#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
TARDBP	23435	broad.mit.edu	37	1	11082410	11082410	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:11082410C>T	ENST00000240185.3	+	6	1058	c.944C>T	c.(943-945)gCg>gTg	p.A315V	TARDBP_ENST00000439080.2_Missense_Mutation_p.A199V|TARDBP_ENST00000315091.3_Intron	NM_007375.3	NP_031401.1	Q13148	TADBP_HUMAN	TAR DNA binding protein	315	Gly-rich.		A -> T (in ALS10; dbSNP:rs80356726). {ECO:0000269|PubMed:18288693, ECO:0000269|PubMed:18372902}.		3'-UTR-mediated mRNA stabilization (GO:0070935)|cell death (GO:0008219)|mRNA processing (GO:0006397)|negative regulation by host of viral transcription (GO:0043922)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)	11	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		AACTTTGGTGCGTTCAGCATT	0.532																																							uc001art.2		NA																	0				ovary(2)	2						c.(943-945)GCG>GTG		TAR DNA binding protein							75.0	71.0	73.0					1																	11082410		2203	4300	6503	SO:0001583	missense	23435				3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr1:11082410C>T	U23731	CCDS122.1	1p36.22	2014-09-17			ENSG00000120948	ENSG00000120948		"""RNA binding motif (RRM) containing"""	11571	protein-coding gene	gene with protein product		605078				7745706	Standard	NM_007375		Approved	TDP-43, ALS10	uc001art.3	Q13148	OTTHUMG00000002120	ENST00000240185.3:c.944C>T	1.37:g.11082410C>T	ENSP00000240185:p.Ala315Val					TARDBP_uc010oap.1_Missense_Mutation_p.A199V	p.A315V	NM_007375	NP_031401	Q13148	TADBP_HUMAN	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)	6	1078	+	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	315		A -> T (in ALS10).	Gly-rich.		A4GUK4|A4GUK5|A4GUK6|B2R629|B4DJ45|E2PU12|Q53H27|Q6FI92|Q96DJ0	Missense_Mutation	SNP	ENST00000240185.3	37	c.944C>T	CCDS122.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.711750	0.30322	.	.	ENSG00000120948	ENST00000240185;ENST00000439080	D;D	0.85088	-1.94;-1.94	5.81	5.81	0.92471	.	0.144183	0.64402	D	0.000005	T	0.78972	0.4368	L	0.33485	1.01	0.58432	D	0.999992	B;B	0.25850	0.136;0.024	B;B	0.11329	0.006;0.002	T	0.73219	-0.4052	10	0.16896	T	0.51	-17.2147	20.0826	0.97783	0.0:1.0:0.0:0.0	.	199;315	B4DJ45;Q13148	.;TADBP_HUMAN	V	315;199	ENSP00000240185:A315V;ENSP00000404666:A199V	ENSP00000240185:A315V	A	+	2	0	TARDBP	11004997	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.465000	0.66725	2.746000	0.94184	0.655000	0.94253	GCG		0.532	TARDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006063.1	NM_007375		5	82	0	0	0	0.000602	0	5	82				
PRAMEF11	440560	broad.mit.edu	37	1	12884933	12884933	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:12884933T>C	ENST00000535591.1	-	4	1373	c.1178A>G	c.(1177-1179)cAa>cGa	p.Q393R	RP5-845O24.8_ENST00000438401.1_lincRNA	NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	393					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						AGCCCTAATTTGAGCAAATCT	0.488																																							uc001auk.2		NA																	0					0						c.(1177-1179)CAA>CGA		PRAME family member 11							65.0	53.0	57.0					1																	12884933		692	1590	2282	SO:0001583	missense	440560							g.chr1:12884933T>C	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.1178A>G	1.37:g.12884933T>C	ENSP00000439551:p.Gln393Arg						p.Q393R	NM_001146344	NP_001139816	O60813	PRA11_HUMAN			4	1374	-			393						Missense_Mutation	SNP	ENST00000535591.1	37	c.1178A>G	CCDS53268.1	.	.	.	.	.	.	.	.	.	.	.	3.769	-0.047984	0.07407	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.54279	0.58;0.58	1.76	0.577	0.17385	.	1.896610	0.03048	N	0.154147	T	0.60625	0.2283	M	0.65498	2.005	0.09310	N	1	D	0.58268	0.982	P	0.54889	0.763	T	0.36480	-0.9746	10	0.31617	T	0.26	.	3.6333	0.08140	0.0:0.2138:0.0:0.7862	.	393	O60813	PRA11_HUMAN	R	393;434;393	ENSP00000439551:Q393R;ENSP00000391839:Q393R	ENSP00000328783:Q434R	Q	-	2	0	PRAMEF11	12807520	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.385000	0.07379	0.132000	0.18615	0.334000	0.21626	CAA		0.488	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341		30	317	0	0	0	0.00632	0	30	317				
WLS	79971	broad.mit.edu	37	1	68603589	68603589	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:68603589C>A	ENST00000262348.4	-	11	1643	c.1390G>T	c.(1390-1392)Ggc>Tgc	p.G464C	WLS_ENST00000354777.2_Missense_Mutation_p.G462C|WLS_ENST00000370976.3_Missense_Mutation_p.G373C|GNG12-AS1_ENST00000434072.1_RNA|GNG12-AS1_ENST00000413628.1_RNA|GNG12-AS1_ENST00000420587.1_RNA|WLS_ENST00000540432.1_Missense_Mutation_p.G464C	NM_024911.6	NP_079187.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator	464					anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						ACTGTGACGCCGCCCCATTTC	0.438																																							uc001def.1		NA																	0					0						c.(1390-1392)GGC>TGC		G protein-coupled receptor 177 isoform 1							98.0	91.0	93.0					1																	68603589		2203	4300	6503	SO:0001583	missense	79971				multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Wnt receptor signaling pathway	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	signal transducer activity	g.chr1:68603589C>A	BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000262348.4:c.1390G>T	1.37:g.68603589C>A	ENSP00000262348:p.Gly464Cys					uc001deb.1_Intron|uc001dec.1_Intron|WLS_uc001dee.2_Missense_Mutation_p.G462C|WLS_uc001deg.1_Missense_Mutation_p.G373C|WLS_uc009wbf.1_Missense_Mutation_p.G419C	p.G464C	NM_024911	NP_079187	Q5T9L3	WLS_HUMAN			11	1661	-			464			Lumenal (Potential).		B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	Missense_Mutation	SNP	ENST00000262348.4	37	c.1390G>T	CCDS642.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.452578	0.84209	.	.	ENSG00000116729	ENST00000540432;ENST00000354777;ENST00000262348;ENST00000370976	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.52	5.52	0.82312	.	0.267209	0.42821	N	0.000641	T	0.37839	0.1018	N	0.22421	0.69	0.58432	D	0.999997	D;D;P;D	0.62365	0.991;0.978;0.877;0.991	P;P;P;P	0.55260	0.649;0.772;0.555;0.649	T	0.27297	-1.0078	10	0.59425	D	0.04	-21.2831	19.8034	0.96518	0.0:1.0:0.0:0.0	.	464;373;464;462	F5H4K0;Q5JRS7;Q5T9L3;Q5T9L3-2	.;.;WLS_HUMAN;.	C	464;462;464;373	ENSP00000446112:G464C;ENSP00000346829:G462C;ENSP00000262348:G464C;ENSP00000360015:G373C	ENSP00000262348:G464C	G	-	1	0	WLS	68376177	0.983000	0.35010	0.130000	0.21974	0.907000	0.53573	4.465000	0.60141	2.760000	0.94817	0.655000	0.94253	GGC		0.438	WLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025368.1	NM_024911		12	53	1	0	2.27111e-07	0.001368	3.07699e-07	12	53				
ERICH3	127254	broad.mit.edu	37	1	75038965	75038965	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:75038965C>A	ENST00000326665.5	-	14	2647	c.2429G>T	c.(2428-2430)aGg>aTg	p.R810M	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		810	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CTTCCACGCCCTCAAGGGAGC	0.557																																							uc001dgg.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(2428-2430)AGG>ATG		hypothetical protein LOC127254							92.0	89.0	90.0					1																	75038965		2203	4300	6503	SO:0001583	missense	127254							g.chr1:75038965C>A																												ENST00000326665.5:c.2429G>T	1.37:g.75038965C>A	ENSP00000322609:p.Arg810Met						p.R810M	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN			14	2648	-			810			Glu-rich.		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	c.2429G>T	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054238	0.36277	.	.	ENSG00000178965	ENST00000326665	T	0.12672	2.66	5.54	2.65	0.31530	.	.	.	.	.	T	0.06781	0.0173	N	0.22421	0.69	0.09310	N	0.999999	D	0.54964	0.969	P	0.53146	0.719	T	0.23084	-1.0198	9	0.48119	T	0.1	-1.556	9.5311	0.39193	0.0:0.705:0.0:0.295	.	810	Q5RHP9	CA173_HUMAN	M	810	ENSP00000322609:R810M	ENSP00000322609:R810M	R	-	2	0	C1orf173	74811553	0.000000	0.05858	0.005000	0.12908	0.017000	0.09413	0.074000	0.14662	0.727000	0.32360	0.561000	0.74099	AGG		0.557	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			15	89	1	0	0.000308642	0.003163	0.000367744	15	89				
GBP3	2635	broad.mit.edu	37	1	89480335	89480335	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:89480335T>A	ENST00000370481.4	-	4	543	c.323A>T	c.(322-324)gAc>gTc	p.D108V	GBP3_ENST00000475853.2_5'Flank	NM_018284.2	NP_060754.2	Q8WXF7	ATLA1_HUMAN	guanylate binding protein 3	156	GB1/RHD3-type G.				axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		ATTCTGGTTGTCACCCTGGAA	0.473																																							uc001dmt.2		NA																	0				ovary(1)|pancreas(1)	2						c.(322-324)GAC>GTC		guanylate binding protein 3							133.0	114.0	120.0					1																	89480335		2203	4300	6503	SO:0001583	missense	2635					integral to membrane	GTP binding|GTPase activity	g.chr1:89480335T>A	BC063819	CCDS717.2	1p22.2	2008-02-05			ENSG00000117226	ENSG00000117226			4184	protein-coding gene	gene with protein product		600413				7518790	Standard	NM_018284		Approved	FLJ10961	uc001dmt.3	Q9H0R5	OTTHUMG00000010616	ENST00000370481.4:c.323A>T	1.37:g.89480335T>A	ENSP00000359512:p.Asp108Val					GBP3_uc010oss.1_Missense_Mutation_p.D29V|GBP3_uc001dmu.2_5'UTR|GBP3_uc001dmv.2_RNA	p.D108V	NM_018284	NP_060754	Q9H0R5	GBP3_HUMAN		all cancers(265;0.0103)|Epithelial(280;0.0293)	4	528	-		Lung NSC(277;0.123)	108					A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Missense_Mutation	SNP	ENST00000370481.4	37	c.323A>T	CCDS717.2	.	.	.	.	.	.	.	.	.	.	T	19.06	3.753877	0.69648	.	.	ENSG00000117226	ENST00000370482;ENST00000370481;ENST00000235878	T;T	0.76968	-1.06;-1.06	3.98	3.98	0.46160	Guanylate-binding protein, N-terminal (1);	0.225904	0.42682	D	0.000670	D	0.88280	0.6394	H	0.95004	3.61	0.52099	D	0.999942	D	0.69078	0.997	D	0.72338	0.977	D	0.90665	0.4593	10	0.87932	D	0	.	11.1563	0.48489	0.0:0.0:0.0:1.0	.	108	Q9H0R5	GBP3_HUMAN	V	108	ENSP00000359512:D108V;ENSP00000235878:D108V	ENSP00000235878:D108V	D	-	2	0	GBP3	89252923	0.968000	0.33430	0.983000	0.44433	0.936000	0.57629	4.413000	0.59795	1.806000	0.52798	0.496000	0.49642	GAC		0.473	GBP3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313541.3	NM_018284		25	61	0	0	0	0.008361	0	25	61				
RBM15	64783	broad.mit.edu	37	1	110882201	110882201	+	Silent	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:110882201C>T	ENST00000369784.3	+	1	1074	c.174C>T	c.(172-174)tcC>tcT	p.S58S	RBM15_ENST00000602849.1_Silent_p.S58S|RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000487146.2_Silent_p.S58S	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	58					negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CCAAACGCTCCCGTGGTGGTG	0.652			T	MKL1	acute megakaryocytic leukemia																																		uc001dzl.1		NA		Dom	yes		1	1p13	64783	T	RNA binding motif protein 15			L	MKL1		acute megakaryocytic leukemia		0				ovary(3)	3						c.(172-174)TCC>TCT		RNA binding motif protein 15							38.0	40.0	39.0					1																	110882201		2203	4300	6503	SO:0001819	synonymous_variant	64783				interspecies interaction between organisms	nucleus	nucleotide binding|protein binding|RNA binding	g.chr1:110882201C>T	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.174C>T	1.37:g.110882201C>T						RBM15_uc001dzm.1_Silent_p.S58S|uc001dzj.2_5'Flank	p.S58S	NM_022768	NP_073605	Q96T37	RBM15_HUMAN		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)	1	257	+		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)	58					A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Silent	SNP	ENST00000369784.3	37	c.174C>T	CCDS822.1																																																																																				0.652	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768		11	48	0	0	0	0.000978	0	11	48				
GJA5	2702	broad.mit.edu	37	1	147230940	147230940	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:147230940C>T	ENST00000271348.2	-	2	568	c.407G>A	c.(406-408)tGg>tAg	p.W136*	RP11-433J22.2_ENST00000428911.1_RNA|GJA5_ENST00000369237.1_Nonsense_Mutation_p.W136*	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	136					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			CCCTTCCTCCCAGCAGGACAG	0.602																																							uc001eps.1		NA																	0				ovary(1)	1						c.(406-408)TGG>TAG		connexin 40							78.0	74.0	75.0					1																	147230940		2203	4300	6503	SO:0001587	stop_gained	2702				angiogenesis|cell-cell junction assembly|muscle contraction	integral to membrane		g.chr1:147230940C>T		CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.407G>A	1.37:g.147230940C>T	ENSP00000271348:p.Trp136*					GJA5_uc001ept.1_Nonsense_Mutation_p.W136*	p.W136*	NM_181703	NP_859054	P36382	CXA5_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.202)		2	548	-	all_hematologic(923;0.0276)		136			Cytoplasmic (Potential).		Q5T3B6|Q5U0N6	Nonsense_Mutation	SNP	ENST00000271348.2	37	c.407G>A	CCDS929.1	.	.	.	.	.	.	.	.	.	.	C	34	5.393112	0.96009	.	.	ENSG00000143140	ENST00000271348;ENST00000369237;ENST00000430508	.	.	.	5.68	5.68	0.88126	.	0.281651	0.30510	N	0.009471	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	15.2986	0.73928	0.0:0.8606:0.1394:0.0	.	.	.	.	X	136	.	ENSP00000271348:W136X	W	-	2	0	GJA5	145697564	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	3.325000	0.52030	2.677000	0.91161	0.563000	0.77884	TGG		0.602	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039422.2	NM_181703		8	138	0	0	0	0.004482	0	8	138				
ECM1	1893	broad.mit.edu	37	1	150485219	150485219	+	Silent	SNP	G	G	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:150485219G>C	ENST00000369047.4	+	9	1448	c.1323G>C	c.(1321-1323)ctG>ctC	p.L441L	ECM1_ENST00000346569.6_Silent_p.L316L|ECM1_ENST00000369049.4_Silent_p.L468L|ECM1_ENST00000470432.1_3'UTR	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	441					angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TTCCTGGGCTGATCCACAACA	0.522																																					Melanoma(156;1696 2560 11093 19685)	Melanoma(156;1696 2560 11093 19685)	uc001eus.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1321-1323)CTG>CTC		extracellular matrix protein 1 isoform 1							241.0	231.0	235.0					1																	150485219		2203	4300	6503	SO:0001819	synonymous_variant	1893				angiogenesis|biomineral tissue development|negative regulation of bone mineralization|negative regulation of peptidase activity|ossification|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of I-kappaB kinase/NF-kappaB cascade	proteinaceous extracellular matrix	laminin binding|protease binding|protein C-terminus binding|signal transducer activity	g.chr1:150485219G>C	U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.1323G>C	1.37:g.150485219G>C						ECM1_uc001eut.2_Silent_p.L316L|ECM1_uc001euu.2_Silent_p.L470L|ECM1_uc001euv.2_Silent_p.L468L|ECM1_uc009wlu.2_Silent_p.L201L	p.L441L	NM_004425	NP_004416	Q16610	ECM1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		9	1522	+	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		441					A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Silent	SNP	ENST00000369047.4	37	c.1323G>C	CCDS953.1																																																																																				0.522	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035832.2	NM_004425		26	310	0	0	0	0.001786	0	26	310				
PBXIP1	57326	broad.mit.edu	37	1	154919123	154919124	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:154919123_154919124CC>TA	ENST00000368463.3	-	10	1097_1098	c.1026_1027GG>TA	c.(1024-1029)gaGGcc>gaTAcc	p.342_343EA>DT	PBXIP1_ENST00000542459.1_Missense_Mutation_p.187_188EA>DT|PBXIP1_ENST00000498553.1_5'Flank|PBXIP1_ENST00000368465.1_Missense_Mutation_p.313_314EA>DT|PBXIP1_ENST00000539880.1_Missense_Mutation_p.169_170EA>DT	NM_020524.2	NP_065385.2	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein 1	342					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)	cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(6)|lung(13)|prostate(1)|urinary_tract(1)	24	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ACACAGTCGGCCTCCAGCCCCT	0.703																																							uc001ffr.2		NA																	0				large_intestine(1)	1						c.(1024-1029)GAGGCC>GATACC		pre-B-cell leukemia homeobox interacting protein																																				SO:0001583	missense	57326				cell differentiation|multicellular organismal development|negative regulation of transcription, DNA-dependent	cytosol|microtubule|nucleus	protein binding|transcription corepressor activity	g.chr1:154919123_154919124CC>TA	AF221521	CCDS1074.1	1q22	2008-02-05	2007-01-30		ENSG00000163346	ENSG00000163346			21199	protein-coding gene	gene with protein product			"""pre-B-cell leukemia transcription factor interacting protein 1"""			7505766, 10825160	Standard	NM_020524		Approved	HPIP	uc001ffr.3	Q96AQ6	OTTHUMG00000037369	ENST00000368463.3:c.1026_1027delinsTA	1.37:g.154919123_154919124delinsTA	ENSP00000357448:p.E342_A343delinsDT					PBXIP1_uc001ffs.2_Missense_Mutation_p.313_314EA>DT|PBXIP1_uc010pep.1_Missense_Mutation_p.187_188EA>DT	p.342_343EA>DT	NM_020524	NP_065385	Q96AQ6	PBIP1_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		10	1085_1086	-	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		342_343			Potential.		Q5T174|Q5T176|Q9H8X6|Q9HA02|Q9HD85	Missense_Mutation	DNP	ENST00000368463.3	37	c.1026_1027GG>TA	CCDS1074.1																																																																																				0.703	PBXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090943.1	NM_020524		12	21	0	0	0	0.004672	0	12	21				
PEAR1	375033	broad.mit.edu	37	1	156882331	156882331	+	Missense_Mutation	SNP	A	A	T	rs199792419	byFrequency	TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:156882331A>T	ENST00000338302.3	+	18	2351	c.2126A>T	c.(2125-2127)cAg>cTg	p.Q709L	PEAR1_ENST00000292357.7_Missense_Mutation_p.Q709L			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	709					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CAGCCATGCCAGTGTGGTCCT	0.607																																							uc001fqj.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2125-2127)CAG>CTG		platelet endothelial aggregation receptor 1							80.0	84.0	83.0					1																	156882331		2203	4300	6503	SO:0001583	missense	375033					integral to membrane		g.chr1:156882331A>T	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.2126A>T	1.37:g.156882331A>T	ENSP00000344465:p.Gln709Leu					PEAR1_uc001fqk.1_Missense_Mutation_p.Q334L	p.Q709L	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN			17	2242	+	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		709					Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	c.2126A>T	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	A	16.09	3.023094	0.54683	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	T;T	0.50813	0.73;0.73	4.82	4.82	0.62117	.	0.170578	0.27981	N	0.017066	T	0.21881	0.0527	L	0.31804	0.96	0.32996	D	0.525651	B	0.22800	0.075	B	0.24701	0.055	T	0.14531	-1.0469	10	0.49607	T	0.09	.	12.3668	0.55232	1.0:0.0:0.0:0.0	.	709	Q5VY43	PEAR1_HUMAN	L	709	ENSP00000344465:Q709L;ENSP00000292357:Q709L	ENSP00000292357:Q709L	Q	+	2	0	PEAR1	155148955	0.074000	0.21230	1.000000	0.80357	0.924000	0.55760	0.978000	0.29488	2.017000	0.59298	0.379000	0.24179	CAG		0.607	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471		19	66	0	0	0	0.007413	0	19	66				
SPTA1	6708	broad.mit.edu	37	1	158609780	158609781	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:158609780_158609781CA>AG	ENST00000368147.4	-	34	4934_4935	c.4754_4755TG>CT	c.(4753-4755)cTG>cCT	p.L1585P		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1585					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AATGTTCCTTCAGCTGTTCCAG	0.48																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(4753-4755)CTG>CCT		spectrin, alpha, erythrocytic 1																																				SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158609780_158609781CA>AG	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4754_4755delinsAG	1.37:g.158609780_158609781delinsAG	ENSP00000357129:p.Leu1585Pro						p.L1585P	NM_003126	NP_003117	P02549	SPTA1_HUMAN			34	4953_4954	-	all_hematologic(112;0.0378)		1585			Spectrin 15.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	DNP	ENST00000368147.4	37	c.4754_4755TG>CT	CCDS41423.1																																																																																				0.480	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		23	104	0	0	0	0.004672	0	23	104				
ZP4	57829	broad.mit.edu	37	1	238048857	238048857	+	Missense_Mutation	SNP	C	C	A	rs368326237		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:238048857C>A	ENST00000366570.4	-	8	1152	c.994G>T	c.(994-996)Ggt>Tgt	p.G332C	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	332	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TCACCAACACCGTAGTAAGAG	0.483																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	0				ovary(2)|skin(1)	3						c.(994-996)GGT>TGT		zona pellucida glycoprotein 4 preproprotein							60.0	58.0	59.0					1																	238048857		2203	4300	6503	SO:0001583	missense	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238048857C>A	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.994G>T	1.37:g.238048857C>A	ENSP00000355529:p.Gly332Cys					LOC100130331_uc010pyc.1_Intron	p.G332C	NM_021186	NP_067009	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		8	994	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	332			ZP.|Extracellular (Potential).		B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	c.994G>T	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	C	13.37	2.217122	0.39201	.	.	ENSG00000116996	ENST00000366570	T	0.74632	-0.86	4.95	-4.42	0.03579	Zona pellucida sperm-binding protein (3);	7.519890	0.01141	N	0.006208	T	0.81064	0.4745	M	0.71206	2.165	0.09310	N	1	D	0.61080	0.989	D	0.65443	0.935	T	0.69960	-0.5003	10	0.56958	D	0.05	6.0896	2.7199	0.05198	0.1244:0.3923:0.1273:0.356	.	332	Q12836	ZP4_HUMAN	C	332	ENSP00000355529:G332C	ENSP00000355529:G332C	G	-	1	0	ZP4	236115480	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.517000	0.06275	-0.819000	0.04323	-0.302000	0.09304	GGT		0.483	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			10	58	1	0	0.000442599	0.006214	0.000523639	10	58				
OR2T33	391195	broad.mit.edu	37	1	248436327	248436327	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr1:248436327T>C	ENST00000318021.2	-	1	811	c.790A>G	c.(790-792)Agg>Ggg	p.R264G		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TTAGTGGACCTATGGGATTTG	0.483																																							uc010pzi.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(790-792)AGG>GGG		olfactory receptor, family 2, subfamily T,							135.0	148.0	144.0					1																	248436327		2203	4300	6503	SO:0001583	missense	391195				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248436327T>C		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.790A>G	1.37:g.248436327T>C	ENSP00000324687:p.Arg264Gly						p.R264G	NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	790	-	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		264			Extracellular (Potential).		B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	c.790A>G	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	0.120	-1.126231	0.01770	.	.	ENSG00000177212	ENST00000318021	T	0.00107	8.72	1.77	1.77	0.24775	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31589	U	0.007386	T	0.00109	0.0003	N	0.25201	0.72	0.09310	N	1	B	0.20459	0.045	B	0.23852	0.049	T	0.41680	-0.9495	10	0.72032	D	0.01	.	1.7647	0.02999	0.2821:0.1764:0.0:0.5415	.	264	Q8NG76	O2T33_HUMAN	G	264	ENSP00000324687:R264G	ENSP00000324687:R264G	R	-	1	2	OR2T33	246502950	0.000000	0.05858	0.211000	0.23655	0.032000	0.12392	-1.437000	0.02419	1.057000	0.40506	0.342000	0.21767	AGG		0.483	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695		41	161	0	0	0	0.00874	0	41	161				
GPR158	57512	broad.mit.edu	37	10	25861630	25861630	+	Missense_Mutation	SNP	G	G	T	rs138045559		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr10:25861630G>T	ENST00000376351.3	+	7	1926	c.1567G>T	c.(1567-1569)Ggc>Tgc	p.G523C		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	523					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						ATATATGACTGGCGGACGGGT	0.418																																							uc001isj.2		NA																	0				ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.(1567-1569)GGC>TGC		G protein-coupled receptor 158 precursor							210.0	167.0	181.0					10																	25861630		2203	4300	6503	SO:0001583	missense	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25861630G>T	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1567G>T	10.37:g.25861630G>T	ENSP00000365529:p.Gly523Cys						p.G523C	NM_020752	NP_065803	Q5T848	GP158_HUMAN			7	1627	+			523			Cytoplasmic (Potential).		Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	c.1567G>T	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028078	0.75390	.	.	ENSG00000151025	ENST00000376351	D	0.87809	-2.3	5.78	5.78	0.91487	GPCR, family 3, C-terminal (2);	0.168255	0.42172	D	0.000755	D	0.84737	0.5538	N	0.08118	0	0.49389	D	0.999789	D	0.69078	0.997	D	0.68353	0.957	D	0.85923	0.1447	10	0.59425	D	0.04	.	10.4244	0.44369	0.1445:0.0:0.8555:0.0	.	523	Q5T848	GP158_HUMAN	C	523	ENSP00000365529:G523C	ENSP00000365529:G523C	G	+	1	0	GPR158	25901636	1.000000	0.71417	0.993000	0.49108	0.977000	0.68977	6.316000	0.72857	2.736000	0.93811	0.557000	0.71058	GGC		0.418	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		13	69	1	0	0.000219431	0.00245	0.000267134	13	69				
ZNF248	57209	broad.mit.edu	37	10	38121171	38121171	+	Missense_Mutation	SNP	C	C	A	rs371568860		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr10:38121171C>A	ENST00000395867.3	-	6	1662	c.1112G>T	c.(1111-1113)cGg>cTg	p.R371L	ZNF248_ENST00000357328.4_Missense_Mutation_p.R371L|AL135791.1_ENST00000583461.1_RNA|ZNF248_ENST00000374648.3_Intron|ZNF248_ENST00000494133.1_Intron	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	371					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						GTGAGCTCTCCGAAGCTGGGT	0.418																																							uc001izd.1		NA																	0				ovary(1)	1						c.(1111-1113)CGG>CTG		zinc finger protein 248							99.0	95.0	96.0					10																	38121171		2203	4299	6502	SO:0001583	missense	57209				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:38121171C>A	AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.1112G>T	10.37:g.38121171C>A	ENSP00000379208:p.Arg371Leu					ZNF248_uc009xmc.2_Intron|ZNF248_uc001izb.2_Intron|ZNF248_uc001izc.2_Intron|ZNF248_uc010qeu.1_Missense_Mutation_p.R371L	p.R371L	NM_021045	NP_066383	Q8NDW4	ZN248_HUMAN			6	1611	-			371					Q8NDV8|Q9UMP3	Missense_Mutation	SNP	ENST00000395867.3	37	c.1112G>T	CCDS7194.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.868721	0.32977	.	.	ENSG00000198105	ENST00000395867;ENST00000357328	T;T	0.14022	2.54;2.54	4.6	3.69	0.42338	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42548	D	0.000694	T	0.05960	0.0155	N	0.11341	0.13	0.33585	D	0.600359	P	0.40398	0.716	B	0.35039	0.194	T	0.07654	-1.0761	10	0.59425	D	0.04	.	6.271	0.20955	0.0:0.8028:0.0:0.1972	.	371	Q8NDW4	ZN248_HUMAN	L	371	ENSP00000379208:R371L;ENSP00000349882:R371L	ENSP00000349882:R371L	R	-	2	0	ZNF248	38161177	0.760000	0.28428	0.996000	0.52242	0.315000	0.28087	1.057000	0.30492	2.550000	0.86006	0.557000	0.71058	CGG		0.418	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047609.1	NM_021045		15	92	1	0	3.52763e-06	0.00499	4.59412e-06	15	92				
CDH23	64072	broad.mit.edu	37	10	73569756	73569756	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr10:73569756G>A	ENST00000224721.6	+	60	8922	c.8917G>A	c.(8917-8919)Gtg>Atg	p.V2973M	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Missense_Mutation_p.V728M	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2968	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CCCCGACCGTGTGCGCGGCTT	0.602																																							uc001jrx.3		NA																	0				central_nervous_system(5)|large_intestine(4)|ovary(2)	11						c.(8902-8904)GTG>ATG		cadherin-like 23 isoform 1 precursor							92.0	92.0	92.0					10																	73569756		2113	4204	6317	SO:0001583	missense	64072				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding	g.chr10:73569756G>A	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.8917G>A	10.37:g.73569756G>A	ENSP00000224721:p.Val2973Met					CDH23_uc001jsg.3_Missense_Mutation_p.V728M|CDH23_uc001jsh.3_Missense_Mutation_p.V728M|CDH23_uc001jsi.3_Missense_Mutation_p.V728M|CDH23_uc001jsj.3_5'Flank|CDH23_uc010qjr.1_5'Flank	p.V2968M	NM_022124	NP_071407	Q9H251	CAD23_HUMAN			59	9279	+			2968		V -> A (in USH1D).	Cadherin 27.|Extracellular (Potential).		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37	c.8902G>A		.	.	.	.	.	.	.	.	.	.	G	18.52	3.642717	0.67244	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	T	0.61980	0.06	5.82	5.82	0.92795	Cadherin (1);	0.000000	0.64402	D	0.000001	T	0.70684	0.3252	M	0.75264	2.295	0.80722	D	1	P;P	0.44627	0.839;0.804	P;B	0.45449	0.481;0.235	T	0.73263	-0.4038	10	0.56958	D	0.05	.	20.0871	0.97801	0.0:0.0:1.0:0.0	.	2968;2968	E9PEX1;Q9H251	.;CAD23_HUMAN	M	2973;2968;2971;728	ENSP00000381768:V728M	ENSP00000224721:V2973M	V	+	1	0	CDH23	73239762	1.000000	0.71417	0.964000	0.40570	0.489000	0.33432	9.818000	0.99354	2.759000	0.94783	0.549000	0.68633	GTG		0.602	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		21	106	0	0	0	0.00278	0	21	106				
MYOF	26509	broad.mit.edu	37	10	95216684	95216684	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr10:95216684C>A	ENST00000359263.4	-	2	98	c.99G>T	c.(97-99)aaG>aaT	p.K33N	MYOF_ENST00000371502.4_Missense_Mutation_p.K33N|MYOF_ENST00000371501.4_Missense_Mutation_p.K33N|MYOF_ENST00000371489.1_Missense_Mutation_p.K33N|MYOF_ENST00000371488.3_Missense_Mutation_p.K33N|MYOF_ENST00000358334.5_Missense_Mutation_p.K33N	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	33	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TCTTTGTTTTCTTTTTCTCAT	0.313																																							uc001kin.2		NA																	0				ovary(3)|breast(1)	4						c.(97-99)AAG>AAT		myoferlin isoform a							119.0	120.0	119.0					10																	95216684		1813	4072	5885	SO:0001583	missense	26509				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding	g.chr10:95216684C>A	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.99G>T	10.37:g.95216684C>A	ENSP00000352208:p.Lys33Asn					MYOF_uc001kio.2_Missense_Mutation_p.K33N|MYOF_uc001kip.3_Missense_Mutation_p.K33N|MYOF_uc009xuf.2_Missense_Mutation_p.K15N	p.K33N	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN			2	222	-			33			C2 1.|Cytoplasmic (Potential).		B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	c.99G>T	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	C	19.79	3.892773	0.72524	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502;ENST00000371489;ENST00000371488	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	4.59	4.59	0.56863	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.71634	0.3363	M	0.93016	3.37	0.54753	D	0.999981	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.996;0.996;0.999	T	0.79361	-0.1835	10	0.87932	D	0	-17.3608	14.7653	0.69634	0.0:1.0:0.0:0.0	.	15;33;33	Q9NZM1-8;Q9NZM1-6;Q9NZM1	.;.;MYOF_HUMAN	N	33	ENSP00000351094:K33N;ENSP00000352208:K33N;ENSP00000360556:K33N;ENSP00000360557:K33N;ENSP00000360544:K33N;ENSP00000360543:K33N	ENSP00000351094:K33N	K	-	3	2	MYOF	95206674	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.604000	0.54081	2.528000	0.85240	0.655000	0.94253	AAG		0.313	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451		5	46	1	0	1.23904e-05	0.000602	1.589e-05	5	46				
IKZF5	64376	broad.mit.edu	37	10	124753508	124753508	+	Missense_Mutation	SNP	T	T	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr10:124753508T>G	ENST00000368886.5	-	5	1368	c.1048A>C	c.(1048-1050)Acc>Ccc	p.T350P	PSTK_ENST00000497219.1_Intron	NM_001271840.1	NP_001258769.1	Q9H5V7	IKZF5_HUMAN	IKAROS family zinc finger 5 (Pegasus)	350					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|lung(3)|prostate(1)	6		all_neural(114;0.169)|Colorectal(57;0.178)|Glioma(114;0.222)		Colorectal(40;0.0701)|COAD - Colon adenocarcinoma(40;0.0754)		GGGGCTGGGGTGCTTGGCTGG	0.547																																							uc001lha.2		NA																	0					0						c.(1048-1050)ACC>CCC		zinc finger protein, subfamily 1A, 5							52.0	61.0	58.0					10																	124753508		2081	4225	6306	SO:0001583	missense	64376				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:124753508T>G	AF230808	CCDS41574.1	10q26	2011-05-31	2006-08-25	2006-08-25	ENSG00000095574	ENSG00000095574		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	14283	protein-coding gene	gene with protein product		606238	"""zinc finger protein, subfamily 1A, 5"", ""zinc finger protein, subfamily 1A, 5 (Pegasus)"""	ZNFN1A5		10978333	Standard	NM_001271840		Approved	Pegasus, FLJ22973	uc021qaj.2	Q9H5V7	OTTHUMG00000019192	ENST00000368886.5:c.1048A>C	10.37:g.124753508T>G	ENSP00000357881:p.Thr350Pro					IKZF5_uc001lgz.2_Missense_Mutation_p.T188P	p.T350P	NM_022466	NP_071911	Q9H5V7	IKZF5_HUMAN		Colorectal(40;0.0701)|COAD - Colon adenocarcinoma(40;0.0754)	5	1347	-		all_neural(114;0.169)|Colorectal(57;0.178)|Glioma(114;0.222)	350					B3KVH7|D3DRE7|Q9H2T0	Missense_Mutation	SNP	ENST00000368886.5	37	c.1048A>C	CCDS41574.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.299879	0.81136	.	.	ENSG00000095574	ENST00000368886	T	0.05855	3.38	6.03	6.03	0.97812	.	0.043122	0.85682	N	0.000000	T	0.18964	0.0455	L	0.50333	1.59	0.80722	D	1	D	0.76494	0.999	D	0.64237	0.923	T	0.00168	-1.1963	10	0.44086	T	0.13	-16.6324	16.5582	0.84512	0.0:0.0:0.0:1.0	.	350	Q9H5V7	IKZF5_HUMAN	P	350	ENSP00000357881:T350P	ENSP00000357881:T350P	T	-	1	0	IKZF5	124743498	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.451000	0.80668	2.308000	0.77769	0.533000	0.62120	ACC		0.547	IKZF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050820.2	NM_022466		10	63	0	0	0	0.001786	0	10	63				
MUC5B	727897	broad.mit.edu	37	11	1264070	1264070	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr11:1264070C>T	ENST00000529681.1	+	31	6018	c.5960C>T	c.(5959-5961)tCc>tTc	p.S1987F	MUC5B_ENST00000447027.1_Missense_Mutation_p.S1990F|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1987	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCTCTTCCTCCCTGGGCACC	0.637																																							uc009ycr.1		NA																	0					0						c.(8038-8040)TCC>TTC		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							200.0	255.0	237.0					11																	1264070		2172	4248	6420	SO:0001583	missense	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1264070C>T	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.5960C>T	11.37:g.1264070C>T	ENSP00000436812:p.Ser1987Phe					MUC5B_uc001ltb.2_Missense_Mutation_p.S1990F	p.S2680F	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	47	8165	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	1987			7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	c.8039C>T	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	1.682	-0.506320	0.04231	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.18810	2.19;2.39	1.45	-2.89	0.05665	.	.	.	.	.	T	0.11196	0.0273	L	0.34521	1.04	0.09310	N	1	B;B	0.29212	0.133;0.237	B;B	0.15484	0.013;0.013	T	0.13926	-1.0491	9	0.87932	D	0	.	1.9958	0.03456	0.1616:0.3752:0.3156:0.1476	.	2680;1990	A7Y9J9;E9PBJ0	.;.	F	1987;1990;1988;2057	ENSP00000436812:S1987F;ENSP00000415793:S1990F	ENSP00000343037:S1988F	S	+	2	0	MUC5B	1220646	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.057000	0.11768	-1.689000	0.01434	0.205000	0.17691	TCC		0.637	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		45	197	0	0	0	0.00361	0	45	197				
OR52R1	119695	broad.mit.edu	37	11	4824767	4824767	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr11:4824767G>C	ENST00000356069.2	-	1	843	c.844C>G	c.(844-846)Ctc>Gtc	p.L282V	OR52R1_ENST00000380382.1_Missense_Mutation_p.L361V|MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGTAGATAGAGATTAGCAAAC	0.468																																							uc010qym.1		NA																	0				skin(1)	1						c.(1081-1083)CTC>GTC		olfactory receptor, family 52, subfamily R,							138.0	139.0	138.0					11																	4824767		2201	4298	6499	SO:0001583	missense	119695				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4824767G>C	BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.844C>G	11.37:g.4824767G>C	ENSP00000348368:p.Leu282Val						p.L361V	NM_001005177	NP_001005177	Q8NGF1	O52R1_HUMAN		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	1081	-		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)	282			Helical; Name=7; (Potential).		Q6IFI0	Missense_Mutation	SNP	ENST00000356069.2	37	c.1081C>G	CCDS31360.2	.	.	.	.	.	.	.	.	.	.	G	4.650	0.120894	0.08881	.	.	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.00220	8.52;8.52	5.57	-11.1	0.00147	GPCR, rhodopsin-like superfamily (1);	0.893166	0.09240	N	0.829271	T	0.00109	0.0003	L	0.43646	1.37	0.09310	N	1	B	0.10296	0.003	B	0.18871	0.023	T	0.38972	-0.9636	10	0.48119	T	0.1	.	3.6841	0.08321	0.1126:0.3599:0.2186:0.309	.	282	Q8NGF1	O52R1_HUMAN	V	282;361	ENSP00000348368:L282V;ENSP00000369742:L361V	ENSP00000348368:L282V	L	-	1	0	OR52R1	4781343	0.000000	0.05858	0.064000	0.19789	0.208000	0.24298	-1.517000	0.02248	-1.817000	0.01219	0.650000	0.86243	CTC		0.468	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142183.1	NM_001005177		34	130	0	0	0	0.002445	0	34	130				
USH1C	10083	broad.mit.edu	37	11	17542494	17542494	+	Nonsense_Mutation	SNP	C	C	T	rs550843060		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr11:17542494C>T	ENST00000318024.4	-	14	1241	c.1133G>A	c.(1132-1134)tGg>tAg	p.W378*	USH1C_ENST00000005226.7_Nonsense_Mutation_p.W378*|USH1C_ENST00000527720.1_Nonsense_Mutation_p.W347*|USH1C_ENST00000527020.1_Nonsense_Mutation_p.W359*	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	378					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CTTTGAGCCCCAGTCTTCTTC	0.498													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20412	0.0		0.0	False		,,,				2504	0.0						uc001mnf.2		NA																	0				ovary(1)	1						c.(1132-1134)TGG>TAG		harmonin isoform a							465.0	463.0	463.0					11																	17542494		2200	4293	6493	SO:0001587	stop_gained	10083				equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding	g.chr11:17542494C>T	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1133G>A	11.37:g.17542494C>T	ENSP00000317018:p.Trp378*					USH1C_uc001mne.2_Nonsense_Mutation_p.W378*|USH1C_uc009yhb.2_Nonsense_Mutation_p.W359*|USH1C_uc001mng.2_RNA|USH1C_uc001mnd.2_Nonsense_Mutation_p.W342*	p.W378*	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN			14	1242	-			378					A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Nonsense_Mutation	SNP	ENST00000318024.4	37	c.1133G>A	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	C	39	7.872776	0.98537	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.5905	0.91210	0.0:1.0:0.0:0.0	.	.	.	.	X	378;347;359;378	.	ENSP00000005226:W378X	W	-	2	0	USH1C	17499070	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.409000	0.73289	2.688000	0.91661	0.591000	0.81541	TGG		0.498	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709		105	448	0	0	0	0.00361	0	105	448				
WT1	7490	broad.mit.edu	37	11	32413568	32413568	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr11:32413568G>T	ENST00000379079.2	-	9	1019	c.746C>A	c.(745-747)tCc>tAc	p.S249Y	WT1_ENST00000332351.3_Missense_Mutation_p.S461Y|WT1_ENST00000448076.3_Missense_Mutation_p.S461Y|WT1_ENST00000530998.1_Missense_Mutation_p.S232Y	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	393					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V380_S410del(1)|p.S249F(1)|p.S393F(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			GTCGGACCGGGAGAACTTTCG	0.433			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																														uc001mtn.1		NA	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	D|Mis|N|F|S	Wilms tumour 1 gene			O	EWSR1	Wilms	Wilms|desmoplastic small round cell tumor	EWSR1/WT1(231)	3	Substitution - Missense(2)|Deletion - In frame(1)	p.V380_S410del(1)	lung(2)|haematopoietic_and_lymphoid_tissue(1)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687						c.(1381-1383)TCC>TAC		Wilms tumor 1 isoform D							190.0	185.0	187.0					11																	32413568		2202	4299	6501	SO:0001583	missense	7490	Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr11:32413568G>T		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.746C>A	11.37:g.32413568G>T	ENSP00000368370:p.Ser249Tyr					WT1_uc001mtl.1_Missense_Mutation_p.S249Y|WT1_uc001mtm.1_Missense_Mutation_p.S232Y|WT1_uc001mto.1_Missense_Mutation_p.S461Y|WT1_uc001mtp.1_Missense_Mutation_p.S444Y|WT1_uc001mtq.1_Missense_Mutation_p.S444Y|WT1_uc009yjs.1_RNA	p.S461Y	NM_024426	NP_077744	P19544	WT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(30;0.128)		9	1578	-	Breast(20;0.247)		393			C2H2-type 3.|Important for interaction with target DNA.		A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	ENST00000379079.2	37	c.1382C>A	CCDS55751.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722550	0.89298	.	.	ENSG00000184937	ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076	T;T;T;T;T	0.19394	3.14;2.15;2.15;3.14;3.14	6.04	5.11	0.69529	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000004	T	0.46521	0.1397	M	0.66297	2.02	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;0.999	D;D;D;D;D	0.87578	0.997;0.998;0.998;0.994;0.995	T	0.49093	-0.8975	10	0.72032	D	0.01	.	16.5978	0.84801	0.0:0.0:0.8686:0.1314	.	449;393;466;232;249	P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.;WT1_HUMAN;.;.;.	Y	249;461;232;444;461	ENSP00000368370:S249Y;ENSP00000331327:S461Y;ENSP00000435307:S232Y;ENSP00000415516:S444Y;ENSP00000413452:S461Y	ENSP00000331327:S461Y	S	-	2	0	WT1	32370144	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.837000	0.99465	1.531000	0.49152	0.561000	0.74099	TCC		0.433	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1	NM_000378		28	162	1	0	9.45814e-24	0.004878	1.49903e-23	28	162				
OR10AG1	282770	broad.mit.edu	37	11	55735552	55735552	+	Missense_Mutation	SNP	T	T	G	rs140763949		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr11:55735552T>G	ENST00000312345.2	-	1	438	c.388A>C	c.(388-390)Aaa>Caa	p.K130Q		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					ATGCAGACTTTGTGGTTCATC	0.453																																							uc010rit.1		NA																	0				skin(2)	2						c.(388-390)AAA>CAA		olfactory receptor, family 10, subfamily AG,							78.0	75.0	76.0					11																	55735552		2201	4296	6497	SO:0001583	missense	282770				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55735552T>G	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.388A>C	11.37:g.55735552T>G	ENSP00000311477:p.Lys130Gln						p.K130Q	NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN			1	388	-	Esophageal squamous(21;0.0137)		130			Cytoplasmic (Potential).		B2RNH4|Q6IEU3	Missense_Mutation	SNP	ENST00000312345.2	37	c.388A>C	CCDS31514.1	.	.	.	.	.	.	.	.	.	.	T	6.209	0.406759	0.11754	.	.	ENSG00000174970	ENST00000312345	T	0.00902	5.56	5.47	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.792533	0.11087	N	0.601197	T	0.01189	0.0039	L	0.33710	1.025	0.09310	N	1	B	0.26935	0.164	B	0.27608	0.081	T	0.50541	-0.8816	10	0.32370	T	0.25	.	10.9412	0.47275	0.0:0.0:0.1574:0.8426	.	130	Q8NH19	O10AG_HUMAN	Q	130	ENSP00000311477:K130Q	ENSP00000311477:K130Q	K	-	1	0	OR10AG1	55492128	0.000000	0.05858	0.088000	0.20740	0.122000	0.20287	0.071000	0.14594	0.923000	0.37045	0.391000	0.25812	AAA		0.453	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		7	33	0	0	0	0.008291	0	7	33				
OR4D10	390197	broad.mit.edu	37	11	59245081	59245081	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr11:59245081A>G	ENST00000530162.1	+	1	236	c.179A>G	c.(178-180)tAt>tGt	p.Y60C		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ACGCCCATGTATTTTTTGCTC	0.438																																							uc001nnz.1		NA																	0				ovary(2)|skin(1)	3						c.(178-180)TAT>TGT		olfactory receptor, family 4, subfamily D,							190.0	194.0	193.0					11																	59245081		2122	4259	6381	SO:0001583	missense	390197				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59245081A>G	AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.179A>G	11.37:g.59245081A>G	ENSP00000436424:p.Tyr60Cys						p.Y60C	NM_001004705	NP_001004705	Q8NGI6	OR4DA_HUMAN			1	179	+			60			Helical; Name=2; (Potential).		B2RNH6	Missense_Mutation	SNP	ENST00000530162.1	37	c.179A>G	CCDS53636.1	.	.	.	.	.	.	.	.	.	.	A	13.94	2.387031	0.42308	.	.	ENSG00000254466	ENST00000530162	T	0.11930	2.73	4.4	4.4	0.53042	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.48572	0.1507	H	0.95402	3.665	0.42555	D	0.993129	D	0.89917	1.0	D	0.97110	1.0	T	0.64622	-0.6364	9	0.87932	D	0	.	12.7482	0.57293	1.0:0.0:0.0:0.0	.	60	Q8NGI6	OR4DA_HUMAN	C	60	ENSP00000436424:Y60C	ENSP00000436424:Y60C	Y	+	2	0	OR4D10	59001657	1.000000	0.71417	0.810000	0.32431	0.042000	0.13812	6.166000	0.71896	1.733000	0.51620	0.533000	0.62120	TAT		0.438	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394235.1	NM_001004705		16	188	0	0	0	0.003163	0	16	188				
B3GAT1	27087	broad.mit.edu	37	11	134251867	134251867	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr11:134251867T>A	ENST00000524765.1	-	5	5514	c.970A>T	c.(970-972)Aag>Tag	p.K324*	B3GAT1_ENST00000392580.1_Nonsense_Mutation_p.K324*|B3GAT1_ENST00000312527.4_Nonsense_Mutation_p.K324*|B3GAT1_ENST00000537389.1_Nonsense_Mutation_p.K337*|B3GAT1_ENST00000531510.1_5'Flank			Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	324					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		AAGCCCTTCTTGCCCTCATTC	0.607																																							uc001qhq.2		NA																	0				ovary(1)	1						c.(970-972)AAG>TAG		beta-1,3-glucuronyltransferase 1							195.0	142.0	160.0					11																	134251867		2201	4297	6498	SO:0001587	stop_gained	27087				carbohydrate metabolic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding	g.chr11:134251867T>A	AB029396	CCDS8500.1	11q25	2014-07-08	2014-07-08		ENSG00000109956	ENSG00000109956	2.4.1.135	"""CD molecules"", ""Beta-1,3-glucuronyltransferases"""	921	protein-coding gene	gene with protein product	"""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1"", ""glucuronosyltransferase P"""	151290	"""CD57 antigen"""	CD57, LEU7			Standard	XM_005271506		Approved	GlcAT-P, HNK-1, NK-1	uc001qhq.3	Q9P2W7	OTTHUMG00000167180	ENST00000524765.1:c.970A>T	11.37:g.134251867T>A	ENSP00000433847:p.Lys324*					B3GAT1_uc001qhr.2_Nonsense_Mutation_p.K324*|B3GAT1_uc010scv.1_Nonsense_Mutation_p.K337*	p.K324*	NM_018644	NP_061114	Q9P2W7	B3GA1_HUMAN		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)	6	1231	-	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)	324			Lumenal (Potential).		Q96FS7	Nonsense_Mutation	SNP	ENST00000524765.1	37	c.970A>T	CCDS8500.1	.	.	.	.	.	.	.	.	.	.	T	59	38.800757	0.99984	.	.	ENSG00000109956	ENST00000392580;ENST00000312527;ENST00000524765;ENST00000537389	.	.	.	5.84	5.84	0.93424	.	0.083951	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.8667	15.866	0.79067	0.0:0.0:0.0:1.0	.	.	.	.	X	324;324;324;337	.	ENSP00000307875:K324X	K	-	1	0	B3GAT1	133757077	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.970000	0.70431	2.234000	0.73211	0.459000	0.35465	AAG		0.607	B3GAT1-002	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393639.1	NM_018644		6	70	0	0	0	0.001168	0	6	70				
NCAPD2	9918	broad.mit.edu	37	12	6619879	6619879	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr12:6619879C>T	ENST00000315579.5	+	5	1146	c.347C>T	c.(346-348)gCc>gTc	p.A116V	NCAPD2_ENST00000545962.1_Missense_Mutation_p.A71V|SCARNA10_ENST00000459255.1_RNA	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	116	Interactions with SMC2 and SMC4.				mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						CATCTAAATGCCCTCAAAATG	0.502																																							uc001qoo.2		NA																	0				ovary(2)|lung(1)|breast(1)|kidney(1)	5						c.(346-348)GCC>GTC		non-SMC condensin I complex, subunit D2							141.0	132.0	135.0					12																	6619879		2203	4300	6503	SO:0001583	missense	9918				cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding	g.chr12:6619879C>T	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.347C>T	12.37:g.6619879C>T	ENSP00000325017:p.Ala116Val					NCAPD2_uc009zen.1_Intron|NCAPD2_uc010sfd.1_Missense_Mutation_p.A71V	p.A116V	NM_014865	NP_055680	Q15021	CND1_HUMAN			5	393	+			116			Interactions with SMC2 and SMC4.		D3DUR4|Q8N6U3	Missense_Mutation	SNP	ENST00000315579.5	37	c.347C>T	CCDS8548.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944744	0.73672	.	.	ENSG00000010292	ENST00000315579;ENST00000539714;ENST00000545962	T;T;T	0.50001	0.85;0.76;0.85	5.29	4.38	0.52667	Condensin complex, subunit 1, N-terminal (1);	0.148363	0.64402	D	0.000011	T	0.63402	0.2508	M	0.71581	2.175	0.49299	D	0.999771	D;D	0.89917	0.998;1.0	D;D	0.77557	0.972;0.99	T	0.63088	-0.6715	10	0.07325	T	0.83	-11.4703	15.938	0.79729	0.0:0.8646:0.1354:0.0	.	71;116	F5GZJ1;Q15021	.;CND1_HUMAN	V	116;116;71	ENSP00000325017:A116V;ENSP00000444377:A116V;ENSP00000444417:A71V	ENSP00000325017:A116V	A	+	2	0	NCAPD2	6490140	1.000000	0.71417	0.994000	0.49952	0.831000	0.47069	3.377000	0.52425	1.425000	0.47237	0.655000	0.94253	GCC		0.502	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865		5	104	0	0	0	0.001168	0	5	104				
CD163	9332	broad.mit.edu	37	12	7649703	7649703	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr12:7649703C>T	ENST00000359156.4	-	5	1007	c.805G>A	c.(805-807)Gta>Ata	p.V269I	CD163_ENST00000396620.3_Missense_Mutation_p.V269I|CD163_ENST00000541972.1_Missense_Mutation_p.V257I|CD163_ENST00000432237.2_Missense_Mutation_p.V269I	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	269	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.	Cleavage; in calcium-free condition.			acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	ACTCCATCTACCAGTCTCAGG	0.458																																							uc001qsz.3		NA																	0				ovary(6)|pancreas(1)|skin(1)	8						c.(805-807)GTA>ATA		CD163 antigen isoform a							168.0	141.0	150.0					12																	7649703		2203	4300	6503	SO:0001583	missense	9332				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity	g.chr12:7649703C>T	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.805G>A	12.37:g.7649703C>T	ENSP00000352071:p.Val269Ile					CD163_uc001qta.3_Missense_Mutation_p.V269I|CD163_uc009zfw.2_Missense_Mutation_p.V269I	p.V269I	NM_004244	NP_004235	Q86VB7	C163A_HUMAN			5	933	-			269			SRCR 3.|Extracellular (Potential).	Cleavage; in calcium-free condition.	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	c.805G>A	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.673971	0.29693	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	4.9	4.01	0.46588	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.627139	0.15116	N	0.279659	T	0.41073	0.1143	M	0.69523	2.12	0.39506	D	0.968274	B;B;B	0.29590	0.131;0.25;0.075	B;B;B	0.30251	0.077;0.107;0.113	T	0.39057	-0.9632	10	0.48119	T	0.1	.	7.3238	0.26542	0.0:0.7377:0.1697:0.0925	.	269;269;269	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	I	269;257;269;269	ENSP00000352071:V269I;ENSP00000444071:V257I;ENSP00000379863:V269I;ENSP00000403885:V269I	ENSP00000352071:V269I	V	-	1	0	CD163	7540970	0.012000	0.17670	0.193000	0.23327	0.667000	0.39255	0.553000	0.23391	1.204000	0.43247	0.462000	0.41574	GTA		0.458	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		9	86	0	0	0	0.006214	0	9	86				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		3	10	1	0	3.59834e-05	0.001168	4.47793e-05	3	10				
KRT7	3855	broad.mit.edu	37	12	52629142	52629142	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr12:52629142C>A	ENST00000331817.5	+	2	711	c.528C>A	c.(526-528)ttC>ttA	p.F176L		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	176	Coil 1B.|Rod.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TGGAGGACTTCAAGAATAAGT	0.622																																							uc001saa.1		NA																	0					0						c.(526-528)TTC>TTA		keratin 7							49.0	54.0	52.0					12																	52629142		2203	4300	6503	SO:0001583	missense	3855				cytoskeleton organization|DNA replication|interphase|interspecies interaction between organisms|regulation of translation	Golgi apparatus|keratin filament|nucleus	protein binding|structural molecule activity	g.chr12:52629142C>A		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.528C>A	12.37:g.52629142C>A	ENSP00000329243:p.Phe176Leu					KRT7_uc009zmf.1_Missense_Mutation_p.F176L	p.F176L	NM_005556	NP_005547	P08729	K2C7_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.105)	2	655	+			176			Rod.|Coil 1B.		Q92676|Q9BUD8|Q9Y3R7	Missense_Mutation	SNP	ENST00000331817.5	37	c.528C>A	CCDS8822.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109222	0.77096	.	.	ENSG00000135480	ENST00000331817;ENST00000543899;ENST00000422319;ENST00000551537	D	0.87491	-2.26	4.41	2.54	0.30619	Filament (1);	0.000000	0.35067	N	0.003467	D	0.86723	0.6001	L	0.41961	1.31	0.58432	D	0.999998	P;P	0.41080	0.713;0.737	P;P	0.51550	0.673;0.496	D	0.85598	0.1250	10	0.46703	T	0.11	.	11.4208	0.49980	0.0:0.8414:0.0:0.1586	.	176;176	F8VZY5;P08729	.;K2C7_HUMAN	L	176;176;152;176	ENSP00000329243:F176L	ENSP00000329243:F176L	F	+	3	2	KRT7	50915409	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.520000	0.45554	1.184000	0.42957	0.655000	0.94253	TTC		0.622	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556		10	36	1	0	0.000673444	0.008291	0.000785685	10	36				
NXPH4	11247	broad.mit.edu	37	12	57619307	57619307	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr12:57619307T>A	ENST00000349394.5	+	2	879	c.704T>A	c.(703-705)gTg>gAg	p.V235E	Y_RNA_ENST00000365197.1_RNA	NM_007224.3	NP_009155.1	O95158	NXPH4_HUMAN	neurexophilin 4	235	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	10						AATTGCCACGTGGAGTATGAG	0.692																																							uc010srf.1		NA																	0					0						c.(703-705)GTG>GAG		neurexophilin 4 precursor							32.0	33.0	33.0					12																	57619307		2203	4300	6503	SO:0001583	missense	11247				neuropeptide signaling pathway	extracellular region		g.chr12:57619307T>A	AF043469	CCDS8933.1	12q13.3	2014-09-04			ENSG00000182379	ENSG00000182379			8078	protein-coding gene	gene with protein product		604637				9570794	Standard	NM_007224		Approved	NPH4	uc009zpj.4	O95158	OTTHUMG00000171241	ENST00000349394.5:c.704T>A	12.37:g.57619307T>A	ENSP00000333593:p.Val235Glu					NXPH4_uc009zpj.2_Missense_Mutation_p.V41E	p.V235E	NM_007224	NP_009155	O95158	NXPH4_HUMAN			2	879	+			235			V (Cys-rich).		A8K4I4|Q7Z6L3|Q8N462	Missense_Mutation	SNP	ENST00000349394.5	37	c.704T>A	CCDS8933.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.658392	0.88154	.	.	ENSG00000182379	ENST00000349394	.	.	.	3.98	3.98	0.46160	.	0.074268	0.52532	D	0.000063	T	0.66703	0.2816	L	0.43923	1.385	0.58432	D	0.999992	D	0.76494	0.999	D	0.72338	0.977	T	0.69855	-0.5032	9	0.87932	D	0	-10.7916	11.9749	0.53085	0.0:0.0:0.0:1.0	.	235	O95158	NXPH4_HUMAN	E	235	.	ENSP00000333593:V235E	V	+	2	0	NXPH4	55905574	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.614000	0.82996	1.654000	0.50703	0.379000	0.24179	GTG		0.692	NXPH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412474.1	NM_007224		4	26	0	0	0	0.000248	0	4	26				
UBE3B	89910	broad.mit.edu	37	12	109936113	109936113	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr12:109936113G>A	ENST00000342494.3	+	11	1490	c.895G>A	c.(895-897)Gat>Aat	p.D299N	UBE3B_ENST00000280774.5_Missense_Mutation_p.D299N|UBE3B_ENST00000434735.2_Missense_Mutation_p.D299N	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	299					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						TCGATGCCGTGATGTATGTGA	0.438																																							uc001top.2		NA																	0				ovary(2)|lung(2)	4						c.(895-897)GAT>AAT		ubiquitin protein ligase E3B							259.0	238.0	245.0					12																	109936113		2203	4300	6503	SO:0001583	missense	89910				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity	g.chr12:109936113G>A	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.895G>A	12.37:g.109936113G>A	ENSP00000340596:p.Asp299Asn					UBE3B_uc001toq.2_Missense_Mutation_p.D299N|UBE3B_uc001too.1_RNA|UBE3B_uc009zvj.1_Missense_Mutation_p.D299N	p.D299N	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN			11	1498	+			299					A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	ENST00000342494.3	37	c.895G>A	CCDS9129.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960865	0.74016	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000539599;ENST00000342494	T;T;T;T	0.42513	1.3;0.97;1.56;1.3	5.81	5.81	0.92471	.	0.042080	0.85682	D	0.000000	T	0.40694	0.1127	L	0.46157	1.445	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.10405	-1.0631	10	0.31617	T	0.26	-19.7892	19.1077	0.93303	0.0:0.0:1.0:0.0	.	299	Q7Z3V4	UBE3B_HUMAN	N	299	ENSP00000391529:D299N;ENSP00000280774:D299N;ENSP00000443131:D299N;ENSP00000340596:D299N	ENSP00000280774:D299N	D	+	1	0	UBE3B	108420496	1.000000	0.71417	0.885000	0.34714	0.298000	0.27526	6.757000	0.74924	2.771000	0.95319	0.650000	0.86243	GAT		0.438	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415		23	141	0	0	0	0.003954	0	23	141				
NAA25	80018	broad.mit.edu	37	12	112471045	112471045	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr12:112471045G>A	ENST00000261745.4	-	23	3036	c.2788C>T	c.(2788-2790)Ctc>Ttc	p.L930F		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	930						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						ACCGGTGAGAGAGAAGTGTCT	0.368																																							uc001ttm.2		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(2788-2790)CTC>TTC		mitochondrial distribution and morphology 20							115.0	122.0	120.0					12																	112471045		2203	4300	6503	SO:0001583	missense	80018					cytoplasm	protein binding	g.chr12:112471045G>A	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.2788C>T	12.37:g.112471045G>A	ENSP00000261745:p.Leu930Phe					NAA25_uc001ttn.3_RNA	p.L930F	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN			23	2808	-			930					A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	ENST00000261745.4	37	c.2788C>T	CCDS9159.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.163900	0.38217	.	.	ENSG00000111300	ENST00000261745	T	0.23754	1.89	5.91	-2.88	0.05682	.	0.838744	0.10655	N	0.649382	T	0.08223	0.0205	N	0.08118	0	0.19775	N	0.999957	B	0.02656	0.0	B	0.01281	0.0	T	0.37384	-0.9708	10	0.10111	T	0.7	-0.1244	2.2144	0.03955	0.2677:0.1885:0.4355:0.1083	.	930	Q14CX7	NAA25_HUMAN	F	930	ENSP00000261745:L930F	ENSP00000261745:L930F	L	-	1	0	NAA25	110955428	0.993000	0.37304	0.899000	0.35326	0.958000	0.62258	0.636000	0.24644	-0.033000	0.13736	0.644000	0.83932	CTC		0.368	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1	NM_024953		16	66	0	0	0	0.00499	0	16	66				
RASAL1	8437	broad.mit.edu	37	12	113553497	113553497	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr12:113553497G>A	ENST00000261729.5	-	11	1261	c.946C>T	c.(946-948)Cgg>Tgg	p.R316W	RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000446861.3_Missense_Mutation_p.R316W|RASAL1_ENST00000546530.1_Missense_Mutation_p.R316W|RASAL1_ENST00000548055.1_Missense_Mutation_p.R316W			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	316	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						GCCAGTCCCCGGCCAAGAAAG	0.627																																							uc001tum.1		NA																	0				ovary(2)|skin(2)	4						c.(946-948)CGG>TGG		RAS protein activator like 1							53.0	56.0	55.0					12																	113553497		2203	4300	6503	SO:0001583	missense	8437				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity	g.chr12:113553497G>A	AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.946C>T	12.37:g.113553497G>A	ENSP00000261729:p.Arg316Trp					RASAL1_uc010syp.1_Missense_Mutation_p.R316W|RASAL1_uc001tul.2_Missense_Mutation_p.R316W|RASAL1_uc001tun.1_Missense_Mutation_p.R316W|RASAL1_uc010syq.1_Missense_Mutation_p.R316W|RASAL1_uc001tuo.3_Missense_Mutation_p.R316W|RASAL1_uc010syr.1_Missense_Mutation_p.R316W	p.R316W	NM_004658	NP_004649	O95294	RASL1_HUMAN			11	1239	-			316			Ras-GAP.		B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	c.946C>T	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673368	0.88445	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.19394	2.15;2.15;2.15;2.15	5.46	4.57	0.56435	Rho GTPase activation protein (1);Ras GTPase-activating protein (2);	0.347258	0.30879	N	0.008696	T	0.41558	0.1164	M	0.79123	2.44	0.36906	D	0.89063	D;D;D;D;D;D;D	0.71674	0.992;0.986;0.995;0.996;0.992;0.986;0.998	P;P;P;P;P;P;P	0.55824	0.513;0.513;0.785;0.614;0.761;0.582;0.785	T	0.57106	-0.7868	10	0.72032	D	0.01	.	14.5713	0.68213	0.0:0.0:0.8524:0.1476	.	316;316;316;328;316;316;316	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	W	316	ENSP00000450244:R316W;ENSP00000261729:R316W;ENSP00000395920:R316W;ENSP00000448510:R316W	ENSP00000261729:R316W	R	-	1	2	RASAL1	112037880	1.000000	0.71417	0.998000	0.56505	0.925000	0.55904	5.171000	0.64996	1.274000	0.44362	0.491000	0.48974	CGG		0.627	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		7	49	0	0	0	0.00308	0	7	49				
GPR180	160897	broad.mit.edu	37	13	95273342	95273342	+	Silent	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr13:95273342C>T	ENST00000376958.4	+	6	772	c.747C>T	c.(745-747)atC>atT	p.I249I		NM_180989.5	NP_851320.1	Q86V85	GP180_HUMAN	G protein-coupled receptor 180	249					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	10	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					TTTTTGACATCGCTTCCCAAA	0.343																																							uc001vly.2		NA																	0				breast(1)	1						c.(745-747)ATC>ATT		G protein-coupled receptor 180 precursor							138.0	128.0	132.0					13																	95273342		2203	4300	6503	SO:0001819	synonymous_variant	160897					integral to membrane		g.chr13:95273342C>T	AF339823	CCDS9472.1	13q32.1	2006-04-05			ENSG00000152749	ENSG00000152749			28899	protein-coding gene	gene with protein product	"""intimal thickness related receptor"""	607787				12538434	Standard	NM_180989		Approved	ITR	uc001vly.3	Q86V85	OTTHUMG00000017207	ENST00000376958.4:c.747C>T	13.37:g.95273342C>T						GPR180_uc001vlz.2_Silent_p.I148I|GPR180_uc010afi.2_Silent_p.I10I	p.I249I	NM_180989	NP_851320	Q86V85	GP180_HUMAN			6	825	+	all_neural(89;0.0684)|Medulloblastoma(90;0.163)		249			Helical; (Potential).		A8K1D5	Silent	SNP	ENST00000376958.4	37	c.747C>T	CCDS9472.1																																																																																				0.343	GPR180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045465.3	NM_180989		4	62	0	0	0	0.000248	0	4	62				
OR4M1	441670	broad.mit.edu	37	14	20248875	20248875	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr14:20248875T>A	ENST00000315957.4	+	1	475	c.394T>A	c.(394-396)Tat>Aat	p.Y132N		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ACCCCTCCACTATGCTACCAT	0.507																																							uc010tku.1		NA																	0					0						c.(394-396)TAT>AAT		olfactory receptor, family 4, subfamily M,							251.0	262.0	258.0					14																	20248875		2203	4300	6503	SO:0001583	missense	441670				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20248875T>A		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.394T>A	14.37:g.20248875T>A	ENSP00000319654:p.Tyr132Asn						p.Y132N	NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	394	+	all_cancers(95;0.00108)		132			Cytoplasmic (Potential).		B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	37	c.394T>A	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	20.6	4.017543	0.75161	.	.	ENSG00000176299	ENST00000315957	T	0.33438	1.41	4.33	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44097	D	0.000495	T	0.68595	0.3018	H	0.97940	4.11	0.45634	D	0.998564	D	0.89917	1.0	D	0.85130	0.997	T	0.79669	-0.1707	10	0.87932	D	0	-10.9879	11.7653	0.51926	0.0:0.0:0.0:1.0	.	132	Q8NGD0	OR4M1_HUMAN	N	132	ENSP00000319654:Y132N	ENSP00000319654:Y132N	Y	+	1	0	OR4M1	19318715	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.383000	0.79741	1.949000	0.56562	0.414000	0.27820	TAT		0.507	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1			20	410	0	0	0	0.002299	0	20	410				
NID2	22795	broad.mit.edu	37	14	52505627	52505627	+	Missense_Mutation	SNP	G	G	A	rs148168699	byFrequency	TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr14:52505627G>A	ENST00000216286.5	-	9	2094	c.2095C>T	c.(2095-2097)Cgc>Tgc	p.R699C	NID2_ENST00000541773.1_Missense_Mutation_p.R646C	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	699	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					TGGTGGATGCGGTAGGACCAT	0.512																																							uc001wzo.2		NA																	0				pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7						c.(2095-2097)CGC>TGC		nidogen 2 precursor		G	CYS/ARG	5,4401	9.9+/-24.2	0,5,2198	140.0	132.0	135.0		2095	5.3	0.9	14	dbSNP_134	135	1,8599	1.2+/-3.3	0,1,4299	yes	missense	NID2	NM_007361.3	180	0,6,6497	AA,AG,GG		0.0116,0.1135,0.0461	probably-damaging	699/1376	52505627	6,13000	2203	4300	6503	SO:0001583	missense	22795					basement membrane	calcium ion binding|collagen binding	g.chr14:52505627G>A	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.2095C>T	14.37:g.52505627G>A	ENSP00000216286:p.Arg699Cys					NID2_uc010tqs.1_Missense_Mutation_p.R699C|NID2_uc010tqt.1_Missense_Mutation_p.R699C|NID2_uc001wzp.2_Missense_Mutation_p.R699C	p.R699C	NM_007361	NP_031387	Q14112	NID2_HUMAN			9	2329	-	Breast(41;0.0639)|all_epithelial(31;0.123)		699			Nidogen G2 beta-barrel.		A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	c.2095C>T	CCDS9706.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.38|17.38	3.374310|3.374310	0.61735|0.61735	0.001135|0.001135	1.16E-4|1.16E-4	ENSG00000087303|ENSG00000087303	ENST00000556572|ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	.|T;T	.|0.30981	.|1.51;1.51	6.17|6.17	5.28|5.28	0.74379|0.74379	.|G2 nidogen/fibulin G2F (3);Green fluorescent protein-like (1);	.|0.420852	.|0.31167	.|N	.|0.008137	T|T	0.54319|0.54319	0.1851|0.1851	M|M	0.68317|0.68317	2.08|2.08	0.40687|0.40687	D|D	0.982365|0.982365	.|D;D;D;D	.|0.89917	.|0.995;0.999;1.0;0.999	.|P;P;D;P	.|0.68621	.|0.892;0.799;0.959;0.849	T|T	0.60757|0.60757	-0.7200|-0.7200	5|10	.|0.87932	.|D	.|0	.|.	16.7397|16.7397	0.85456|0.85456	0.0:0.0:0.8697:0.1303|0.0:0.0:0.8697:0.1303	.|.	.|293;646;701;699	.|E7EPP3;Q14112-2;Q5CZI2;Q14112	.|.;.;.;NID2_HUMAN	L|C	15|699;293;646;701	.|ENSP00000216286:R699C;ENSP00000443730:R646C	.|ENSP00000216286:R699C	P|R	-|-	2|1	0|0	NID2|NID2	51575377|51575377	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.196000|0.196000	0.23810|0.23810	3.154000|3.154000	0.50693|0.50693	1.615000|1.615000	0.50252|0.50252	0.655000|0.655000	0.94253|0.94253	CCG|CGC		0.512	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1			6	91	0	0	0	0.001168	0	6	91				
PELI2	57161	broad.mit.edu	37	14	56755184	56755184	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr14:56755184C>G	ENST00000267460.4	+	4	625	c.339C>G	c.(337-339)gaC>gaG	p.D113E		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	113	FHA; atypical.				innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)			kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						GCCCTATCGACTTCGTTGTCA	0.478																																							uc001xch.2		NA																	0				ovary(1)	1						c.(337-339)GAC>GAG		pellino 2							83.0	72.0	76.0					14																	56755184		2203	4300	6503	SO:0001583	missense	57161				innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of protein phosphorylation|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	protein binding	g.chr14:56755184C>G	AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.339C>G	14.37:g.56755184C>G	ENSP00000267460:p.Asp113Glu						p.D113E	NM_021255	NP_067078	Q9HAT8	PELI2_HUMAN			4	625	+			113					B2RDY5	Missense_Mutation	SNP	ENST00000267460.4	37	c.339C>G	CCDS9726.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285833	0.80803	.	.	ENSG00000139946	ENST00000267460	T	0.60797	0.16	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.79293	0.4421	M	0.89414	3.03	0.58432	D	0.999999	D	0.63046	0.992	D	0.79108	0.992	T	0.82671	-0.0342	10	0.87932	D	0	-45.3773	14.0996	0.65046	0.0:0.9283:0.0:0.0717	.	113	Q9HAT8	PELI2_HUMAN	E	113	ENSP00000267460:D113E	ENSP00000267460:D113E	D	+	3	2	PELI2	55824937	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	3.826000	0.55738	2.699000	0.92147	0.655000	0.94253	GAC		0.478	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276925.1			10	31	0	0	0	0.000978	0	10	31				
NPAP1	23742	broad.mit.edu	37	15	24922305	24922305	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr15:24922305G>T	ENST00000329468.2	+	1	1765	c.1291G>T	c.(1291-1293)Gac>Tac	p.D431Y		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	431	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TGACTTGGCTGACCTGGCTAC	0.542																																							uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(1291-1293)GAC>TAC		hypothetical protein LOC23742							130.0	119.0	123.0					15																	24922305		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24922305G>T	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1291G>T	15.37:g.24922305G>T	ENSP00000333735:p.Asp431Tyr						p.D431Y	NM_018958	NP_061831	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	1765	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	431			Pro-rich.			Missense_Mutation	SNP	ENST00000329468.2	37	c.1291G>T	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	12.39	1.924620	0.34002	.	.	ENSG00000185823	ENST00000329468	T	0.06687	3.27	2.1	-3.15	0.05233	.	1.879380	0.02674	N	0.108903	T	0.06142	0.0159	L	0.29908	0.895	0.09310	N	1	B	0.26975	0.165	B	0.27076	0.076	T	0.31336	-0.9947	10	0.59425	D	0.04	.	0.2358	0.00186	0.3024:0.2055:0.2843:0.2078	.	431	Q9NZP6	CO002_HUMAN	Y	431	ENSP00000333735:D431Y	ENSP00000333735:D431Y	D	+	1	0	C15orf2	22473398	0.000000	0.05858	0.000000	0.03702	0.456000	0.32438	-0.380000	0.07427	-0.835000	0.04234	0.313000	0.20887	GAC		0.542	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		7	62	1	0	0.00198382	0.001984	0.0022519	7	62				
CSPG4	1464	broad.mit.edu	37	15	75981484	75981484	+	Missense_Mutation	SNP	C	C	A	rs200073538		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr15:75981484C>A	ENST00000308508.5	-	3	2014	c.1922G>T	c.(1921-1923)cGg>cTg	p.R641L		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	641	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.|Interaction with COL6A2. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						ATCGCTGACCCGGAACGTCAA	0.687																																							uc002baw.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1921-1923)CGG>CTG		chondroitin sulfate proteoglycan 4 precursor							27.0	28.0	28.0					15																	75981484		2196	4288	6484	SO:0001583	missense	1464				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity	g.chr15:75981484C>A	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1922G>T	15.37:g.75981484C>A	ENSP00000312506:p.Arg641Leu						p.R641L	NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN			3	2015	-			641			Interaction with COL5A1 (By similarity).|Extracellular (Potential).|Gly/Ser-rich (glycosaminoglycan attachment domain).|CSPG 2.|Interaction with COL6A2 (By similarity).		D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	c.1922G>T	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	14.56	2.573162	0.45902	.	.	ENSG00000173546	ENST00000308508	T	0.21543	2.0	5.35	4.43	0.53597	.	0.393509	0.24530	N	0.037730	T	0.31702	0.0805	M	0.73962	2.25	0.37644	D	0.922165	D	0.59767	0.986	P	0.52424	0.698	T	0.28776	-1.0033	10	0.59425	D	0.04	.	5.7464	0.18122	0.0:0.7478:0.0:0.2522	.	641	Q6UVK1	CSPG4_HUMAN	L	641	ENSP00000312506:R641L	ENSP00000312506:R641L	R	-	2	0	CSPG4	73768539	0.998000	0.40836	0.994000	0.49952	0.292000	0.27327	3.005000	0.49521	2.498000	0.84270	0.555000	0.69702	CGG		0.687	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897		7	52	1	0	6.5536e-12	0.00308	9.74341e-12	7	52				
ADAMTSL3	57188	broad.mit.edu	37	15	84651344	84651344	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr15:84651344G>C	ENST00000286744.5	+	21	3188	c.2964G>C	c.(2962-2964)caG>caC	p.Q988H	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.Q988H	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	988	Ig-like C2-type 1.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GCTCTGCACAGGAAACAGTTG	0.567																																							uc002bjz.3		NA																	0				ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27						c.(2962-2964)CAG>CAC		ADAMTS-like 3 precursor							86.0	85.0	85.0					15																	84651344		2203	4300	6503	SO:0001583	missense	57188					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr15:84651344G>C	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2964G>C	15.37:g.84651344G>C	ENSP00000286744:p.Gln988His					ADAMTSL3_uc010bmt.1_Missense_Mutation_p.Q988H|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.Q988H	p.Q988H	NM_207517	NP_997400	P82987	ATL3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		21	3188	+			988			Ig-like C2-type 1.		A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	c.2964G>C	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	G	4.871	0.161955	0.09287	.	.	ENSG00000156218	ENST00000286744	T	0.77489	-1.1	5.05	-8.1	0.01086	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.796636	0.10655	N	0.649358	T	0.46073	0.1374	N	0.05383	-0.06	0.21105	N	0.999783	B;B	0.09022	0.0;0.002	B;B	0.15052	0.012;0.003	T	0.32322	-0.9911	10	0.23891	T	0.37	.	2.8748	0.05628	0.1806:0.3545:0.3089:0.156	.	988;988	P82987-2;P82987	.;ATL3_HUMAN	H	988	ENSP00000286744:Q988H	ENSP00000286744:Q988H	Q	+	3	2	ADAMTSL3	82442348	0.002000	0.14202	0.001000	0.08648	0.505000	0.33919	-0.717000	0.04986	-1.147000	0.02851	-0.300000	0.09419	CAG		0.567	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517		38	85	0	0	0	0.007835	0	38	85				
SMG1	23049	broad.mit.edu	37	16	18866017	18866017	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr16:18866017C>T	ENST00000446231.2	-	30	4856	c.4444G>A	c.(4444-4446)Gaa>Aaa	p.E1482K	SMG1_ENST00000389467.3_Missense_Mutation_p.E1482K			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1482	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ATATCAAGTTCGGGCCCCCAT	0.338																																							uc002dfm.2		NA																	0				breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						c.(4444-4446)GAA>AAA		PI-3-kinase-related kinase SMG-1							88.0	81.0	83.0					16																	18866017		1820	4076	5896	SO:0001583	missense	23049				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr16:18866017C>T	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.4444G>A	16.37:g.18866017C>T	ENSP00000402515:p.Glu1482Lys					SMG1_uc010bwb.2_Missense_Mutation_p.E1342K|SMG1_uc010bwa.2_Missense_Mutation_p.E213K	p.E1482K	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN			30	4807	-			1482			FAT.|Interaction with SMG8 and SMG9.		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	c.4444G>A	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425260	0.62733	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01051	5.4;5.4	5.74	5.74	0.90152	PIK-related kinase (1);Armadillo-type fold (1);	0.190954	0.36303	N	0.002673	T	0.03348	0.0097	N	0.22421	0.69	0.53005	D	0.999964	D	0.76494	0.999	D	0.71184	0.972	T	0.73026	-0.4112	10	0.24483	T	0.36	.	19.918	0.97070	0.0:1.0:0.0:0.0	.	1482	Q96Q15	SMG1_HUMAN	K	1482	ENSP00000402515:E1482K;ENSP00000374118:E1482K	ENSP00000374118:E1482K	E	-	1	0	SMG1	18773518	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	7.476000	0.81055	2.716000	0.92895	0.561000	0.74099	GAA		0.338	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092		8	56	0	0	0	0.00308	0	8	56				
TNRC6A	27327	broad.mit.edu	37	16	24803129	24803129	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr16:24803129A>T	ENST00000395799.3	+	6	3295	c.3166A>T	c.(3166-3168)Agt>Tgt	p.S1056C	TNRC6A_ENST00000315183.7_Missense_Mutation_p.S1056C	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1056	Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		AGAGGCAAGCAGTGGCTCTGG	0.408																																							uc002dmm.2		NA																	0				ovary(2)	2						c.(3166-3168)AGT>TGT		trinucleotide repeat containing 6A							35.0	30.0	32.0					16																	24803129		2197	4300	6497	SO:0001583	missense	27327				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding	g.chr16:24803129A>T	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.3166A>T	16.37:g.24803129A>T	ENSP00000379144:p.Ser1056Cys					TNRC6A_uc010bxs.2_Missense_Mutation_p.S803C|TNRC6A_uc010vcc.1_Missense_Mutation_p.S803C|TNRC6A_uc002dmn.2_Missense_Mutation_p.S803C|TNRC6A_uc002dmo.2_Missense_Mutation_p.S803C	p.S1056C	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN		GBM - Glioblastoma multiforme(48;0.0394)	6	3280	+			1056			Sufficient for interaction with EIF2C1 and EIF2C4.		C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	c.3166A>T	CCDS10624.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.09|11.09	1.536500|1.536500	0.27475|0.27475	.|.	.|.	ENSG00000090905|ENSG00000090905	ENST00000450465|ENST00000315183;ENST00000395799	.|T;T	.|0.12879	.|2.64;2.64	5.21|5.21	0.387|0.387	0.16259|0.16259	.|.	.|0.879864	.|0.09995	.|N	.|0.729229	T|T	0.13756|0.13756	0.0333|0.0333	L|L	0.59436|0.59436	1.845|1.845	0.58432|0.58432	D|D	0.999997|0.999997	.|B;B;B	.|0.11235	.|0.004;0.001;0.001	.|B;B;B	.|0.15484	.|0.013;0.002;0.002	T|T	0.05716|0.05716	-1.0868|-1.0868	5|10	.|0.54805	.|T	.|0.06	-0.1088|-0.1088	5.6355|5.6355	0.17534|0.17534	0.6056:0.0:0.2746:0.1198|0.6056:0.0:0.2746:0.1198	.|.	.|803;1056;1056	.|Q8NDV7-2;Q8NDV7-6;Q8NDV7	.|.;.;TNR6A_HUMAN	L|C	54|1056	.|ENSP00000326900:S1056C;ENSP00000379144:S1056C	.|ENSP00000326900:S1056C	Q|S	+|+	2|1	0|0	TNRC6A|TNRC6A	24710630|24710630	0.685000|0.685000	0.27652|0.27652	0.713000|0.713000	0.30519|0.30519	0.871000|0.871000	0.50021|0.50021	0.039000|0.039000	0.13884|0.13884	-0.167000|-0.167000	0.10871|0.10871	-0.274000|-0.274000	0.10170|0.10170	CAG|AGT		0.408	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847		4	12	0	0	0	0.000602	0	4	12				
KATNB1	10300	broad.mit.edu	37	16	57775655	57775655	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr16:57775655G>T	ENST00000379661.3	+	3	489	c.97G>T	c.(97-99)Ggg>Tgg	p.G33W		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1											cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				CAAAGCCTCCGGGCGGCTGCT	0.647																																							uc002eml.1		NA																	0					0						c.(97-99)GGG>TGG		katanin p80 subunit B 1							51.0	46.0	48.0					16																	57775655		2198	4300	6498	SO:0001583	missense	10300				cell division|mitosis|negative regulation of microtubule depolymerization|positive regulation of microtubule depolymerization|protein targeting	katanin complex|microtubule|spindle pole	microtubule binding|protein heterodimerization activity	g.chr16:57775655G>T	AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.97G>T	16.37:g.57775655G>T	ENSP00000368982:p.Gly33Trp						p.G33W	NM_005886	NP_005877	Q9BVA0	KTNB1_HUMAN			3	471	+		all_neural(199;0.223)	33			WD 1.|Interaction with centrosomes.|Interaction with dynein (By similarity).			Missense_Mutation	SNP	ENST00000379661.3	37	c.97G>T	CCDS10788.1	.	.	.	.	.	.	.	.	.	.	g	26.9	4.783597	0.90282	.	.	ENSG00000140854	ENST00000379661	T	0.66815	-0.23	5.01	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.86422	0.5929	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90253	0.4295	10	0.87932	D	0	-42.1669	16.8827	0.86067	0.0:0.0:1.0:0.0	.	33	Q9BVA0	KTNB1_HUMAN	W	33	ENSP00000368982:G33W	ENSP00000368982:G33W	G	+	1	0	KATNB1	56333156	1.000000	0.71417	0.919000	0.36401	0.963000	0.63663	7.630000	0.83225	2.321000	0.78463	0.655000	0.94253	GGG		0.647	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257343.3			9	40	1	0	0.000274275	0.004482	0.000331498	9	40				
AC009120.6	0	broad.mit.edu	37	16	74366531	74366531	+	RNA	SNP	A	A	C	rs3743922		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr16:74366531A>C	ENST00000565313.1	-	0	0				AC009120.6_ENST00000561921.1_RNA																							CCCGGATCCCATTTGCATAGC	0.602																																							uc002fcr.2		NA																	0					0						c.(835-837)AAT>AAG		Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.																																						283922							g.chr16:74366531A>C																													16.37:g.74366531A>C						LOC283922_uc010vms.1_RNA	p.N279K							14	2183	-									Missense_Mutation	SNP	ENST00000565313.1	37	c.837T>G																																																																																					0.602	AC009120.6-003	KNOWN	basic	antisense	antisense	OTTHUMT00000434677.1			6	17	0	0	0	0.001984	0	6	17				
TUBB8P7	197331	broad.mit.edu	37	16	90161578	90161578	+	RNA	SNP	G	G	A	rs13337896	byFrequency	TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr16:90161578G>A	ENST00000564451.1	+	0	931				TUBB8P7_ENST00000567960.1_RNA					tubulin, beta 8 class VIII pseudogene 7									p.R105H(3)									GCCAAGGGACGCTACACCGAA	0.587													.|||	668	0.133387	0.0386	0.1499	5008	,	,		18807	0.4087		0.0537	False		,,,				2504	0.0481						uc002fqp.2		NA																	3	Substitution - Missense(3)		urinary_tract(1)|prostate(1)|kidney(1)		NA						c.(451-453)ACG>ACA		Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																																						0							g.chr16:90161578G>A			16q24.3	2013-02-18			ENSG00000261812	ENSG00000261812			42345	pseudogene	pseudogene							Standard	NG_002334		Approved				OTTHUMG00000172847		16.37:g.90161578G>A						uc002fqq.2_Silent_p.T168T	p.T151T							3	931	+									Silent	SNP	ENST00000564451.1	37	c.453G>A																																																																																					0.587	TUBB8P7-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000420856.1	NG_002334		4	69	0	0	0	0.000248	0	4	69				
ZBTB4	57659	broad.mit.edu	37	17	7365687	7365687	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr17:7365687C>A	ENST00000311403.4	-	4	2953	c.2614G>T	c.(2614-2616)Gtg>Ttg	p.V872L	ZBTB4_ENST00000380599.4_Missense_Mutation_p.V872L	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	872					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		AATTCCTGCACAGGTGGGTAT	0.627																																							uc002ghc.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(2614-2616)GTG>TTG		zinc finger and BTB domain containing 4							27.0	29.0	29.0					17																	7365687		2202	4300	6502	SO:0001583	missense	57659				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr17:7365687C>A	AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.2614G>T	17.37:g.7365687C>A	ENSP00000307858:p.Val872Leu					ZBTB4_uc002ghd.3_Missense_Mutation_p.V872L	p.V872L	NM_001128833	NP_001122305	Q9P1Z0	ZBTB4_HUMAN		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)	4	2864	-		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)	872					B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Missense_Mutation	SNP	ENST00000311403.4	37	c.2614G>T	CCDS11107.1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.334547	0.60853	.	.	ENSG00000174282	ENST00000311403;ENST00000380599	T;T	0.05025	3.51;3.51	5.04	5.04	0.67666	.	0.212209	0.32608	N	0.005880	T	0.05868	0.0153	N	0.24115	0.695	0.31277	N	0.69108	P	0.38827	0.649	B	0.36186	0.219	T	0.05989	-1.0852	10	0.52906	T	0.07	-13.9586	15.4067	0.74884	0.0:1.0:0.0:0.0	.	872	Q9P1Z0	ZBTB4_HUMAN	L	872	ENSP00000307858:V872L;ENSP00000369973:V872L	ENSP00000307858:V872L	V	-	1	0	ZBTB4	7306411	0.938000	0.31826	1.000000	0.80357	0.980000	0.70556	1.376000	0.34306	2.640000	0.89533	0.655000	0.94253	GTG		0.627	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226940.2	NM_020899		9	46	1	0	1.58986e-06	0.008291	2.11982e-06	9	46				
CNTROB	116840	broad.mit.edu	37	17	7851025	7851025	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr17:7851025G>T	ENST00000563694.1	+	14	3055	c.2130G>T	c.(2128-2130)aaG>aaT	p.K710N	CNTROB_ENST00000380255.3_3'UTR|CNTROB_ENST00000565740.1_Missense_Mutation_p.K710N|CNTROB_ENST00000380262.3_Missense_Mutation_p.K710N	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	710	Pro-rich.|Required for centrosome localization.				centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)	p.K710N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				AGGGCCTCAAGAATTTTTTGC	0.542																																							uc002gjq.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	breast(1)|central_nervous_system(1)	2						c.(2128-2130)AAG>AAT		centrobin, centrosomal BRCA2 interacting protein							79.0	86.0	84.0					17																	7851025		2203	4300	6503	SO:0001583	missense	116840				centriole replication|centrosome separation|cytokinesis	centriole	protein domain specific binding	g.chr17:7851025G>T	AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.2130G>T	17.37:g.7851025G>T	ENSP00000456335:p.Lys710Asn					CNTROB_uc002gjp.2_Missense_Mutation_p.K710N|CNTROB_uc002gjr.2_Missense_Mutation_p.K612N	p.K710N	NM_053051	NP_444279	Q8N137	CNTRB_HUMAN			15	3049	+		Prostate(122;0.173)	710			Pro-rich.|Required for centrosome localization.		A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Missense_Mutation	SNP	ENST00000563694.1	37	c.2130G>T	CCDS11126.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709554	0.68730	.	.	ENSG00000170037	ENST00000380262	T	0.11385	2.78	5.41	4.44	0.53790	.	0.127688	0.36628	N	0.002499	T	0.16214	0.0390	L	0.29908	0.895	0.80722	D	1	D;D;D	0.69078	0.99;0.99;0.997	P;P;P	0.58266	0.836;0.836;0.836	T	0.01280	-1.1397	10	0.87932	D	0	-35.5196	9.8704	0.41170	0.0917:0.0:0.9083:0.0	.	710;710;710	Q8N137-3;Q8N137;Q8N137-2	.;CNTRB_HUMAN;.	N	710	ENSP00000369614:K710N	ENSP00000369614:K710N	K	+	3	2	CNTROB	7791750	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	1.931000	0.40134	1.513000	0.48852	0.561000	0.74099	AAG		0.542	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051		12	91	1	0	1.08611e-07	0.000978	1.48346e-07	12	91				
TMEM132E	124842	broad.mit.edu	37	17	32961947	32961947	+	Silent	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr17:32961947C>T	ENST00000321639.5	+	8	1876	c.1548C>T	c.(1546-1548)tcC>tcT	p.S516S		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	516						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		CGACATCATCCGAGGGCACTG	0.637																																							uc002hif.2		NA																	0				central_nervous_system(1)	1						c.(1546-1548)TCC>TCT		transmembrane protein 132E precursor							109.0	86.0	94.0					17																	32961947		2203	4300	6503	SO:0001819	synonymous_variant	124842					integral to membrane		g.chr17:32961947C>T	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1548C>T	17.37:g.32961947C>T							p.S516S	NM_207313	NP_997196	Q6IEE7	T132E_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.231)	8	1876	+			516			Extracellular (Potential).		Q8WUF4|Q8WVA5	Silent	SNP	ENST00000321639.5	37	c.1548C>T	CCDS11283.1																																																																																				0.637	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313		8	85	0	0	0	0.008291	0	8	85				
KRT40	125115	broad.mit.edu	37	17	39137108	39137108	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr17:39137108G>T	ENST00000398486.2	-	7	1064	c.904C>A	c.(904-906)Cag>Aag	p.Q302K	KRT40_ENST00000377755.4_Missense_Mutation_p.Q302K	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	302	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				ATCTCCATCTGGCAGCCCTGC	0.522																																							uc010cxh.1		NA																	0					0						c.(904-906)CAG>AAG		type I hair keratin KA36							103.0	105.0	105.0					17																	39137108		2031	4212	6243	SO:0001583	missense	125115					intermediate filament	structural molecule activity	g.chr17:39137108G>T	AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.904C>A	17.37:g.39137108G>T	ENSP00000381500:p.Gln302Lys					KRT40_uc002hvq.1_RNA	p.Q302K	NM_182497	NP_872303	Q6A162	K1C40_HUMAN			7	1065	-		Breast(137;0.00043)	302			Rod.|Coil 2.		Q6IFU5	Missense_Mutation	SNP	ENST00000398486.2	37	c.904C>A	CCDS42320.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.457660	0.63401	.	.	ENSG00000204889	ENST00000377755;ENST00000398486	D;D	0.86694	-2.16;-2.16	5.4	5.4	0.78164	Filament (1);	0.000000	0.32055	N	0.006653	D	0.86171	0.5869	N	0.16790	0.44	0.32404	N	0.551582	D	0.89917	1.0	D	0.87578	0.998	T	0.83107	-0.0125	10	0.16896	T	0.51	.	12.2518	0.54601	0.0:0.0:0.7337:0.2662	.	302	Q6A162	K1C40_HUMAN	K	302	ENSP00000366984:Q302K;ENSP00000381500:Q302K	ENSP00000366984:Q302K	Q	-	1	0	KRT40	36390634	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.426000	0.66476	2.688000	0.91661	0.655000	0.94253	CAG		0.522	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257701.3	NM_182497		17	136	1	0	2.5808e-16	0.006122	3.97774e-16	17	136				
TTC25	83538	broad.mit.edu	37	17	40101407	40101407	+	RNA	SNP	A	A	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr17:40101407A>C	ENST00000591658.1	+	0	1144							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm (GO:0005737)				endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				CCTGATGCAAAATCGAGAGCC	0.473																																							uc002hyj.3		NA																	0				ovary(1)	1						c.(1075-1077)AAA>ACA		tetratricopeptide repeat domain 25							51.0	45.0	47.0					17																	40101407		1906	4128	6034			83538					cytoplasm	protein binding	g.chr17:40101407A>C	AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815		"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product							Standard	XM_006722129		Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40101407A>C						TTC25_uc010cxt.2_RNA|TTC25_uc010cxs.1_Missense_Mutation_p.N215H	p.K359T	NM_031421	NP_113609	Q96NG3	TTC25_HUMAN			8	1165	+		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)	359					Q6NX40|Q6PJ04|Q9H0K5	Missense_Mutation	SNP	ENST00000591658.1	37	c.1076A>C		.	.	.	.	.	.	.	.	.	.	A	11.97	1.797420	0.31777	.	.	ENSG00000204815	ENST00000377540	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	T	0.39200	0.1069	.	.	.	0.09310	N	0.999996	P	0.38642	0.641	B	0.37833	0.259	T	0.54741	-0.8248	6	0.36615	T	0.2	-23.0584	10.7467	0.46185	0.8232:0.0:0.0:0.1768	.	215	C9JGW6	.	H	215	.	ENSP00000366763:N215H	N	+	1	0	AC091172.1	37354933	0.657000	0.27393	1.000000	0.80357	0.990000	0.78478	1.314000	0.33597	2.139000	0.66308	0.450000	0.29827	AAT		0.473	TTC25-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000449237.1	NM_031421		3	14	0	0	0	0.004672	0	3	14				
CNP	1267	broad.mit.edu	37	17	40120102	40120102	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr17:40120102G>A	ENST00000393892.3	+	2	164	c.20G>A	c.(19-21)cGa>cAa	p.R7Q	CNP_ENST00000393888.1_5'UTR|TTC25_ENST00000591658.1_RNA|CNP_ENST00000472031.1_Intron|CNP_ENST00000591072.1_Intron|CNP_ENST00000592446.1_3'UTR	NM_033133.4	NP_149124.3	P09543	CN37_HUMAN	2',3'-cyclic nucleotide 3' phosphodiesterase	7					adult locomotory behavior (GO:0008344)|aging (GO:0007568)|axonogenesis (GO:0007409)|cyclic nucleotide catabolic process (GO:0009214)|microtubule cytoskeleton organization (GO:0000226)|oligodendrocyte differentiation (GO:0048709)|regulation of mitochondrial membrane permeability (GO:0046902)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule (GO:0005874)|microvillus (GO:0005902)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|myelin sheath abaxonal region (GO:0035748)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	2',3'-cyclic-nucleotide 3'-phosphodiesterase activity (GO:0004113)|cyclic nucleotide binding (GO:0030551)|RNA binding (GO:0003723)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	9		all_cancers(22;2.38e-06)|all_epithelial(22;6.79e-05)|Breast(137;0.000143)		UCEC - Uterine corpus endometrioid carcinoma (308;0.171)		GGCTTCTCCCGAAAAAGCCAC	0.567																																							uc002hyl.1		NA																	0					0						c.(19-21)CGA>CAA		2',3'-cyclic nucleotide 3' phosphodiesterase							103.0	108.0	106.0					17																	40120102		2040	4193	6233	SO:0001583	missense	1267				cell killing|cyclic nucleotide catabolic process|RNA metabolic process|synaptic transmission	extracellular space|melanosome	2',3'-cyclic-nucleotide 3'-phosphodiesterase activity|ATP binding|protein binding	g.chr17:40120102G>A		CCDS11414.2	17q21	2008-02-05			ENSG00000173786	ENSG00000173786	3.1.4.37		2158	protein-coding gene	gene with protein product		123830				1322358	Standard	XM_006721701		Approved		uc002hyl.1	P09543	OTTHUMG00000133502	ENST00000393892.3:c.20G>A	17.37:g.40120102G>A	ENSP00000377470:p.Arg7Gln					CNP_uc002hyk.1_Missense_Mutation_p.R7Q|CNP_uc010wfz.1_Missense_Mutation_p.R7Q|CNP_uc002hym.1_5'UTR|CNP_uc010wga.1_Intron	p.R7Q	NM_033133	NP_149124	P09543	CN37_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.171)	2	164	+		all_cancers(22;2.38e-06)|all_epithelial(22;6.79e-05)|Breast(137;0.000143)	7						Missense_Mutation	SNP	ENST00000393892.3	37	c.20G>A	CCDS11414.2	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586246	0.66105	.	.	ENSG00000173786	ENST00000393892;ENST00000310262	T	0.50813	0.73	4.81	3.82	0.43975	.	0.447486	0.15498	U	0.259184	T	0.29028	0.0721	N	0.19112	0.55	0.80722	D	1	P;P	0.36438	0.553;0.553	B;B	0.30646	0.118;0.075	T	0.15178	-1.0446	10	0.87932	D	0	6.0E-4	7.8392	0.29389	0.0936:0.1668:0.7395:0.0	.	7;7	B4DI06;P09543	.;CN37_HUMAN	Q	7	ENSP00000377470:R7Q	ENSP00000309643:R7Q	R	+	2	0	CNP	37373628	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.149000	0.50655	1.356000	0.45884	0.549000	0.68633	CGA		0.567	CNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257443.2			7	98	0	0	0	0.00308	0	7	98				
TEX2	55852	broad.mit.edu	37	17	62238285	62238285	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr17:62238285T>A	ENST00000583097.1	-	8	2852	c.2680A>T	c.(2680-2682)Att>Ttt	p.I894F	TEX2_ENST00000584379.1_Missense_Mutation_p.I894F|TEX2_ENST00000258991.3_Missense_Mutation_p.I901F			Q8IWB9	TEX2_HUMAN	testis expressed 2	894					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TCCAAATCAATCCAGAGTCCT	0.363																																							uc002jec.2		NA																	0				ovary(1)	1						c.(2680-2682)ATT>TTT		testis expressed sequence 2							94.0	98.0	97.0					17																	62238285		2203	4300	6503	SO:0001583	missense	55852				signal transduction|sphingolipid metabolic process	integral to membrane		g.chr17:62238285T>A	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2680A>T	17.37:g.62238285T>A	ENSP00000462665:p.Ile894Phe					TEX2_uc002jed.2_Missense_Mutation_p.I901F|TEX2_uc002jee.2_Missense_Mutation_p.I894F	p.I894F	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)	8	2853	-			894					Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	37	c.2680A>T		.	.	.	.	.	.	.	.	.	.	T	12.56	1.976043	0.34848	.	.	ENSG00000136478	ENST00000258991	T	0.42900	0.96	5.84	5.84	0.93424	Domain of unknown function DUF2404 (1);	0.099352	0.64402	D	0.000001	T	0.23649	0.0572	N	0.04768	-0.165	0.54753	D	0.999984	B;B	0.12630	0.005;0.006	B;B	0.19946	0.016;0.027	T	0.10314	-1.0635	10	0.29301	T	0.29	-16.5957	12.0381	0.53438	0.0:0.0687:0.0:0.9313	.	901;894	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	F	901	ENSP00000258991:I901F	ENSP00000258991:I901F	I	-	1	0	TEX2	59592017	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.011000	0.57124	2.234000	0.73211	0.459000	0.35465	ATT		0.363	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469		18	97	0	0	0	0.00499	0	18	97				
CCDC57	284001	broad.mit.edu	37	17	80059641	80059641	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr17:80059641T>C	ENST00000389641.4	-	18	2704	c.2668A>G	c.(2668-2670)Aca>Gca	p.T890A	CCDC57_ENST00000392347.1_Missense_Mutation_p.T890A			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	890										endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GAGGCTCCTGTGGTCTTGGCC	0.612																																							uc002kdx.1		NA																	0				ovary(2)	2						c.(2665-2667)ACA>GCA		coiled-coil domain containing 57							89.0	97.0	95.0					17																	80059641		1996	4162	6158	SO:0001583	missense	284001							g.chr17:80059641T>C	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.2668A>G	17.37:g.80059641T>C	ENSP00000374292:p.Thr890Ala						p.T889A	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)		17	2702	-	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		890					A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	ENST00000389641.4	37	c.2665A>G		.	.	.	.	.	.	.	.	.	.	t	10.41	1.343761	0.24339	.	.	ENSG00000176155	ENST00000389641;ENST00000392347	T;T	0.09445	2.98;2.98	3.39	0.87	0.19102	.	.	.	.	.	T	0.06280	0.0162	N	0.24115	0.695	0.22266	N	0.999241	B	0.23891	0.093	B	0.20955	0.032	T	0.40813	-0.9543	9	0.31617	T	0.26	.	4.1581	0.10270	0.0:0.1187:0.2063:0.675	.	890	Q2TAC2	CCD57_HUMAN	A	890	ENSP00000374292:T890A;ENSP00000376158:T890A	ENSP00000374292:T890A	T	-	1	0	CCDC57	77652930	0.001000	0.12720	0.044000	0.18714	0.192000	0.23643	-1.042000	0.03539	-0.085000	0.12573	0.454000	0.30748	ACA		0.612	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082		16	105	0	0	0	0.004007	0	16	105				
CLUL1	27098	broad.mit.edu	37	18	641480	641480	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr18:641480G>T	ENST00000400606.2	+	7	1293	c.1148G>T	c.(1147-1149)gGc>gTc	p.G383V	CLUL1_ENST00000338387.7_Missense_Mutation_p.G383V|CLUL1_ENST00000579494.1_Missense_Mutation_p.G383V|C18orf56_ENST00000585033.1_Intron|CLUL1_ENST00000540035.1_Missense_Mutation_p.G435V|CLUL1_ENST00000581619.1_Missense_Mutation_p.G408V	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	383					cell death (GO:0008219)	extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						GGGCAATTTGGCTGGGTGTCT	0.493																																							uc002kkp.2		NA																	0				ovary(2)	2						c.(1147-1149)GGC>GTC		clusterin-like 1 (retinal) precursor							108.0	105.0	106.0					18																	641480		1933	4127	6060	SO:0001583	missense	27098				cell death	extracellular region		g.chr18:641480G>T	D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.1148G>T	18.37:g.641480G>T	ENSP00000383449:p.Gly383Val					CLUL1_uc010wys.1_Missense_Mutation_p.G435V|CLUL1_uc002kkq.2_Missense_Mutation_p.G383V	p.G383V	NM_014410	NP_055225	Q15846	CLUL1_HUMAN			7	1293	+			383					A0FDN7	Missense_Mutation	SNP	ENST00000400606.2	37	c.1148G>T	CCDS42405.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674015	0.47781	.	.	ENSG00000079101	ENST00000400606;ENST00000540035;ENST00000338387	T;T;T	0.33216	1.42;1.42;1.42	5.59	5.59	0.84812	Clusterin, C-terminal (1);	0.109587	0.64402	D	0.000008	T	0.55386	0.1917	M	0.68952	2.095	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.73380	0.966;0.98	T	0.56432	-0.7980	10	0.72032	D	0.01	-5.3504	17.7499	0.88430	0.0:0.0:1.0:0.0	.	435;383	F5GWQ8;Q15846	.;CLUL1_HUMAN	V	383;435;383	ENSP00000383449:G383V;ENSP00000441726:G435V;ENSP00000341128:G383V	ENSP00000341128:G383V	G	+	2	0	CLUL1	631480	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	3.602000	0.54066	2.630000	0.89119	0.563000	0.77884	GGC		0.493	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441183.1			11	94	1	0	5.50884e-06	0.001368	7.11911e-06	11	94				
LRRC30	339291	broad.mit.edu	37	18	7231146	7231146	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr18:7231146A>G	ENST00000383467.2	+	1	24	c.10A>G	c.(10-12)Agg>Ggg	p.R4G		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	4										central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						AATGGGGGCCAGGCAGTCAAG	0.607																																							uc010wzk.1		NA																	0				ovary(1)|liver(1)	2						c.(10-12)AGG>GGG		leucine rich repeat containing 30							52.0	57.0	56.0					18																	7231146		2024	4171	6195	SO:0001583	missense	339291							g.chr18:7231146A>G		CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.10A>G	18.37:g.7231146A>G	ENSP00000372959:p.Arg4Gly						p.R4G	NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN			1	10	+			4						Missense_Mutation	SNP	ENST00000383467.2	37	c.10A>G	CCDS42409.1	.	.	.	.	.	.	.	.	.	.	A	10.94	1.493326	0.26774	.	.	ENSG00000206422	ENST00000383467	T	0.46063	0.88	5.56	1.89	0.25635	.	0.854162	0.10761	N	0.637216	T	0.26159	0.0638	N	0.19112	0.55	0.19945	N	0.999942	B	0.06786	0.001	B	0.04013	0.001	T	0.22730	-1.0208	10	0.66056	D	0.02	.	5.5286	0.16972	0.6516:0.1379:0.2105:0.0	.	4	A6NM36	LRC30_HUMAN	G	4	ENSP00000372959:R4G	ENSP00000372959:R4G	R	+	1	2	LRRC30	7221146	1.000000	0.71417	0.992000	0.48379	0.691000	0.40173	2.170000	0.42443	0.476000	0.27440	0.533000	0.62120	AGG		0.607	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442140.1	XM_292678		7	80	0	0	0	0.00308	0	7	80				
POTEC	388468	broad.mit.edu	37	18	14542792	14542792	+	Silent	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr18:14542792G>T	ENST00000358970.5	-	1	353	c.354C>A	c.(352-354)ggC>ggA	p.G118G	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	118										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						CTCCCCAAGCGCCCACGTTGC	0.597																																							uc010dln.2		NA																	0				skin(3)	3						c.(352-354)GGC>GGA		ANKRD26-like family B, member 2							63.0	66.0	65.0					18																	14542792		692	1590	2282	SO:0001819	synonymous_variant	388468							g.chr18:14542792G>T	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.354C>A	18.37:g.14542792G>T						POTEC_uc010xaj.1_RNA	p.G118G	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN			1	808	-			118						Silent	SNP	ENST00000358970.5	37	c.354C>A	CCDS45835.1																																																																																				0.597	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269		14	200	1	0	1.05317e-09	0.00245	1.52528e-09	14	200				
CDH7	1005	broad.mit.edu	37	18	63430252	63430252	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr18:63430252G>T	ENST00000397968.2	+	2	600	c.174G>T	c.(172-174)gaG>gaT	p.E58D	CDH7_ENST00000581601.1_3'UTR|CDH7_ENST00000323011.3_Missense_Mutation_p.E58D|CDH7_ENST00000536984.2_Missense_Mutation_p.E58D	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	58	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TTGTGCTGGAGGAATACATGG	0.458																																							uc002ljz.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(172-174)GAG>GAT		cadherin 7, type 2 preproprotein							80.0	75.0	77.0					18																	63430252		2203	4300	6503	SO:0001583	missense	1005				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:63430252G>T	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.174G>T	18.37:g.63430252G>T	ENSP00000381058:p.Glu58Asp					CDH7_uc002lka.2_Missense_Mutation_p.E58D|CDH7_uc002lkb.2_Missense_Mutation_p.E58D	p.E58D	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN			2	499	+		Esophageal squamous(42;0.129)	58			Extracellular (Potential).|Cadherin 1.		Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	c.174G>T	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545546	0.65198	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.00560	6.6;6.6;6.6	5.57	3.66	0.41972	Cadherin-like (1);	0.113047	0.56097	D	0.000029	T	0.03783	0.0107	H	0.98155	4.16	0.54753	D	0.999987	D;D	0.65815	0.995;0.991	D;D	0.75020	0.911;0.985	T	0.00324	-1.1817	10	0.87932	D	0	.	8.5551	0.33476	0.3033:0.0:0.6967:0.0	.	58;58	F5H5X9;Q9ULB5	.;CADH7_HUMAN	D	58	ENSP00000319166:E58D;ENSP00000443030:E58D;ENSP00000381058:E58D	ENSP00000319166:E58D	E	+	3	2	CDH7	61581232	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.725000	0.38074	1.218000	0.43458	0.655000	0.94253	GAG		0.458	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646		12	48	1	0	4.36969e-10	0.001855	6.38355e-10	12	48				
ADNP2	22850	broad.mit.edu	37	18	77896341	77896341	+	Silent	SNP	G	G	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr18:77896341G>C	ENST00000262198.4	+	4	3500	c.3045G>C	c.(3043-3045)gtG>gtC	p.V1015V		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	1015					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CGAGTGTTGTGCCTTTTAAAA	0.507																																							uc002lnw.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(3043-3045)GTG>GTC		ADNP homeobox 2							47.0	53.0	51.0					18																	77896341		2203	4299	6502	SO:0001819	synonymous_variant	22850				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:77896341G>C	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.3045G>C	18.37:g.77896341G>C							p.V1015V	NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)	4	3500	+		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)	1015					A8K951|O94943|Q9H9P3	Silent	SNP	ENST00000262198.4	37	c.3045G>C	CCDS32853.1																																																																																				0.507	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913		13	47	0	0	0	0.003163	0	13	47				
PTPRS	5802	broad.mit.edu	37	19	5274329	5274329	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr19:5274329T>A	ENST00000587303.1	-	2	217	c.118A>T	c.(118-120)Aag>Tag	p.K40*	PTPRS_ENST00000262963.6_Nonsense_Mutation_p.K40*|PTPRS_ENST00000372412.4_Nonsense_Mutation_p.K40*|PTPRS_ENST00000590509.1_Nonsense_Mutation_p.K40*|PTPRS_ENST00000592099.1_Nonsense_Mutation_p.K40*|PTPRS_ENST00000348075.2_Nonsense_Mutation_p.K40*|PTPRS_ENST00000353284.2_Nonsense_Mutation_p.K40*|PTPRS_ENST00000357368.4_Nonsense_Mutation_p.K40*|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000588012.1_Nonsense_Mutation_p.K40*			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	40	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	ATCTGGTCCTTGGGTTCTTTG	0.597																																							uc002mbv.2		NA																	0				large_intestine(2)|ovary(1)|central_nervous_system(1)	4						c.(118-120)AAG>TAG		protein tyrosine phosphatase, receptor type,							36.0	40.0	38.0					19																	5274329		2203	4300	6503	SO:0001587	stop_gained	5802				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr19:5274329T>A	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.118A>T	19.37:g.5274329T>A	ENSP00000467537:p.Lys40*					PTPRS_uc002mbu.1_Nonsense_Mutation_p.K40*|PTPRS_uc010xin.1_Nonsense_Mutation_p.K40*|PTPRS_uc002mbw.2_Nonsense_Mutation_p.K40*|PTPRS_uc002mbx.2_Nonsense_Mutation_p.K40*|PTPRS_uc002mby.2_Nonsense_Mutation_p.K40*|PTPRS_uc002mbz.1_Nonsense_Mutation_p.K40*	p.K40*	NM_002850	NP_002841	Q13332	PTPRS_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	3	352	-			40			Ig-like C2-type 1.|Extracellular (Potential).		O75255|O75870|Q15718|Q16341|Q2M3R7	Nonsense_Mutation	SNP	ENST00000587303.1	37	c.118A>T	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	T	37	6.552534	0.97658	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	.	.	.	3.7	2.57	0.30868	.	0.659026	0.12389	U	0.473184	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	4.4406	0.11572	0.0:0.1512:0.1967:0.6521	.	.	.	.	X	66;40;40;40;40;40;40;40;40;40	.	ENSP00000262963:K40X	K	-	1	0	PTPRS	5225329	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.247000	0.43151	1.459000	0.47892	0.374000	0.22700	AAG		0.597	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2			16	28	0	0	0	0.004007	0	16	28				
MBD3L1	85509	broad.mit.edu	37	19	8953771	8953771	+	Silent	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr19:8953771C>T	ENST00000595891.1	+	3	648	c.417C>T	c.(415-417)atC>atT	p.I139I	MBD3L1_ENST00000305625.2_Silent_p.I139I			Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like 1	139					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	12						GAGTGGGTATCTCGCAGCTCC	0.522																																							uc002mko.2		NA																	0					0						c.(415-417)ATC>ATT		methyl-CpG binding domain protein 3-like							47.0	40.0	42.0					19																	8953771		2203	4300	6503	SO:0001819	synonymous_variant	85509				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr19:8953771C>T	AY038022	CCDS12209.1	19p13.2	2011-01-31	2003-03-19	2003-03-21	ENSG00000170948	ENSG00000170948			15774	protein-coding gene	gene with protein product		607963	"""methyl-CpG binding domain protein 3-like"""	MBD3L		12504854	Standard	NM_145208		Approved		uc002mko.2	Q8WWY6		ENST00000595891.1:c.417C>T	19.37:g.8953771C>T							p.I139I	NM_145208	NP_660209	Q8WWY6	MB3L1_HUMAN			1	503	+			139					B5BUM6|Q2M291	Silent	SNP	ENST00000595891.1	37	c.417C>T	CCDS12209.1																																																																																				0.522	MBD3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459973.1	NM_145208		5	27	0	0	0	0.000602	0	5	27				
KIAA1683	80726	broad.mit.edu	37	19	18375896	18375896	+	Silent	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr19:18375896C>T	ENST00000600328.3	-	3	2647	c.2454G>A	c.(2452-2454)caG>caA	p.Q818Q	KIAA1683_ENST00000392413.4_Silent_p.Q818Q|KIAA1683_ENST00000600359.3_Silent_p.Q772Q			Q9H0B3	K1683_HUMAN	KIAA1683	818						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						ATGGTCCCCCCTGAGTGGTCT	0.687																																							uc002nin.2		NA																	0				ovary(2)	2						c.(2452-2454)CAG>CAA		KIAA1683 isoform b							61.0	62.0	62.0					19																	18375896		2202	4298	6500	SO:0001819	synonymous_variant	80726					mitochondrion		g.chr19:18375896C>T	AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.2454G>A	19.37:g.18375896C>T						KIAA1683_uc010ebn.2_Silent_p.Q818Q|KIAA1683_uc010xqe.1_Silent_p.Q772Q	p.Q818Q	NM_025249	NP_079525	Q9H0B3	K1683_HUMAN			3	2670	-			818					B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Silent	SNP	ENST00000600328.3	37	c.2454G>A	CCDS32958.1																																																																																				0.687	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3			9	134	0	0	0	0.008291	0	9	134				
ZNF420	147923	broad.mit.edu	37	19	37619025	37619025	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr19:37619025C>T	ENST00000337995.3	+	5	1347	c.1132C>T	c.(1132-1134)Ctt>Ttt	p.L378F	CTC-454I21.4_ENST00000587645.1_RNA|ZNF585A_ENST00000588723.1_Intron|ZNF420_ENST00000304239.7_Missense_Mutation_p.L378F	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	378					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGGCTCACAACTTACTCAACA	0.418																																							uc002ofl.2		NA																	0					0						c.(1132-1134)CTT>TTT		zinc finger protein 420							90.0	94.0	93.0					19																	37619025		2203	4300	6503	SO:0001583	missense	147923				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37619025C>T	AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.1132C>T	19.37:g.37619025C>T	ENSP00000338770:p.Leu378Phe						p.L378F	NM_144689	NP_653290	Q8TAQ5	ZN420_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		5	1347	+			378			C2H2-type 9.		B2RDY6|Q96ML5	Missense_Mutation	SNP	ENST00000337995.3	37	c.1132C>T	CCDS12498.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707531	0.48412	.	.	ENSG00000197050	ENST00000304239;ENST00000337995	T;T	0.52057	0.68;0.68	4.24	3.2	0.36748	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.62502	0.2433	M	0.73319	2.225	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.62637	-0.6812	9	0.59425	D	0.04	.	8.2111	0.31483	0.0:0.8019:0.0:0.1981	.	378	Q8TAQ5	ZN420_HUMAN	F	378	ENSP00000306102:L378F;ENSP00000338770:L378F	ENSP00000306102:L378F	L	+	1	0	ZNF420	42310865	0.930000	0.31532	0.996000	0.52242	0.977000	0.68977	2.055000	0.41345	0.994000	0.38892	0.655000	0.94253	CTT		0.418	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109587.3	NM_144689		8	83	0	0	0	0.004482	0	8	83				
FCGBP	8857	broad.mit.edu	37	19	40411646	40411646	+	Nonsense_Mutation	SNP	T	T	A	rs139603547		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr19:40411646T>A	ENST00000221347.6	-	7	3989	c.3982A>T	c.(3982-3984)Aag>Tag	p.K1328*		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1328	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			ACCGTGACCTTCCACTGTCTC	0.647																																							uc002omp.3		NA																	0				ovary(4)|skin(4)|central_nervous_system(1)	9						c.(3982-3984)AAG>TAG		Fc fragment of IgG binding protein precursor							80.0	76.0	77.0					19																	40411646		2203	4300	6503	SO:0001587	stop_gained	8857					extracellular region	protein binding	g.chr19:40411646T>A	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.3982A>T	19.37:g.40411646T>A	ENSP00000221347:p.Lys1328*						p.K1328*	NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		7	3990	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		1328			VWFD 3.		O95784	Nonsense_Mutation	SNP	ENST00000221347.6	37	c.3982A>T	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	T	40	8.326983	0.98762	.	.	ENSG00000090920	ENST00000221347	.	.	.	4.54	4.54	0.55810	.	0.252433	0.31697	N	0.007218	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	8.2647	0.31806	0.0:0.0:0.2014:0.7986	.	.	.	.	X	1328	.	ENSP00000221347:K1328X	K	-	1	0	FCGBP	45103486	0.000000	0.05858	0.954000	0.39281	0.249000	0.25844	-0.003000	0.12901	1.930000	0.55929	0.438000	0.28831	AAG		0.647	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		30	119	0	0	0	0.002836	0	30	119				
PSG8	440533	broad.mit.edu	37	19	43258571	43258571	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr19:43258571G>T	ENST00000306511.4	-	5	1254	c.1157C>A	c.(1156-1158)aCa>aAa	p.T386K	PSG8_ENST00000401467.2_Missense_Mutation_p.T293K|PSG8_ENST00000406636.3_Missense_Mutation_p.T264K|PSG8_ENST00000404209.4_Missense_Mutation_p.T386K|PSG8_ENST00000600709.1_5'UTR	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	386	Ig-like C2-type 3.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GCTATGCTTTGTAGTAATTTG	0.468																																							uc002ouo.2		NA																	0					0						c.(1156-1158)ACA>AAA		pregnancy specific beta-1-glycoprotein 8 isoform							205.0	220.0	215.0					19																	43258571		2203	4299	6502	SO:0001583	missense	440533					extracellular region		g.chr19:43258571G>T	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.1157C>A	19.37:g.43258571G>T	ENSP00000305005:p.Thr386Lys					PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_Missense_Mutation_p.T225K|PSG8_uc002ouh.2_Missense_Mutation_p.T386K|PSG8_uc010ein.2_Missense_Mutation_p.T264K|PSG8_uc002ouj.3_Missense_Mutation_p.T168K|PSG8_uc002ouk.3_Missense_Mutation_p.T225K|PSG8_uc002oul.3_Missense_Mutation_p.T386K|PSG8_uc002oum.3_Missense_Mutation_p.T293K|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Missense_Mutation_p.T293K	p.T386K	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN			5	1255	-		Prostate(69;0.00899)	386			Ig-like C2-type 3.		A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	37	c.1157C>A	CCDS33037.1	.	.	.	.	.	.	.	.	.	.	N	2.930	-0.221220	0.06061	.	.	ENSG00000124467	ENST00000404209;ENST00000292109;ENST00000406636;ENST00000401467;ENST00000426252;ENST00000407488;ENST00000306511	T;T;T;T	0.11821	2.74;2.74;2.74;2.74	1.62	-1.46	0.08800	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.16811	0.0404	L	0.28740	0.885	0.09310	N	1	B;P;D;B;B;B	0.56287	0.228;0.589;0.975;0.011;0.01;0.012	B;B;P;B;B;B	0.62885	0.192;0.309;0.908;0.034;0.02;0.034	T	0.16188	-1.0411	9	0.37606	T	0.19	.	4.5305	0.12002	0.5791:0.0:0.4209:0.0	.	264;293;386;293;386;386	Q9UQ74-2;B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;.;PSG8_HUMAN;.;.;.	K	386;168;264;293;198;293;386	ENSP00000385869:T386K;ENSP00000385081:T264K;ENSP00000386090:T293K;ENSP00000305005:T386K	ENSP00000292109:T168K	T	-	2	0	PSG8	47950411	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.048000	0.03517	-0.578000	0.05959	0.298000	0.19748	ACA		0.468	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1			56	249	1	0	1.45723e-30	0.00361	2.35398e-30	56	249				
KPTN	11133	broad.mit.edu	37	19	47986421	47986421	+	Missense_Mutation	SNP	G	G	C	rs369379973		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr19:47986421G>C	ENST00000338134.3	-	4	553	c.446C>G	c.(445-447)gCg>gGg	p.A149G	NAPA-AS1_ENST00000594367.1_RNA|KPTN_ENST00000595484.1_5'UTR|KPTN_ENST00000536339.1_5'UTR|NAPA-AS1_ENST00000593284.1_RNA	NM_007059.2	NP_008990.2	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)	149					actin filament organization (GO:0007015)|cellular component movement (GO:0006928)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(1)|lung(3)|ovary(2)|pancreas(2)	8		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		CACTCACTCCGCATGGCACAG	0.577																																							uc002pgy.2		NA																	0				ovary(1)	1						c.(445-447)GCG>GGG		kaptin (actin binding protein)							143.0	158.0	153.0					19																	47986421		2125	4233	6358	SO:0001583	missense	11133				actin filament organization|cellular component movement|sensory perception of sound	actin cytoskeleton|growth cone|microtubule organizing center|nucleus|perinuclear region of cytoplasm|stereocilium	actin binding	g.chr19:47986421G>C	AF105369	CCDS42583.1	19q13.32	2014-08-13	2001-11-28		ENSG00000118162	ENSG00000118162			6404	protein-coding gene	gene with protein product		615620	"""kaptin (actin-binding protein)"""			10099934	Standard	XM_005258467		Approved	2E4	uc002pgy.3	Q9Y664	OTTHUMG00000183443	ENST00000338134.3:c.446C>G	19.37:g.47986421G>C	ENSP00000337850:p.Ala149Gly					KPTN_uc010xys.1_RNA|uc002pgz.1_5'Flank	p.A149G	NM_007059	NP_008990	Q9Y664	KPTN_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)	4	550	-		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)	149					B3KN86|B4DQ76|Q96GT1	Missense_Mutation	SNP	ENST00000338134.3	37	c.446C>G	CCDS42583.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.065147	0.55432	.	.	ENSG00000118162	ENST00000338134	.	.	.	4.33	4.33	0.51752	.	0.113431	0.64402	D	0.000012	T	0.61751	0.2372	L	0.56769	1.78	0.80722	D	1	B	0.24618	0.107	B	0.29862	0.108	T	0.64879	-0.6303	9	0.59425	D	0.04	.	15.7723	0.78180	0.0:0.0:1.0:0.0	.	149	Q9Y664	KPTN_HUMAN	G	149	.	ENSP00000337850:A149G	A	-	2	0	KPTN	52678233	1.000000	0.71417	0.866000	0.34008	0.531000	0.34715	8.641000	0.91032	2.245000	0.73994	0.491000	0.48974	GCG		0.577	KPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466672.2			43	230	0	0	0	0.00361	0	43	230				
ZNF600	162966	broad.mit.edu	37	19	53268962	53268962	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr19:53268962G>C	ENST00000338230.3	-	3	2314	c.2047C>G	c.(2047-2049)Caa>Gaa	p.Q683E		NM_198457.2	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	683					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(4)|large_intestine(9)|liver(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		CCAGTATGTTGTTTCAGGTGT	0.403																																					Esophageal Squamous(196;1235 2112 2375 33339 34207)	Esophageal Squamous(196;1235 2112 2375 33339 34207)	uc002qab.3		NA																	0					0						c.(2047-2049)CAA>GAA		zinc finger protein 600							107.0	102.0	104.0					19																	53268962		2203	4300	6503	SO:0001583	missense	162966				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53268962G>C	U52096	CCDS12856.1	19q13.42	2013-01-08				ENSG00000189190		"""Zinc fingers, C2H2-type"""	30951	protein-coding gene	gene with protein product						12576331	Standard	NM_198457		Approved	KR-ZNF1, DKFZp686F06123	uc002qab.4	Q6ZNG1		ENST00000338230.3:c.2047C>G	19.37:g.53268962G>C	ENSP00000344791:p.Gln683Glu						p.Q683E	NM_198457	NP_940859	Q6ZNG1	ZN600_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)	3	2333	-			683			C2H2-type 19.		Q6MZR0	Missense_Mutation	SNP	ENST00000338230.3	37	c.2047C>G	CCDS12856.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.234179	0.00023	.	.	ENSG00000189190	ENST00000338230	T	0.06608	3.28	1.58	-3.15	0.05233	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03871	0.0109	L	0.28694	0.88	0.09310	N	1	B	0.26400	0.148	B	0.31751	0.135	T	0.44574	-0.9319	9	0.02654	T	1	.	5.8462	0.18667	0.2651:0.4038:0.3311:0.0	.	683	Q6ZNG1	ZN600_HUMAN	E	683	ENSP00000344791:Q683E	ENSP00000344791:Q683E	Q	-	1	0	ZNF600	57960774	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.626000	0.00206	-2.392000	0.00585	-0.683000	0.03753	CAA		0.403	ZNF600-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463093.1	NM_198457		13	63	0	0	0	0.001368	0	13	63				
ZNF28	7576	broad.mit.edu	37	19	53303701	53303701	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr19:53303701G>T	ENST00000457749.2	-	4	1516	c.1397C>A	c.(1396-1398)cCa>cAa	p.P466Q	ZNF28_ENST00000360272.4_Missense_Mutation_p.P413Q|ZNF28_ENST00000438150.2_Missense_Mutation_p.P413Q|ZNF28_ENST00000414252.2_Missense_Mutation_p.P413Q	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		ACATTTGTATGGTTTCTCTGC	0.388																																							uc002qad.2		NA																	0				skin(1)	1						c.(1396-1398)CCA>CAA		zinc finger protein 28							112.0	114.0	114.0					19																	53303701		2203	4300	6503	SO:0001583	missense	7576				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53303701G>T	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1397C>A	19.37:g.53303701G>T	ENSP00000397693:p.Pro466Gln					ZNF28_uc002qac.2_Missense_Mutation_p.P413Q|ZNF28_uc010eqe.2_Missense_Mutation_p.P412Q	p.P466Q	NM_006969	NP_008900	P17035	ZNF28_HUMAN		GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)	4	1517	-			466					A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	37	c.1397C>A	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	16.14	3.039956	0.55003	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29	1.74	1.74	0.24563	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29556	0.0737	M	0.75150	2.29	0.32584	N	0.528125	D	0.56287	0.975	P	0.51657	0.676	T	0.49370	-0.8947	9	0.87932	D	0	.	10.4845	0.44713	0.0:0.0:1.0:0.0	.	466	P17035	ZNF28_HUMAN	Q	413;466;413;413;413	ENSP00000412143:P413Q;ENSP00000397693:P466Q;ENSP00000353410:P413Q;ENSP00000444965:P413Q;ENSP00000375661:P413Q	ENSP00000353410:P413Q	P	-	2	0	ZNF28	57995513	0.000000	0.05858	0.189000	0.23252	0.034000	0.12701	0.613000	0.24299	0.955000	0.37878	0.186000	0.17326	CCA		0.388	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969		11	93	1	0	3.07112e-06	0.000978	4.03084e-06	11	93				
ZSCAN1	284312	broad.mit.edu	37	19	58565042	58565042	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr19:58565042C>T	ENST00000282326.1	+	6	1097	c.850C>T	c.(850-852)Cgt>Tgt	p.R284C		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	284					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GGTAGTGCCGCGTGGGCCCCG	0.627																																							uc002qrc.1		NA																	0				ovary(2)	2						c.(850-852)CGT>TGT		zinc finger and SCAN domain containing 1							62.0	62.0	62.0					19																	58565042		2203	4300	6503	SO:0001583	missense	284312				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58565042C>T	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.850C>T	19.37:g.58565042C>T	ENSP00000282326:p.Arg284Cys						p.R284C	NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)	6	1097	+		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	284					Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	ENST00000282326.1	37	c.850C>T	CCDS12969.1	.	.	.	.	.	.	.	.	.	.	C	11.17	1.560119	0.27827	.	.	ENSG00000152467	ENST00000282326	T	0.06849	3.25	1.14	-0.0454	0.13851	.	.	.	.	.	T	0.05456	0.0144	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	P	0.48677	0.586	T	0.34825	-0.9813	9	0.87932	D	0	.	4.4478	0.11606	0.377:0.623:0.0:0.0	.	284	Q8NBB4	ZSCA1_HUMAN	C	284	ENSP00000282326:R284C	ENSP00000282326:R284C	R	+	1	0	ZSCAN1	63256854	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.578000	0.36525	0.035000	0.15519	0.491000	0.48974	CGT		0.627	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572		8	69	0	0	0	0.00308	0	8	69				
RNF144A	9781	broad.mit.edu	37	2	7170334	7170334	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:7170334G>A	ENST00000320892.6	+	8	1177	c.735G>A	c.(733-735)tgG>tgA	p.W245*	RNF144A_ENST00000467276.1_3'UTR	NM_014746.3	NP_055561.2	P50876	R144A_HUMAN	ring finger protein 144A	245					protein ubiquitination (GO:0016567)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)	25	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		CTGTGATCTGGCATCGGACAC	0.537																																							uc002qys.2		NA																	0				ovary(1)|kidney(1)	2						c.(733-735)TGG>TGA		ring finger protein 144							101.0	97.0	98.0					2																	7170334		2203	4300	6503	SO:0001587	stop_gained	9781					Golgi apparatus|integral to membrane	ligase activity|zinc ion binding	g.chr2:7170334G>A	D79983	CCDS1657.1	2p25.2	2008-02-05	2007-08-20	2007-08-20	ENSG00000151692	ENSG00000151692		"""RING-type (C3HC4) zinc fingers"""	20457	protein-coding gene	gene with protein product			"""ring finger protein 144"""	RNF144		8724849, 10431818	Standard	NM_014746		Approved	UBCE7IP4, KIAA0161	uc002qys.3	P50876	OTTHUMG00000090353	ENST00000320892.6:c.735G>A	2.37:g.7170334G>A	ENSP00000321330:p.Trp245*					RNF144A_uc002qyt.2_Nonsense_Mutation_p.W94*	p.W245*	NM_014746	NP_055561	P50876	R144A_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.195)	8	1177	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)	245					D6W4Y6|Q585H5	Nonsense_Mutation	SNP	ENST00000320892.6	37	c.735G>A	CCDS1657.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.508630|5.508630	0.96386|0.96386	.|.	.|.	ENSG00000151692|ENSG00000151692	ENST00000432850|ENST00000320892	.|.	.|.	.|.	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.46367|.	0.1389|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.36672|.	-0.9738|.	4|.	.|0.02654	.|T	.|1	.|.	18.5853|18.5853	0.91187|0.91187	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	D|X	241|245	.|.	.|ENSP00000321330:W245X	G|W	+|+	2|3	0|0	RNF144A|RNF144A	7087785|7087785	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	9.747000|9.747000	0.98863|0.98863	2.448000|2.448000	0.82819|0.82819	0.456000|0.456000	0.33151|0.33151	GGC|TGG		0.537	RNF144A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206725.2	NM_014746		6	90	0	0	0	0.001984	0	6	90				
KCNF1	3754	broad.mit.edu	37	2	11053812	11053812	+	Missense_Mutation	SNP	G	G	T	rs201734044		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:11053812G>T	ENST00000295082.1	+	1	1750	c.1260G>T	c.(1258-1260)gaG>gaT	p.E420D		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	420					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		GCGTCCTGGAGACCGCGGCCA	0.622																																							uc002rax.2		NA																	0				ovary(1)	1						c.(1258-1260)GAG>GAT		potassium voltage-gated channel, subfamily F,							96.0	79.0	85.0					2																	11053812		2203	4300	6503	SO:0001583	missense	3754					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr2:11053812G>T	AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	ENST00000295082.1:c.1260G>T	2.37:g.11053812G>T	ENSP00000295082:p.Glu420Asp						p.E420D	NM_002236	NP_002227	Q9H3M0	KCNF1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)	1	1750	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		420			Cytoplasmic (Potential).		O43527|Q585L3	Missense_Mutation	SNP	ENST00000295082.1	37	c.1260G>T	CCDS1676.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.089861	0.36855	.	.	ENSG00000162975	ENST00000295082	D	0.98280	-4.84	5.61	1.79	0.24919	.	0.054627	0.64402	D	0.000001	D	0.94331	0.8178	N	0.24115	0.695	0.46631	D	0.999139	B	0.22080	0.064	B	0.17979	0.02	D	0.89622	0.3849	10	0.51188	T	0.08	.	10.3407	0.43877	0.3533:0.0:0.6467:0.0	.	420	Q9H3M0	KCNF1_HUMAN	D	420	ENSP00000295082:E420D	ENSP00000295082:E420D	E	+	3	2	KCNF1	10971263	1.000000	0.71417	0.991000	0.47740	0.936000	0.57629	1.569000	0.36428	0.419000	0.25927	0.655000	0.94253	GAG		0.622	KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239265.1	NM_002236		4	40	1	0	0.000602214	0.000602	0.000707497	4	40				
FSHR	2492	broad.mit.edu	37	2	49381520	49381520	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:49381520T>A	ENST00000406846.2	-	1	156	c.37A>T	c.(37-39)Agc>Tgc	p.S13C	FSHR_ENST00000346173.3_Missense_Mutation_p.S13C|FSHR_ENST00000304421.4_Missense_Mutation_p.S13C	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	13				S -> R (in Ref. 10; CAA48179). {ECO:0000305}.	female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	GAGCCCAAGCTCAGGAATGCC	0.498									Gonadal Dysgenesis, 46 XX																														uc002rww.2		NA																	0				ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8						c.(37-39)AGC>TGC		follicle stimulating hormone receptor isoform 1	Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)						78.0	82.0	81.0					2																	49381520		2203	4300	6503	SO:0001583	missense	2492	Gonadal_Dysgenesis_46_XX	Familial Cancer Database		female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding	g.chr2:49381520T>A		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.37A>T	2.37:g.49381520T>A	ENSP00000384708:p.Ser13Cys					FSHR_uc002rwx.2_Missense_Mutation_p.S13C|FSHR_uc010fbn.2_Missense_Mutation_p.S13C|FSHR_uc010fbo.1_RNA	p.S13C	NM_000145	NP_000136	P23945	FSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		1	111	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	13	S -> R (in Ref. 8; CAA48179).				A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	c.37A>T	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	T	13.28	2.188924	0.38707	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000454032	T;T;T;T	0.72835	-0.59;-0.69;-0.6;0.23	5.46	1.84	0.25277	.	0.478098	0.24224	N	0.040406	T	0.66297	0.2775	L	0.49126	1.545	0.80722	D	1	P;P;P	0.49447	0.876;0.924;0.876	B;P;B	0.49752	0.417;0.621;0.417	T	0.61227	-0.7105	9	.	.	.	.	5.9728	0.19361	0.0:0.3282:0.0:0.6718	.	13;13;13	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	C	13	ENSP00000384708:S13C;ENSP00000333908:S13C;ENSP00000306780:S13C;ENSP00000415504:S13C	.	S	-	1	0	FSHR	49235024	0.658000	0.27402	0.984000	0.44739	0.951000	0.60555	0.475000	0.22164	0.525000	0.28522	0.533000	0.62120	AGC		0.498	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2			19	37	0	0	0	0.007413	0	19	37				
PLEK	5341	broad.mit.edu	37	2	68615552	68615552	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:68615552A>G	ENST00000234313.7	+	6	870	c.691A>G	c.(691-693)Agt>Ggt	p.S231G		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	231					actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		AGAGAATTCCAGTGATGATGA	0.458																																							uc002sen.3		NA																	0				ovary(1)	1						c.(691-693)AGT>GGT		pleckstrin							139.0	139.0	139.0					2																	68615552		2203	4300	6503	SO:0001583	missense	5341				actin cytoskeleton reorganization|cortical actin cytoskeleton organization|hemopoietic progenitor cell differentiation|inhibition of phospholipase C activity involved in G-protein coupled receptor signaling pathway|integrin-mediated signaling pathway|negative regulation of calcium-mediated signaling|negative regulation of inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|platelet aggregation|positive regulation of actin filament bundle assembly|positive regulation of actin filament depolymerization|positive regulation of inositol-polyphosphate 5-phosphatase activity|positive regulation of integrin activation|positive regulation of platelet activation|protein kinase C signaling cascade|protein secretion by platelet|regulation of cell diameter|ruffle organization|thrombin receptor signaling pathway|vesicle docking involved in exocytosis	cytosol|extracellular region|membrane fraction|ruffle membrane|soluble fraction	phosphatidylinositol-3,4-bisphosphate binding|protein homodimerization activity|protein kinase C binding	g.chr2:68615552A>G	X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.691A>G	2.37:g.68615552A>G	ENSP00000234313:p.Ser231Gly					PLEK_uc010fde.2_Missense_Mutation_p.S231G	p.S231G	NM_002664	NP_002655	P08567	PLEK_HUMAN		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)	6	853	+		Ovarian(717;0.0129)	231					B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	ENST00000234313.7	37	c.691A>G	CCDS1887.1	.	.	.	.	.	.	.	.	.	.	A	17.55	3.416365	0.62511	.	.	ENSG00000115956	ENST00000234313	T	0.21361	2.01	5.17	5.17	0.71159	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.43590	0.1254	M	0.76002	2.32	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.70716	0.97;0.97	T	0.33727	-0.9857	10	0.17369	T	0.5	.	15.0181	0.71605	1.0:0.0:0.0:0.0	.	249;231	Q59GZ2;P08567	.;PLEK_HUMAN	G	231	ENSP00000234313:S231G	ENSP00000234313:S231G	S	+	1	0	PLEK	68469056	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.624000	0.90961	1.952000	0.56665	0.533000	0.62120	AGT		0.458	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664		6	138	0	0	0	0.001984	0	6	138				
POLR1A	25885	broad.mit.edu	37	2	86272749	86272749	+	Silent	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:86272749G>A	ENST00000263857.6	-	20	3255	c.2877C>T	c.(2875-2877)atC>atT	p.I959I	POLR1A_ENST00000409681.1_Silent_p.I959I			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	959					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						CAGGAGGTTTGATGCCGGTGA	0.507																																							uc002sqs.2		NA																	0				ovary(2)|skin(1)	3						c.(2875-2877)ATC>ATT		DNA-directed RNA polymerase I A							83.0	95.0	91.0					2																	86272749		1910	4134	6044	SO:0001819	synonymous_variant	25885				termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding	g.chr2:86272749G>A	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.2877C>T	2.37:g.86272749G>A						POLR1A_uc010ytb.1_Silent_p.I325I|POLR1A_uc002sqt.1_5'Flank	p.I959I	NM_015425	NP_056240	O95602	RPA1_HUMAN			20	3256	-			959					B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Silent	SNP	ENST00000263857.6	37	c.2877C>T	CCDS42706.1																																																																																				0.507	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425		13	122	0	0	0	0.00245	0	13	122				
ANKRD36	375248	broad.mit.edu	37	2	97779487	97779487	+	Missense_Mutation	SNP	G	G	A	rs2315151|rs141447363	byFrequency	TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:97779487G>A	ENST00000461153.2	+	1	255	c.11G>A	c.(10-12)gGc>gAc	p.G4D	ANKRD36_ENST00000420699.2_Missense_Mutation_p.G4D			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	4										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						ATGGAAGACGGCAAGCGGGAG	0.562																																							uc010yva.1		NA																	0					0						c.(10-12)GGC>GAC		ankyrin repeat domain 36							68.0	70.0	69.0					2																	97779487		1931	4119	6050	SO:0001583	missense	375248							g.chr2:97779487G>A	BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.11G>A	2.37:g.97779487G>A	ENSP00000419530:p.Gly4Asp					ANKRD36_uc002sxn.2_Missense_Mutation_p.G4D|ANKRD36_uc010yuz.1_RNA|ANKRD36_uc010fic.2_5'UTR|ANKRD36_uc002sxo.2_Missense_Mutation_p.G4D|ANKRD36_uc002sxp.3_RNA	p.G4D	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN			1	255	+			4					B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	ENST00000461153.2	37	c.11G>A	CCDS54379.1	.	.	.	.	.	.	.	.	.	.	A	3.167	-0.170831	0.06421	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000393513;ENST00000289105;ENST00000455519	T;T	0.32023	1.47;1.47	0.453	-0.905	0.10527	.	.	.	.	.	T	0.12178	0.0296	N	0.08118	0	0.09310	N	0.999995	B;B;B	0.23185	0.0;0.081;0.0	B;B;B	0.15052	0.0;0.012;0.0	T	0.20371	-1.0277	8	0.72032	D	0.01	.	.	.	.	rs2315151;rs2315151	4;4;4	A6QL64;F2Z332;A6QL64-4	AN36A_HUMAN;.;.	D	4	ENSP00000419530:G4D;ENSP00000391950:G4D	ENSP00000289105:G4D	G	+	2	0	ANKRD36	97143214	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.367000	0.02583	-2.717000	0.00390	-2.820000	0.00109	GGC		0.562	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5			4	134	0	0	0	0.000248	0	4	134				
MERTK	10461	broad.mit.edu	37	2	112754934	112754934	+	Silent	SNP	G	G	T	rs191874938	byFrequency	TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:112754934G>T	ENST00000295408.4	+	10	1742	c.1485G>T	c.(1483-1485)gcG>gcT	p.A495A	MERTK_ENST00000421804.2_Silent_p.A495A|MERTK_ENST00000409780.1_Silent_p.A319A			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	495					apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						CAACTCCGGCGCCTGGCAACG	0.448																																							uc002thk.1		NA																	0				lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						c.(1483-1485)GCG>GCT		MER receptor tyrosine kinase precursor							193.0	187.0	189.0					2																	112754934		2203	4300	6503	SO:0001819	synonymous_variant	10461				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr2:112754934G>T	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.1485G>T	2.37:g.112754934G>T						MERTK_uc002thl.1_Silent_p.A319A	p.A495A	NM_006343	NP_006334	Q12866	MERTK_HUMAN			10	1607	+			495			Extracellular (Potential).		Q9HBB4	Silent	SNP	ENST00000295408.4	37	c.1485G>T	CCDS2094.1	.	.	.	.	.	.	.	.	.	.	G	4.052	0.007286	0.07866	.	.	ENSG00000153208	ENST00000393237	.	.	.	5.87	-11.7	0.00046	.	0.000000	0.33346	U	0.005019	T	0.28333	0.0700	.	.	.	0.48830	D	0.999712	.	.	.	.	.	.	T	0.65582	-0.6133	6	0.13470	T	0.59	-27.3183	4.8956	0.13749	0.5557:0.239:0.0883:0.117	.	.	.	.	S	139	.	ENSP00000376929:A139S	A	+	1	0	MERTK	112471405	0.000000	0.05858	0.000000	0.03702	0.537000	0.34900	-5.405000	0.00125	-5.015000	0.00024	-1.483000	0.00984	GCC		0.448	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2			46	171	1	0	3.21987e-24	0.00361	5.15179e-24	46	171				
MAP3K19	80122	broad.mit.edu	37	2	135744057	135744057	+	Silent	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:135744057G>A	ENST00000375845.3	-	7	2415	c.2385C>T	c.(2383-2385)tcC>tcT	p.S795S	MAP3K19_ENST00000358371.4_Silent_p.S682S|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000392915.1_Silent_p.S812S|MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000392917.3_Intron	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	795							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										TCTGTTTCATGGACTGCTCAG	0.388																																							uc002tue.1		NA																	0				stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5						c.(2383-2385)TCC>TCT		Yeast Sps1/Ste20-related kinase 4 isoform 1							67.0	67.0	67.0					2																	135744057		2203	4300	6503	SO:0001819	synonymous_variant	80122						ATP binding|protein serine/threonine kinase activity	g.chr2:135744057G>A	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.2385C>T	2.37:g.135744057G>A						YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Silent_p.S682S|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_Silent_p.S523S|YSK4_uc002tui.3_Silent_p.S812S	p.S795S	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.112)	7	2416	-			795					B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Silent	SNP	ENST00000375845.3	37	c.2385C>T	CCDS2176.2																																																																																				0.388	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052		6	68	0	0	0	0.001168	0	6	68				
THSD7B	80731	broad.mit.edu	37	2	137814267	137814267	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:137814267G>C	ENST00000409968.1	+	3	595	c.417G>C	c.(415-417)caG>caC	p.Q139H	THSD7B_ENST00000543459.1_5'Flank|THSD7B_ENST00000413152.2_Missense_Mutation_p.Q108H|THSD7B_ENST00000272643.3_Missense_Mutation_p.Q139H			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	139	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		ATGGACTGCAGCACCGGATGG	0.552																																							uc002tva.1		NA																	0				ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(322-324)CAG>CAC		thrombospondin, type I, domain containing 7B							80.0	85.0	83.0					2																	137814267		2042	4214	6256	SO:0001583	missense	80731							g.chr2:137814267G>C			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.417G>C	2.37:g.137814267G>C	ENSP00000387145:p.Gln139His					THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_5'UTR	p.Q108H	NM_001080427	NP_001073896				BRCA - Breast invasive adenocarcinoma(221;0.19)	2	324	+									Missense_Mutation	SNP	ENST00000409968.1	37	c.324G>C		.	.	.	.	.	.	.	.	.	.	G	20.7	4.033601	0.75504	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.65178	-0.14;-0.14;-0.14	6.07	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.78729	0.4329	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80516	-0.1348	9	.	.	.	.	12.2746	0.54728	0.1392:0.0:0.8608:0.0	.	108	C9JKN6	.	H	139;139;108	ENSP00000387145:Q139H;ENSP00000272643:Q139H;ENSP00000413841:Q108H	.	Q	+	3	2	THSD7B	137530737	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.920000	0.63390	1.588000	0.49971	0.585000	0.79938	CAG		0.552	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		15	93	0	0	0	0.003163	0	15	93				
PPIG	9360	broad.mit.edu	37	2	170493582	170493582	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:170493582G>T	ENST00000260970.3	+	14	2034	c.1814G>T	c.(1813-1815)cGa>cTa	p.R605L	PPIG_ENST00000409714.3_Missense_Mutation_p.R590L|PPIG_ENST00000448752.2_Missense_Mutation_p.R605L	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	605	Arg/Ser-rich (RS domain).				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)	p.R605Q(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	GGACGGTCACGAAGCCGAGAG	0.488																																							uc002uez.2		NA																	1	Substitution - Missense(1)		NS(1)	ovary(2)|central_nervous_system(1)	3						c.(1813-1815)CGA>CTA		peptidylprolyl isomerase G	L-Proline(DB00172)						114.0	111.0	112.0					2																	170493582		2203	4300	6503	SO:0001583	missense	9360				protein folding|RNA splicing	nuclear matrix|nuclear speck	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity	g.chr2:170493582G>T	X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.1814G>T	2.37:g.170493582G>T	ENSP00000260970:p.Arg605Leu					PPIG_uc010fpx.2_Missense_Mutation_p.R590L|PPIG_uc010fpy.2_Missense_Mutation_p.R598L|PPIG_uc002ufb.2_Missense_Mutation_p.R605L|PPIG_uc002ufd.2_Missense_Mutation_p.R602L	p.R605L	NM_004792	NP_004783	Q13427	PPIG_HUMAN			14	2034	+			605			Arg/Ser-rich (RS domain).		D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	ENST00000260970.3	37	c.1814G>T	CCDS2235.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792778	0.50102	.	.	ENSG00000138398	ENST00000260970;ENST00000409714;ENST00000448752	T;T;T	0.20463	2.09;2.07;2.09	5.6	3.82	0.43975	.	0.000000	0.85682	D	0.000000	T	0.14527	0.0351	L	0.27053	0.805	0.33073	D	0.535674	P;P;P	0.35401	0.499;0.499;0.499	B;B;B	0.29716	0.106;0.106;0.106	T	0.13098	-1.0522	10	0.72032	D	0.01	-6.439	12.5096	0.55999	0.1357:0.0:0.8643:0.0	.	590;590;605	E9PG73;Q2NKQ6;Q13427	.;.;PPIG_HUMAN	L	605;590;605	ENSP00000260970:R605L;ENSP00000386245:R590L;ENSP00000407083:R605L	ENSP00000260970:R605L	R	+	2	0	PPIG	170201828	1.000000	0.71417	0.902000	0.35471	0.944000	0.59088	7.290000	0.78711	0.737000	0.32582	-0.186000	0.12905	CGA		0.488	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2			5	26	1	0	2.7689e-08	0.001984	3.81291e-08	5	26				
TTN	7273	broad.mit.edu	37	2	179451522	179451522	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:179451522G>A	ENST00000591111.1	-	258	59407	c.59183C>T	c.(59182-59184)cCc>cTc	p.P19728L	TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P12429L|TTN_ENST00000460472.2_Missense_Mutation_p.P12304L|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P12496L|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P21369L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P18801L|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590743.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19728	Fibronectin type-III 43. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCCTTGGGGGATCCGGCTC	0.408																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(56401-56403)CCC>CTC		titin isoform N2-A							178.0	176.0	177.0					2																	179451522		1882	4116	5998	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179451522G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.59183C>T	2.37:g.179451522G>A	ENSP00000465570:p.Pro19728Leu					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P12496L|TTN_uc010zfi.1_Missense_Mutation_p.P12429L|TTN_uc010zfj.1_Missense_Mutation_p.P12304L	p.P18801L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		257	56626	-			19728					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.56402C>T		.	.	.	.	.	.	.	.	.	.	G	22.5	4.296412	0.81025	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	6.06	6.06	0.98353	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84165	0.5412	H	0.94306	3.52	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.87212	0.2248	9	0.87932	D	0	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	12304;12429;12496;19728	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	18801;12304;12496;12429;12302	ENSP00000343764:P18801L;ENSP00000434586:P12304L;ENSP00000340554:P12496L;ENSP00000352154:P12429L	ENSP00000340554:P12496L	P	-	2	0	TTN	179159768	1.000000	0.71417	0.983000	0.44433	0.828000	0.46876	9.807000	0.99171	2.879000	0.98667	0.650000	0.86243	CCC		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		10	104	0	0	0	0.001368	0	10	104				
TTN	7273	broad.mit.edu	37	2	179583959	179583959	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:179583959C>A	ENST00000591111.1	-	81	23431	c.23207G>T	c.(23206-23208)gGc>gTc	p.G7736V	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.G8053V|TTN_ENST00000342992.6_Missense_Mutation_p.G6809V|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13279	Ig-like 59.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGTGTATATGCCTGTGTCGGA	0.502																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(20425-20427)GGC>GTC		titin isoform N2-A							77.0	82.0	81.0					2																	179583959		2034	4187	6221	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179583959C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.23207G>T	2.37:g.179583959C>A	ENSP00000465570:p.Gly7736Val					TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.G3470V	p.G6809V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		80	20650	-			7736					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.20426G>T		.	.	.	.	.	.	.	.	.	.	C	14.89	2.669982	0.47677	.	.	ENSG00000155657	ENST00000342992	T	0.77750	-1.12	5.87	5.87	0.94306	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.94417	0.8204	H	0.99689	4.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96221	0.9160	9	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	7736	Q8WZ42	TITIN_HUMAN	V	6809	ENSP00000343764:G6809V	ENSP00000343764:G6809V	G	-	2	0	TTN	179292204	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GGC		0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		6	107	1	0	0.00116845	0.001168	0.00135379	6	107				
NRP2	8828	broad.mit.edu	37	2	206581060	206581061	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:206581060_206581061GG>TT	ENST00000357785.5	+	3	426_427	c.395_396GG>TT	c.(394-396)gGG>gTT	p.G132V	NRP2_ENST00000360409.3_Missense_Mutation_p.G132V|NRP2_ENST00000540841.1_Missense_Mutation_p.G132V|NRP2_ENST00000412873.2_Missense_Mutation_p.G132V|NRP2_ENST00000357118.4_Missense_Mutation_p.G132V|NRP2_ENST00000272849.3_Missense_Mutation_p.G132V|NRP2_ENST00000417189.1_Missense_Mutation_p.G132V|NRP2_ENST00000355117.4_Missense_Mutation_p.G132V|NRP2_ENST00000540178.1_Missense_Mutation_p.G132V			Q99435	NELL2_HUMAN	neuropilin 2	0	Laminin G-like.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						GCCCGGCAGGGGGCAGGCTTCT	0.609																																							uc002vaw.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(394-396)GGG>GTT		neuropilin 2 isoform 1 precursor																																				SO:0001583	missense	8828				angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity	g.chr2:206581060_206581061GG>TT	AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	Exception_encountered	2.37:g.206581060_206581061delinsTT	ENSP00000350432:p.Gly132Val					NRP2_uc002vat.2_Missense_Mutation_p.G132V|NRP2_uc002vau.2_Missense_Mutation_p.G132V|NRP2_uc002vav.2_Missense_Mutation_p.G132V|NRP2_uc002vax.2_Missense_Mutation_p.G132V|NRP2_uc002vay.2_Missense_Mutation_p.G132V|NRP2_uc010fud.2_Missense_Mutation_p.G132V	p.G132V	NM_201266	NP_957718	O60462	NRP2_HUMAN			3	1186_1187	+			132			Extracellular (Potential).|CUB 1.		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	DNP	ENST00000357785.5	37	c.395_396GG>TT	CCDS46496.1																																																																																				0.609	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1			19	78	0	0	0	0.004672	0	19	78				
ARMC9	80210	broad.mit.edu	37	2	232146780	232146780	+	Silent	SNP	G	G	A	rs34385474	byFrequency	TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:232146780G>A	ENST00000349938.4	+	17	1754	c.1560G>A	c.(1558-1560)ccG>ccA	p.P520P	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	520						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		AGATACAGCCGTATGTGAATG	0.423													g|||	7	0.00139776	0.0053	0.0	5008	,	,		22326	0.0		0.0	False		,,,				2504	0.0						uc002vrq.3		NA																	0				ovary(1)	1						c.(1558-1560)CCG>CCA		armadillo repeat containing 9		A		8,4398	14.3+/-33.2	0,8,2195	153.0	151.0	152.0		1560	-8.9	0.5	2	dbSNP_126	152	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ARMC9	NM_025139.3		0,10,6493	AA,AG,GG		0.0233,0.1816,0.0769		520/666	232146780	10,12996	2203	4300	6503	SO:0001819	synonymous_variant	80210						binding	g.chr2:232146780G>A	BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.1560G>A	2.37:g.232146780G>A						ARMC9_uc002vrp.3_Silent_p.P520P|ARMC9_uc002vrr.1_RNA	p.P520P	NM_025139	NP_079415	Q7Z3E5	ARMC9_HUMAN		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)	17	1672	+		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)	520					Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Silent	SNP	ENST00000349938.4	37	c.1560G>A	CCDS2484.1																																																																																				0.423	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139		7	140	0	0	0	0.00308	0	7	140				
OTOS	150677	broad.mit.edu	37	2	241078674	241078674	+	Silent	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr2:241078674G>T	ENST00000391989.2	-	5	413	c.183C>A	c.(181-183)ccC>ccA	p.P61P	MYEOV2_ENST00000307266.3_5'Flank|OTOS_ENST00000319460.1_Silent_p.P61P|MYEOV2_ENST00000607357.1_5'Flank			Q8NHW6	OTOSP_HUMAN	otospiralin	61					sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)				endometrium(2)|large_intestine(1)|lung(3)	6		all_epithelial(40;2.79e-15)|Breast(86;3.04e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|Hepatocellular(293;0.148)|all_hematologic(139;0.158)|Melanoma(123;0.16)		Epithelial(32;2.56e-30)|all cancers(36;7.18e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.37e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.07e-06)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		CCTCGATCTGGGGGTAGGCCC	0.622																																							uc002vyv.2		NA																	0					0						c.(181-183)CCC>CCA		otospiralin precursor							78.0	82.0	81.0					2																	241078674		2203	4300	6503	SO:0001819	synonymous_variant	150677					extracellular region		g.chr2:241078674G>T		CCDS2533.1	2q37.3	2008-02-05			ENSG00000178602	ENSG00000178602			22644	protein-coding gene	gene with protein product		607877				12687421	Standard	NM_148961		Approved	OTOSP	uc002vyv.3	Q8NHW6	OTTHUMG00000133351	ENST00000391989.2:c.183C>A	2.37:g.241078674G>T						MYEOV2_uc002vyu.1_5'Flank|MYEOV2_uc010zof.1_5'Flank	p.P61P	NM_148961	NP_683764	Q8NHW6	OTOSP_HUMAN		Epithelial(32;2.56e-30)|all cancers(36;7.18e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.37e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.07e-06)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)	4	338	-		all_epithelial(40;2.79e-15)|Breast(86;3.04e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|Hepatocellular(293;0.148)|all_hematologic(139;0.158)|Melanoma(123;0.16)	61					Q53SW6	Silent	SNP	ENST00000391989.2	37	c.183C>A	CCDS2533.1																																																																																				0.622	OTOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257181.3	NM_148961		11	114	1	0	1.58986e-06	0.008291	2.11982e-06	11	114				
HSPA12B	116835	broad.mit.edu	37	20	3728940	3728940	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr20:3728940G>A	ENST00000254963.2	+	8	897	c.752G>A	c.(751-753)cGc>cAc	p.R251H	HSPA12B_ENST00000542646.1_Missense_Mutation_p.R85H	NM_001197327.1|NM_052970.4	NP_001184256.1|NP_443202.3	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	251							ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	14						GTATACTGCCGCAAGCTGCGC	0.682																																							uc002wjd.2		NA																	0					0						c.(751-753)CGC>CAC		heat shock 70kD protein 12B							50.0	47.0	48.0					20																	3728940		2203	4300	6503	SO:0001583	missense	116835						ATP binding	g.chr20:3728940G>A	AK056712	CCDS13061.1	20p13	2011-09-02	2003-04-10	2003-04-10	ENSG00000132622	ENSG00000132622		"""Heat shock proteins / HSP70"""	16193	protein-coding gene	gene with protein product		610702	"""chromosome 20 open reading frame 60"""	C20orf60		12552099	Standard	NM_052970		Approved	dJ1009E24.2	uc002wjd.3	Q96MM6	OTTHUMG00000031755	ENST00000254963.2:c.752G>A	20.37:g.3728940G>A	ENSP00000254963:p.Arg251His					HSPA12B_uc010zqi.1_Missense_Mutation_p.R250H|HSPA12B_uc002wje.2_Missense_Mutation_p.R164H|HSPA12B_uc010zqj.1_Missense_Mutation_p.R85H	p.R251H	NM_052970	NP_443202	Q96MM6	HS12B_HUMAN			8	855	+			251					D3DVX7|Q2TAK3|Q9BR52	Missense_Mutation	SNP	ENST00000254963.2	37	c.752G>A	CCDS13061.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.945226	0.92593	.	.	ENSG00000132622	ENST00000254963;ENST00000542646;ENST00000399701	T;T;T	0.46451	1.47;0.87;0.88	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.52008	0.1708	L	0.38953	1.18	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.99;0.997	T	0.33599	-0.9862	10	0.15499	T	0.54	.	15.7728	0.78184	0.0:0.0:1.0:0.0	.	250;251	B7ZLP2;Q96MM6	.;HS12B_HUMAN	H	251;85;165	ENSP00000254963:R251H;ENSP00000441506:R85H;ENSP00000382608:R165H	ENSP00000254963:R251H	R	+	2	0	HSPA12B	3676940	1.000000	0.71417	1.000000	0.80357	0.664000	0.39144	9.657000	0.98554	2.578000	0.87016	0.655000	0.94253	CGC		0.682	HSPA12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077756.2	NM_052970		11	62	0	0	0	0.000978	0	11	62				
CEP250	11190	broad.mit.edu	37	20	34078568	34078568	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr20:34078568A>G	ENST00000397527.1	+	21	3412	c.2692A>G	c.(2692-2694)Atg>Gtg	p.M898V	RP3-477O4.14_ENST00000444933.1_RNA|CEP250_ENST00000342580.4_Intron|RP3-477O4.14_ENST00000453914.1_RNA|RP3-477O4.14_ENST00000416260.1_RNA	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	898	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GCAGACAGAAATGGAGGCCAT	0.572																																							uc002xcm.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(2692-2694)ATG>GTG		centrosomal protein 2							114.0	102.0	106.0					20																	34078568		2203	4300	6503	SO:0001583	missense	11190				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding	g.chr20:34078568A>G	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.2692A>G	20.37:g.34078568A>G	ENSP00000380661:p.Met898Val					CEP250_uc010zve.1_Missense_Mutation_p.M266V	p.M898V	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.0106)		22	3363	+	Lung NSC(9;0.00156)|all_lung(11;0.00243)		898			Gln/Glu-rich.|Potential.		E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	37	c.2692A>G	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.431853	0.00184	.	.	ENSG00000126001	ENST00000397527	T	0.08634	3.07	4.47	0.691	0.18045	.	1.345290	0.04753	N	0.424827	T	0.05731	0.0150	N	0.25647	0.755	0.21697	N	0.999581	B	0.02656	0.0	B	0.04013	0.001	T	0.41963	-0.9479	10	0.17832	T	0.49	.	2.7723	0.05338	0.6002:0.0:0.2106:0.1892	.	898	Q9BV73	CP250_HUMAN	V	898	ENSP00000380661:M898V	ENSP00000380661:M898V	M	+	1	0	CEP250	33541982	0.094000	0.21725	0.443000	0.26883	0.063000	0.16089	0.188000	0.17018	0.341000	0.23771	0.454000	0.30748	ATG		0.572	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186		7	94	0	0	0	0.00308	0	7	94				
ZNF217	7764	broad.mit.edu	37	20	52198292	52198292	+	Silent	SNP	C	C	T	rs374457302		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr20:52198292C>T	ENST00000371471.2	-	2	1499	c.1074G>A	c.(1072-1074)gcG>gcA	p.A358A	ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Silent_p.A358A			O75362	ZN217_HUMAN	zinc finger protein 217	358					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A358A(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CCACGGAGGGCGCTTCGCCGT	0.557																																							uc002xwq.3		NA																	2	Substitution - coding silent(2)		large_intestine(2)	skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6						c.(1072-1074)GCG>GCA		zinc finger protein 217		C		1,4405	2.1+/-5.4	0,1,2202	115.0	117.0	117.0		1074	4.8	0.3	20		117	0,8600		0,0,4300	no	coding-synonymous	ZNF217	NM_006526.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		358/1049	52198292	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7764				negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr20:52198292C>T	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1074G>A	20.37:g.52198292C>T						ZNF217_uc010gij.1_Silent_p.A350A	p.A358A	NM_006526	NP_006517	O75362	ZN217_HUMAN	BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)		1	1345	-	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		358					E1P5Y6|Q14DB8	Silent	SNP	ENST00000371471.2	37	c.1074G>A	CCDS13443.1																																																																																				0.557	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526		9	110	0	0	0	0.004482	0	9	110				
OPRL1	4987	broad.mit.edu	37	20	62730084	62730084	+	Missense_Mutation	SNP	G	G	A	rs138440707		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr20:62730084G>A	ENST00000349451.3	+	6	1457	c.1045G>A	c.(1045-1047)Gtg>Atg	p.V349M	OPRL1_ENST00000355631.4_Missense_Mutation_p.V349M|OPRL1_ENST00000336866.2_Missense_Mutation_p.V349M	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	349					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					GTCTGACCGCGTGCGCAGCAT	0.642																																							uc002yic.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1045-1047)GTG>ATG		opiate receptor-like 1			MET/VAL,MET/VAL,MET/VAL	0,4402		0,0,2201	67.0	60.0	62.0		1045,1045,1045	3.1	0.4	20	dbSNP_134	62	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense,missense	OPRL1	NM_000913.4,NM_001200019.1,NM_182647.2	21,21,21	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	349/371,349/371,349/371	62730084	1,12997	2201	4298	6499	SO:0001583	missense	4987				elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity	g.chr20:62730084G>A		CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.1045G>A	20.37:g.62730084G>A	ENSP00000336764:p.Val349Met					OPRL1_uc002yid.2_Missense_Mutation_p.V349M|OPRL1_uc002yif.3_Missense_Mutation_p.V344M	p.V349M	NM_182647	NP_872588	P41146	OPRX_HUMAN			5	1447	+	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)		349			Cytoplasmic (Potential).		Q8TD34|Q8WYH9|Q9H4K4	Missense_Mutation	SNP	ENST00000349451.3	37	c.1045G>A	CCDS13556.1	.	.	.	.	.	.	.	.	.	.	G	4.609	0.113180	0.08831	0.0	1.16E-4	ENSG00000125510	ENST00000336866;ENST00000355631;ENST00000349451	T;T;T	0.64803	-0.12;-0.12;-0.12	5.12	3.11	0.35812	.	0.202211	0.49305	D	0.000156	T	0.32852	0.0843	N	0.12637	0.245	0.28900	N	0.893331	B;B	0.32893	0.389;0.27	B;B	0.23716	0.048;0.022	T	0.11767	-1.0574	10	0.31617	T	0.26	.	3.0779	0.06253	0.2627:0.2452:0.4921:0.0	.	344;349	P41146-2;P41146	.;OPRX_HUMAN	M	349	ENSP00000336843:V349M;ENSP00000347848:V349M;ENSP00000336764:V349M	ENSP00000336843:V349M	V	+	1	0	OPRL1	62200528	0.999000	0.42202	0.424000	0.26647	0.117000	0.20001	3.201000	0.51059	1.110000	0.41699	0.550000	0.68814	GTG		0.642	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080295.1	NM_182647		14	49	0	0	0	0.001855	0	14	49				
KRTAP19-8	728299	broad.mit.edu	37	21	32410632	32410632	+	Missense_Mutation	SNP	T	T	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr21:32410632T>G	ENST00000382822.2	-	1	163	c.131A>C	c.(130-132)tAt>tCt	p.Y44S		NM_001099219.1	NP_001092689.1	Q3LI54	KR198_HUMAN	keratin associated protein 19-8	44						intermediate filament (GO:0005882)				endometrium(2)|upper_aerodigestive_tract(1)	3						GCTGAATCCATAGCCTCCGTA	0.517																																							uc010glt.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(130-132)TAT>TCT		keratin associated protein 19-8							90.0	110.0	103.0					21																	32410632		2202	4300	6502	SO:0001583	missense	728299					intermediate filament		g.chr21:32410632T>G	AB096964	CCDS42917.1	21q22.11	2007-11-23			ENSG00000206102	ENSG00000206102		"""Keratin associated proteins"""	33898	protein-coding gene	gene with protein product							Standard	NM_001099219		Approved		uc010glt.3	Q3LI54	OTTHUMG00000057787	ENST00000382822.2:c.131A>C	21.37:g.32410632T>G	ENSP00000372272:p.Tyr44Ser						p.Y44S	NM_001099219	NP_001092689	Q3LI54	KR198_HUMAN			1	164	-			44						Missense_Mutation	SNP	ENST00000382822.2	37	c.131A>C	CCDS42917.1	.	.	.	.	.	.	.	.	.	.	T	7.851	0.724022	0.15439	.	.	ENSG00000206102	ENST00000382822	T	0.10763	2.84	4.01	2.81	0.32909	.	.	.	.	.	T	0.22704	0.0548	.	.	.	0.09310	N	1	D	0.58620	0.983	P	0.60415	0.874	T	0.05616	-1.0874	8	0.87932	D	0	.	6.5811	0.22594	0.2136:0.0:0.0:0.7864	.	44	Q3LI54	KR198_HUMAN	S	44	ENSP00000372272:Y44S	ENSP00000372272:Y44S	Y	-	2	0	KRTAP19-8	31332503	0.008000	0.16893	0.034000	0.17996	0.113000	0.19764	0.533000	0.23082	0.659000	0.30945	0.413000	0.27773	TAT		0.517	KRTAP19-8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000128239.3	NM_001099219		19	97	0	0	0	0.008871	0	19	97				
TBX1	6899	broad.mit.edu	37	22	19750849	19750849	+	Missense_Mutation	SNP	G	G	A	rs371125236		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr22:19750849G>A	ENST00000329705.7	+	4	625	c.496G>A	c.(496-498)Gac>Aac	p.D166N	TBX1_ENST00000359500.3_Missense_Mutation_p.D166N|TBX1_ENST00000332710.4_Missense_Mutation_p.D166N	NM_080646.1	NP_542377.1	O43435	TBX1_HUMAN	T-box 1	166					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|aorta morphogenesis (GO:0035909)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|blood vessel morphogenesis (GO:0048514)|blood vessel remodeling (GO:0001974)|cell fate specification (GO:0001708)|cell proliferation (GO:0008283)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|coronary artery morphogenesis (GO:0060982)|determination of left/right symmetry (GO:0007368)|ear morphogenesis (GO:0042471)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic viscerocranium morphogenesis (GO:0048703)|enamel mineralization (GO:0070166)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|lymph vessel development (GO:0001945)|mesenchymal cell apoptotic process (GO:0097152)|mesoderm development (GO:0007498)|middle ear morphogenesis (GO:0042474)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle organ morphogenesis (GO:0048644)|muscle tissue morphogenesis (GO:0060415)|negative regulation of cell differentiation (GO:0045596)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|parathyroid gland development (GO:0060017)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of tongue muscle cell differentiation (GO:2001037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of organ morphogenesis (GO:2000027)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retinoic acid receptor signaling pathway (GO:0048384)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|social behavior (GO:0035176)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tongue morphogenesis (GO:0043587)|transcription, DNA-templated (GO:0006351)|vagus nerve morphogenesis (GO:0021644)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|lung(3)|ovary(2)	8	Colorectal(54;0.0993)	all_lung(157;3.05e-06)				CGTGCCGGTGGACGATAAGCG	0.612																																							uc002zqb.2		NA																	0				ovary(1)|breast(1)	2						c.(496-498)GAC>AAC		T-box 1 isoform A			ASN/ASP,ASN/ASP,ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	159.0	121.0	134.0		496,496,496	5.1	1.0	22		134	0,8600		0,0,4300	no	missense,missense,missense	TBX1	NM_005992.1,NM_080646.1,NM_080647.1	23,23,23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	166/373,166/399,166/496	19750849	1,13005	2203	4300	6503	SO:0001583	missense	6899				embryonic viscerocranium morphogenesis|heart development|parathyroid gland development|pharyngeal system development|regulation of transcription from RNA polymerase II promoter|soft palate development|thymus development	nucleus	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr22:19750849G>A	AF012131	CCDS13765.1, CCDS13766.1, CCDS13767.1	22q11.21	2014-09-17			ENSG00000184058	ENSG00000184058		"""T-boxes"""	11592	protein-coding gene	gene with protein product		602054	"""velocardiofacial syndrome"""	VCF		9268629, 23000736	Standard	NM_080646		Approved	CATCH22	uc002zqa.1	O43435	OTTHUMG00000150421	ENST00000329705.7:c.496G>A	22.37:g.19750849G>A	ENSP00000331176:p.Asp166Asn					TBX1_uc002zqa.1_Missense_Mutation_p.D166N|TBX1_uc002zqc.2_Missense_Mutation_p.D166N	p.D166N	NM_080646	NP_542377	O43435	TBX1_HUMAN			4	625	+	Colorectal(54;0.0993)	all_lung(157;3.05e-06)	166			T-box.		C6G493|C6G494|O43436|Q96RJ2	Missense_Mutation	SNP	ENST00000329705.7	37	c.496G>A	CCDS13766.1	.	.	.	.	.	.	.	.	.	.	g	35	5.434438	0.96150	2.27E-4	0.0	ENSG00000184058	ENST00000332710;ENST00000329705;ENST00000359500	D;D;D	0.91407	-2.84;-2.84;-2.84	5.08	5.08	0.68730	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.96904	0.8989	H	0.95114	3.625	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.77004	0.983;0.989;0.971	D	0.98185	1.0459	10	0.87932	D	0	.	18.4713	0.90776	0.0:0.0:1.0:0.0	.	166;166;166	Q152R5;O43435;D9ZGG0	.;TBX1_HUMAN;.	N	166	ENSP00000331791:D166N;ENSP00000331176:D166N;ENSP00000352483:D166N	ENSP00000331176:D166N	D	+	1	0	TBX1	18130849	1.000000	0.71417	0.998000	0.56505	0.663000	0.39108	6.753000	0.74904	2.349000	0.79799	0.543000	0.68304	GAC		0.612	TBX1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318033.1	NM_080647		13	40	0	0	0	0.001855	0	13	40				
HHATL	57467	broad.mit.edu	37	3	42735266	42735266	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr3:42735266G>T	ENST00000441594.1	-	10	1352	c.1091C>A	c.(1090-1092)cCa>cAa	p.P364Q	HHATL_ENST00000310417.5_Missense_Mutation_p.P364Q	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	364					negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		TGCCAGCTCTGGGATCACAGC	0.542																																							uc003clw.2		NA																	0				ovary(3)	3						c.(1090-1092)CCA>CAA		hedgehog acyltransferase-like							72.0	60.0	64.0					3																	42735266		2203	4300	6503	SO:0001583	missense	57467				negative regulation of N-terminal protein palmitoylation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm		g.chr3:42735266G>T	AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.1091C>A	3.37:g.42735266G>T	ENSP00000405423:p.Pro364Gln					HHATL_uc003clx.2_Missense_Mutation_p.P364Q	p.P364Q	NM_020707	NP_065758	Q9HCP6	HHATL_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.215)	11	1238	-			364					Q8TBG3|Q9ULP7	Missense_Mutation	SNP	ENST00000441594.1	37	c.1091C>A	CCDS2704.1	.	.	.	.	.	.	.	.	.	.	g	2.439	-0.328992	0.05314	.	.	ENSG00000010282	ENST00000310417;ENST00000441594	T;T	0.72615	-0.67;-0.67	4.26	4.26	0.50523	.	0.291851	0.36268	N	0.002694	T	0.55114	0.1900	L	0.36672	1.1	0.27234	N	0.959335	P	0.38677	0.642	B	0.34991	0.193	T	0.52830	-0.8523	10	0.38643	T	0.18	-10.0817	7.6093	0.28120	0.0:0.145:0.6203:0.2347	.	364	Q9HCP6	HHATL_HUMAN	Q	364	ENSP00000310621:P364Q;ENSP00000405423:P364Q	ENSP00000310621:P364Q	P	-	2	0	HHATL	42710270	1.000000	0.71417	0.989000	0.46669	0.073000	0.16967	4.002000	0.57053	1.920000	0.55613	0.450000	0.29827	CCA		0.542	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343627.1	NM_020707		6	37	1	0	2.7689e-08	0.001984	3.81291e-08	6	37				
KCNAB1	7881	broad.mit.edu	37	3	156175266	156175266	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr3:156175266G>A	ENST00000490337.1	+	4	446	c.382G>A	c.(382-384)Gcc>Acc	p.A128T	KCNAB1_ENST00000471742.1_Missense_Mutation_p.A117T|KCNAB1_ENST00000389634.5_Missense_Mutation_p.A110T|KCNAB1_ENST00000389636.5_Missense_Mutation_p.A128T|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000302490.8_Missense_Mutation_p.A110T	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	128					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GATGACCATCGCCTATGAAAG	0.473																																							uc003far.2		NA																	0				ovary(3)|skin(1)	4						c.(382-384)GCC>ACC		potassium voltage-gated channel, shaker-related							235.0	204.0	214.0					3																	156175266		2203	4300	6503	SO:0001583	missense	7881					cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity	g.chr3:156175266G>A	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.382G>A	3.37:g.156175266G>A	ENSP00000419952:p.Ala128Thr					KCNAB1_uc011bon.1_Missense_Mutation_p.A128T|KCNAB1_uc003fas.2_Missense_Mutation_p.A117T|KCNAB1_uc003fat.2_Missense_Mutation_p.A110T|KCNAB1_uc010hvt.1_Missense_Mutation_p.A110T|KCNAB1_uc011boo.1_Missense_Mutation_p.A4T	p.A128T	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)		4	446	+			128					A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	ENST00000490337.1	37	c.382G>A	CCDS3174.1	.	.	.	.	.	.	.	.	.	.	G	32	5.128857	0.94473	.	.	ENSG00000169282	ENST00000472028;ENST00000490337;ENST00000389636;ENST00000471742;ENST00000475456;ENST00000302490;ENST00000389634	T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01	5.48	5.48	0.80851	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.75968	0.3922	H	0.96662	3.86	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.997;0.997;0.997;0.995	D	0.84091	0.0390	10	0.87932	D	0	-18.6711	14.8543	0.70323	0.0:0.0:1.0:0.0	.	128;110;110;117;128	B7Z8E5;F8W6W4;B3KPZ4;Q14722-3;Q14722	.;.;.;.;KCAB1_HUMAN	T	46;128;128;117;71;110;110	ENSP00000420755:A46T;ENSP00000419952:A128T;ENSP00000374287:A128T;ENSP00000418956:A117T;ENSP00000420221:A71T;ENSP00000305858:A110T;ENSP00000374285:A110T	ENSP00000305858:A110T	A	+	1	0	KCNAB1	157657960	1.000000	0.71417	0.982000	0.44146	0.997000	0.91878	7.919000	0.87513	2.554000	0.86153	0.655000	0.94253	GCC		0.473	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471		14	97	0	0	0	0.004007	0	14	97				
ACAP2	23527	broad.mit.edu	37	3	195000115	195000115	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr3:195000115A>G	ENST00000326793.6	-	23	2509	c.2279T>C	c.(2278-2280)aTg>aCg	p.M760T	ACAP2-IT1_ENST00000419899.1_RNA|ACAP2_ENST00000472860.1_5'UTR	NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	760					cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						ATTGGATGCCATTTGGGAAAA	0.313																																							uc003fun.3		NA																	0				large_intestine(1)|ovary(1)	2						c.(2278-2280)ATG>ACG		centaurin, beta 2							66.0	71.0	69.0					3																	195000115		2203	4295	6498	SO:0001583	missense	23527				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr3:195000115A>G		CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.2279T>C	3.37:g.195000115A>G	ENSP00000324287:p.Met760Thr						p.M760T	NM_012287	NP_036419	Q15057	ACAP2_HUMAN			23	2520	-			760					A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	ENST00000326793.6	37	c.2279T>C	CCDS33924.1	.	.	.	.	.	.	.	.	.	.	A	16.63	3.175981	0.57692	.	.	ENSG00000114331	ENST00000326793	T	0.46451	0.87	6.02	6.02	0.97574	.	0.134655	0.64402	D	0.000004	T	0.44808	0.1311	M	0.76574	2.34	0.58432	D	0.999998	P	0.37612	0.602	B	0.31946	0.138	T	0.51593	-0.8686	10	0.72032	D	0.01	.	15.7305	0.77800	1.0:0.0:0.0:0.0	.	760	Q15057	ACAP2_HUMAN	T	760	ENSP00000324287:M760T	ENSP00000324287:M760T	M	-	2	0	ACAP2	196481404	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.638000	0.91019	2.299000	0.77371	0.528000	0.53228	ATG		0.313	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	NM_012287		9	35	0	0	0	0.008291	0	9	35				
PIGG	54872	broad.mit.edu	37	4	515677	515677	+	Missense_Mutation	SNP	G	G	A	rs138569779	byFrequency	TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr4:515677G>A	ENST00000453061.2	+	8	1667	c.1561G>A	c.(1561-1563)Gtg>Atg	p.V521M	PIGG_ENST00000310340.5_Missense_Mutation_p.V513M|PIGG_ENST00000536264.1_3'UTR|PIGG_ENST00000503111.1_3'UTR|PIGG_ENST00000504346.1_Missense_Mutation_p.V432M|PIGG_ENST00000509768.1_Missense_Mutation_p.V432M|PIGG_ENST00000383028.4_Missense_Mutation_p.V388M|PIGG_ENST00000296306.7_3'UTR	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	521					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						GCTGCTGTGTGTGATTGTGTC	0.587													G|||	6	0.00119808	0.0045	0.0	5008	,	,		18637	0.0		0.0	False		,,,				2504	0.0						uc003gak.3		NA																	0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(1561-1563)GTG>ATG		phosphatidylinositol glycan anchor biosynthesis,		G	MET/VAL,MET/VAL	30,4376	36.0+/-67.5	0,30,2173	131.0	106.0	114.0		1561,1537	4.7	0.2	4	dbSNP_134	114	0,8600		0,0,4300	yes	missense,missense	PIGG	NM_001127178.1,NM_017733.3	21,21	0,30,6473	AA,AG,GG		0.0,0.6809,0.2307	possibly-damaging,possibly-damaging	521/984,513/976	515677	30,12976	2203	4300	6503	SO:0001583	missense	54872				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity	g.chr4:515677G>A		CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1561G>A	4.37:g.515677G>A	ENSP00000415203:p.Val521Met					PIGG_uc003gaj.3_Missense_Mutation_p.V513M|PIGG_uc011bux.1_RNA|PIGG_uc010ibf.2_Missense_Mutation_p.V388M|PIGG_uc003gal.3_Missense_Mutation_p.V432M|PIGG_uc003gai.2_Intron|PIGG_uc011buw.1_3'UTR|PIGG_uc003gam.2_3'UTR|PIGG_uc003gan.2_Missense_Mutation_p.V432M	p.V521M	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN			8	1697	+			521			Helical; (Potential).		B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	ENST00000453061.2	37	c.1561G>A	CCDS46992.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	11.27	1.589844	0.28357	0.006809	0.0	ENSG00000174227	ENST00000310340;ENST00000453061;ENST00000504346;ENST00000383028;ENST00000509768	T;T;T;T;T	0.32515	3.18;3.2;2.87;2.86;1.45	5.57	4.73	0.59995	.	0.483364	0.23977	N	0.042709	T	0.14270	0.0345	N	0.08118	0	0.28045	N	0.93357	P;P;P;P	0.47841	0.875;0.901;0.694;0.895	P;B;B;P	0.48189	0.57;0.444;0.295;0.456	T	0.03403	-1.1040	10	0.27785	T	0.31	.	8.8247	0.35047	0.1692:0.0:0.8308:0.0	.	388;432;521;513	Q5H8A4-3;D6RFE8;Q5H8A4;Q5H8A4-2	.;.;PIGG_HUMAN;.	M	513;521;432;388;432	ENSP00000311750:V513M;ENSP00000415203:V521M;ENSP00000424800:V432M;ENSP00000372494:V388M;ENSP00000421550:V432M	ENSP00000311750:V513M	V	+	1	0	PIGG	505677	0.658000	0.27402	0.162000	0.22713	0.006000	0.05464	2.611000	0.46334	1.367000	0.46095	-0.221000	0.12465	GTG		0.587	PIGG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357494.1	NM_017733		5	60	0	0	0	0.000602	0	5	60				
PCDH10	57575	broad.mit.edu	37	4	134073195	134073195	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr4:134073195C>G	ENST00000264360.5	+	1	2726	c.1900C>G	c.(1900-1902)Cgc>Ggc	p.R634G	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	634	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CATGGACTGGCGCACCGGGGA	0.692																																							uc003iha.2		NA																	0				ovary(2)	2						c.(1900-1902)CGC>GGC		protocadherin 10 isoform 1 precursor							32.0	36.0	35.0					4																	134073195		2180	4279	6459	SO:0001583	missense	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134073195C>G	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1900C>G	4.37:g.134073195C>G	ENSP00000264360:p.Arg634Gly					uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.R634G	p.R634G	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	2726	+			634			Cadherin 6.|Extracellular (Potential).		Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	c.1900C>G	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	8.334	0.827258	0.16749	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.52295	0.67	4.29	4.29	0.51040	Cadherin (4);Cadherin-like (1);	0.000000	0.44483	D	0.000458	T	0.55465	0.1922	L	0.39514	1.22	0.53688	D	0.999973	D;B	0.76494	0.999;0.002	D;B	0.87578	0.998;0.033	T	0.47560	-0.9108	10	0.22109	T	0.4	.	11.7517	0.51852	0.1761:0.8239:0.0:0.0	.	634;634	Q9P2E7;Q96SF0	PCD10_HUMAN;.	G	634	ENSP00000264360:R634G	ENSP00000264360:R634G	R	+	1	0	PCDH10	134292645	0.993000	0.37304	1.000000	0.80357	0.994000	0.84299	0.267000	0.18552	2.207000	0.71202	0.655000	0.94253	CGC		0.692	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		19	53	0	0	0	0.001882	0	19	53				
IQGAP2	10788	broad.mit.edu	37	5	75996968	75996968	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr5:75996968G>T	ENST00000274364.6	+	34	4732	c.4435G>T	c.(4435-4437)Gtg>Ttg	p.V1479L	IQGAP2_ENST00000502745.1_Missense_Mutation_p.V975L|CTD-2384B11.2_ENST00000507514.1_RNA|IQGAP2_ENST00000379730.3_Missense_Mutation_p.V981L|IQGAP2_ENST00000396234.3_Missense_Mutation_p.V975L	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1479					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AGCGAAGCCAGTGAAGTACAC	0.408																																							uc003kek.2		NA																	0				ovary(6)|central_nervous_system(1)	7						c.(4435-4437)GTG>TTG		IQ motif containing GTPase activating protein 2							136.0	128.0	130.0					5																	75996968		2203	4300	6503	SO:0001583	missense	10788				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity	g.chr5:75996968G>T	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.4435G>T	5.37:g.75996968G>T	ENSP00000274364:p.Val1479Leu					IQGAP2_uc011csv.1_Missense_Mutation_p.V975L|IQGAP2_uc003kel.2_Missense_Mutation_p.V975L	p.V1479L	NM_006633	NP_006624	Q13576	IQGA2_HUMAN		all cancers(79;1.38e-36)	34	4657	+		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)	1479					A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	c.4435G>T	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.594139	0.00857	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000396234;ENST00000502745	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.56	4.68	0.58851	RasGAP protein, C-terminal (1);	0.326333	0.32068	N	0.006623	T	0.12646	0.0307	N	0.02181	-0.65	0.27742	N	0.944456	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.15484	0.008;0.008;0.013	T	0.39165	-0.9627	10	0.02654	T	1	-25.3507	4.8996	0.13767	0.0792:0.3015:0.4905:0.1288	.	981;975;1479	F5H7S7;Q13576-2;Q13576	.;.;IQGA2_HUMAN	L	1479;981;975;975	ENSP00000274364:V1479L;ENSP00000442313:V981L;ENSP00000379535:V975L;ENSP00000426027:V975L	ENSP00000274364:V1479L	V	+	1	0	IQGAP2	76032724	0.305000	0.24481	0.822000	0.32727	0.082000	0.17680	1.321000	0.33678	2.773000	0.95371	0.655000	0.94253	GTG		0.408	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633		10	59	1	0	2.17888e-05	0.006214	2.77312e-05	10	59				
FER	2241	broad.mit.edu	37	5	108382819	108382819	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr5:108382819A>G	ENST00000281092.4	+	16	2228	c.1844A>G	c.(1843-1845)tAt>tGt	p.Y615C	FER_ENST00000438717.2_Missense_Mutation_p.Y440C	NM_005246.2	NP_005237.2	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	615	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cell proliferation (GO:0008283)|cell-cell adhesion mediated by cadherin (GO:0044331)|cellular response to insulin stimulus (GO:0032869)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to reactive oxygen species (GO:0034614)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|diapedesis (GO:0050904)|extracellular matrix-cell signaling (GO:0035426)|Fc-epsilon receptor signaling pathway (GO:0038095)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular signal transduction (GO:0035556)|Kit signaling pathway (GO:0038109)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of mast cell activation involved in immune response (GO:0033007)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of fibroblast migration (GO:0010762)|regulation of lamellipodium assembly (GO:0010591)|regulation of protein phosphorylation (GO:0001932)|response to lipopolysaccharide (GO:0032496)|response to platelet-derived growth factor (GO:0036119)|substrate adhesion-dependent cell spreading (GO:0034446)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(2)|biliary_tract(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	32		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		CTCAAGCAATATGATCATCCC	0.313																																					Colon(146;1051 1799 9836 27344 47401)	Colon(146;1051 1799 9836 27344 47401)	uc003kop.1		NA																	0				lung(2)|stomach(1)|ovary(1)|kidney(1)	5						c.(1843-1845)TAT>TGT		fer (fps/fes related) tyrosine kinase							106.0	100.0	102.0					5																	108382819		2202	4299	6501	SO:0001583	missense	2241				intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr5:108382819A>G	J03358	CCDS4098.1	5q21	2013-02-14	2008-02-07		ENSG00000151422	ENSG00000151422	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	3655	protein-coding gene	gene with protein product	"""phosphoprotein NCP94"", ""protein phosphatase 1, regulatory subunit 74"""	176942					Standard	NM_005246		Approved	TYK3, PPP1R74	uc003kop.1	P16591	OTTHUMG00000128751	ENST00000281092.4:c.1844A>G	5.37:g.108382819A>G	ENSP00000281092:p.Tyr615Cys					FER_uc011cvg.1_Missense_Mutation_p.Y440C	p.Y615C	NM_005246	NP_005237	P16591	FER_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)	16	2228	+		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)	615			Protein kinase.		B2RCR4|B4DSQ2|H2FLB8	Missense_Mutation	SNP	ENST00000281092.4	37	c.1844A>G	CCDS4098.1	.	.	.	.	.	.	.	.	.	.	A	17.37	3.373041	0.61624	.	.	ENSG00000151422	ENST00000281092;ENST00000438717	T;T	0.33865	1.39;1.39	5.33	5.33	0.75918	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39009	0.1062	N	0.04063	-0.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.54781	-0.8242	10	0.62326	D	0.03	-11.4262	15.5911	0.76530	1.0:0.0:0.0:0.0	.	615	P16591	FER_HUMAN	C	615;440	ENSP00000281092:Y615C;ENSP00000394297:Y440C	ENSP00000281092:Y615C	Y	+	2	0	FER	108410718	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.765000	0.74965	2.145000	0.66743	0.454000	0.30748	TAT		0.313	FER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250664.1	NM_005246		5	27	0	0	0	0.000602	0	5	27				
SLC6A7	6534	broad.mit.edu	37	5	149578887	149578887	+	Silent	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr5:149578887C>A	ENST00000230671.2	+	5	1052	c.681C>A	c.(679-681)atC>atA	p.I227I	SLC6A7_ENST00000524041.1_Silent_p.I227I	NM_014228.3	NP_055043.2	Q99884	SC6A7_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 7	227					proline transport (GO:0015824)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)|stomach(1)	16		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	CCTGGGTCATCGTGTTCCTCT	0.642																																							uc003lrr.2		NA																	0					0						c.(679-681)ATC>ATA		solute carrier family 6, member 7	L-Proline(DB00172)						108.0	99.0	102.0					5																	149578887		2203	4300	6503	SO:0001819	synonymous_variant	6534					integral to plasma membrane|membrane fraction	neurotransmitter:sodium symporter activity|proline:sodium symporter activity	g.chr5:149578887C>A	S80071	CCDS4305.1	5q32	2013-07-19	2013-07-19		ENSG00000011083	ENSG00000011083		"""Solute carriers"""	11054	protein-coding gene	gene with protein product	"""brain-specific L-proline transporter"", ""sodium-dependent proline transporter"""	606205	"""solute carrier family 6 (neurotransmitter transporter, L-proline), member 7"""			7651355	Standard	NM_014228		Approved	PROT	uc003lrr.3	Q99884	OTTHUMG00000130046	ENST00000230671.2:c.681C>A	5.37:g.149578887C>A							p.I227I	NM_014228	NP_055043	Q99884	SC6A7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		5	1052	+		all_hematologic(541;0.224)	227			Helical; Name=4; (Potential).		Q0VG81|Q52LU6	Silent	SNP	ENST00000230671.2	37	c.681C>A	CCDS4305.1																																																																																				0.642	SLC6A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252325.1	NM_014228		23	64	1	0	1.22574e-08	0.002299	1.71603e-08	23	64				
CDHR2	54825	broad.mit.edu	37	5	176011494	176011494	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr5:176011494G>A	ENST00000510636.1	+	19	2486	c.2212G>A	c.(2212-2214)Ggt>Agt	p.G738S	CDHR2_ENST00000506348.1_Missense_Mutation_p.G738S|CDHR2_ENST00000261944.5_Missense_Mutation_p.G738S	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	738	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						GTCGGGGAGTGGTGCCAACTA	0.642																																							uc003mem.1		NA																	0				ovary(2)	2						c.(2212-2214)GGT>AGT		protocadherin LKC precursor							109.0	106.0	107.0					5																	176011494		2203	4300	6503	SO:0001583	missense	54825				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding	g.chr5:176011494G>A	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.2212G>A	5.37:g.176011494G>A	ENSP00000424565:p.Gly738Ser					CDHR2_uc003men.1_Missense_Mutation_p.G738S	p.G738S	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN			19	2278	+			738			Cadherin 7.|Extracellular (Potential).		A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	c.2212G>A	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	G	9.362	1.068378	0.20067	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.52057	0.68;0.68;0.68	5.12	3.32	0.38043	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.39937	0.1097	L	0.52364	1.645	0.42771	D	0.993833	B	0.29378	0.243	B	0.27262	0.078	T	0.15521	-1.0434	9	0.27082	T	0.32	-15.3267	11.6912	0.51516	0.1461:0.0:0.8539:0.0	.	738	Q9BYE9	CDHR2_HUMAN	S	738	ENSP00000424565:G738S;ENSP00000261944:G738S;ENSP00000421078:G738S	ENSP00000261944:G738S	G	+	1	0	CDHR2	175944100	1.000000	0.71417	0.003000	0.11579	0.067000	0.16453	3.790000	0.55461	0.651000	0.30788	0.549000	0.68633	GGT		0.642	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675		42	134	0	0	0	0.002222	0	42	134				
ADAMTS2	9509	broad.mit.edu	37	5	178540919	178540919	+	Silent	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr5:178540919G>T	ENST00000251582.7	-	22	3686	c.3585C>A	c.(3583-3585)atC>atA	p.I1195I		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1195					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TGAGCTCTTGGATTCTTTGGT	0.433																																							uc003mjw.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(3583-3585)ATC>ATA		ADAM metallopeptidase with thrombospondin type 1							165.0	166.0	166.0					5																	178540919		2203	4300	6503	SO:0001819	synonymous_variant	9509				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:178540919G>T	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3585C>A	5.37:g.178540919G>T						uc003mjv.3_5'Flank	p.I1195I	NM_014244	NP_055059	O95450	ATS2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)	22	3585	-	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	1195						Silent	SNP	ENST00000251582.7	37	c.3585C>A	CCDS4444.1																																																																																				0.433	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244		13	136	1	0	2.68362e-12	0.001368	4.02543e-12	13	136				
BLOC1S5-TXNDC5	100526836	broad.mit.edu	37	6	7987629	7987629	+	Intron	SNP	C	C	A	rs138980345	byFrequency	TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr6:7987629C>A	ENST00000439343.2	-	4	372				TXNDC5_ENST00000539054.1_Intron					BLOC1S5-TXNDC5 readthrough (NMD candidate)																		GATGCTGACACGTACAATGCT	0.468																																							uc003mxx.3		NA																	0					0						c.(859-861)ACG>AAG		RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;																																				SO:0001627	intron_variant	206426							g.chr6:7987629C>A			6p24.3	2013-05-09	2013-05-09	2012-08-01	ENSG00000259040	ENSG00000259040			42001	other	readthrough			"""MUTED-TXNDC5 readthrough (non-protein coding)"""	MUTED-TXNDC5			Standard	NR_037616		Approved				OTTHUMG00000171453	ENST00000439343.2:c.372+38970G>T	6.37:g.7987629C>A						TXNDC5_uc003mxw.2_Intron	p.T287K	NR_027712						1	1295	+									Missense_Mutation	SNP	ENST00000439343.2	37	c.860C>A																																																																																					0.468	BLOC1S5-TXNDC5-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000413472.1	NR_037616.1		5	36	1	0	3.59834e-05	0.001168	4.47793e-05	5	36				
OR2B2	81697	broad.mit.edu	37	6	27879450	27879450	+	Silent	SNP	T	T	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr6:27879450T>G	ENST00000303324.2	-	1	724	c.648A>C	c.(646-648)atA>atC	p.I216I		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I216I(1)		cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22						AAGCATACGATATAAGGATGA	0.443																																							uc011dkw.1		NA																	1	Substitution - coding silent(1)		prostate(1)		0						c.(646-648)ATA>ATC		olfactory receptor, family 2, subfamily B,							124.0	111.0	115.0					6																	27879450		2203	4300	6503	SO:0001819	synonymous_variant	81697				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:27879450T>G	Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131		"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9			Standard	NM_033057		Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.648A>C	6.37:g.27879450T>G							p.I216I	NM_033057	NP_149046	Q9GZK3	OR2B2_HUMAN			1	648	-			216			Helical; Name=5; (Potential).		B2RNH2|Q9GZL2|Q9Y299	Silent	SNP	ENST00000303324.2	37	c.648A>C	CCDS4641.1																																																																																				0.443	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040163.1			3	47	0	0	0	0.000602	0	3	47				
TAP2	6891	broad.mit.edu	37	6	32803552	32803552	+	Splice_Site	SNP	T	T	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr6:32803552T>A	ENST00000452392.2	-	4	782		c.e4-2		TAP2_ENST00000374897.2_Splice_Site|TAP2_ENST00000374899.4_Splice_Site			Q9UDX4	S14L3_HUMAN	transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)									Vitamin E(DB00163)	GACAGTGAGCTGTGGGGTAGG	0.582																																							uc003occ.2		NA																	0					0						c.e3-1		transporter 2, ATP-binding cassette, sub-family							74.0	76.0	75.0					6																	32803552		1509	2707	4216	SO:0001630	splice_region_variant	6891				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding	g.chr6:32803552T>A	M74447	CCDS4755.1	6p21.3	2014-09-17			ENSG00000204267	ENSG00000204267		"""ATP binding cassette transporters / subfamily B"""	44	protein-coding gene	gene with protein product		170261		ABCB3		1529427, 1946428, 16395595	Standard	NM_001290043		Approved	PSF2, RING11, D6S217E	uc003ocd.3	Q03519	OTTHUMG00000031068	ENST00000452392.2:c.609-2A>T	6.37:g.32803552T>A						TAP2_uc011dqf.1_Splice_Site_p.S203_splice|TAP2_uc003ocb.1_Splice_Site_p.S203_splice|TAP2_uc003ocd.2_Splice_Site_p.S203_splice	p.S203_splice	NM_018833	NP_061313	Q03519	TAP2_HUMAN			3	640	-								E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Splice_Site	SNP	ENST00000452392.2	37	c.609_splice		.	.	.	.	.	.	.	.	.	.	T	16.13	3.036561	0.54896	.	.	ENSG00000204267;ENSG00000204267;ENSG00000204267;ENSG00000250264	ENST00000556934;ENST00000374899;ENST00000374897;ENST00000452392	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5497	0.61726	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	XXbac-BPG246D15.9;TAP2	32911530	1.000000	0.71417	0.987000	0.45799	0.447000	0.32167	4.881000	0.63114	2.089000	0.63090	0.443000	0.29094	.		0.582	TAP2-001	NOVEL	mRNA_end_NF|cds_end_NF|basic|appris_principal|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000361828.1	NM_000544	Intron	7	72	0	0	0	0.006214	0	7	72				
DST	667	broad.mit.edu	37	6	56371588	56371588	+	Splice_Site	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr6:56371588C>A	ENST00000361203.3	-	71	18287		c.e71-1		DST_ENST00000370754.5_Splice_Site|DST_ENST00000340834.4_Splice_Site|DST_ENST00000370769.4_Splice_Site|DST_ENST00000421834.2_Splice_Site|DST_ENST00000446842.2_Splice_Site|DST_ENST00000244364.6_Splice_Site|DST_ENST00000312431.6_Splice_Site|DST_ENST00000370788.2_Splice_Site			Q03001	DYST_HUMAN	dystonin						axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCCTTATGGTCTAGAATAAGA	0.378																																							uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.e70-1		dystonin isoform 2							118.0	116.0	117.0					6																	56371588		1829	4092	5921	SO:0001630	splice_region_variant	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56371588C>A	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.18280-1G>T	6.37:g.56371588C>A						DST_uc003pcz.3_Splice_Site_p.T4117_splice|DST_uc011dxj.1_Splice_Site_p.T4146_splice|DST_uc011dxk.1_Splice_Site_p.T4157_splice|DST_uc003pcy.3_Splice_Site_p.T3791_splice	p.T4295_splice	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		70	12911	-	Lung NSC(77;0.103)							B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Splice_Site	SNP	ENST00000361203.3	37	c.12883_splice		.	.	.	.	.	.	.	.	.	.	C	16.80	3.222360	0.58560	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203;ENST00000537444	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.195	0.93684	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DST	56479547	1.000000	0.71417	0.986000	0.45419	0.395000	0.30598	5.733000	0.68571	2.531000	0.85337	0.585000	0.79938	.		0.378	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	Intron	27	94	1	0	4.02929e-09	0.002096	5.78564e-09	27	94				
PRIM2	5558	broad.mit.edu	37	6	57398228	57398228	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr6:57398228C>A	ENST00000607273.1	+	10	1018	c.931C>A	c.(931-933)Cta>Ata	p.L311I	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	311					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GCAGTATGTCCTATTTCTGAA	0.403																																							uc003pdx.2		NA																	0					0						c.(931-933)CTA>ATA		DNA primase polypeptide 2							238.0	219.0	225.0					6																	57398228		1961	4162	6123	SO:0001583	missense	5558				DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding	g.chr6:57398228C>A		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.931C>A	6.37:g.57398228C>A	ENSP00000475738:p.Leu311Ile						p.L311I	NM_000947	NP_000938	P49643	PRI2_HUMAN		Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)	10	1018	+			311					Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	ENST00000607273.1	37	c.931C>A																																																																																					0.403	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000947		6	188	1	0	5.4927e-09	0.004482	7.82012e-09	6	188				
MRPL18	29074	broad.mit.edu	37	6	160211662	160211662	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr6:160211662A>G	ENST00000367034.4	+	1	165	c.43A>G	c.(43-45)Agg>Ggg	p.R15G	TCP1_ENST00000420894.2_5'Flank|MRPL18_ENST00000480842.1_3'UTR|TCP1_ENST00000544255.1_5'Flank|TCP1_ENST00000546023.1_5'Flank|TCP1_ENST00000321394.7_5'Flank|TCP1_ENST00000392168.2_5'Flank	NM_014161.3	NP_054880.2	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18	15					rRNA import into mitochondrion (GO:0035928)|translation (GO:0006412)	extracellular space (GO:0005615)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	11		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		CTCGGTTTGCAGGAACCCTGG	0.557																																							uc003qsw.3		NA																	0					0						c.(43-45)AGG>GGG		mitochondrial ribosomal protein L18 precursor							111.0	98.0	102.0					6																	160211662		2203	4300	6503	SO:0001583	missense	29074				rRNA transport|translation	mitochondrial ribosome	5S rRNA binding|structural constituent of ribosome	g.chr6:160211662A>G	AF161556	CCDS5270.1	6q25.3	2012-09-13			ENSG00000112110	ENSG00000112110		"""Mitochondrial ribosomal proteins / large subunits"""	14477	protein-coding gene	gene with protein product		611831				11042152, 11551941	Standard	NM_014161		Approved	HSPC071	uc003qsw.4	Q9H0U6	OTTHUMG00000015942	ENST00000367034.4:c.43A>G	6.37:g.160211662A>G	ENSP00000356001:p.Arg15Gly					TCP1_uc003qsr.2_5'Flank|TCP1_uc003qss.2_5'Flank|TCP1_uc010kjz.2_5'Flank|TCP1_uc003qst.2_5'Flank|TCP1_uc010kka.1_5'Flank|MRPL18_uc010kkb.2_Intron	p.R15G	NM_014161	NP_054880	Q9H0U6	RM18_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)	1	171	+		Breast(66;0.000776)|Ovarian(120;0.0303)	15					Q5TAP9|Q9NZW8	Missense_Mutation	SNP	ENST00000367034.4	37	c.43A>G	CCDS5270.1	.	.	.	.	.	.	.	.	.	.	A	12.38	1.920602	0.33908	.	.	ENSG00000112110	ENST00000367034	T	0.46819	0.86	5.32	5.32	0.75619	.	0.169539	0.51477	D	0.000081	T	0.41190	0.1148	M	0.63428	1.95	0.39157	D	0.96233	P	0.46987	0.888	P	0.47102	0.537	T	0.51076	-0.8751	10	0.87932	D	0	-16.4417	11.5973	0.50981	1.0:0.0:0.0:0.0	.	15	Q9H0U6	RM18_HUMAN	G	15	ENSP00000356001:R15G	ENSP00000356001:R15G	R	+	1	2	MRPL18	160131652	1.000000	0.71417	0.850000	0.33497	0.119000	0.20118	2.473000	0.45145	2.233000	0.73108	0.533000	0.62120	AGG		0.557	MRPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042925.1			3	63	0	0	0	0.000248	0	3	63				
CCZ1B	221960	broad.mit.edu	37	7	6862974	6862974	+	Silent	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr7:6862974C>T	ENST00000316731.8	-	5	980	c.408G>A	c.(406-408)tcG>tcA	p.S136S	CCZ1B_ENST00000538180.1_5'UTR	NM_198097.3	NP_932765.1	P86790	CCZ1B_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog B (S. cerevisiae)	136						lysosome (GO:0005764)|membrane (GO:0016020)											GCCGCAGCACCGAGCTATAAA	0.493																																							uc003sqx.1		NA																	0					0						c.(406-408)TCG>TCA		hypothetical protein LOC221960							91.0	80.0	84.0					7																	6862974		2195	4296	6491	SO:0001819	synonymous_variant	221960					lysosomal membrane		g.chr7:6862974C>T	BC010130	CCDS5354.1	7p22.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000146574	ENSG00000146574			21717	protein-coding gene	gene with protein product	"""similar to CGI-43 protein"""		"""chromosome 7 open reading frame 28B"""	C7orf28B		12477932	Standard	NM_198097		Approved	DKFZP586I1023, H_NH0577018.2, MGC19819	uc003sqx.2	P86790	OTTHUMG00000152441	ENST00000316731.8:c.408G>A	7.37:g.6862974C>T						C7orf28B_uc011jxd.1_5'UTR|C7orf28B_uc003sqy.1_3'UTR	p.S136S	NM_198097	NP_932765	P86791	CCZ1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)	5	441	-		Ovarian(82;0.232)	136					A2RU45|O95766|Q9UG65|Q9Y359	Silent	SNP	ENST00000316731.8	37	c.408G>A	CCDS5354.1																																																																																				0.493	CCZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246858.1	NM_198097		11	97	0	0	0	0.007413	0	11	97				
ABCB5	340273	broad.mit.edu	37	7	20721241	20721241	+	Silent	SNP	T	T	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr7:20721241T>A	ENST00000404938.2	+	15	2473	c.1821T>A	c.(1819-1821)gcT>gcA	p.A607A	ABCB5_ENST00000258738.6_Silent_p.A162A	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	607	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						GAGCACATGCTGAACTAATGG	0.428																																							uc003suw.3		NA																	0				skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						c.(484-486)GCT>GCA		ATP-binding cassette, sub-family B, member 5							175.0	146.0	156.0					7																	20721241		2203	4300	6503	SO:0001819	synonymous_variant	340273				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity	g.chr7:20721241T>A	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.1821T>A	7.37:g.20721241T>A						ABCB5_uc010kuh.2_Silent_p.A607A	p.A162A	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN			6	1032	+			162			ABC transporter 1.|Extracellular (Potential).		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Silent	SNP	ENST00000404938.2	37	c.486T>A	CCDS55090.1																																																																																				0.428	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559		10	51	0	0	0	0.008291	0	10	51				
AKAP9	10142	broad.mit.edu	37	7	91622330	91622330	+	Silent	SNP	A	A	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr7:91622330A>G	ENST00000359028.2	+	6	798	c.573A>G	c.(571-573)gaA>gaG	p.E191E	AKAP9_ENST00000394564.1_Silent_p.E179E|AKAP9_ENST00000356239.3_Silent_p.E179E|AKAP9_ENST00000358100.2_Silent_p.E191E			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	191					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GAGAGCTGGAAGAAATGAGGG	0.433			T	BRAF	papillary thyroid																																		uc003ulg.2		NA		Dom	yes		7	7q21-q22	10142	T	A kinase (PRKA) anchor protein (yotiao) 9			E	BRAF		papillary thyroid		0				breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26						c.(535-537)GAA>GAG		A-kinase anchor protein 9 isoform 2							150.0	146.0	147.0					7																	91622330		2203	4300	6503	SO:0001819	synonymous_variant	10142				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	g.chr7:91622330A>G	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.573A>G	7.37:g.91622330A>G						AKAP9_uc003uld.3_Silent_p.E179E|AKAP9_uc003ule.2_Silent_p.E191E|AKAP9_uc003ulf.2_Silent_p.E179E	p.E179E	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		5	762	+	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		191			Potential.		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Silent	SNP	ENST00000359028.2	37	c.537A>G																																																																																					0.433	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		6	51	0	0	0	0.001984	0	6	51				
PRSS37	136242	broad.mit.edu	37	7	141537006	141537006	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr7:141537006A>C	ENST00000350549.3	-	4	844	c.473T>G	c.(472-474)aTg>aGg	p.M158R	PRSS37_ENST00000438520.1_Missense_Mutation_p.M158R	NM_001008270.2|NM_001171951.1	NP_001008271.2|NP_001165422.1	A4D1T9	PRS37_HUMAN	protease, serine, 37	158	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				binding of sperm to zona pellucida (GO:0007339)|cell migration (GO:0016477)|protein maturation (GO:0051604)	extracellular region (GO:0005576)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(3)	15						TCGATCAGACATCACGGGGGC	0.453																																							uc003vws.1		NA																	0				skin(1)	1						c.(472-474)ATG>AGG		protease, serine, 37 precursor							106.0	108.0	107.0					7																	141537006		2203	4300	6503	SO:0001583	missense	136242				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr7:141537006A>C		CCDS34764.1	7q34	2010-05-07			ENSG00000165076	ENSG00000165076		"""Serine peptidases / Serine peptidases"""	29211	protein-coding gene	gene with protein product							Standard	NM_001008270		Approved		uc003vws.2	A4D1T9	OTTHUMG00000157174	ENST00000350549.3:c.473T>G	7.37:g.141537006A>C	ENSP00000297767:p.Met158Arg					PRSS37_uc011krk.1_Missense_Mutation_p.M145R|PRSS37_uc011krl.1_Missense_Mutation_p.M157R|PRSS37_uc003vwt.1_Missense_Mutation_p.M145R	p.M158R	NM_001008270	NP_001008271	A4D1T9	PRS37_HUMAN			4	845	-			158			Peptidase S1.		B2RPB5	Missense_Mutation	SNP	ENST00000350549.3	37	c.473T>G	CCDS34764.1	.	.	.	.	.	.	.	.	.	.	A	14.97	2.693992	0.48202	.	.	ENSG00000165076	ENST00000350549;ENST00000438520	D;D	0.88509	-2.39;-2.39	5.65	5.65	0.86999	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.083036	0.53938	D	0.000041	D	0.82724	0.5099	L	0.28274	0.84	0.41892	D	0.990375	B;B	0.12630	0.006;0.006	B;B	0.20577	0.03;0.03	T	0.79291	-0.1864	10	0.59425	D	0.04	.	12.1892	0.54261	1.0:0.0:0.0:0.0	.	157;158	B7ZMK3;A4D1T9	.;PRS37_HUMAN	R	158	ENSP00000297767:M158R;ENSP00000414461:M158R	ENSP00000297767:M158R	M	-	2	0	PRSS37	141183475	1.000000	0.71417	0.967000	0.41034	0.747000	0.42532	5.696000	0.68287	2.371000	0.80710	0.533000	0.62120	ATG		0.453	PRSS37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347763.1	NM_001008270		7	70	0	0	0	0.004482	0	7	70				
CSMD1	64478	broad.mit.edu	37	8	2824215	2824215	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr8:2824215C>A	ENST00000520002.1	-	59	9535	c.8980G>T	c.(8980-8982)Gat>Tat	p.D2994Y	CSMD1_ENST00000537824.1_Missense_Mutation_p.D2993Y|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000602557.1_Missense_Mutation_p.D2994Y			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2994	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGAATGCCATCACTACTGACA	0.552																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(8980-8982)GAT>TAT		CUB and Sushi multiple domains 1 precursor							68.0	71.0	70.0					8																	2824215		2080	4214	6294	SO:0001583	missense	64478					integral to membrane		g.chr8:2824215C>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8980G>T	8.37:g.2824215C>A	ENSP00000430733:p.Asp2994Tyr					CSMD1_uc011kwj.1_Missense_Mutation_p.D2323Y|CSMD1_uc010lrg.2_Intron	p.D2994Y	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	58	9370	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2994			Extracellular (Potential).|Sushi 23.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.8980G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.92|16.92	3.254505|3.254505	0.59212|0.59212	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000520002;ENST00000318252;ENST00000537824|ENST00000335551	T;T|.	0.66995|.	-0.24;-0.24|.	5.46|5.46	5.46|5.46	0.80206|0.80206	Complement control module (2);Sushi/SCR/CCP (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.83096|.	0.5180|.	M|M	0.84948|0.84948	2.725|2.725	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.998|.	D|.	0.84417|.	0.0569|.	10|.	0.72032|.	D|.	0.01|.	.|.	19.3169|19.3169	0.94218|0.94218	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2994;2994|.	E5RIG2;Q96PZ7|.	.;CSMD1_HUMAN|.	Y|L	2994;2855;2993|2410	ENSP00000430733:D2994Y;ENSP00000441462:D2993Y|.	ENSP00000320445:D2855Y|.	D|X	-|-	1|2	0|2	CSMD1|CSMD1	2811622|2811622	1.000000|1.000000	0.71417|0.71417	0.096000|0.096000	0.21009|0.21009	0.085000|0.085000	0.17905|0.17905	5.917000|5.917000	0.69989|0.69989	2.557000|2.557000	0.86248|0.86248	0.655000|0.655000	0.94253|0.94253	GAT|TGA		0.552	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		4	20	1	0	0.00198382	0.001984	0.0022519	4	20				
CSMD1	64478	broad.mit.edu	37	8	3216716	3216716	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr8:3216716C>A	ENST00000520002.1	-	22	3820	c.3265G>T	c.(3265-3267)Ggg>Tgg	p.G1089W	CSMD1_ENST00000537824.1_Missense_Mutation_p.G1088W|CSMD1_ENST00000602723.1_Missense_Mutation_p.G1089W|CSMD1_ENST00000539096.1_Missense_Mutation_p.G1088W|CSMD1_ENST00000400186.3_Missense_Mutation_p.G1089W|CSMD1_ENST00000542608.1_Missense_Mutation_p.G1088W|CSMD1_ENST00000602557.1_Missense_Mutation_p.G1089W			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1089	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGGCGGCCCCCACCCAGGCAG	0.557																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(3265-3267)GGG>TGG		CUB and Sushi multiple domains 1 precursor							68.0	73.0	72.0					8																	3216716		2203	4300	6503	SO:0001583	missense	64478					integral to membrane		g.chr8:3216716C>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3265G>T	8.37:g.3216716C>A	ENSP00000430733:p.Gly1089Trp					CSMD1_uc011kwj.1_Missense_Mutation_p.G481W|CSMD1_uc003wqe.2_Missense_Mutation_p.G245W	p.G1089W	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	21	3655	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	1089			Sushi 6.|Extracellular (Potential).		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.3265G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	27.5|27.5	4.837369|4.837369	0.91117|0.91117	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.25579|.	1.79;1.79;1.79;1.79;1.79|.	5.34|5.34	5.34|5.34	0.76211|0.76211	Complement control module (2);Sushi/SCR/CCP (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88239|0.88239	0.6383|0.6383	H|H	0.96175|0.96175	3.78|3.78	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.91890|0.91890	0.5523|0.5523	10|5	0.87932|.	D|.	0|.	.|.	19.067|19.067	0.93116|0.93116	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1089;1089;1089|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	W|L	1089;1089;951;1088;1088;1088|568	ENSP00000383047:G1089W;ENSP00000430733:G1089W;ENSP00000441462:G1088W;ENSP00000446243:G1088W;ENSP00000441675:G1088W|.	ENSP00000320445:G951W|.	G|W	-|-	1|2	0|0	CSMD1|CSMD1	3204123|3204123	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	7.612000|7.612000	0.82975|0.82975	2.489000|2.489000	0.83994|0.83994	0.550000|0.550000	0.68814|0.68814	GGG|TGG		0.557	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		12	113	1	0	0.00316338	0.003163	0.00356676	12	113				
ZFHX4	79776	broad.mit.edu	37	8	77767139	77767139	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr8:77767139G>A	ENST00000521891.2	+	10	8430	c.7982G>A	c.(7981-7983)aGg>aAg	p.R2661K	ZFHX4_ENST00000455469.2_Missense_Mutation_p.R2616K|ZFHX4_ENST00000050961.6_Missense_Mutation_p.R2616K|ZFHX4_ENST00000518282.1_Missense_Mutation_p.R2635K	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2616					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCGCGGGAGAGGAAAGGCCAG	0.522										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(7846-7848)AGG>AAG		zinc finger homeodomain 4							57.0	59.0	58.0					8																	77767139		1906	4138	6044	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77767139G>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7982G>A	8.37:g.77767139G>A	ENSP00000430497:p.Arg2661Lys	HNSCC(33;0.089)				ZFHX4_uc003yau.1_Missense_Mutation_p.R2661K|ZFHX4_uc003yaw.1_Missense_Mutation_p.R2616K	p.R2616K	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	8234	+			2616			Homeobox 3.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.7847G>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	18.28	3.589273	0.66105	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5	5.12	5.12	0.69794	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.45361	U	0.000379	D	0.94755	0.8307	N	0.25380	0.74	0.58432	D	0.999994	P;P;P	0.46064	0.872;0.845;0.86	P;P;P	0.61003	0.831;0.876;0.882	D	0.94589	0.7786	10	0.45353	T	0.12	.	18.7313	0.91736	0.0:0.0:1.0:0.0	.	2616;2616;2661	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	K	2661;2645;2616;2616;2635	ENSP00000430497:R2661K;ENSP00000399605:R2616K;ENSP00000050961:R2616K;ENSP00000430848:R2635K	ENSP00000050961:R2616K	R	+	2	0	ZFHX4	77929694	1.000000	0.71417	0.968000	0.41197	0.819000	0.46315	9.657000	0.98554	2.659000	0.90383	0.555000	0.69702	AGG		0.522	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		19	89	0	0	0	0.006122	0	19	89				
ZFHX4	79776	broad.mit.edu	37	8	77768513	77768513	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr8:77768513C>A	ENST00000521891.2	+	10	9804	c.9356C>A	c.(9355-9357)cCg>cAg	p.P3119Q	ZFHX4_ENST00000455469.2_Missense_Mutation_p.P3074Q|ZFHX4_ENST00000050961.6_Missense_Mutation_p.P3074Q|ZFHX4_ENST00000518282.1_Missense_Mutation_p.P3093Q	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3074	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.P3103L(2)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCCTCCTTGCCGGGATTTCCA	0.512										HNSCC(33;0.089)																													uc003yav.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(9220-9222)CCG>CAG		zinc finger homeodomain 4							31.0	32.0	32.0					8																	77768513		1893	4118	6011	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77768513C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9356C>A	8.37:g.77768513C>A	ENSP00000430497:p.Pro3119Gln	HNSCC(33;0.089)				ZFHX4_uc003yau.1_Missense_Mutation_p.P3119Q|ZFHX4_uc003yaw.1_Missense_Mutation_p.P3074Q	p.P3074Q	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	9608	+			3074			Pro-rich.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.9221C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	16.81	3.226232	0.58668	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.52526	0.69;0.74;0.66;0.71	5.45	5.45	0.79879	.	0.000000	0.44285	U	0.000474	T	0.67277	0.2876	M	0.63843	1.955	0.58432	D	0.999998	D;D;D	0.76494	0.998;0.997;0.999	P;D;D	0.73380	0.835;0.961;0.98	T	0.64542	-0.6383	10	0.45353	T	0.12	.	19.4736	0.94973	0.0:1.0:0.0:0.0	.	3074;3074;3119	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	Q	3119;3103;3074;3074;3093	ENSP00000430497:P3119Q;ENSP00000399605:P3074Q;ENSP00000050961:P3074Q;ENSP00000430848:P3093Q	ENSP00000050961:P3074Q	P	+	2	0	ZFHX4	77931068	1.000000	0.71417	0.972000	0.41901	0.985000	0.73830	7.651000	0.83577	2.836000	0.97738	0.655000	0.94253	CCG		0.512	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		12	41	1	0	0.00010058	0.001368	0.000123339	12	41				
RIMS2	9699	broad.mit.edu	37	8	105261795	105261795	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr8:105261795C>T	ENST00000436393.2	+	26	3965	c.3724C>T	c.(3724-3726)Cca>Tca	p.P1242S	RIMS2_ENST00000406091.3_Missense_Mutation_p.P1224S|RIMS2_ENST00000339750.2_Missense_Mutation_p.P160S|RIMS2_ENST00000507740.1_Missense_Mutation_p.P1038S|RIMS2_ENST00000262231.10_Missense_Mutation_p.P1063S			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1286					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TGTTGTAAAACCAGGTTCCAA	0.403										HNSCC(12;0.0054)																													uc003yls.2		NA																	0				ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(3724-3726)CCA>TCA		regulating synaptic membrane exocytosis 2							68.0	69.0	68.0					8																	105261795		1828	4080	5908	SO:0001583	missense	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:105261795C>T	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3724C>T	8.37:g.105261795C>T	ENSP00000390665:p.Pro1242Ser	HNSCC(12;0.0054)				RIMS2_uc003ylp.2_Missense_Mutation_p.P1224S|RIMS2_uc003ylw.2_Missense_Mutation_p.P1231S|RIMS2_uc003ylq.2_Missense_Mutation_p.P1038S|RIMS2_uc003ylr.2_Missense_Mutation_p.P1063S	p.P1242S	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		26	3965	+			1286			C2 2.		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37	c.3724C>T		.	.	.	.	.	.	.	.	.	.	C	29.4	5.004061	0.93287	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;1.08;-0.93;-0.93;-0.93	5.46	5.46	0.80206	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	D	0.84329	0.5448	M	0.63843	1.955	0.80722	D	1	D;P;P;D;D	0.76494	0.962;0.838;0.915;0.999;0.999	P;B;P;D;D	0.74348	0.886;0.253;0.818;0.983;0.983	T	0.81335	-0.0979	9	0.29301	T	0.29	.	19.3153	0.94211	0.0:1.0:0.0:0.0	.	1286;1242;1063;1038;1224	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	S	1261;1224;1286;1063;1038;1231;1242;160;160	ENSP00000384892:P1224S;ENSP00000262231:P1063S;ENSP00000423559:P1038S;ENSP00000386228:P1231S;ENSP00000390665:P1242S;ENSP00000428478:P160S;ENSP00000342051:P160S	ENSP00000262231:P1063S	P	+	1	0	RIMS2	105330971	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.583000	0.87209	0.555000	0.69702	CCA		0.403	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		4	43	0	0	0	0.000248	0	4	43				
MAL2	114569	broad.mit.edu	37	8	120252494	120252494	+	Silent	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr8:120252494C>T	ENST00000276681.6	+	4	495	c.393C>T	c.(391-393)tgC>tgT	p.C131C	MAL2_ENST00000521748.1_3'UTR|RP11-4K16.2_ENST00000522828.1_lincRNA	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	131	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			ATTTGCATTGCAATACAACCA	0.403																																							uc003yop.2		NA																	0					0						c.(391-393)TGC>TGT		MAL2 proteolipid protein							72.0	71.0	71.0					8																	120252494		1904	4117	6021	SO:0001819	synonymous_variant	114569					apical plasma membrane|endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding	g.chr8:120252494C>T	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.393C>T	8.37:g.120252494C>T							p.C131C	NM_052886	NP_443118	Q969L2	MAL2_HUMAN	STAD - Stomach adenocarcinoma(47;0.000967)		4	495	+	all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		131			Lumenal (Potential).|MARVEL.		B2R520|Q6ZMD9	Silent	SNP	ENST00000276681.6	37	c.393C>T																																																																																					0.403	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886		7	51	0	0	0	0.00308	0	7	51				
ENPP2	5168	broad.mit.edu	37	8	120594688	120594688	+	Silent	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr8:120594688G>T	ENST00000075322.6	-	18	1756	c.1698C>A	c.(1696-1698)ggC>ggA	p.G566G	ENPP2_ENST00000259486.6_Silent_p.G618G|ENPP2_ENST00000522167.1_Silent_p.G205G|ENPP2_ENST00000522826.1_Silent_p.G566G|ENPP2_ENST00000427067.2_Silent_p.G562G	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	566					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CACAAGTGCAGCCCAGGTCAA	0.438																																					Melanoma(20;305 879 2501 4818 31020)	Melanoma(20;305 879 2501 4818 31020)	uc003yot.1		NA																	0				ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7						c.(1696-1698)GGC>GGA		autotaxin isoform 2 preproprotein							139.0	126.0	130.0					8																	120594688		2203	4300	6503	SO:0001819	synonymous_variant	5168				cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding	g.chr8:120594688G>T	D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.1698C>A	8.37:g.120594688G>T						ENPP2_uc011lic.1_Silent_p.G83G|ENPP2_uc003yor.1_Silent_p.G205G|ENPP2_uc003yos.1_Silent_p.G618G|ENPP2_uc010mdd.1_Silent_p.G566G	p.G566G	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00185)		18	1784	-	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		566					A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Silent	SNP	ENST00000075322.6	37	c.1698C>A	CCDS34936.1																																																																																				0.438	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1			18	99	1	0	1.02788e-11	0.00499	1.51478e-11	18	99				
TONSL	4796	broad.mit.edu	37	8	145661703	145661703	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr8:145661703T>C	ENST00000409379.3	-	17	2142	c.2113A>G	c.(2113-2115)Agc>Ggc	p.S705G	AC084125.4_ENST00000442850.1_RNA|AC084125.4_ENST00000544423.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	705					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						AGTCTAGTGCTATTAGAGGGG	0.652																																							uc011llg.1		NA																	0					0						c.(2113-2115)AGC>GGC		NF-kappa-B inhibitor-like protein 2							32.0	42.0	39.0					8																	145661703		2187	4268	6455	SO:0001583	missense	4796				cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity	g.chr8:145661703T>C		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.2113A>G	8.37:g.145661703T>C	ENSP00000386239:p.Ser705Gly					uc011llh.1_Intron	p.S705G	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)		17	2128	-	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		705					B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	37	c.2113A>G	CCDS34968.2	.	.	.	.	.	.	.	.	.	.	T	6.390	0.440003	0.12104	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.46451	0.87	2.98	-1.87	0.07737	.	0.593258	0.14607	U	0.309261	T	0.16769	0.0403	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.10870	-1.0611	10	0.34782	T	0.22	-1.3061	3.4544	0.07510	0.0:0.3873:0.2632:0.3495	.	705	Q96HA7	TONSL_HUMAN	G	705;704	ENSP00000386239:S705G	ENSP00000386239:S705G	S	-	1	0	TONSL	145632511	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	-0.322000	0.08007	-0.159000	0.11021	0.379000	0.24179	AGC		0.652	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432		6	90	0	0	0	0.001984	0	6	90				
TMEM215	401498	broad.mit.edu	37	9	32784340	32784340	+	Silent	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr9:32784340C>T	ENST00000342743.5	+	2	524	c.159C>T	c.(157-159)ggC>ggT	p.G53G		NM_212558.2	NP_997723.2	Q68D42	TM215_HUMAN	transmembrane protein 215	53						integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)	12						GCCTACCAGGCATCGCAGCCA	0.587																																							uc003zri.3		NA																	0					0						c.(157-159)GGC>GGT		transmembrane protein 215							72.0	65.0	67.0					9																	32784340		2203	4300	6503	SO:0001819	synonymous_variant	401498					integral to membrane		g.chr9:32784340C>T		CCDS6530.1	9p21.1	2008-08-08			ENSG00000188133	ENSG00000188133			33816	protein-coding gene	gene with protein product							Standard	NM_212558		Approved		uc003zri.4	Q68D42	OTTHUMG00000129521	ENST00000342743.5:c.159C>T	9.37:g.32784340C>T							p.G53G	NM_212558	NP_997723	Q68D42	TM215_HUMAN			2	524	+			53			Helical; (Potential).		Q6ZUU2	Silent	SNP	ENST00000342743.5	37	c.159C>T	CCDS6530.1																																																																																				0.587	TMEM215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251701.1	NM_212558		10	50	0	0	0	0.006214	0	10	50				
KIAA1161	57462	broad.mit.edu	37	9	34371852	34371852	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr9:34371852C>T	ENST00000297625.7	-	2	1213	c.988G>A	c.(988-990)Gac>Aac	p.D330N		NM_020702.3	NP_065753.2	Q6NSJ0	K1161_HUMAN	KIAA1161	364					carbohydrate metabolic process (GO:0005975)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|skeletal muscle fiber development (GO:0048741)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		TCATCGAAGTCGAAGTCGCCA	0.582																																							uc003zue.3		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1090-1092)GAC>AAC		hypothetical protein LOC57462							116.0	120.0	119.0					9																	34371852		2196	4278	6474	SO:0001583	missense	57462				carbohydrate metabolic process	integral to membrane	hydrolase activity, hydrolyzing O-glycosyl compounds	g.chr9:34371852C>T	AB032987		9p11.2	2009-11-06			ENSG00000164976	ENSG00000164976			19918	protein-coding gene	gene with protein product						10574461	Standard	XM_006716808		Approved	NET37	uc003zue.4	Q6NSJ0	OTTHUMG00000019816	ENST00000297625.7:c.988G>A	9.37:g.34371852C>T	ENSP00000297625:p.Asp330Asn						p.D364N	NM_020702	NP_065753	Q6NSJ0	K1161_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)	3	1257	-			364			Extracellular (Potential).		Q5T587|Q5T588|Q9ULQ9	Missense_Mutation	SNP	ENST00000297625.7	37	c.1090G>A		.	.	.	.	.	.	.	.	.	.	C	11.69	1.713496	0.30413	.	.	ENSG00000164976	ENST00000297625	D	0.91124	-2.79	5.76	2.5	0.30297	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.253964	0.44483	N	0.000456	D	0.87728	0.6250	M	0.76002	2.32	0.35756	D	0.819829	B	0.17852	0.024	B	0.16289	0.015	D	0.86084	0.1546	10	0.38643	T	0.18	-18.4668	7.9525	0.30023	0.1358:0.702:0.0:0.1622	.	364	Q6NSJ0	K1161_HUMAN	N	330	ENSP00000297625:D330N	ENSP00000297625:D330N	D	-	1	0	KIAA1161	34361852	0.995000	0.38212	1.000000	0.80357	0.637000	0.38172	1.253000	0.32886	1.410000	0.46936	0.561000	0.74099	GAC		0.582	KIAA1161-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000052158.1	XM_351807		6	62	0	0	0	0.001168	0	6	62				
ASTN2	23245	broad.mit.edu	37	9	119202889	119202889	+	Splice_Site	SNP	T	T	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr9:119202889T>A	ENST00000313400.4	-	22	3881	c.3781A>T	c.(3781-3783)Agg>Tgg	p.R1261W	ASTN2_ENST00000361477.3_Splice_Site_p.R313W|ASTN2_ENST00000373996.3_Splice_Site_p.R1257W|ASTN2_ENST00000288520.5_Splice_Site_p.R362W|ASTN2_ENST00000361209.2_Splice_Site_p.R1210W|ASTN2_ENST00000341734.4_Splice_Site_p.R313W			O75129	ASTN2_HUMAN	astrotactin 2	1261					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CGCCCATACCTGGGCCCCAGC	0.507																																							uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(3781-3783)AGG>TGG		astrotactin 2 isoform c							78.0	70.0	73.0					9																	119202889		2203	4300	6503	SO:0001630	splice_region_variant	23245					integral to membrane		g.chr9:119202889T>A	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3782+1A>T	9.37:g.119202889T>A						ASTN2_uc004bjr.1_Missense_Mutation_p.R1257W|ASTN2_uc004bjt.1_Missense_Mutation_p.R1210W|ASTN2_uc004bjp.1_Missense_Mutation_p.R354W|ASTN2_uc004bjq.1_Missense_Mutation_p.R313W|ASTN2_uc011lxr.1_Missense_Mutation_p.R313W|ASTN2_uc011lxs.1_Missense_Mutation_p.R313W|ASTN2_uc011lxt.1_Missense_Mutation_p.R313W|ASTN2_uc004bjo.1_Missense_Mutation_p.R42W	p.R1261W	NM_198187	NP_937830	O75129	ASTN2_HUMAN			22	3882	-			1261			Extracellular (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.3781A>T		.	.	.	.	.	.	.	.	.	.	T	17.36	3.370131	0.61624	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000288520;ENST00000341734;ENST00000373986;ENST00000361209;ENST00000361477	T;T;T;T;T;T;T	0.20200	2.52;2.51;2.09;2.12;2.33;2.55;2.12	5.9	5.9	0.94986	.	0.047099	0.85682	D	0.000000	T	0.34948	0.0915	L	0.34521	1.04	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	0.999;0.999;1.0;0.99;1.0;0.998;0.999	D;D;D;P;D;D;D	0.85130	0.993;0.975;0.997;0.841;0.997;0.949;0.993	T	0.09975	-1.0650	10	0.87932	D	0	-25.9536	12.2135	0.54394	0.0:0.0:0.142:0.858	.	313;313;1210;1261;1257;313;362	B7ZKP4;B7ZKP5;O75129-2;O75129;O75129-3;O75129-6;O75129-4	.;.;.;ASTN2_HUMAN;.;.;.	W	1261;1257;362;313;984;1210;313	ENSP00000314038:R1261W;ENSP00000363108:R1257W;ENSP00000288520:R362W;ENSP00000339925:R313W;ENSP00000363098:R984W;ENSP00000354504:R1210W;ENSP00000355116:R313W	ENSP00000288520:R362W	R	-	1	2	ASTN2	118242710	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	4.900000	0.63252	2.251000	0.74343	0.528000	0.53228	AGG		0.507	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	Missense_Mutation	5	45	0	0	0	0.000602	0	5	45				
TOR1A	1861	broad.mit.edu	37	9	132584947	132584947	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr9:132584947A>C	ENST00000351698.4	-	2	405	c.357T>G	c.(355-357)atT>atG	p.I119M	TOR1A_ENST00000473084.1_5'UTR	NM_000113.2	NP_000104.1	O14656	TOR1A_HUMAN	torsin family 1, member A (torsin A)	119	Interaction with SNAPIN.				ATP catabolic process (GO:0006200)|cell adhesion (GO:0007155)|chaperone mediated protein folding requiring cofactor (GO:0051085)|chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|ER-associated misfolded protein catabolic process (GO:0071712)|intermediate filament cytoskeleton organization (GO:0045104)|neuron projection development (GO:0031175)|nuclear envelope organization (GO:0006998)|nuclear membrane organization (GO:0071763)|organelle organization (GO:0006996)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|protein deneddylation (GO:0000338)|protein homooligomerization (GO:0051260)|protein localization to nucleus (GO:0034504)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of protein localization to cell surface (GO:2000008)|response to oxidative stress (GO:0006979)|synaptic vesicle transport (GO:0048489)|wound healing, spreading of cells (GO:0044319)	cell junction (GO:0030054)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cytoskeletal protein binding (GO:0008092)|kinesin binding (GO:0019894)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20		Ovarian(14;0.00556)				CACCCTCGTAAATATTCTCTG	0.488																																							uc004byl.2		NA																	0				central_nervous_system(1)	1						c.(355-357)ATT>ATG		torsin A precursor							215.0	180.0	192.0					9																	132584947		2203	4300	6503	SO:0001583	missense	1861				chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding	g.chr9:132584947A>C	AF007871	CCDS6930.1	9q32-q34	2008-07-21	2004-11-24	2004-11-26	ENSG00000136827	ENSG00000136827			3098	protein-coding gene	gene with protein product		605204	"""dystonia 1, torsion (autosomal dominant; torsin A)"""	DYT1		10644435	Standard	NM_000113		Approved	DQ2	uc004byl.3	O14656	OTTHUMG00000020794	ENST00000351698.4:c.357T>G	9.37:g.132584947A>C	ENSP00000345719:p.Ile119Met					TOR1A_uc004bym.2_RNA|TOR1A_uc004byn.2_Missense_Mutation_p.I119M	p.I119M	NM_000113	NP_000104	O14656	TOR1A_HUMAN			2	434	-		Ovarian(14;0.00556)	119					B2RB58|Q53Y64|Q96CA0	Missense_Mutation	SNP	ENST00000351698.4	37	c.357T>G	CCDS6930.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.697506	0.30142	.	.	ENSG00000136827	ENST00000351698	T	0.40225	1.04	4.94	-0.0321	0.13906	.	0.097521	0.64402	D	0.000001	T	0.47060	0.1425	L	0.37507	1.11	0.52501	D	0.999957	D;D	0.76494	0.999;0.98	D;D	0.70016	0.967;0.914	T	0.23048	-1.0199	10	0.41790	T	0.15	-13.0186	9.7422	0.40424	0.6174:0.0:0.3826:0.0	.	119;119	O14656-2;O14656	.;TOR1A_HUMAN	M	119	ENSP00000345719:I119M	ENSP00000345719:I119M	I	-	3	3	TOR1A	131624768	1.000000	0.71417	0.066000	0.19879	0.003000	0.03518	1.185000	0.32065	-0.258000	0.09446	0.459000	0.35465	ATT		0.488	TOR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054611.1	NM_000113		10	128	0	0	0	0.000978	0	10	128				
NUP214	8021	broad.mit.edu	37	9	134034776	134034776	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr9:134034776C>T	ENST00000359428.5	+	18	2587	c.2443C>T	c.(2443-2445)Cgg>Tgg	p.R815W	RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000586290.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.R816W|RP11-544A12.4_ENST00000589128.1_RNA|RP11-544A12.4_ENST00000417798.2_RNA|RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000587264.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.R805W|RP11-544A12.4_ENST00000587408.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	815	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		ATAGGAAATTCGGCGCCTTCA	0.343			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)	Pancreas(4;24 48 25510 30394 32571)	uc004cag.2		NA		Dom	yes		9	9q34.1	8021	T	nucleoporin 214kDa (CAN)			L	DEK|SET|ABL1		AML|T-ALL		0				breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16						c.(2443-2445)CGG>TGG		nucleoporin 214kDa							61.0	57.0	58.0					9																	134034776		2203	4300	6503	SO:0001583	missense	8021				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding	g.chr9:134034776C>T	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.2443C>T	9.37:g.134034776C>T	ENSP00000352400:p.Arg815Trp					NUP214_uc004cah.2_Missense_Mutation_p.R805W|NUP214_uc004cai.2_Missense_Mutation_p.R245W|NUP214_uc004caf.1_Missense_Mutation_p.R804W|NUP214_uc010mzf.2_Missense_Mutation_p.R113W	p.R815W	NM_005085	NP_005076	P35658	NU214_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)	18	2554	+	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)	815			11 X 5 AA approximate repeats.		A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	c.2443C>T	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515950	0.85495	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605	T;T;T	0.46451	0.98;0.87;0.88	5.9	4.04	0.47022	.	0.000000	0.38959	N	0.001516	T	0.44705	0.1306	N	0.08118	0	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.995;1.0;0.995;1.0	T	0.55379	-0.8150	10	0.87932	D	0	-20.2518	14.6516	0.68800	0.265:0.735:0.0:0.0	.	804;409;805;815	P35658-2;Q5JUP9;P35658-4;P35658	.;.;.;NU214_HUMAN	W	815;805;816;804;409;244	ENSP00000352400:R815W;ENSP00000396576:R805W;ENSP00000405014:R816W	ENSP00000352400:R815W	R	+	1	2	NUP214	133024597	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.912000	0.48782	0.812000	0.34326	-0.182000	0.12963	CGG		0.343	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085		6	25	0	0	0	0.001984	0	6	25				
CACNA1B	774	broad.mit.edu	37	9	140968458	140968458	+	Silent	SNP	G	G	T			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr9:140968458G>T	ENST00000371372.1	+	34	4942	c.4797G>T	c.(4795-4797)ctG>ctT	p.L1599L	CACNA1B_ENST00000371357.1_Silent_p.L1598L|CACNA1B_ENST00000277549.5_Silent_p.L793L|CACNA1B_ENST00000277551.2_Silent_p.L1599L|CACNA1B_ENST00000371363.1_Silent_p.L1597L|CACNA1B_ENST00000371355.4_Silent_p.L1600L|CACNA1B_ENST00000371365.2_5'Flank	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1599					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CGCAGGCCCTGCCCTACGTGT	0.642																																							uc004cog.2		NA																	0				breast(3)|large_intestine(2)|ovary(1)	6						c.(4795-4797)CTG>CTT		calcium channel, voltage-dependent, N type,	Amlodipine(DB00381)|Gabapentin(DB00996)						96.0	104.0	101.0					9																	140968458		2186	4293	6479	SO:0001819	synonymous_variant	774				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity	g.chr9:140968458G>T	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4797G>T	9.37:g.140968458G>T						CACNA1B_uc004coi.2_Silent_p.L811L|CACNA1B_uc004cok.1_5'Flank|CACNA1B_uc010ncp.1_5'Flank	p.L1599L	NM_000718	NP_000709	Q00975	CAC1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	33	4942	+	all_cancers(76;0.166)		1599			Cytoplasmic (Potential).|IV.		B1AQK5	Silent	SNP	ENST00000371372.1	37	c.4797G>T	CCDS59522.1																																																																																				0.642	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718		29	114	1	0	8.16721e-17	0.002096	1.27045e-16	29	114				
FAM47C	442444	broad.mit.edu	37	X	37027425	37027425	+	Silent	SNP	C	C	G			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chrX:37027425C>G	ENST00000358047.3	+	1	994	c.942C>G	c.(940-942)cgC>cgG	p.R314R		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	314										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CCAAGTCACGCGTATCTCATC	0.607																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(940-942)CGC>CGG		hypothetical protein LOC442444							91.0	79.0	83.0					X																	37027425		2202	4300	6502	SO:0001819	synonymous_variant	442444							g.chrX:37027425C>G	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.942C>G	X.37:g.37027425C>G							p.R314R	NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN			1	956	+			314					Q6ZU46	Silent	SNP	ENST00000358047.3	37	c.942C>G	CCDS35227.1																																																																																				0.607	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		20	37	0	0	0	0.008871	0	20	37				
ZIC3	7547	broad.mit.edu	37	X	136649338	136649338	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chrX:136649338C>A	ENST00000287538.5	+	1	1038	c.488C>A	c.(487-489)cCc>cAc	p.P163H	ZIC3_ENST00000370606.3_Missense_Mutation_p.P163H|RP1-137H15.2_ENST00000442841.1_RNA	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	163					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					TTGCTGTTTCCCGGGCTGCAT	0.711																																							uc004fak.2		NA																	0				ovary(2)|breast(1)	3						c.(487-489)CCC>CAC		zinc finger protein of the cerebellum 3							21.0	24.0	23.0					X																	136649338		2161	4203	6364	SO:0001583	missense	7547				cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:136649338C>A	AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.488C>A	X.37:g.136649338C>A	ENSP00000287538:p.Pro163His						p.P163H	NM_003413	NP_003404	O60481	ZIC3_HUMAN			1	993	+	Acute lymphoblastic leukemia(192;0.000127)		163					B2CNW4|Q14DE5|Q5JY75	Missense_Mutation	SNP	ENST00000287538.5	37	c.488C>A	CCDS14663.1	.	.	.	.	.	.	.	.	.	.	c	18.46	3.629019	0.67015	.	.	ENSG00000156925	ENST00000287538;ENST00000370606	T;T	0.48522	0.81;0.81	4.47	4.47	0.54385	.	0.057270	0.64402	D	0.000001	T	0.68091	0.2963	M	0.73430	2.235	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	T	0.73332	-0.4016	10	0.87932	D	0	.	14.8577	0.70351	0.0:1.0:0.0:0.0	.	163	O60481	ZIC3_HUMAN	H	163	ENSP00000287538:P163H;ENSP00000359638:P163H	ENSP00000287538:P163H	P	+	2	0	ZIC3	136477004	1.000000	0.71417	0.852000	0.33557	0.856000	0.48823	7.298000	0.78815	2.059000	0.61396	0.597000	0.82753	CCC		0.711	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1			13	31	1	0	0.000308642	0.003163	0.000367744	13	31				
AFF2	2334	broad.mit.edu	37	X	148037518	148037518	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chrX:148037518C>A	ENST00000370460.2	+	11	2422	c.1943C>A	c.(1942-1944)cCa>cAa	p.P648Q	AFF2_ENST00000370457.5_Missense_Mutation_p.P615Q|AFF2_ENST00000342251.3_Missense_Mutation_p.P615Q|AFF2_ENST00000286437.5_Missense_Mutation_p.P289Q	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	648					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TGGCCCAAACCAAATATTACC	0.478																																							uc004fcp.2		NA																	0				ovary(3)|pancreas(2)	5						c.(1942-1944)CCA>CAA		fragile X mental retardation 2							102.0	109.0	106.0					X																	148037518		2203	4300	6503	SO:0001583	missense	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:148037518C>A	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1943C>A	X.37:g.148037518C>A	ENSP00000359489:p.Pro648Gln					AFF2_uc004fcq.2_Missense_Mutation_p.P638Q|AFF2_uc004fcr.2_Missense_Mutation_p.P609Q|AFF2_uc011mxb.1_Missense_Mutation_p.P613Q|AFF2_uc004fcs.2_Missense_Mutation_p.P615Q|AFF2_uc011mxc.1_Missense_Mutation_p.P289Q	p.P648Q	NM_002025	NP_002016	P51816	AFF2_HUMAN			11	2422	+	Acute lymphoblastic leukemia(192;6.56e-05)		648					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	c.1943C>A	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.926944	0.73327	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.5	5.5	0.81552	.	0.187494	0.45126	D	0.000399	T	0.78464	0.4287	M	0.71581	2.175	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;0.999;1.0	T	0.76072	-0.3093	10	0.30854	T	0.27	.	18.4401	0.90664	0.0:1.0:0.0:0.0	.	289;613;615;609;638;648	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	Q	648;615;615;289	ENSP00000359489:P648Q;ENSP00000359486:P615Q;ENSP00000345459:P615Q;ENSP00000286437:P289Q	ENSP00000286437:P289Q	P	+	2	0	AFF2	147845218	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	4.456000	0.60081	2.295000	0.77249	0.556000	0.70494	CCA		0.478	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		48	48	1	0	6.08268e-21	0.00361	9.55038e-21	48	48				
F8	2157	broad.mit.edu	37	X	154159066	154159066	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chrX:154159066G>A	ENST00000360256.4	-	14	3199	c.2999C>T	c.(2998-3000)cCt>cTt	p.P1000L		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1000	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CAACAAAGCAGGTCCATGAGC	0.343																																							uc004fmt.2		NA																	0				ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(2998-3000)CCT>CTT		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						78.0	75.0	76.0					X																	154159066		2203	4299	6502	SO:0001583	missense	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154159066G>A	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.2999C>T	X.37:g.154159066G>A	ENSP00000353393:p.Pro1000Leu						p.P1000L	NM_000132	NP_000123	P00451	FA8_HUMAN			14	3170	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		1000			B.		Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	c.2999C>T	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	G	0.735	-0.778593	0.02929	.	.	ENSG00000185010	ENST00000360256	D	0.99023	-5.34	5.03	3.2	0.36748	.	1.017430	0.07830	N	0.961157	D	0.96796	0.8954	L	0.47716	1.5	0.09310	N	1	B	0.30406	0.278	B	0.21546	0.035	D	0.92630	0.6115	10	0.36615	T	0.2	0.0146	5.5571	0.17123	0.106:0.0:0.6982:0.1959	.	1000	P00451	FA8_HUMAN	L	1000	ENSP00000353393:P1000L	ENSP00000353393:P1000L	P	-	2	0	F8	153812260	0.001000	0.12720	0.000000	0.03702	0.061000	0.15899	0.452000	0.21795	0.431000	0.26258	0.556000	0.70494	CCT		0.343	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			16	47	0	0	0	0.00499	0	16	47				
FLT3	2322	broad.mit.edu	37	13	28589835	28589835	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr13:28589835delG	ENST00000241453.7	-	21	2626	c.2545delC	c.(2545-2547)cgtfs	p.R849fs	FLT3_ENST00000537084.1_Frame_Shift_Del_p.R808fs|FLT3_ENST00000469894.1_5'Flank|FLT3_ENST00000380982.4_Frame_Shift_Del_p.R852fs	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	849	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACAGGCAGACGGGCCTGTGGA	0.413			"""Mis, O"""		"""AML, ALL"""																																		uc001urw.2		NA		Dom	yes		13	13q12	2322	Mis|O	fms-related tyrosine kinase 3			L			AML|ALL		0				haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549						c.(2545-2547)CGTfs		fms-related tyrosine kinase 3 precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						58.0	60.0	60.0					13																	28589835		2203	4300	6503	SO:0001589	frameshift_variant	2322				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity	g.chr13:28589835delG	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.2545delC	13.37:g.28589835delG	ENSP00000241453:p.Arg849fs					FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Frame_Shift_Del_p.R808fs	p.R849fs	NM_004119	NP_004110	P36888	FLT3_HUMAN	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	21	2627	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	849			Protein kinase.|Cytoplasmic (Potential).		A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Frame_Shift_Del	DEL	ENST00000241453.7	37	c.2545delC	CCDS31953.1																																																																																				0.413	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2			13	61	NA	NA	NA	NA	NA	13	61	---	---	---	---
EIF2AK4	440275	broad.mit.edu	37	15	40268969	40268969	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr15:40268969delG	ENST00000263791.5	+	12	2216	c.2173delG	c.(2173-2175)gccfs	p.A725fs	EIF2AK4_ENST00000382727.2_Frame_Shift_Del_p.A725fs	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	725	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		CCGTTTCCCCGCCACCGGCCC	0.711																																							uc001zkm.1		NA																	0				lung(2)|stomach(1)|skin(1)	4						c.(2173-2175)GCCfs		eukaryotic translation initiation factor 2 alpha							37.0	41.0	40.0					15																	40268969		1752	3840	5592	SO:0001589	frameshift_variant	440275				translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity	g.chr15:40268969delG	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.2173delG	15.37:g.40268969delG	ENSP00000263791:p.Ala725fs					EIF2AK4_uc010bbj.1_Frame_Shift_Del_p.A454fs	p.A725fs	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)	12	2223	+		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)	725			Protein kinase 2.		C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Frame_Shift_Del	DEL	ENST00000263791.5	37	c.2173delG	CCDS42016.1																																																																																				0.711	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1			10	89	NA	NA	NA	NA	NA	10	89	---	---	---	---
SCIMP	388325	broad.mit.edu	37	17	5124612	5124612	+	Frame_Shift_Del	DEL	T	T	-			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr17:5124612delT	ENST00000574081.1	-	3	283	c.179delA	c.(178-180)cacfs	p.H60fs	RP11-333E1.1_ENST00000575601.1_RNA|RP11-333E1.1_ENST00000573772.1_RNA|SCIMP_ENST00000399600.4_Frame_Shift_Del_p.H53fs|RP11-333E1.1_ENST00000571689.1_RNA|SCIMP_ENST00000574297.1_Frame_Shift_Del_p.H60fs|SCIMP_ENST00000571800.1_Frame_Shift_Del_p.H53fs	NM_001271842.1|NM_207103.3	NP_001258771.1|NP_996986.1	Q6UWF3	SCIMP_HUMAN	SLP adaptor and CSK interacting membrane protein	60	Pro-rich.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)	immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|tetraspanin-enriched microdomain (GO:0097197)|uropod membrane (GO:0031259)											TACTTGCTTGTGTTTCAGGGG	0.423																																							uc002gbh.2		NA																	0				ovary(1)	1						c.(178-180)CACfs		hypothetical protein LOC388325							213.0	199.0	203.0					17																	5124612		1862	4097	5959	SO:0001589	frameshift_variant	388325					integral to membrane		g.chr17:5124612delT	AY358809	CCDS42242.1, CCDS62044.1	17p13.2	2011-11-24	2011-11-23	2011-11-23	ENSG00000161929	ENSG00000161929			33504	protein-coding gene	gene with protein product	"""SLP65/SLP76, Csk-interacting membrane protein"""	614406	"""chromosome 17 open reading frame 87"""	C17orf87		21930792	Standard	NM_207103		Approved	DTFT5783, UNQ5783, FLJ32580, MGC163426, MGC163428	uc002gbh.3	Q6UWF3	OTTHUMG00000132914	ENST00000574081.1:c.179delA	17.37:g.5124612delT	ENSP00000461269:p.His60fs					uc002gbf.1_Intron|uc002gbg.1_Intron|C17orf87_uc010clb.1_Frame_Shift_Del_p.H53fs|C17orf87_uc002gbi.2_Frame_Shift_Del_p.H53fs	p.H60fs	NM_207103	NP_996986	Q6UWF3	CQ087_HUMAN			3	212	-			60					A6XGL4|B4DLK1|Q96MD0	Frame_Shift_Del	DEL	ENST00000574081.1	37	c.179delA	CCDS42242.1																																																																																				0.423	SCIMP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256425.2	NM_207103		8	95	NA	NA	NA	NA	NA	8	95	---	---	---	---
STK11	6794	broad.mit.edu	37	19	1207136	1207137	+	Frame_Shift_Ins	INS	-	-	CTCCT			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr19:1207136_1207137insCTCCT	ENST00000326873.7	+	1	1397_1398	c.224_225insCTCCT	c.(223-228)agggccfs	p.RA75fs	STK11_ENST00000585748.1_Intron	NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	75	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Sufficient for interaction with SIRT1.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(3)|p.R75M(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGTGCAGGAGGGCCGTCAAGA	0.619		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		24	Whole gene deletion(20)|Unknown(2)|Substitution - Missense(1)|Deletion - Frameshift(1)	p.0?(19)|p.?(3)|p.G52_P179del(1)	cervix(15)|lung(3)|haematopoietic_and_lymphoid_tissue(1)|skin(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(223-225)AGGfs		serine/threonine protein kinase 11																																				SO:0001589	frameshift_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1207136_1207137insCTCCT	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		Exception_encountered	19.37:g.1207136_1207137insCTCCT	ENSP00000324856:p.Arg75fs	TSP Lung(3;<1E-08)					p.R75fs	NM_000455	NP_000446	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	1	1339_1340	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	75			Protein kinase.		B2RBX7|E7EW76	Frame_Shift_Ins	INS	ENST00000326873.7	37	c.224_225insCTCCT	CCDS45896.1																																																																																				0.619	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		9	19	NA	NA	NA	NA	NA	9	19	---	---	---	---
PURA	5813	broad.mit.edu	37	5	139493896	139493898	+	In_Frame_Del	DEL	GGC	GGC	-			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	GGC	GGC	-	-	GGC	GGC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr5:139493896_139493898delGGC	ENST00000331327.3	+	1	189_191	c.130_132delGGC	c.(130-132)ggcdel	p.G49del	PURA_ENST00000505703.1_3'UTR	NM_005859.4	NP_005850.1	Q00577	PURA_HUMAN	purine-rich element binding protein A	49	Gly-rich.				DNA replication initiation (GO:0006270)|DNA unwinding involved in DNA replication (GO:0006268)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|DNA replication factor A complex (GO:0005662)|neuronal cell body (GO:0043025)|nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)	double-stranded telomeric DNA binding (GO:0003691)|poly(A) RNA binding (GO:0044822)|purine-rich negative regulatory element binding (GO:0032422)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)	p.G44delG(1)		central_nervous_system(1)|lung(2)|ovary(1)|prostate(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			cggcggcagtggcggcggcggcg	0.778																																							uc003lfa.2		NA																	1	Deletion - In frame(1)		central_nervous_system(1)		0						c.(130-132)GGCdel		purine-rich element binding protein A				16,814		2,12,401						2.8	1.0			3	100,2536		12,76,1230	no	coding	PURA	NM_005859.4		14,88,1631	A1A1,A1R,RR		3.7936,1.9277,3.3468				116,3350				SO:0001651	inframe_deletion	5813				DNA unwinding involved in replication|DNA-dependent DNA replication initiation	DNA replication factor A complex	double-stranded telomeric DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|single-stranded DNA binding|transcription factor binding	g.chr5:139493896_139493898delGGC	BC036087	CCDS4220.1	5q31	2008-02-05			ENSG00000185129	ENSG00000185129			9701	protein-coding gene	gene with protein product		600473				1448097	Standard	NM_005859		Approved	PURALPHA, PUR1, PUR-ALPHA	uc003lfa.3	Q00577	OTTHUMG00000129242	ENST00000331327.3:c.130_132delGGC	5.37:g.139493905_139493907delGGC	ENSP00000332706:p.Gly49del						p.G49del	NM_005859	NP_005850	Q00577	PURA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	189_191	+			49			Gly-rich.			In_Frame_Del	DEL	ENST00000331327.3	37	c.130_132delGGC	CCDS4220.1																																																																																				0.778	PURA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251341.3	NM_005859		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119976964	119976964	+	Frame_Shift_Del	DEL	G	G	-	rs149649522		TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chr9:119976964delG	ENST00000313400.4	-	3	788	c.688delC	c.(688-690)cagfs	p.Q230fs	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Frame_Shift_Del_p.Q230fs|ASTN2_ENST00000361209.2_Frame_Shift_Del_p.Q230fs			O75129	ASTN2_HUMAN	astrotactin 2	230					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CAACGTCGCTGGGCGTACAGC	0.607																																							uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(688-690)CAGfs		astrotactin 2 isoform c							45.0	44.0	44.0					9																	119976964		2203	4300	6503	SO:0001589	frameshift_variant	23245					integral to membrane		g.chr9:119976964delG	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.688delC	9.37:g.119976964delG	ENSP00000314038:p.Gln230fs					ASTN2_uc004bjr.1_Frame_Shift_Del_p.Q230fs|ASTN2_uc004bjt.1_Frame_Shift_Del_p.Q230fs	p.Q230fs	NM_198187	NP_937830	O75129	ASTN2_HUMAN			3	789	-			230			Cytoplasmic (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Frame_Shift_Del	DEL	ENST00000313400.4	37	c.688delC																																																																																					0.607	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		7	60	NA	NA	NA	NA	NA	7	60	---	---	---	---
RBM10	8241	broad.mit.edu	37	X	47041355	47041355	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6983-01A-11D-1945-08	TCGA-55-6983-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6d4d37e4-0f9b-4f44-bda6-f4c280067d72	f71b30ee-ce4c-4a56-9cf9-ad2e139a5689	g.chrX:47041355delC	ENST00000377604.3	+	16	2441	c.1699delC	c.(1699-1701)cccfs	p.P567fs	RBM10_ENST00000329236.7_Frame_Shift_Del_p.P489fs|RBM10_ENST00000345781.6_Frame_Shift_Del_p.P490fs	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	567	Tyr-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						CCTAGCTGTTCCCGACGTCTC	0.577																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	0				ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.(1699-1701)CCCfs		RNA binding motif protein 10 isoform 1							97.0	79.0	85.0					X																	47041355		2203	4300	6503	SO:0001589	frameshift_variant	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47041355delC	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.1699delC	X.37:g.47041355delC	ENSP00000366829:p.Pro567fs					RBM10_uc004dhg.2_Frame_Shift_Del_p.P489fs|RBM10_uc004dhh.2_Frame_Shift_Del_p.P566fs|RBM10_uc010nhq.2_Frame_Shift_Del_p.P490fs|RBM10_uc004dhi.2_Frame_Shift_Del_p.P632fs	p.P567fs	NM_005676	NP_005667	P98175	RBM10_HUMAN			16	2078	+			567			Tyr-rich.		C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Frame_Shift_Del	DEL	ENST00000377604.3	37	c.1699delC	CCDS14274.1																																																																																				0.577	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676		20	13	NA	NA	NA	NA	NA	20	13	---	---	---	---
