein 483 isoform a							103.0	116.0	112.0					9																	114304223		2203	4300	6503	SO:0001819	synonymous_variant	158399				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:114304223G>A	AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1008G>A	9.37:g.114304223G>A						ZNF483_uc004bfg.2_Intron	p.K336K	NM_133464	NP_597721	Q8TF39	ZN483_HUMAN			6	1232	+			336					Q5VZN2|Q8NAE1	Silent	SNP	ENST00000309235.5	37	c.1008G>A	CCDS35106.1																																																																																				0.403	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	XM_088567		9	169	0	0	0	0.000978159	0	9	169				
GSN	2934	broad.mit.edu	37	9	124076248	124076248	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr9:124076248G>A	ENST00000373818.4	+	6	922	c.853G>A	c.(853-855)Gag>Aag	p.E285K	GSN_ENST00000373807.1_Missense_Mutation_p.E16K|GSN_ENST00000373808.2_Missense_Mutation_p.E234K|GSN_ENST00000436847.1_Missense_Mutation_p.E245K|GSN_ENST00000341272.2_Missense_Mutation_p.E234K|GSN_ENST00000545652.1_Missense_Mutation_p.E242K|GSN_ENST00000394353.2_Missense_Mutation_p.E245K|GSN_ENST00000412819.1_Missense_Mutation_p.E234K|GSN_ENST00000485767.1_3'UTR|GSN_ENST00000373823.3_Missense_Mutation_p.E234K|GSN_ENST00000449733.1_Missense_Mutation_p.E234K	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin	285					actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						TGCAGGTACCGAGGACACCGC	0.632																																							uc004blf.1		NA																	0				breast(2)|ovary(1)	3						c.(853-855)GAG>AAG		gelsolin isoform a precursor							86.0	76.0	79.0					9																	124076248		2203	4300	6503	SO:0001583	missense	2934				actin filament polymerization|actin filament severing|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|cilium morphogenesis	actin cytoskeleton|cytosol	actin binding|calcium ion binding|protein binding	g.chr9:124076248G>A	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.853G>A	9.37:g.124076248G>A	ENSP00000362924:p.Glu285Lys					GSN_uc004bld.1_Missense_Mutation_p.E234K|GSN_uc010mvq.1_Missense_Mutation_p.E245K|GSN_uc010mvr.1_Missense_Mutation_p.E245K|GSN_uc010mvu.1_Missense_Mutation_p.E234K|GSN_uc010mvt.1_Missense_Mutation_p.E234K|GSN_uc010mvs.1_Missense_Mutation_p.E234K|GSN_uc004ble.1_Missense_Mutation_p.E234K|GSN_uc010mvv.1_Missense_Mutation_p.E234K|GSN_uc011lyh.1_Missense_Mutation_p.E251K|GSN_uc011lyi.1_Missense_Mutation_p.E234K|GSN_uc011lyj.1_Missense_Mutation_p.E258K|GSN_uc004blg.1_Missense_Mutation_p.E16K	p.E285K	NM_000177	NP_000168	P06396	GELS_HUMAN			6	914	+			285					A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Missense_Mutation	SNP	ENST00000373818.4	37	c.853G>A	CCDS6828.1	.	.	.	.	.	.	.	.	.	.	G	9.146	1.015152	0.19355	.	.	ENSG00000148180	ENST00000373823;ENST00000432226;ENST00000436847;ENST00000394353;ENST00000449733;ENST00000412819;ENST00000341272;ENST00000373808;ENST00000394352;ENST00000456109;ENST00000545652;ENST00000373818;ENST00000373807	T;T;T;T;T;T;T;T;T;T;T	0.18810	2.46;2.19;2.46;2.46;2.46;2.46;2.46;2.46;2.46;2.45;2.23	5.26	5.26	0.73747	.	2.338630	0.02026	N	0.048214	T	0.13970	0.0338	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.19706	0.008;0.038;0.002;0.029;0.008	B;B;B;B;B	0.12837	0.002;0.008;0.001;0.004;0.002	T	0.24799	-1.0150	10	0.07644	T	0.81	-4.5703	13.4888	0.61382	0.0:0.0:0.8334:0.1666	.	258;242;245;16;285	B7Z9A0;F5H1A8;B7Z373;Q5T0H9;P06396	.;.;.;.;GELS_HUMAN	K	234;234;245;245;234;234;234;234;218;208;242;285;16	ENSP00000362929:E234K;ENSP00000404226:E234K;ENSP00000411293:E245K;ENSP00000377882:E245K;ENSP00000409358:E234K;ENSP00000416586:E234K;ENSP00000340888:E234K;ENSP00000362914:E234K;ENSP00000445823:E242K;ENSP00000362924:E285K;ENSP00000362913:E16K	ENSP00000340888:E234K	E	+	1	0	GSN	123116069	1.000000	0.71417	0.147000	0.22382	0.130000	0.20726	7.200000	0.77838	2.439000	0.82584	0.655000	0.94253	GAG		0.632	GSN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053861.1	NM_000177		9	66	0	0	0	0.000442599	0	9	66				
ZBTB6	10773	broad.mit.edu	37	9	125673231	125673231	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr9:125673231T>C	ENST00000373659.3	-	2	1209	c.1121A>G	c.(1120-1122)aAc>aGc	p.N374S		NM_006626.5	NP_006617.1	Q15916	ZBTB6_HUMAN	zinc finger and BTB domain containing 6	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	11						ACTGTGTATGTTCAAGTGGTC	0.478																																							uc004bnh.2		NA																	0					0						c.(1120-1122)AAC>AGC		zinc finger and BTB domain containing 6							104.0	92.0	96.0					9																	125673231		2203	4300	6503	SO:0001583	missense	10773				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:125673231T>C	X82018	CCDS6846.1	9q33.1-q33.3	2013-01-08	2006-04-10	2006-04-10	ENSG00000186130	ENSG00000186130		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16764	protein-coding gene	gene with protein product		605976	"""zinc finger protein 482"""	ZNF482		7958847	Standard	NM_006626		Approved	ZID	uc004bnh.4	Q15916	OTTHUMG00000020628	ENST00000373659.3:c.1121A>G	9.37:g.125673231T>C	ENSP00000362763:p.Asn374Ser						p.N374S	NM_006626	NP_006617	Q15916	ZBTB6_HUMAN			2	1210	-			374			C2H2-type 3.		A8K8N6	Missense_Mutation	SNP	ENST00000373659.3	37	c.1121A>G	CCDS6846.1	.	.	.	.	.	.	.	.	.	.	T	17.42	3.385519	0.61956	.	.	ENSG00000186130	ENST00000373659	T	0.12569	2.67	5.74	5.74	0.90152	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.23766	0.0575	N	0.20574	0.59	0.54753	D	0.999988	D	0.76494	0.999	D	0.76071	0.987	T	0.03157	-1.1066	10	0.49607	T	0.09	.	15.511	0.75782	0.0:0.0:0.0:1.0	.	374	Q15916	ZBTB6_HUMAN	S	374	ENSP00000362763:N374S	ENSP00000362763:N374S	N	-	2	0	ZBTB6	124713052	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	6.186000	0.72026	2.317000	0.78254	0.459000	0.35465	AAC		0.478	ZBTB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053962.1	NM_006626		4	28	0	0	0	0.00024832	0	4	28				
SPTAN1	6709	broad.mit.edu	37	9	131370516	131370516	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr9:131370516C>G	ENST00000372731.4	+	34	4562	c.4452C>G	c.(4450-4452)atC>atG	p.I1484M	SPTAN1_ENST00000372739.3_Missense_Mutation_p.I1484M|SPTAN1_ENST00000358161.5_Missense_Mutation_p.I1484M	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1484					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						AGGCTCTGATCAAAAAACATG	0.493																																					NSCLC(120;833 1744 2558 35612 37579)	NSCLC(120;833 1744 2558 35612 37579)	uc004bvl.3		NA																	0				breast(5)|ovary(4)|pancreas(1)	10						c.(4450-4452)ATC>ATG		spectrin, alpha, non-erythrocytic 1							145.0	146.0	146.0					9																	131370516		2203	4300	6503	SO:0001583	missense	6709				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton	g.chr9:131370516C>G	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.4452C>G	9.37:g.131370516C>G	ENSP00000361816:p.Ile1484Met					SPTAN1_uc004bvm.3_Missense_Mutation_p.I1484M|SPTAN1_uc004bvn.3_Missense_Mutation_p.I1464M	p.I1484M	NM_003127	NP_003118	Q13813	SPTA2_HUMAN			34	4565	+			1484			Spectrin 16.		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	c.4452C>G	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622543	0.28889	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.44881	0.91;0.91;0.91	5.54	0.412	0.16397	.	0.000000	0.85682	D	0.000000	T	0.54255	0.1847	M	0.70787	2.145	0.58432	D	0.999999	D;B;B	0.71674	0.998;0.014;0.018	D;B;B	0.91635	0.999;0.005;0.008	T	0.47598	-0.9105	10	0.30854	T	0.27	.	6.3273	0.21251	0.3434:0.4851:0.1105:0.061	.	1464;1484;1484	Q13813-3;Q13813-2;Q13813	.;.;SPTA2_HUMAN	M	1484;1484;1484;1464	ENSP00000350882:I1484M;ENSP00000361816:I1484M;ENSP00000361824:I1484M	ENSP00000350882:I1484M	I	+	3	3	SPTAN1	130410337	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	1.910000	0.39927	-0.105000	0.12132	-0.122000	0.15005	ATC		0.493	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127		14	187	0	0	0	0.000422831	0	14	187				
DHRSX	207063	broad.mit.edu	37	X	2161228	2161228	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:2161228C>A	ENST00000334651.5	-	6	692	c.640G>T	c.(640-642)Gcc>Tcc	p.A214S		NM_145177.2	NP_660160.2	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked	214							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)	16		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AGGACAAGGGCCAGCTTGCTC	0.642																																							uc004cqf.3		NA																	0					0						c.(640-642)GCC>TCC		dehydrogenase/reductase (SDR family) X-linked							130.0	113.0	119.0					X																	2161228		2203	4296	6499	SO:0001583	missense	207063						binding|oxidoreductase activity	g.chrX:2161228C>A	AJ293620	CCDS35195.1	Xp22.33 and Yp11.2	2014-05-07	2003-09-12		ENSG00000169084	ENSG00000169084		"""Pseudoautosomal regions / PAR1"""	18399	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 6"", ""short chain dehydrogenase/reductase family 46C, member 1"", ""dehydrogenase/reductase (SDR family) Y-linked"""		"""dehydrogenase/reductase (SDR family) X chromosome"""			11731500, 19027726	Standard	NM_145177		Approved	DHRS5X, DHRSXY, DHRSY, DHRS5Y, SDR46C1, SDR7C6	uc004cqf.4	Q8N5I4	OTTHUMG00000021068	ENST00000334651.5:c.640G>T	X.37:g.2161228C>A	ENSP00000334113:p.Ala214Ser						p.A214S	NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN			6	689	-		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)	214					Q6UWC7|Q8WUS4|Q96GR8|Q9NTF6	Missense_Mutation	SNP	ENST00000334651.5	37	c.640G>T	CCDS35195.1	.	.	.	.	.	.	.	.	.	.	C	13.14	2.149081	0.37923	.	.	ENSG00000169084	ENST00000334651;ENST00000412516	D;D	0.94613	-3.47;-3.47	1.45	1.45	0.22620	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.000000	0.85682	U	0.000000	D	0.96513	0.8862	M	0.81802	2.56	0.22796	N	0.998724	D	0.89917	1.0	D	0.97110	1.0	D	0.91176	0.4972	10	0.87932	D	0	.	10.968	0.47424	0.0:1.0:0.0:0.0	.	214	Q8N5I4	DHRSX_HUMAN	S	214;191	ENSP00000334113:A214S;ENSP00000391778:A191S	ENSP00000334113:A214S	A	-	1	0	DHRSX	2171228	1.000000	0.71417	0.990000	0.47175	0.360000	0.29518	5.877000	0.69675	0.430000	0.26230	0.054000	0.15206	GCC		0.642	DHRSX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055617.3	NM_145177		12	52	1	0	7.93312e-07	0.000219431	1.10364e-05	12	52				
CNKSR2	22866	broad.mit.edu	37	X	21670428	21670428	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:21670428G>C	ENST00000379510.3	+	22	2930	c.2894G>C	c.(2893-2895)aGa>aCa	p.R965T	CNKSR2_ENST00000425654.2_Missense_Mutation_p.R935T	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	965					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						TTTCAGGCCAGAGAAGGGGAA	0.353																																							uc004czx.1		NA																	0				large_intestine(1)|lung(1)	2						c.(2893-2895)AGA>ACA		connector enhancer of kinase suppressor of Ras							77.0	66.0	70.0					X																	21670428		2203	4300	6503	SO:0001583	missense	22866				regulation of signal transduction	cytoplasm|membrane	protein binding	g.chrX:21670428G>C	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2894G>C	X.37:g.21670428G>C	ENSP00000368824:p.Arg965Thr					CNKSR2_uc011mjo.1_Missense_Mutation_p.R935T	p.R965T	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN			22	2930	+			965					B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	c.2894G>C	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375930	0.24857	.	.	ENSG00000149970	ENST00000425654;ENST00000379510	T;T	0.16897	2.31;2.33	5.8	5.8	0.92144	.	0.107795	0.64402	D	0.000004	T	0.13415	0.0325	L	0.38175	1.15	0.80722	D	1	P;P	0.41041	0.554;0.736	B;B	0.33196	0.159;0.159	T	0.02156	-1.1204	10	0.72032	D	0.01	-28.168	12.4057	0.55439	0.0784:0.0:0.9216:0.0	.	935;965	B7ZLJ1;Q8WXI2	.;CNKR2_HUMAN	T	935;965	ENSP00000397906:R935T;ENSP00000368824:R965T	ENSP00000368824:R965T	R	+	2	0	CNKSR2	21580349	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.436000	0.59948	2.439000	0.82584	0.544000	0.68410	AGA		0.353	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927		3	34	0	0	0	6.4e-05	0	3	34				
USP11	8237	broad.mit.edu	37	X	47104820	47104820	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:47104820C>G	ENST00000218348.3	+	17	2338	c.2338C>G	c.(2338-2340)Cgg>Ggg	p.R780G	USP11_ENST00000377107.2_Missense_Mutation_p.R737G	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	780	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						GGCTCCCGTGCGGCTGCAGGA	0.592																																							uc004dhp.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(2338-2340)CGG>GGG		ubiquitin specific peptidase 11							63.0	49.0	54.0					X																	47104820		2203	4300	6503	SO:0001583	missense	8237				protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chrX:47104820C>G	U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.2338C>G	X.37:g.47104820C>G	ENSP00000218348:p.Arg780Gly					USP11_uc004dhq.2_Missense_Mutation_p.R506G	p.R780G	NM_004651	NP_004642	P51784	UBP11_HUMAN			17	2338	+			780					B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	ENST00000218348.3	37	c.2338C>G	CCDS14277.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.681489	0.47991	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.28666	1.6;1.6	5.08	5.08	0.68730	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.357838	0.27270	N	0.020130	T	0.20373	0.0490	N	0.12569	0.235	0.27570	N	0.949902	B;P	0.43024	0.042;0.798	B;P	0.45195	0.115;0.473	T	0.06232	-1.0838	10	0.41790	T	0.15	-11.4542	8.0917	0.30805	0.1763:0.6557:0.168:0.0	.	506;780	B3KP28;P51784	.;UBP11_HUMAN	G	737;780	ENSP00000366311:R737G;ENSP00000218348:R780G	ENSP00000218348:R780G	R	+	1	2	USP11	46989764	0.995000	0.38212	1.000000	0.80357	0.938000	0.57974	1.662000	0.37418	2.113000	0.64589	0.436000	0.28706	CGG		0.592	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651		4	23	0	0	0	0.000602214	0	4	23				
KIF4A	24137	broad.mit.edu	37	X	69640065	69640065	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:69640065A>C	ENST00000374403.3	+	31	3731	c.3649A>C	c.(3649-3651)Aac>Cac	p.N1217H	GDPD2_ENST00000538649.1_5'Flank|GDPD2_ENST00000374382.3_5'Flank|GDPD2_ENST00000453994.2_5'Flank|GDPD2_ENST00000536730.1_5'Flank	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	1217	Globular.|Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TCTGGCCAGCAACACCAGCTT	0.517																																							uc004dyg.2		NA																	0				ovary(4)	4						c.(3649-3651)AAC>CAC		kinesin family member 4							40.0	38.0	39.0					X																	69640065		2203	4300	6503	SO:0001583	missense	24137				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding	g.chrX:69640065A>C	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.3649A>C	X.37:g.69640065A>C	ENSP00000363524:p.Asn1217His					KIF4A_uc010nkw.2_Missense_Mutation_p.N1217H|GDPD2_uc010nkx.1_5'Flank|GDPD2_uc010nky.1_5'Flank|GDPD2_uc004dyh.2_5'Flank|GDPD2_uc011mpk.1_5'Flank|GDPD2_uc011mpl.1_5'Flank|GDPD2_uc011mpm.1_5'Flank	p.N1217H	NM_012310	NP_036442	O95239	KIF4A_HUMAN			31	3776	+			1217			Globular.|Interaction with PRC1.		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	37	c.3649A>C	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	A	17.82	3.484134	0.63962	.	.	ENSG00000090889	ENST00000374403;ENST00000544650	T	0.51574	0.7	4.75	4.75	0.60458	.	0.091297	0.47093	D	0.000243	T	0.45337	0.1337	L	0.51422	1.61	0.80722	D	1	P	0.46395	0.877	P	0.45037	0.467	T	0.38757	-0.9646	9	.	.	.	.	11.3119	0.49368	1.0:0.0:0.0:0.0	.	1217	O95239	KIF4A_HUMAN	H	1217;519	ENSP00000363524:N1217H	.	N	+	1	0	KIF4A	69556790	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.484000	0.66844	1.872000	0.54250	0.483000	0.47432	AAC		0.517	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310		3	24	0	0	0	6.4e-05	0	3	24				
MAGEE1	57692	broad.mit.edu	37	X	75650135	75650136	+	Nonsense_Mutation	DNP	GG	GG	CT			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:75650135_75650136GG>CT	ENST00000361470.2	+	1	2090_2091	c.1812_1813GG>CT	c.(1810-1815)tgGGaa>tgCTaa	p.604_605WE>C*		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	604	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						CTGAGATTTGGGAAATGCTCTG	0.5																																							uc004ecm.1		NA																	0				breast(3)|ovary(1)|pancreas(1)|skin(1)	6						c.(1810-1815)TGGGAA>TGCTAA		melanoma antigen family E, 1																																				SO:0001587	stop_gained	57692					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane		g.chrX:75650135_75650136GG>CT	AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	Exception_encountered	X.37:g.75650135_75650136delinsCT	ENSP00000354912:p.W604_E605delinsC*						p.604_605WE>C*	NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN			1	2019_2020	+			604_605			MAGE 1.		Q5JXC7|Q86TG0|Q8TD92|Q9H216	Nonsense_Mutation	DNP	ENST00000361470.2	37	c.1812_1813GG>CT	CCDS14433.1																																																																																				0.500	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932		4	29	0	0	0	6.4e-05	0	4	29				
PCDH11X	27328	broad.mit.edu	37	X	91131897	91131897	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:91131897A>C	ENST00000373094.1	+	2	1503	c.658A>C	c.(658-660)Aag>Cag	p.K220Q	PCDH11X_ENST00000361655.2_Missense_Mutation_p.K220Q|PCDH11X_ENST00000298274.8_Missense_Mutation_p.K220Q|PCDH11X_ENST00000361724.1_Missense_Mutation_p.K220Q|PCDH11X_ENST00000504220.2_Missense_Mutation_p.K220Q|PCDH11X_ENST00000373097.1_Missense_Mutation_p.K220Q|PCDH11X_ENST00000373088.1_Missense_Mutation_p.K220Q|PCDH11X_ENST00000395337.2_Missense_Mutation_p.K220Q|PCDH11X_ENST00000406881.1_Missense_Mutation_p.K220Q	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	220	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GATGAAAGTAAAGGTTGAAGA	0.418																																					NSCLC(38;925 1092 2571 38200 45895)	NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	0				large_intestine(2)	2						c.(658-660)AAG>CAG		protocadherin 11 X-linked isoform c							240.0	209.0	219.0					X																	91131897		2203	4300	6503	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91131897A>C	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.658A>C	X.37:g.91131897A>C	ENSP00000362186:p.Lys220Gln					PCDH11X_uc004efl.1_Missense_Mutation_p.K220Q|PCDH11X_uc004efo.1_Missense_Mutation_p.K220Q|PCDH11X_uc010nmv.1_Missense_Mutation_p.K220Q|PCDH11X_uc004efm.1_Missense_Mutation_p.K220Q|PCDH11X_uc004efn.1_Missense_Mutation_p.K220Q|PCDH11X_uc004efh.1_Missense_Mutation_p.K220Q|PCDH11X_uc004efj.1_Missense_Mutation_p.K220Q	p.K220Q	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN			2	1503	+			220			Extracellular (Potential).|Cadherin 2.		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.658A>C	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	A	17.21	3.330986	0.60853	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13	4.69	4.69	0.59074	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.35393	0.0930	L	0.37850	1.14	0.43103	D	0.994791	D;D;D;D;D;D;D;D	0.89917	1.0;0.993;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.963;0.999;1.0;1.0;1.0;0.999;0.999	T	0.13737	-1.0498	10	0.72032	D	0.01	.	12.4567	0.55708	1.0:0.0:0.0:0.0	.	220;220;220;220;220;220;220;220	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	Q	220	ENSP00000378746:K220Q;ENSP00000362186:K220Q;ENSP00000362189:K220Q;ENSP00000355040:K220Q;ENSP00000362180:K220Q;ENSP00000423762:K220Q;ENSP00000355105:K220Q;ENSP00000384758:K220Q;ENSP00000298274:K220Q	ENSP00000298274:K220Q	K	+	1	0	PCDH11X	91018553	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.982000	0.76173	1.526000	0.49068	0.441000	0.28932	AAG		0.418	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		4	143	0	0	0	0.00024832	0	4	143				
COL4A6	1288	broad.mit.edu	37	X	107464479	107464479	+	Silent	SNP	T	T	C			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:107464479T>C	ENST00000372216.4	-	4	373	c.273A>G	c.(271-273)aaA>aaG	p.K91K	COL4A6_ENST00000394872.2_Silent_p.K90K|COL4A6_ENST00000545689.1_Silent_p.K90K|COL4A6_ENST00000334504.7_Silent_p.K90K|COL4A6_ENST00000538570.1_Silent_p.K90K	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	91	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CCTTATCTCCTTTTGGTCCAT	0.458									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)	Melanoma(87;1895 1945 2589 7165)	uc004enw.3		NA																	0				ovary(6)|urinary_tract(1)|large_intestine(1)	8						c.(271-273)AAA>AAG		type IV alpha 6 collagen isoform A precursor							174.0	151.0	159.0					X																	107464479		2203	4300	6503	SO:0001819	synonymous_variant	1288	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107464479T>C	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.273A>G	X.37:g.107464479T>C						COL4A6_uc004env.3_Silent_p.K90K|COL4A6_uc011msn.1_Silent_p.K90K|COL4A6_uc010npk.2_Silent_p.K90K	p.K91K	NM_001847	NP_001838	Q14031	CO4A6_HUMAN			4	376	-			91			Triple-helical region.		Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	ENST00000372216.4	37	c.273A>G	CCDS14541.1																																																																																				0.458	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2			4	171	0	0	0	3.59834e-05	0	4	171				
NKRF	55922	broad.mit.edu	37	X	118723544	118723544	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:118723544C>A	ENST00000371527.1	-	2	2496	c.1844G>T	c.(1843-1845)cGc>cTc	p.R615L	NKRF_ENST00000542113.1_Missense_Mutation_p.R630L|NKRF_ENST00000304449.5_Missense_Mutation_p.R615L|NKRF_ENST00000487600.1_Intron	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor	615	R3H. {ECO:0000255|PROSITE- ProRule:PRU00382}.			AR -> ES (in Ref. 1; CAB56459). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						GCTCTCGGAGCGGGCGTAGTT	0.448																																							uc004erq.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1843-1845)CGC>CTC		transcription factor NRF							152.0	133.0	140.0					X																	118723544		2203	4300	6503	SO:0001583	missense	55922				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|double-stranded RNA binding	g.chrX:118723544C>A	AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.1844G>T	X.37:g.118723544C>A	ENSP00000360582:p.Arg615Leu					NKRF_uc004err.2_Missense_Mutation_p.R615L	p.R615L	NM_017544	NP_060014	O15226	NKRF_HUMAN			2	2497	-			615	AR -> ES (in Ref. 1; CAB56459).		R3H.		G3V1N1|Q4VC41|Q9UJ91	Missense_Mutation	SNP	ENST00000371527.1	37	c.1844G>T	CCDS35375.1	.	.	.	.	.	.	.	.	.	.	C	7.527	0.657839	0.14645	.	.	ENSG00000186416	ENST00000371527;ENST00000304449;ENST00000542113	T;T;T	0.47177	0.85;0.85;0.85	5.77	4.9	0.64082	Single-stranded nucleic acid binding R3H (3);	0.507790	0.22516	N	0.059023	T	0.35970	0.0950	L	0.43152	1.355	0.35791	D	0.822404	B	0.09022	0.002	B	0.18871	0.023	T	0.36432	-0.9748	10	0.21014	T	0.42	-8.2935	7.4207	0.27071	0.0:0.7108:0.1378:0.1514	.	615	O15226	NKRF_HUMAN	L	615;615;630	ENSP00000360582:R615L;ENSP00000304803:R615L;ENSP00000442308:R630L	ENSP00000304803:R615L	R	-	2	0	NKRF	118607572	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	1.369000	0.34227	2.424000	0.82194	0.600000	0.82982	CGC		0.448	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058044.1	NM_017544		18	109	1	0	5.3912e-06	0.00074312	7.3277e-05	18	109				
THOC2	57187	broad.mit.edu	37	X	122756691	122756691	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:122756691G>A	ENST00000245838.8	-	30	3734	c.3703C>T	c.(3703-3705)Cag>Tag	p.Q1235*	THOC2_ENST00000497887.1_5'Flank|THOC2_ENST00000491737.1_Nonsense_Mutation_p.Q1120*|THOC2_ENST00000355725.4_Nonsense_Mutation_p.Q1235*	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1235					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						ACACCACACTGAGATCTCTCC	0.358																																							uc004etu.2		NA																	0				ovary(3)	3						c.(3703-3705)CAG>TAG		THO complex 2							110.0	90.0	96.0					X																	122756691		1843	4074	5917	SO:0001587	stop_gained	57187				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding	g.chrX:122756691G>A	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.3703C>T	X.37:g.122756691G>A	ENSP00000245838:p.Gln1235*					THOC2_uc010nqt.1_5'Flank|THOC2_uc004etw.1_Nonsense_Mutation_p.Q56*	p.Q1235*	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN			30	3735	-			1235					A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Nonsense_Mutation	SNP	ENST00000245838.8	37	c.3703C>T	CCDS43988.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	9.933970|9.933970	0.99299|0.99299	.|.	.|.	ENSG00000125676|ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737|ENST00000438358	.|.	.|.	.|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.000000|.	0.64402|.	D|.	0.000005|.	.|T	.|0.74680	.|0.3748	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72204	.|-0.4361	.|4	0.05525|0.35671	T|T	0.97|0.21	-8.9954|-8.9954	18.8411|18.8411	0.92184|0.92184	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1235;1235;1120|329	.|.	ENSP00000245838:Q1235X|ENSP00000416639:S329L	Q|S	-|-	1|2	0|0	THOC2|THOC2	122584372|122584372	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.227000|7.227000	0.78070|0.78070	2.397000|2.397000	0.81536|0.81536	0.538000|0.538000	0.68166|0.68166	CAG|TCA		0.358	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3			10	27	0	0	0	0.000442599	0	10	27				
THOC2	57187	broad.mit.edu	37	X	122765704	122765704	+	Splice_Site	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:122765704C>A	ENST00000245838.8	-	22	2348		c.e22-1		THOC2_ENST00000491737.1_Splice_Site|THOC2_ENST00000355725.4_Splice_Site	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2						mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TATCATGACACTAAATTTAAA	0.294																																							uc004etu.2		NA																	0				ovary(3)	3						c.e22-1		THO complex 2							105.0	98.0	100.0					X																	122765704		1805	4068	5873	SO:0001630	splice_region_variant	57187				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding	g.chrX:122765704C>A	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.2317-1G>T	X.37:g.122765704C>A						THOC2_uc011muh.1_Splice_Site_p.C698_splice	p.C773_splice	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN			22	2349	-								A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Splice_Site	SNP	ENST00000245838.8	37	c.2317_splice	CCDS43988.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.180644	0.78677	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0706	0.72034	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	THOC2	122593385	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.802000	0.85969	2.441000	0.82636	0.594000	0.82650	.		0.294	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		Intron	27	165	1	0	9.80776e-20	0.00106085	1.57791e-18	27	165				
TENM1	10178	broad.mit.edu	37	X	123805647	123805647	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:123805647C>A	ENST00000371130.3	-	6	1117	c.1054G>T	c.(1054-1056)Gtt>Ttt	p.V352F	TENM1_ENST00000422452.2_Missense_Mutation_p.V352F	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	352					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TCTCCTTCAACTGGTTGCAAC	0.458																																							uc004euj.2		NA																	0				ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(1054-1056)GTT>TTT		odz, odd Oz/ten-m homolog 1 isoform 3							184.0	158.0	167.0					X																	123805647		2203	4299	6502	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123805647C>A	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1054G>T	X.37:g.123805647C>A	ENSP00000360171:p.Val352Phe					ODZ1_uc011muj.1_Missense_Mutation_p.V351F|ODZ1_uc010nqy.2_Missense_Mutation_p.V352F	p.V352F	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN			6	1118	-			352			Extracellular (Potential).		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.1054G>T	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.353059	0.61293	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86865	-2.18;-2.14	5.97	5.09	0.68999	.	0.315716	0.28946	N	0.013628	D	0.88782	0.6530	L	0.55481	1.735	0.51012	D	0.999902	D;D;D	0.62365	0.991;0.991;0.96	P;P;P	0.52109	0.69;0.593;0.521	D	0.88398	0.3013	10	0.49607	T	0.09	.	15.4146	0.74956	0.14:0.86:0.0:0.0	.	351;352;352	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	F	352	ENSP00000360171:V352F;ENSP00000403954:V352F	ENSP00000360171:V352F	V	-	1	0	ODZ1	123633328	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.677000	0.68142	1.208000	0.43306	0.594000	0.82650	GTT		0.458	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		11	63	1	0	1.08611e-07	0.000978159	1.55675e-06	11	63				
HAUS7	55559	broad.mit.edu	37	X	152734615	152734616	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chrX:152734615_152734616CC>AA	ENST00000370211.4	-	2	285_286	c.242_243GG>TT	c.(241-243)tGG>tTT	p.W81F	HAUS7_ENST00000370212.3_Missense_Mutation_p.W81F|TREX2_ENST00000338525.2_5'UTR|TREX2_ENST00000334497.2_5'UTR|HAUS7_ENST00000421080.2_5'UTR|HAUS7_ENST00000370210.1_Missense_Mutation_p.W71F|TREX2_ENST00000370232.1_5'UTR|TREX2_ENST00000330912.2_5'UTR	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7	81					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						GGGTACACATCCACTCTAGGAT	0.554																																							uc004fho.1		NA																	0					0						c.(241-243)TGG>TTT		HAUS augmin-like complex subunit 7																																				SO:0001583	missense	55559				cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleolus|plasma membrane|spindle	thioesterase binding	g.chrX:152734615_152734616CC>AA	AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.242_243delinsAA	X.37:g.152734615_152734616delinsAA	ENSP00000359230:p.Trp81Phe					HAUS7_uc004fhl.2_RNA|HAUS7_uc004fhm.2_RNA|HAUS7_uc004fhn.1_Missense_Mutation_p.W81F|HAUS7_uc004fhp.1_RNA|HAUS7_uc011myq.1_RNA	p.W81F	NM_017518	NP_059988	Q99871	HAUS7_HUMAN			2	800_801	-			81					B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Missense_Mutation	DNP	ENST00000370211.4	37	c.242_243GG>TT	CCDS35438.1																																																																																				0.554	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060963.2	NM_017518		18	125	0	0	0	6.4e-05	0	18	125				
PRG4	10216	broad.mit.edu	37	1	186276143	186276145	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	CTC	CTC	-	-	CTC	CTC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr1:186276143_186276145delCTC	ENST00000445192.2	+	7	1337_1339	c.1292_1294delCTC	c.(1291-1296)actccc>acc	p.P432del	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367485.4_In_Frame_Del_p.P339del|PRG4_ENST00000367483.4_In_Frame_Del_p.P391del|PRG4_ENST00000367486.3_In_Frame_Del_p.P389del	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	432	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						GCACCCACCACTCCCAAGGAGCC	0.655																																							uc001gru.3		NA																	0				skin(1)	1						c.(1291-1296)ACTCCC>ACC		proteoglycan 4 isoform A																																				SO:0001651	inframe_deletion	10216				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity	g.chr1:186276143_186276145delCTC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1292_1294delCTC	1.37:g.186276143_186276145delCTC	ENSP00000399679:p.Pro432del					PRG4_uc001grt.3_In_Frame_Del_p.P391del|PRG4_uc009wyl.2_In_Frame_Del_p.P339del|PRG4_uc009wym.2_In_Frame_Del_p.P298del|PRG4_uc010poo.1_Intron	p.P432del	NM_005807	NP_005798	Q92954	PRG4_HUMAN			7	1343_1345	+			432			59 X 8 AA repeats of K-X-P-X-P-T-T-X.|11; approximate.		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	In_Frame_Del	DEL	ENST00000445192.2	37	c.1292_1294delCTC	CCDS1369.1																																																																																				0.655	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807		7	73	NA	NA	NA	NA	NA	7	73	---	---	---	---
CACNA2D4	93589	broad.mit.edu	37	12	1965249	1965249	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr12:1965249delG	ENST00000382722.5	-	22	2443	c.2081delC	c.(2080-2082)ccafs	p.P694fs	CACNA2D4_ENST00000585732.1_Frame_Shift_Del_p.P555fs|CACNA2D4_ENST00000586184.1_Frame_Shift_Del_p.P694fs|CACNA2D4_ENST00000587995.1_Frame_Shift_Del_p.P669fs|CACNA2D4_ENST00000585708.1_Frame_Shift_Del_p.P630fs|CACNA2D4_ENST00000588077.1_Frame_Shift_Del_p.P630fs|CACNA2D4_ENST00000539048.2_5'UTR	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	694					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CCGGTGGTCTGGGTCAATATC	0.532																																					Colon(2;101 179 21030 23310 28141)	Colon(2;101 179 21030 23310 28141)	uc001qjp.2		NA																	0				ovary(1)	1						c.(2080-2082)CCAfs		voltage-gated calcium channel alpha(2)delta-4							78.0	86.0	84.0					12																	1965249		2013	4174	6187	SO:0001589	frameshift_variant	93589					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity	g.chr12:1965249delG	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2081delC	12.37:g.1965249delG	ENSP00000372169:p.Pro694fs					CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Frame_Shift_Del_p.P558fs|CACNA2D4_uc009zdr.1_5'Flank	p.P694fs	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)	22	2312	-	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	694			Extracellular (Potential).		Q7Z3S8|Q86XZ5|Q8IZS9	Frame_Shift_Del	DEL	ENST00000382722.5	37	c.2081delC	CCDS44785.1																																																																																				0.532	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2			9	66	NA	NA	NA	NA	NA	9	66	---	---	---	---
VPS4A	27183	broad.mit.edu	37	16	69354959	69354959	+	Frame_Shift_Del	DEL	A	A	-			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr16:69354959delA	ENST00000254950.11	+	9	1013	c.857delA	c.(856-858)gaafs	p.E286fs	COG8_ENST00000564419.1_Intron	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				TCTAGGTTTGAAAAACGAATT	0.542																																							uc002eww.2		NA																	0					0						c.(856-858)GAAfs		vacuolar protein sorting factor 4A							37.0	41.0	40.0					16																	69354959		2194	4295	6489	SO:0001589	frameshift_variant	27183				cell cycle|cellular membrane organization|cytokinesis|endosome transport|protein transport	cytosol|late endosome membrane|midbody|perinuclear region of cytoplasm	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein domain specific binding	g.chr16:69354959delA	AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.857delA	16.37:g.69354959delA	ENSP00000254950:p.Glu286fs						p.E286fs	NM_013245	NP_037377	Q9UN37	VPS4A_HUMAN			9	985	+		Ovarian(137;0.101)	286						Frame_Shift_Del	DEL	ENST00000254950.11	37	c.857delA	CCDS45517.1																																																																																				0.542	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430563.3	NM_013245		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
TVP23B	51030	broad.mit.edu	37	17	18694214	18694215	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr17:18694214_18694215delCA	ENST00000307767.8	+	3	400_401	c.101_102delCA	c.(100-102)ccafs	p.P34fs	TVP23B_ENST00000581733.1_5'UTR|TVP23B_ENST00000476139.1_5'UTR|TVP23B_ENST00000574226.1_Frame_Shift_Del_p.P34fs	NM_016078.4	NP_057162.4	Q9NYZ1	TV23B_HUMAN	trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)	34						integral component of membrane (GO:0016021)											TTCAGACATCCAGTAGCATCGT	0.381																																							uc002gum.2		NA																	0					0						c.(100-102)CCAfs		hypothetical protein LOC51030																																				SO:0001589	frameshift_variant	51030					integral to membrane		g.chr17:18694214_18694215delCA	AF151906	CCDS42274.1	17p11.2	2012-11-29	2012-11-29	2012-11-29	ENSG00000171928	ENSG00000171928			20399	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B"", ""family with sequence similarity 18, member B1"""	FAM18B, FAM18B1		10810093	Standard	NM_016078		Approved	CGI-148, YDR084C	uc002gum.2	Q9NYZ1	OTTHUMG00000059052	ENST00000307767.8:c.101_102delCA	17.37:g.18694214_18694215delCA	ENSP00000305654:p.Pro34fs					FAM18B_uc002gun.2_5'UTR	p.P34fs	NM_016078	NP_057162	Q9NYZ1	F18B1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.0872)|READ - Rectum adenocarcinoma(1115;0.0967)	3	126_127	+			34			Helical; (Potential).		A8K448|Q96HK5|Q9Y3E6	Frame_Shift_Del	DEL	ENST00000307767.8	37	c.101_102delCA	CCDS42274.1																																																																																				0.381	TVP23B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130667.2	NM_016078		38	135	NA	NA	NA	NA	NA	38	135	---	---	---	---
RRM2	6241	broad.mit.edu	37	2	10267088	10267088	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr2:10267088delC	ENST00000304567.5	+	6	725	c.656delC	c.(655-657)gctfs	p.A219fs	RRM2_ENST00000360566.2_Frame_Shift_Del_p.A279fs	NM_001034.3	NP_001025.1	P31350	RIR2_HUMAN	ribonucleotide reductase M2	219					deoxyribonucleoside diphosphate metabolic process (GO:0009186)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|skin(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)	Cladribine(DB00242)|Gallium nitrate(DB05260)	GACAAAGAGGCTACCTATGGT	0.453																																							uc002rah.2		NA																	0					0						c.(655-657)GCTfs		ribonucleotide reductase M2 polypeptide isoform							165.0	150.0	155.0					2																	10267088		2203	4300	6503	SO:0001589	frameshift_variant	6241				deoxyribonucleoside diphosphate metabolic process|deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol	ribonucleoside-diphosphate reductase activity|transition metal ion binding	g.chr2:10267088delC		CCDS1669.1, CCDS54334.1	2p25-p24	2012-10-02	2009-07-10		ENSG00000171848	ENSG00000171848	1.17.4.1		10452	protein-coding gene	gene with protein product		180390	"""ribonucleotide reductase M2 polypeptide"""				Standard	NM_001034		Approved		uc021vdr.1	P31350	OTTHUMG00000090449	ENST00000304567.5:c.656delC	2.37:g.10267088delC	ENSP00000302955:p.Ala219fs						p.A219fs	NM_001034	NP_001025	P31350	RIR2_HUMAN		Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)	6	847	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		219					B2R9B5|J3KP43|Q5WRU7	Frame_Shift_Del	DEL	ENST00000304567.5	37	c.656delC	CCDS1669.1																																																																																				0.453	RRM2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364902.2			23	110	NA	NA	NA	NA	NA	23	110	---	---	---	---
PGM5	5239	broad.mit.edu	37	9	71080103	71080103	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6979-01A-11D-1945-08	TCGA-55-6979-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5f246196-f56a-4c81-9ec9-18326dda0b05	e0e09b0c-f948-4919-95fb-5113d82769d6	g.chr9:71080103delG	ENST00000396396.1	+	7	1367	c.1138delG	c.(1138-1140)gggfs	p.G380fs	PGM5_ENST00000396392.1_Frame_Shift_Del_p.G380fs	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	380					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						CAATCTGTGTGGGGAAGAGAG	0.483																																							uc004agr.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1138-1140)GGGfs		phosphoglucomutase 5							212.0	192.0	199.0					9																	71080103		2203	4300	6503	SO:0001589	frameshift_variant	5239				cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity	g.chr9:71080103delG	L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1138delG	9.37:g.71080103delG	ENSP00000379678:p.Gly380fs						p.G380fs	NM_021965	NP_068800	Q15124	PGM5_HUMAN			7	1367	+			380					B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Frame_Shift_Del	DEL	ENST00000396396.1	37	c.1138delG	CCDS6622.2																																																																																				0.483	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052548.2	NM_021965		22	47	NA	NA	NA	NA	NA	22	47	---	---	---	---
