#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CHD5	26038	broad.mit.edu	37	1	6206324	6206324	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:6206324G>A	ENST00000262450.3	-	11	1849	c.1750C>T	c.(1750-1752)Cgc>Tgc	p.R584C	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		ATGCCATAGCGGTAGAAGCGC	0.607																																							uc001amb.1		NA																	0				central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12						c.(1750-1752)CGC>TGC		chromodomain helicase DNA binding protein 5							149.0	148.0	149.0					1																	6206324		2203	4300	6503	SO:0001583	missense	26038				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding	g.chr1:6206324G>A	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.1750C>T	1.37:g.6206324G>A	ENSP00000262450:p.Arg584Cys					CHD5_uc001ama.1_5'Flank|CHD5_uc001amc.1_RNA	p.R584C	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)	11	1850	-	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)	584					A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	c.1750C>T	CCDS57.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.612667	0.66672	.	.	ENSG00000116254	ENST00000262450;ENST00000378006	T	0.72725	-0.68	3.85	3.85	0.44370	Chromo domain-like (1);	0.000000	0.85682	D	0.000000	D	0.84032	0.5383	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.86555	0.1837	10	0.87932	D	0	-21.9232	11.5749	0.50856	0.0:0.0:0.8215:0.1785	.	584	Q8TDI0	CHD5_HUMAN	C	584;100	ENSP00000262450:R584C	ENSP00000262450:R584C	R	-	1	0	CHD5	6128911	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	6.269000	0.72558	2.138000	0.66242	0.462000	0.41574	CGC		0.607	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557		17	42	0	0	0	0.010504	0	17	42				
PER3	8863	broad.mit.edu	37	1	7880542	7880542	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:7880542C>T	ENST00000361923.2	+	15	1950	c.1775C>T	c.(1774-1776)cCa>cTa	p.P592L	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.P600L	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	592	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		TTGCAAATCCCAGCCATACCT	0.458																																							uc001aoo.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(1774-1776)CCA>CTA		period 3							47.0	42.0	44.0					1																	7880542		2203	4300	6503	SO:0001583	missense	8863				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity	g.chr1:7880542C>T	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.1775C>T	1.37:g.7880542C>T	ENSP00000355031:p.Pro592Leu					PER3_uc009vmg.1_Missense_Mutation_p.P600L|PER3_uc009vmh.1_Missense_Mutation_p.P593L|PER3_uc001aop.2_Missense_Mutation_p.P600L|PER3_uc010nzw.1_Missense_Mutation_p.P281L	p.P592L	NM_016831	NP_058515	P56645	PER3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)	15	1950	+	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)	592			CSNK1E binding domain (By similarity).		Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	c.1775C>T	CCDS89.1	.	.	.	.	.	.	.	.	.	.	C	8.295	0.818502	0.16607	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.10099	2.92;2.91	4.12	2.89	0.33648	.	0.063246	0.08080	U	1.000000	T	0.09905	0.0243	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.21381	0.048;0.014;0.055;0.048	B;B;B;B	0.22386	0.039;0.015;0.034;0.039	T	0.40776	-0.9545	10	0.21540	T	0.41	.	8.909	0.35541	0.0:0.8546:0.0:0.1454	.	592;600;600;592	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	L	600;592	ENSP00000366755:P600L;ENSP00000355031:P592L	ENSP00000355031:P592L	P	+	2	0	PER3	7803129	0.193000	0.23313	0.001000	0.08648	0.028000	0.11728	3.142000	0.50601	0.756000	0.33013	0.555000	0.69702	CCA		0.458	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831		5	14	0	0	0	0.000602	0	5	14				
EPS15	2060	broad.mit.edu	37	1	51829575	51829575	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:51829575C>G	ENST00000371733.3	-	23	2418	c.2322G>C	c.(2320-2322)aaG>aaC	p.K774N	EPS15_ENST00000396122.4_Missense_Mutation_p.K451N|EPS15_ENST00000371730.2_Missense_Mutation_p.K640N	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	774	15 X 3 AA repeats of D-P-F.|Pro-rich.				cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(2)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						GAGTTCCGATCTTTGGTGGCA	0.448			T	MLL	ALL																																		uc001csq.1		NA		Dom	yes		1	1p32	2060	T	epidermal growth factor receptor pathway substrate 15 (AF1p)			L	MLL		ALL		2	Whole gene deletion(2)		thyroid(1)|central_nervous_system(1)	lung(1)|kidney(1)	2						c.(2320-2322)AAG>AAC		epidermal growth factor receptor pathway							215.0	194.0	201.0					1																	51829575		2203	4300	6503	SO:0001583	missense	2060				cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding	g.chr1:51829575C>G	BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.2322G>C	1.37:g.51829575C>G	ENSP00000360798:p.Lys774Asn					EPS15_uc009vyz.1_Missense_Mutation_p.K640N|EPS15_uc001csp.3_Missense_Mutation_p.K460N	p.K774N	NM_001981	NP_001972	P42566	EPS15_HUMAN			23	2414	-			774			15 X 3 AA repeats of D-P-F.|Pro-rich.|SH3-binding.		B2R8J7|D3DPJ2|Q5SRH4	Missense_Mutation	SNP	ENST00000371733.3	37	c.2322G>C	CCDS557.1	.	.	.	.	.	.	.	.	.	.	C	13.91	2.379363	0.42207	.	.	ENSG00000085832	ENST00000371730;ENST00000371733;ENST00000396122	T;T;T	0.57436	0.4;0.4;0.4	5.95	2.61	0.31194	.	.	.	.	.	T	0.67505	0.2900	M	0.73962	2.25	0.48040	D	0.999576	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.991;0.999;0.998	T	0.65096	-0.6251	9	0.35671	T	0.21	.	9.8562	0.41088	0.0:0.6205:0.0:0.3795	.	640;774;460	B1AUU8;P42566;P42566-2	.;EPS15_HUMAN;.	N	640;774;451	ENSP00000360795:K640N;ENSP00000360798:K774N;ENSP00000379428:K451N	ENSP00000360795:K640N	K	-	3	2	EPS15	51602163	0.994000	0.37717	0.707000	0.30419	0.937000	0.57800	0.665000	0.25083	0.838000	0.34948	0.655000	0.94253	AAG		0.448	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022422.1	NM_001981		6	53	0	0	0	0.004482	0	6	53				
DAB1	1600	broad.mit.edu	37	1	57537266	57537266	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:57537266C>T	ENST00000371231.1	-	5	521	c.487G>A	c.(487-489)Gaa>Aaa	p.E163K	DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000414851.2_Missense_Mutation_p.E163K|DAB1_ENST00000371236.2_Missense_Mutation_p.E163K|DAB1_ENST00000439789.2_Intron|DAB1_ENST00000420954.2_Missense_Mutation_p.E163K|DAB1_ENST00000371234.4_Missense_Mutation_p.E163K|DAB1_ENST00000371230.1_Missense_Mutation_p.E163K			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	163	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						TGCTTCAATTCATAAATGAGT	0.413																																							uc001cys.1		NA																	0				skin(2)|ovary(1)	3						c.(487-489)GAA>AAA		disabled homolog 1							164.0	147.0	153.0					1																	57537266		2203	4300	6503	SO:0001583	missense	1600				cell differentiation|nervous system development			g.chr1:57537266C>T	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.487G>A	1.37:g.57537266C>T	ENSP00000360275:p.Glu163Lys					DAB1_uc001cyt.1_Missense_Mutation_p.E163K|DAB1_uc001cyq.1_Missense_Mutation_p.E163K|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Missense_Mutation_p.E163K|DAB1_uc009vzx.1_Missense_Mutation_p.E163K	p.E163K	NM_021080	NP_066566	O75553	DAB1_HUMAN			8	1161	-			163			PID.		A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	37	c.487G>A		.	.	.	.	.	.	.	.	.	.	C	25.4	4.629935	0.87660	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000371231;ENST00000332102;ENST00000371230	T;T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	5.94	5.94	0.96194	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.045192	0.85682	D	0.000000	T	0.61502	0.2352	L	0.29908	0.895	0.80722	D	1	D;B;B;B	0.54047	0.964;0.24;0.045;0.119	P;B;B;B	0.48425	0.577;0.271;0.082;0.177	T	0.60193	-0.7311	10	0.42905	T	0.14	-25.0635	20.3736	0.98901	0.0:1.0:0.0:0.0	.	163;163;163;163	O75553-4;O75553;O75553-6;O75553-5	.;DAB1_HUMAN;.;.	K	163	ENSP00000360280:E163K;ENSP00000360278:E163K;ENSP00000395296:E163K;ENSP00000387581:E163K;ENSP00000360275:E163K;ENSP00000329120:E163K;ENSP00000360274:E163K	ENSP00000329120:E163K	E	-	1	0	DAB1	57309854	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	7.487000	0.81328	2.820000	0.97059	0.650000	0.86243	GAA		0.413	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080		5	17	0	0	0	0.000602	0	5	17				
LRRC7	57554	broad.mit.edu	37	1	70493864	70493864	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:70493864A>G	ENST00000035383.5	+	16	1721	c.1691A>G	c.(1690-1692)aAc>aGc	p.N564S	LRRC7_ENST00000310961.5_Missense_Mutation_p.N569S|RP11-181B18.1_ENST00000414132.1_RNA|LRRC7_ENST00000415775.2_Intron	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	564						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GTTGAAATAAACCTAAAACGA	0.328																																							uc001dep.2		NA																	0				ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(1690-1692)AAC>AGC		leucine rich repeat containing 7							60.0	65.0	63.0					1																	70493864		2203	4298	6501	SO:0001583	missense	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70493864A>G		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1691A>G	1.37:g.70493864A>G	ENSP00000035383:p.Asn564Ser					LRRC7_uc009wbg.2_Intron	p.N564S	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN			16	1721	+			564					Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	c.1691A>G	CCDS645.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.124474	0.77436	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.51325	0.71;0.8	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.43010	0.1228	L	0.32530	0.975	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	T	0.30297	-0.9983	10	0.12766	T	0.61	.	15.5719	0.76345	1.0:0.0:0.0:0.0	.	564	Q96NW7	LRRC7_HUMAN	S	569;564;387	ENSP00000309245:N569S;ENSP00000035383:N564S	ENSP00000035383:N564S	N	+	2	0	LRRC7	70266452	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.664000	0.91139	2.269000	0.75478	0.455000	0.32223	AAC		0.328	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		3	40	0	0	0	0.004672	0	3	40				
LRRC7	57554	broad.mit.edu	37	1	70505431	70505431	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:70505431G>A	ENST00000035383.5	+	19	3840	c.3810G>A	c.(3808-3810)tgG>tgA	p.W1270*	LRRC7_ENST00000310961.5_Nonsense_Mutation_p.W1275*|LRRC7_ENST00000415775.2_Nonsense_Mutation_p.W554*	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1270						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						CTGCAGACTGGAGACAACAGC	0.448																																							uc001dep.2		NA																	0				ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(3808-3810)TGG>TGA		leucine rich repeat containing 7							91.0	89.0	90.0					1																	70505431		2203	4300	6503	SO:0001587	stop_gained	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70505431G>A		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.3810G>A	1.37:g.70505431G>A	ENSP00000035383:p.Trp1270*					LRRC7_uc009wbg.2_Nonsense_Mutation_p.W554*|LRRC7_uc001deq.2_Nonsense_Mutation_p.W511*	p.W1270*	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN			19	3840	+			1270					Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Nonsense_Mutation	SNP	ENST00000035383.5	37	c.3810G>A	CCDS645.1	.	.	.	.	.	.	.	.	.	.	G	50	16.368709	0.99861	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.848	0.96722	0.0:0.0:1.0:0.0	.	.	.	.	X	1275;1270;554;1093	.	ENSP00000035383:W1270X	W	+	3	0	LRRC7	70278019	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.328000	0.96403	2.937000	0.99478	0.650000	0.86243	TGG		0.448	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		9	74	0	0	0	0.010729	0	9	74				
ERICH3	127254	broad.mit.edu	37	1	75036931	75036931	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:75036931G>T	ENST00000326665.5	-	14	4681	c.4463C>A	c.(4462-4464)cCg>cAg	p.P1488Q	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1488	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TAGACTCTCCGGACTCAATTC	0.537																																							uc001dgg.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(4462-4464)CCG>CAG		hypothetical protein LOC127254							172.0	158.0	162.0					1																	75036931		2203	4300	6503	SO:0001583	missense	127254							g.chr1:75036931G>T																												ENST00000326665.5:c.4463C>A	1.37:g.75036931G>T	ENSP00000322609:p.Pro1488Gln						p.P1488Q	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN			14	4682	-			1488			Glu-rich.		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	c.4463C>A	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	G	4.589	0.109371	0.08780	.	.	ENSG00000178965	ENST00000326665	T	0.11604	2.76	5.08	3.21	0.36854	.	.	.	.	.	T	0.01454	0.0047	N	0.08118	0	0.09310	N	0.999997	B	0.11235	0.004	B	0.09377	0.004	T	0.48151	-0.9060	9	0.14656	T	0.56	1.2829	9.8335	0.40956	0.1546:0.6906:0.1548:0.0	.	1488	Q5RHP9	CA173_HUMAN	Q	1488	ENSP00000322609:P1488Q	ENSP00000322609:P1488Q	P	-	2	0	C1orf173	74809519	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.054000	0.14205	0.544000	0.28883	-1.157000	0.01802	CCG		0.537	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			26	86	1	0	5.77227e-19	0.008361	7.65263e-19	26	86				
PTGFR	5737	broad.mit.edu	37	1	78959092	78959092	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:78959092A>G	ENST00000370757.3	+	2	901	c.664A>G	c.(664-666)Atc>Gtc	p.I222V	PTGFR_ENST00000370758.1_Missense_Mutation_p.I222V|PTGFR_ENST00000370756.3_Missense_Mutation_p.I222V	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	222					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	GTGCAATGCAATCACAGGAAT	0.383																																							uc001din.2		NA																	0				ovary(3)|breast(2)|skin(1)	6						c.(664-666)ATC>GTC		prostaglandin F receptor isoform a precursor	Bimatoprost(DB00905)|Latanoprost(DB00654)|Travoprost(DB00287)						62.0	64.0	63.0					1																	78959092		2203	4300	6503	SO:0001583	missense	5737				parturition	extracellular region|integral to plasma membrane	prostaglandin F receptor activity	g.chr1:78959092A>G	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.664A>G	1.37:g.78959092A>G	ENSP00000359793:p.Ile222Val					PTGFR_uc001dim.2_Missense_Mutation_p.I222V	p.I222V	NM_000959	NP_000950	P43088	PF2R_HUMAN		Colorectal(170;0.248)	2	930	+			222			Helical; Name=5; (Potential).		A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	37	c.664A>G	CCDS686.1	.	.	.	.	.	.	.	.	.	.	A	6.189	0.403009	0.11696	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.36699	1.24;1.24;1.24	5.85	3.55	0.40652	GPCR, rhodopsin-like superfamily (1);	0.338512	0.34362	N	0.004028	T	0.05914	0.0154	N	0.14661	0.345	0.29815	N	0.831353	B;B	0.10296	0.001;0.003	B;B	0.11329	0.004;0.006	T	0.39643	-0.9604	10	0.09084	T	0.74	-10.3027	7.8899	0.29672	0.7067:0.0:0.2933:0.0	.	222;222	P43088;P43088-2	PF2R_HUMAN;.	V	222	ENSP00000359794:I222V;ENSP00000359793:I222V;ENSP00000359792:I222V	ENSP00000359792:I222V	I	+	1	0	PTGFR	78731680	0.010000	0.17322	1.000000	0.80357	0.992000	0.81027	0.223000	0.17719	0.584000	0.29591	0.533000	0.62120	ATC		0.383	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959		9	16	0	0	0	0.004482	0	9	16				
CLCA4	22802	broad.mit.edu	37	1	87031096	87031096	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:87031096G>A	ENST00000370563.3	+	5	739	c.697G>A	c.(697-699)Gaa>Aaa	p.E233K	CLCA4_ENST00000263723.5_Intron	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	233					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		AGTACAAACAGAAAAAGCATC	0.318																																							uc009wcs.2		NA																	0				ovary(2)	2						c.(697-699)GAA>AAA		chloride channel accessory 4							82.0	83.0	83.0					1																	87031096		1908	4137	6045	SO:0001583	missense	22802					apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:87031096G>A	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.697G>A	1.37:g.87031096G>A	ENSP00000359594:p.Glu233Lys					CLCA4_uc009wct.2_5'UTR|CLCA4_uc009wcu.2_Missense_Mutation_p.E53K	p.E233K	NM_012128	NP_036260	Q14CN2	CLCA4_HUMAN		all cancers(265;0.0202)|Epithelial(280;0.0404)	5	741	+		Lung NSC(277;0.238)	233					A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	ENST00000370563.3	37	c.697G>A	CCDS41355.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.564504	0.45694	.	.	ENSG00000016602	ENST00000370563	T	0.12774	2.65	6.0	5.07	0.68467	Chloride channel calcium-activated (1);	0.812061	0.11421	N	0.565750	T	0.22589	0.0545	M	0.83012	2.62	0.24777	N	0.992838	D	0.76494	0.999	D	0.73708	0.981	T	0.21143	-1.0254	10	0.22706	T	0.39	-17.3136	10.2129	0.43152	0.074:0.1391:0.7869:0.0	.	233	Q14CN2	CLCA4_HUMAN	K	233	ENSP00000359594:E233K	ENSP00000359594:E233K	E	+	1	0	CLCA4	86803684	0.044000	0.20184	0.998000	0.56505	0.128000	0.20619	1.994000	0.40757	1.495000	0.48549	0.655000	0.94253	GAA		0.318	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128		4	60	0	0	0	0.000602	0	4	60				
LRRC8C	84230	broad.mit.edu	37	1	90179620	90179620	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:90179620C>T	ENST00000370454.4	+	3	1746	c.1491C>T	c.(1489-1491)agC>agT	p.S497S	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	497					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		AGGTCTTGAGCGTCAAGTTTG	0.488																																							uc001dnl.3		NA																	0				ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8						c.(1489-1491)AGC>AGT		leucine rich repeat containing 8 family, member							80.0	77.0	78.0					1																	90179620		2203	4300	6503	SO:0001819	synonymous_variant	84230					endoplasmic reticulum membrane|integral to membrane		g.chr1:90179620C>T		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1491C>T	1.37:g.90179620C>T							p.S497S	NM_032270	NP_115646	Q8TDW0	LRC8C_HUMAN		all cancers(265;0.00756)|Epithelial(280;0.0313)	3	1733	+		all_lung(203;0.126)	497			LRR 5.		B3KXS9|Q29RV6|Q9H075	Silent	SNP	ENST00000370454.4	37	c.1491C>T	CCDS725.1																																																																																				0.488	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270		5	17	0	0	0	0.001984	0	5	17				
CCDC18	343099	broad.mit.edu	37	1	93687224	93687224	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:93687224C>T	ENST00000343253.7	+	15	2520	c.2018C>T	c.(2017-2019)tCc>tTc	p.S673F	CCDC18_ENST00000334652.5_5'UTR|CCDC18_ENST00000338949.4_Missense_Mutation_p.S429F|CCDC18_ENST00000421014.2_3'UTR|CCDC18_ENST00000401026.3_Missense_Mutation_p.S674F|CCDC18_ENST00000557479.1_Missense_Mutation_p.S792F			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	673										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		AAGACTATGTCCATGTTGCAA	0.303																																							uc001dpq.2		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(2374-2376)TCC>TTC		sarcoma antigen NY-SAR-41							135.0	132.0	133.0					1																	93687224		1842	4078	5920	SO:0001583	missense	343099							g.chr1:93687224C>T			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.2018C>T	1.37:g.93687224C>T	ENSP00000343377:p.Ser673Phe					CCDC18_uc009wdl.1_Missense_Mutation_p.S309F	p.S792F	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)	15	2543	+		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)	673			Potential.		Q6ZU17	Missense_Mutation	SNP	ENST00000343253.7	37	c.2375C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.947433|3.947433	0.73672|0.73672	.|.	.|.	ENSG00000122483|ENSG00000122483	ENST00000370276|ENST00000343253;ENST00000401026;ENST00000557479;ENST00000338949;ENST00000455267	.|T;T;T;T;T	.|0.14391	.|2.51;2.51;2.51;2.51;2.51	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	.|0.336269	.|0.32204	.|N	.|0.006438	T|T	0.21468|0.21468	0.0517|0.0517	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|D;D	.|0.64830	.|0.983;0.994	.|P;P	.|0.62298	.|0.776;0.9	T|T	0.00909|0.00909	-1.1518|-1.1518	5|10	.|0.59425	.|D	.|0.04	.|.	18.5869|18.5869	0.91192|0.91192	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|673;792	.|Q5T9S5;G3V388	.|CCD18_HUMAN;.	S|F	727|673;674;792;429;349	.|ENSP00000343377:S673F;ENSP00000383808:S674F;ENSP00000451099:S792F;ENSP00000344380:S429F;ENSP00000391151:S349F	.|ENSP00000344380:S429F	P|S	+|+	1|2	0|0	CCDC18|CCDC18	93459812|93459812	0.962000|0.962000	0.33011|0.33011	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	2.000000|2.000000	0.40816|0.40816	2.471000|2.471000	0.83476|0.83476	0.555000|0.555000	0.69702|0.69702	CCA|TCC		0.303	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1	NM_206886		23	66	0	0	0	0.005443	0	23	66				
PLPPR4	9890	broad.mit.edu	37	1	99771530	99771530	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:99771530G>A	ENST00000370185.3	+	7	1753	c.1256G>A	c.(1255-1257)cGa>cAa	p.R419Q	LPPR4_ENST00000457765.1_Missense_Mutation_p.R361Q|LPPR4_ENST00000370184.1_Missense_Mutation_p.R261Q	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		419					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.R419Q(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		ACCTTGCCGCGAGCCAATACC	0.498																																							uc001dse.2		NA																	1	Substitution - Missense(1)		endometrium(1)	ovary(3)	3						c.(1255-1257)CGA>CAA		plasticity related gene 1							56.0	58.0	57.0					1																	99771530		2203	4300	6503	SO:0001583	missense	9890						phosphatidate phosphatase activity	g.chr1:99771530G>A																												ENST00000370185.3:c.1256G>A	1.37:g.99771530G>A	ENSP00000359204:p.Arg419Gln					LPPR4_uc010oue.1_Missense_Mutation_p.R361Q	p.R419Q	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)	7	1362	+		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)	419					E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	c.1256G>A	CCDS757.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228539	0.58777	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.59224	0.83;0.28;0.32	5.5	5.5	0.81552	.	0.348037	0.30185	N	0.010204	T	0.70369	0.3216	M	0.67397	2.05	0.58432	D	0.999998	D;D	0.89917	0.999;1.0	D;D	0.78314	0.99;0.991	T	0.68450	-0.5405	9	.	.	.	-24.5187	19.3904	0.94578	0.0:0.0:1.0:0.0	.	361;419	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	Q	419;361;419;261	ENSP00000359204:R419Q;ENSP00000394913:R361Q;ENSP00000359203:R261Q	.	R	+	2	0	RP4-788L13.1	99544118	1.000000	0.71417	0.610000	0.28997	0.117000	0.20001	9.121000	0.94375	2.575000	0.86900	0.650000	0.86243	CGA		0.498	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			5	45	0	0	0	0.000602	0	5	45				
ATXN7L2	127002	broad.mit.edu	37	1	110033961	110033961	+	Silent	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:110033961A>G	ENST00000369870.3	+	10	1791	c.1776A>G	c.(1774-1776)aaA>aaG	p.K592K	CYB561D1_ENST00000528785.1_5'Flank|CYB561D1_ENST00000369868.3_5'Flank|CYB561D1_ENST00000533024.1_5'Flank|CYB561D1_ENST00000420578.2_5'Flank|CYB561D1_ENST00000310611.4_5'Flank|CYB561D1_ENST00000496961.1_5'Flank|CYB561D1_ENST00000527072.1_5'Flank|CYB561D1_ENST00000393709.3_5'Flank|CYB561D1_ENST00000430195.2_5'Flank|ATXN7L2_ENST00000459635.1_3'UTR	NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	592										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		CCACTGGAAAAGGGAAACCCT	0.597																																							uc001dxr.2		NA																	0				ovary(2)	2						c.(1774-1776)AAA>AAG		ataxin 7-like 2							67.0	74.0	72.0					1																	110033961		2203	4300	6503	SO:0001819	synonymous_variant	127002							g.chr1:110033961A>G	BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.1776A>G	1.37:g.110033961A>G						ATXN7L2_uc001dxs.2_Silent_p.K219K|ATXN7L2_uc001dxt.2_Silent_p.K95K|CYB561D1_uc010ovl.1_5'Flank|CYB561D1_uc010ovm.1_5'Flank|CYB561D1_uc001dxu.2_5'Flank|CYB561D1_uc001dxw.2_5'Flank|CYB561D1_uc010ovn.1_5'Flank|CYB561D1_uc010ovo.1_5'Flank|CYB561D1_uc009wfd.2_5'Flank|CYB561D1_uc010ovp.1_5'Flank	p.K592K	NM_153340	NP_699171	Q5T6C5	AT7L2_HUMAN		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)	10	1791	+		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)	592						Silent	SNP	ENST00000369870.3	37	c.1776A>G	CCDS30794.1																																																																																				0.597	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030331.1	NM_153340		3	60	0	0	0	0.009096	0	3	60				
RP11-337C18.8	0	broad.mit.edu	37	1	146650815	146650815	+	RNA	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:146650815G>C	ENST00000607149.1	+	0	350				RP11-337C18.8_ENST00000606757.1_RNA|RP11-337C18.9_ENST00000606152.1_RNA|RP11-337C18.10_ENST00000606856.1_RNA																							AGAGAGCAATGATGGGCCTGT	0.428																																							uc001epg.1		NA																	0					0						c.(1123-1125)GAT>CAT		SubName: Full=cDNA FLJ53558, highly similar to Protein disulfide-isomerase A3 (EC 5.3.4.1);																																						171423							g.chr1:146650815G>C																													1.37:g.146650815G>C							p.D375H	NR_002305						1	1386	+									Missense_Mutation	SNP	ENST00000607149.1	37	c.1123G>C																																																																																					0.428	RP11-337C18.8-004	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000471324.1			6	56	0	0	0	0.004482	0	6	56				
GJA8	2703	broad.mit.edu	37	1	147380681	147380681	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:147380681C>A	ENST00000369235.1	+	1	599	c.599C>A	c.(598-600)aCg>aAg	p.T200K	GJA8_ENST00000240986.4_Missense_Mutation_p.T200K			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	200					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					TCCCGGCCCACGGAGAAAACC	0.607																																					Melanoma(76;1255 1795 8195 52096)	Melanoma(76;1255 1795 8195 52096)	uc001epu.1		NA																	0				ovary(2)|large_intestine(2)|breast(1)|skin(1)	6						c.(598-600)ACG>AAG		connexin 50							116.0	101.0	106.0					1																	147380681		2203	4300	6503	SO:0001583	missense	2703				cell communication|visual perception	connexon complex|integral to plasma membrane	channel activity	g.chr1:147380681C>A	U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.599C>A	1.37:g.147380681C>A	ENSP00000358238:p.Thr200Lys						p.T200K	NM_005267	NP_005258	P48165	CXA8_HUMAN			2	662	+	all_hematologic(923;0.0276)		200			Extracellular (Potential).		A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	ENST00000369235.1	37	c.599C>A	CCDS30834.1	.	.	.	.	.	.	.	.	.	.	c	21.3	4.128035	0.77549	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.96232	-3.95;-3.95	4.89	4.89	0.63831	Gap junction protein, cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.98311	0.9440	M	0.88842	2.985	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99640	1.0988	10	0.87932	D	0	.	18.0406	0.89318	0.0:1.0:0.0:0.0	.	200	P48165	CXA8_HUMAN	K	200	ENSP00000240986:T200K;ENSP00000358238:T200K	ENSP00000240986:T200K	T	+	2	0	GJA8	145847305	1.000000	0.71417	0.989000	0.46669	0.790000	0.44656	7.744000	0.85034	2.241000	0.73720	0.313000	0.20887	ACG		0.607	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267		16	70	1	0	1.15088e-07	0.004007	1.33823e-07	16	70				
SV2A	9900	broad.mit.edu	37	1	149884960	149884960	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:149884960G>A	ENST00000369146.3	-	2	923	c.433C>T	c.(433-435)Cga>Tga	p.R145*	SV2A_ENST00000369145.1_Nonsense_Mutation_p.R145*	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	145					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.R145*(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	AGTTCTTCTCGTTCTTTCCGT	0.637																																							uc001etg.2		NA																	1	Substitution - Nonsense(1)		prostate(1)	ovary(6)|pancreas(1)	7						c.(433-435)CGA>TGA		synaptic vesicle glycoprotein 2	Levetiracetam(DB01202)						118.0	117.0	117.0					1																	149884960		2203	4300	6503	SO:0001587	stop_gained	9900				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr1:149884960G>A	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.433C>T	1.37:g.149884960G>A	ENSP00000358142:p.Arg145*					SV2A_uc001eth.2_Nonsense_Mutation_p.R145*	p.R145*	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		2	924	-	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		145			Cytoplasmic (Potential).		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Nonsense_Mutation	SNP	ENST00000369146.3	37	c.433C>T	CCDS940.1	.	.	.	.	.	.	.	.	.	.	G	39	7.607869	0.98387	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	.	.	.	5.07	3.02	0.34903	.	0.490245	0.19507	N	0.112596	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-18.9207	12.8897	0.58064	0.0:0.0:0.5883:0.4117	.	.	.	.	X	145	.	ENSP00000358141:R145X	R	-	1	2	SV2A	148151584	0.059000	0.20769	0.978000	0.43139	0.994000	0.84299	0.498000	0.22530	1.344000	0.45657	0.557000	0.71058	CGA		0.637	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1			3	40	0	0	0	0.009096	0	3	40				
LENEP	55891	broad.mit.edu	37	1	154966094	154966094	+	Missense_Mutation	SNP	G	G	A	rs199697277		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:154966094G>A	ENST00000392487.1	+	1	31	c.11G>A	c.(10-12)cGg>cAg	p.R4Q				Q9Y5L5	LENEP_HUMAN	lens epithelial protein	4					multicellular organismal development (GO:0007275)		DNA binding (GO:0003677)			lung(2)	2	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ATGCAGCCCCGGACACAGCCC	0.612																																							uc001fgi.2		NA																	0					0						c.(10-12)CGG>CAG		lens epithelial protein		G	GLN/ARG	0,4406		0,0,2203	57.0	58.0	57.0		11	-3.0	0.7	1		57	2,8598	2.2+/-6.3	0,2,4298	yes	missense	LENEP	NM_018655.2	43	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	4/62	154966094	2,13004	2203	4300	6503	SO:0001583	missense	55891				multicellular organismal development		DNA binding	g.chr1:154966094G>A	AF268478	CCDS1080.1	1q22.2	2008-02-05			ENSG00000163352	ENSG00000163352			14429	protein-coding gene	gene with protein product		607377				10655141, 11376938	Standard	NM_018655		Approved	LEP503	uc001fgi.3	Q9Y5L5	OTTHUMG00000037417	ENST00000392487.1:c.11G>A	1.37:g.154966094G>A	ENSP00000376278:p.Arg4Gln						p.R4Q	NM_018655	NP_061125	Q9Y5L5	LENEP_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		1	33	+	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		4					B5BUM1|Q5T1A4	Missense_Mutation	SNP	ENST00000392487.1	37	c.11G>A	CCDS1080.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.587669	0.28268	0.0	2.33E-4	ENSG00000163352	ENST00000392487	.	.	.	4.81	-3.01	0.05463	.	0.743369	0.11082	N	0.601717	T	0.07052	0.0179	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.37934	-0.9684	8	0.19147	T	0.46	-9.4476	6.1326	0.20213	0.4685:0.2484:0.2831:0.0	.	4	Q9Y5L5	LENEP_HUMAN	Q	4	.	ENSP00000357412:R4Q	R	+	2	0	LENEP	153232718	0.001000	0.12720	0.740000	0.30986	0.940000	0.58332	0.139000	0.16036	-0.503000	0.06586	-0.986000	0.02555	CGG		0.612	LENEP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385609.2	NM_018655		3	158	0	0	0	0.009096	0	3	158				
UBQLN4	56893	broad.mit.edu	37	1	156020194	156020194	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:156020194G>A	ENST00000368309.3	-	4	721	c.629C>T	c.(628-630)tCt>tTt	p.S210F	UBQLN4_ENST00000472638.1_Intron	NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	210					regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					ATCAGGGTTAGACATCATATC	0.522																																							uc001fna.2		NA																	0				pancreas(1)|skin(1)	2						c.(628-630)TCT>TTT		ataxin-1 ubiquitin-like interacting protein							171.0	151.0	158.0					1																	156020194		2203	4300	6503	SO:0001583	missense	56893					cytosol|endoplasmic reticulum membrane|nucleus	identical protein binding	g.chr1:156020194G>A	BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.629C>T	1.37:g.156020194G>A	ENSP00000357292:p.Ser210Phe					UBQLN4_uc010pgx.1_Missense_Mutation_p.S190F	p.S210F	NM_020131	NP_064516	Q9NRR5	UBQL4_HUMAN			4	653	-	Hepatocellular(266;0.133)|all_neural(408;0.195)		210					A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Missense_Mutation	SNP	ENST00000368309.3	37	c.629C>T	CCDS1127.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643103	0.87859	.	.	ENSG00000160803	ENST00000368309	T	0.80909	-1.43	4.49	4.49	0.54785	Heat shock chaperonin-binding (1);	0.000000	0.85682	D	0.000000	D	0.85818	0.5785	M	0.62266	1.93	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.995	D	0.87603	0.2498	10	0.87932	D	0	-42.4415	15.9589	0.79910	0.0:0.0:1.0:0.0	.	190;210	B4DZF6;Q9NRR5	.;UBQL4_HUMAN	F	210	ENSP00000357292:S210F	ENSP00000357292:S210F	S	-	2	0	UBQLN4	154286818	1.000000	0.71417	0.990000	0.47175	0.983000	0.72400	9.646000	0.98474	2.342000	0.79632	0.561000	0.74099	TCT		0.522	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046193.1	NM_020131		5	231	0	0	0	0.001168	0	5	231				
OR10K1	391109	broad.mit.edu	37	1	158435910	158435910	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:158435910C>A	ENST00000289451.2	+	1	639	c.559C>A	c.(559-561)Ctg>Atg	p.L187M		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					TGTCCTTAAACTGGCATCTCA	0.507																																							uc010pij.1		NA																	0				ovary(1)	1						c.(559-561)CTG>ATG		olfactory receptor, family 10, subfamily K,							197.0	195.0	196.0					1																	158435910		2203	4300	6503	SO:0001583	missense	391109				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158435910C>A	AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.559C>A	1.37:g.158435910C>A	ENSP00000289451:p.Leu187Met						p.L187M	NM_001004473	NP_001004473	Q8NGX5	O10K1_HUMAN			1	559	+	all_hematologic(112;0.0378)		187			Extracellular (Potential).		Q6IFS2	Missense_Mutation	SNP	ENST00000289451.2	37	c.559C>A	CCDS30897.1	.	.	.	.	.	.	.	.	.	.	c	14.87	2.663159	0.47572	.	.	ENSG00000173285	ENST00000289451	T	0.00402	7.56	4.24	2.33	0.28932	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33938	N	0.004418	T	0.00356	0.0011	M	0.75150	2.29	0.22866	N	0.99864	D	0.53745	0.962	P	0.61003	0.882	T	0.45366	-0.9266	10	0.87932	D	0	.	8.3092	0.32060	0.0:0.7525:0.1577:0.0898	.	187	Q8NGX5	O10K1_HUMAN	M	187	ENSP00000289451:L187M	ENSP00000289451:L187M	L	+	1	2	OR10K1	156702534	0.076000	0.21285	0.992000	0.48379	0.799000	0.45148	0.511000	0.22739	0.401000	0.25424	0.557000	0.71058	CTG		0.507	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046367.1			105	130	1	0	8.83409e-43	0.01441	1.1892e-42	105	130				
LRRC52	440699	broad.mit.edu	37	1	165514004	165514004	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:165514004C>T	ENST00000294818.1	+	1	761	c.471C>T	c.(469-471)ctC>ctT	p.L157L	RP11-280O1.2_ENST00000416424.1_RNA|RP11-280O1.2_ENST00000421273.1_RNA|RP11-280O1.2_ENST00000438275.1_RNA	NM_001005214.3	NP_001005214.2	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52	157					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)	18	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					ACCTGGACCTCAGAAATACCG	0.522																																							uc001gde.2		NA																	0				ovary(1)	1						c.(469-471)CTC>CTT		leucine rich repeat containing 52 precursor							172.0	169.0	170.0					1																	165514004		2203	4300	6503	SO:0001819	synonymous_variant	440699					integral to membrane		g.chr1:165514004C>T	AK098677	CCDS30930.1	1q23.3	2008-02-05			ENSG00000162763	ENSG00000162763			32156	protein-coding gene	gene with protein product		615218					Standard	NM_001005214		Approved	FLJ25811	uc001gde.2	Q8N7C0	OTTHUMG00000034625	ENST00000294818.1:c.471C>T	1.37:g.165514004C>T						LOC400794_uc001gdc.2_Intron|LOC400794_uc001gdd.2_Intron|LOC400794_uc009wvd.2_Intron	p.L157L	NM_001005214	NP_001005214	Q8N7C0	LRC52_HUMAN			1	527	+	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)		157			Extracellular (Potential).|LRR 5.		A2RUN7|Q5T9K5	Silent	SNP	ENST00000294818.1	37	c.471C>T	CCDS30930.1																																																																																				0.522	LRRC52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083793.1	NM_001005214		12	118	0	0	0	0.003163	0	12	118				
NPL	80896	broad.mit.edu	37	1	182787814	182787814	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:182787814G>T	ENST00000367553.1	+	8	640	c.596G>T	c.(595-597)gGg>gTg	p.G199V	NPL_ENST00000258317.2_Missense_Mutation_p.G199V|NPL_ENST00000367555.1_Missense_Mutation_p.G199V|NPL_ENST00000463899.1_3'UTR|NPL_ENST00000367552.2_Missense_Mutation_p.G199V|NPL_ENST00000367554.3_Missense_Mutation_p.G180V	NM_001200056.1|NM_030769.2	NP_001186985.1|NP_110396.1	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)	199					carbohydrate metabolic process (GO:0005975)|N-acetylneuraminate catabolic process (GO:0019262)	cytoplasm (GO:0005737)	N-acetylneuraminate lyase activity (GO:0008747)			breast(1)|central_nervous_system(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(1)|stomach(1)	15						TTCCTTTTTGGGGTGGATGAG	0.448																																							uc009wyb.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(595-597)GGG>GTG		N-acetylneuraminate pyruvate lyase							63.0	63.0	63.0					1																	182787814		2203	4300	6503	SO:0001583	missense	80896				carbohydrate metabolic process	cytoplasm	N-acetylneuraminate lyase activity	g.chr1:182787814G>T	AF338436	CCDS1350.1, CCDS55666.1, CCDS55667.1, CCDS72990.1	1q25	2010-11-25	2003-09-16	2003-09-17	ENSG00000135838	ENSG00000135838	4.1.3.3		16781	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 1 (E. coli)"""	611412	"""chromosome 1 open reading frame 13"""	C1orf13		11318611	Standard	NM_001200056		Approved	NPL1, DHDPS1	uc009wyb.3	Q9BXD5	OTTHUMG00000035321	ENST00000367553.1:c.596G>T	1.37:g.182787814G>T	ENSP00000356524:p.Gly199Val					NPL_uc010pnx.1_Missense_Mutation_p.G180V|NPL_uc010pny.1_Intron|NPL_uc001gpo.1_Missense_Mutation_p.G180V|NPL_uc009wyc.2_Missense_Mutation_p.G199V|NPL_uc001gpp.3_Missense_Mutation_p.G199V|NPL_uc001gpq.1_Missense_Mutation_p.G199V	p.G199V	NM_030769	NP_110396	Q9BXD5	NPL_HUMAN			9	736	+			199					B2R839|Q4G0Q8|Q4G0Z2|Q64L88|Q6PEL0	Missense_Mutation	SNP	ENST00000367553.1	37	c.596G>T	CCDS1350.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215731	0.79352	.	.	ENSG00000135838	ENST00000367555;ENST00000367554;ENST00000367551;ENST00000367553;ENST00000367552;ENST00000258317	D;D;D;D;D	0.99667	-6.34;-6.34;-6.34;-6.34;-6.34	5.48	5.48	0.80851	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.99664	0.9875	M	0.88640	2.97	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.97804	1.0246	10	0.87932	D	0	0.0751	17.1276	0.86718	0.0:0.0:1.0:0.0	.	180;199;199;199;180	A6NK93;Q9BXD5-4;Q9BXD5;Q9BXD5-3;Q9BXD5-2	.;.;NPL_HUMAN;.;.	V	199;180;180;199;199;199	ENSP00000356526:G199V;ENSP00000356525:G180V;ENSP00000356524:G199V;ENSP00000356523:G199V;ENSP00000258317:G199V	ENSP00000258317:G199V	G	+	2	0	NPL	181054437	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.565000	0.82337	2.561000	0.86390	0.655000	0.94253	GGG		0.448	NPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085463.1	NM_030769		11	29	1	0	0.00010058	0.013537	0.000110009	11	29				
DHX9	1660	broad.mit.edu	37	1	182827742	182827742	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:182827742C>G	ENST00000367549.3	+	9	977	c.867C>G	c.(865-867)atC>atG	p.I289M		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	289	Interaction with BRCA1.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						TGCAAAACATCATTCAAGAGC	0.373																																					Colon(69;210 1162 3697 13559 39565)	Colon(69;210 1162 3697 13559 39565)	uc001gpr.2		NA																	0				ovary(2)	2						c.(865-867)ATC>ATG		DEAH (Asp-Glu-Ala-His) box polypeptide 9							96.0	93.0	94.0					1																	182827742		1850	4087	5937	SO:0001583	missense	1660				CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding	g.chr1:182827742C>G	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.867C>G	1.37:g.182827742C>G	ENSP00000356520:p.Ile289Met					DHX9_uc001gps.2_Missense_Mutation_p.I75M	p.I289M	NM_001357	NP_001348	Q08211	DHX9_HUMAN			9	1030	+			289			Interaction with BRCA1.		B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	c.867C>G	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077268	0.36662	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.09723	2.95	5.73	-3.91	0.04168	.	0.780188	0.11943	N	0.514464	T	0.04770	0.0129	N	0.14661	0.345	0.09310	N	1	B	0.34399	0.452	B	0.33392	0.163	T	0.32161	-0.9917	10	0.49607	T	0.09	.	4.4486	0.11609	0.1003:0.2315:0.1094:0.5589	.	289	Q08211	DHX9_HUMAN	M	289	ENSP00000356520:I289M	ENSP00000356520:I289M	I	+	3	3	DHX9	181094365	0.000000	0.05858	0.000000	0.03702	0.952000	0.60782	-1.366000	0.02585	-0.670000	0.05282	-0.137000	0.14449	ATC		0.373	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588		6	43	0	0	0	0.001984	0	6	43				
HMCN1	83872	broad.mit.edu	37	1	186147872	186147872	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:186147872C>T	ENST00000271588.4	+	104	16497	c.16268C>T	c.(16267-16269)tCt>tTt	p.S5423F	HMCN1_ENST00000367492.2_Intron|GS1-174L6.4_ENST00000428391.1_RNA	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5423					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CCTGAAGGCTCTGAGGCAAGC	0.443																																							uc001grq.1		NA																	0				ovary(22)|skin(1)	23						c.(16267-16269)TCT>TTT		hemicentin 1 precursor							104.0	100.0	101.0					1																	186147872		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186147872C>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16268C>T	1.37:g.186147872C>T	ENSP00000271588:p.Ser5423Phe					HMCN1_uc001grs.1_Intron	p.S5423F	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN			104	16497	+			5423					A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.16268C>T	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	10.41	1.343861	0.24339	.	.	ENSG00000143341	ENST00000271588	D	0.85861	-2.04	5.77	0.46	0.16684	Growth factor, receptor (1);	0.489512	0.24925	N	0.034503	T	0.52058	0.1711	N	0.01751	-0.74	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.50947	-0.8767	10	0.05351	T	0.99	.	1.2703	0.02019	0.2384:0.3673:0.2296:0.1646	.	5423	Q96RW7	HMCN1_HUMAN	F	5423	ENSP00000271588:S5423F	ENSP00000271588:S5423F	S	+	2	0	HMCN1	184414495	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	0.732000	0.26072	0.457000	0.26962	0.655000	0.94253	TCT		0.443	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		4	70	0	0	0	0.009096	0	4	70				
LGR6	59352	broad.mit.edu	37	1	202287921	202287921	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:202287921C>T	ENST00000367278.3	+	18	2579	c.2490C>T	c.(2488-2490)ttC>ttT	p.F830F	LGR6_ENST00000255432.7_Silent_p.F778F|LGR6_ENST00000439764.2_Silent_p.F691F	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	830					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						ACCTGCTCTTCAACCCCCACT	0.677																																							uc001gxu.2		NA																	0				large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						c.(2488-2490)TTC>TTT		leucine-rich repeat-containing G protein-coupled							102.0	100.0	101.0					1																	202287921		2203	4300	6503	SO:0001819	synonymous_variant	59352					integral to membrane|plasma membrane	protein-hormone receptor activity	g.chr1:202287921C>T	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.2490C>T	1.37:g.202287921C>T						LGR6_uc001gxv.2_Silent_p.F778F|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Silent_p.F691F	p.F830F	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN			18	2490	+			830			Helical; Name=7; (Potential).		Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Silent	SNP	ENST00000367278.3	37	c.2490C>T	CCDS30971.1																																																																																				0.677	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636		25	225	0	0	0	0.013726	0	25	225				
PLXNA2	5362	broad.mit.edu	37	1	208224761	208224761	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:208224761T>C	ENST00000367033.3	-	16	3758	c.3001A>G	c.(3001-3003)Atg>Gtg	p.M1001V		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1001	IPT/TIG 2.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		ATCTCACTCATTGACCTCCTG	0.572																																							uc001hgz.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(3001-3003)ATG>GTG		plexin A2 precursor							65.0	56.0	59.0					1																	208224761		2203	4300	6503	SO:0001583	missense	5362				axon guidance	integral to membrane|intracellular|plasma membrane		g.chr1:208224761T>C	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3001A>G	1.37:g.208224761T>C	ENSP00000356000:p.Met1001Val						p.M1001V	NM_025179	NP_079455	O75051	PLXA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.199)	16	3759	-			1001			Extracellular (Potential).|IPT/TIG 2.		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	c.3001A>G	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	T	13.13	2.146586	0.37923	.	.	ENSG00000076356	ENST00000367033	T	0.76316	-1.01	5.09	5.09	0.68999	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.134436	0.64402	D	0.000002	T	0.70011	0.3175	L	0.48362	1.52	0.47621	D	0.999471	B	0.09022	0.002	B	0.12156	0.007	T	0.65384	-0.6181	10	0.32370	T	0.25	.	10.9679	0.47422	0.0:0.0:0.1564:0.8436	.	1001	O75051	PLXA2_HUMAN	V	1001	ENSP00000356000:M1001V	ENSP00000356000:M1001V	M	-	1	0	PLXNA2	206291384	1.000000	0.71417	0.995000	0.50966	0.968000	0.65278	3.888000	0.56204	1.916000	0.55485	0.455000	0.32223	ATG		0.572	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179		4	29	0	0	0	0.000602	0	4	29				
USH2A	7399	broad.mit.edu	37	1	216370038	216370038	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:216370038C>T	ENST00000307340.3	-	19	4494	c.4108G>A	c.(4108-4110)Gtc>Atc	p.V1370I	RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366942.3_Missense_Mutation_p.V1370I|USH2A_ENST00000366943.2_Missense_Mutation_p.V1370I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1370	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGGGAAAGACTGAAGGAGGG	0.368										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(4108-4110)GTC>ATC		usherin isoform B							123.0	118.0	119.0					1																	216370038		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216370038C>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4108G>A	1.37:g.216370038C>T	ENSP00000305941:p.Val1370Ile	HNSCC(13;0.011)				USH2A_uc001hkv.2_Missense_Mutation_p.V1370I	p.V1370I	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	19	4495	-			1370			Extracellular (Potential).|Fibronectin type-III 4.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.4108G>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.567225	0.65651	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.56103	2.43;0.48;0.48	5.96	5.06	0.68205	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.176512	0.26605	N	0.023446	T	0.51702	0.1690	L	0.52266	1.64	0.38036	D	0.935325	P;P	0.42296	0.725;0.775	P;B	0.45449	0.481;0.306	T	0.52305	-0.8593	10	0.22109	T	0.4	.	13.5344	0.61639	0.0:0.9284:0.0:0.0716	.	1370;1370	O75445-2;O75445	.;USH2A_HUMAN	I	1370	ENSP00000305941:V1370I;ENSP00000355910:V1370I;ENSP00000355909:V1370I	ENSP00000305941:V1370I	V	-	1	0	USH2A	214436661	0.997000	0.39634	0.019000	0.16419	0.002000	0.02628	3.143000	0.50608	1.538000	0.49270	-0.140000	0.14226	GTC		0.368	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		10	21	0	0	0	0.013537	0	10	21				
OBSCN	84033	broad.mit.edu	37	1	228401921	228401921	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:228401921C>T	ENST00000422127.1	+	4	1349	c.1305C>T	c.(1303-1305)ggC>ggT	p.G435G	OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.G435G|OBSCN_ENST00000366707.4_5'UTR|C1orf145_ENST00000295012.5_5'Flank|OBSCN_ENST00000570156.2_Silent_p.G435G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	435	Ig-like 5.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGCGCGTGGGCGACACGGCTA	0.711																																							uc009xez.1		NA																	0				stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(1303-1305)GGC>GGT		obscurin, cytoskeletal calmodulin and							50.0	58.0	56.0					1																	228401921		1960	4137	6097	SO:0001819	synonymous_variant	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228401921C>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.1305C>T	1.37:g.228401921C>T						OBSCN_uc001hsn.2_Silent_p.G435G|uc001hsm.1_5'Flank	p.G435G	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN			4	1349	+		Prostate(94;0.0405)	435			Ig-like 5.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	c.1305C>T	CCDS58065.1																																																																																				0.711	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		11	119	0	0	0	0.010729	0	11	119				
FAM89A	375061	broad.mit.edu	37	1	231155691	231155691	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:231155691C>T	ENST00000366654.4	-	2	507	c.473G>A	c.(472-474)aGg>aAg	p.R158K	FAM89A_ENST00000494111.1_5'UTR|MIR1182_ENST00000408363.1_RNA	NM_198552.2	NP_940954.1	Q96GI7	FA89A_HUMAN	family with sequence similarity 89, member A	158										endometrium(1)|upper_aerodigestive_tract(1)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				TCGGTCCCTCCTGTCGTGCAG	0.592																																							uc001hui.2		NA																	0					0						c.(472-474)AGG>AAG		family with sequence similarity 89, member A							89.0	86.0	87.0					1																	231155691		2203	4300	6503	SO:0001583	missense	375061							g.chr1:231155691C>T	BC009447	CCDS1590.1	1q42.2	2008-02-05	2005-09-13	2005-09-13	ENSG00000182118	ENSG00000182118			25057	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 153"""	C1orf153		12477932	Standard	NM_198552		Approved	MGC15887	uc001hui.2	Q96GI7	OTTHUMG00000037960	ENST00000366654.4:c.473G>A	1.37:g.231155691C>T	ENSP00000355614:p.Arg158Lys					FAM89A_uc009xfm.2_Missense_Mutation_p.R169K|MIR1182_hsa-mir-1182|MI0006275_5'Flank	p.R158K	NM_198552	NP_940954	Q96GI7	FA89A_HUMAN			2	511	-	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)	158						Missense_Mutation	SNP	ENST00000366654.4	37	c.473G>A	CCDS1590.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.596838	0.46318	.	.	ENSG00000182118	ENST00000366654	.	.	.	5.85	4.94	0.65067	.	0.478034	0.21607	N	0.071851	T	0.22898	0.0553	N	0.08118	0	0.09310	N	1	B	0.20368	0.044	B	0.15870	0.014	T	0.08994	-1.0695	9	0.10377	T	0.69	-7.1924	14.8939	0.70630	0.0:0.9305:0.0:0.0695	.	158	Q96GI7	FA89A_HUMAN	K	158	.	ENSP00000355614:R158K	R	-	2	0	FAM89A	229222314	0.001000	0.12720	0.003000	0.11579	0.696000	0.40369	1.224000	0.32539	1.613000	0.50231	0.643000	0.83706	AGG		0.592	FAM89A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092652.1	NM_198552		17	48	0	0	0	0.00499	0	17	48				
SIPA1L2	57568	broad.mit.edu	37	1	232650057	232650057	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:232650057T>A	ENST00000366630.1	-	2	1387	c.1029A>T	c.(1027-1029)gaA>gaT	p.E343D	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.E343D			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	343					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TAGCCATGGCTTCGTTGATAT	0.507																																							uc001hvg.2		NA																	0				ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6						c.(1027-1029)GAA>GAT		signal-induced proliferation-associated 1 like							84.0	85.0	84.0					1																	232650057		1948	4164	6112	SO:0001583	missense	57568				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr1:232650057T>A	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.1029A>T	1.37:g.232650057T>A	ENSP00000355589:p.Glu343Asp						p.E343D	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN			1	1187	-		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)	343					Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	c.1029A>T	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	T	14.24	2.475841	0.44044	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	T;T	0.81163	-1.46;-1.46	5.39	3.09	0.35607	.	0.000000	0.85682	D	0.000000	D	0.82346	0.5017	M	0.61703	1.905	0.49582	D	0.9998	D	0.54207	0.965	P	0.54401	0.751	T	0.78723	-0.2093	10	0.35671	T	0.21	-33.3631	9.7351	0.40384	0.0:0.1396:0.0:0.8604	.	343	Q9P2F8	SI1L2_HUMAN	D	343	ENSP00000355589:E343D;ENSP00000262861:E343D	ENSP00000262861:E343D	E	-	3	2	SIPA1L2	230716680	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	1.160000	0.31761	0.500000	0.27991	-0.256000	0.11100	GAA		0.507	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839		7	66	0	0	0	0.004482	0	7	66				
RYR2	6262	broad.mit.edu	37	1	237777588	237777588	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:237777588G>A	ENST00000366574.2	+	37	5477	c.5160G>A	c.(5158-5160)atG>atA	p.M1720I	RYR2_ENST00000542537.1_Missense_Mutation_p.M1704I|RYR2_ENST00000360064.6_Missense_Mutation_p.M1718I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1720	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCAGGCTCATGATGAACAACG	0.522																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(5158-5160)ATG>ATA		cardiac muscle ryanodine receptor							60.0	60.0	60.0					1																	237777588		2153	4260	6413	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237777588G>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5160G>A	1.37:g.237777588G>A	ENSP00000355533:p.Met1720Ile						p.M1720I	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		37	5280	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1720			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.5160G>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.799121	0.50208	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.73789	-0.78;-0.78;-0.78	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.68293	0.2985	L	0.59436	1.845	0.80722	D	1	P	0.44478	0.836	B	0.37833	0.259	T	0.67829	-0.5569	10	0.25751	T	0.34	.	14.1386	0.65303	0.0:0.0:0.85:0.15	.	1720	Q92736	RYR2_HUMAN	I	1720;1718;1704	ENSP00000355533:M1720I;ENSP00000353174:M1718I;ENSP00000443798:M1704I	ENSP00000353174:M1718I	M	+	3	0	RYR2	235844211	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.573000	0.67417	2.563000	0.86464	0.650000	0.86243	ATG		0.522	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		7	35	0	0	0	0.001984	0	7	35				
OR2C3	81472	broad.mit.edu	37	1	247695307	247695307	+	Silent	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:247695307C>A	ENST00000366487.3	-	2	868	c.507G>T	c.(505-507)ctG>ctT	p.L169L	GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366491.2_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			TGTTCCCACACAGCGGTAGGA	0.552																																							uc009xgy.2		NA																	0				ovary(1)|skin(1)	2						c.(505-507)CTG>CTT		olfactory receptor, family 2, subfamily C,							67.0	62.0	64.0					1																	247695307		2203	4300	6503	SO:0001819	synonymous_variant	81472				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247695307C>A	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.507G>T	1.37:g.247695307C>A						C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	p.L169L	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0241)		2	869	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	169			Extracellular (Potential).		Q5JQS4|Q6IEZ1|Q8NGW7	Silent	SNP	ENST00000366487.3	37	c.507G>T	CCDS1634.2																																																																																				0.552	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074		8	16	1	0	0.00307968	0.00308	0.00321758	8	16				
OR2G3	81469	broad.mit.edu	37	1	247769700	247769700	+	Silent	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:247769700G>A	ENST00000320002.2	+	1	845	c.813G>A	c.(811-813)ggG>ggA	p.G271G	RP11-978I15.10_ENST00000435333.1_RNA|RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AGGACCAAGGGAAGTTTATCT	0.453																																							uc010pyz.1		NA																	0				central_nervous_system(1)	1						c.(811-813)GGG>GGA		olfactory receptor, family 2, subfamily G,							106.0	99.0	101.0					1																	247769700		2203	4300	6503	SO:0001819	synonymous_variant	81469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247769700G>A	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.813G>A	1.37:g.247769700G>A							p.G271G	NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	813	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		271			Extracellular (Potential).		B2RN64|Q5JQT1|Q6IF45	Silent	SNP	ENST00000320002.2	37	c.813G>A	CCDS31093.1																																																																																				0.453	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1			19	21	0	0	0	0.008871	0	19	21				
OR1C1	26188	broad.mit.edu	37	1	247921358	247921358	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:247921358C>T	ENST00000408896.2	-	1	624	c.351G>A	c.(349-351)gtG>gtA	p.V117V		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	117					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CATACGCCATCACACACAGAA	0.488																																							uc010pza.1		NA																	0				skin(1)	1						c.(349-351)GTG>GTA		olfactory receptor, family 1, subfamily C,							64.0	60.0	61.0					1																	247921358		1992	4167	6159	SO:0001819	synonymous_variant	26188				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247921358C>T	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.351G>A	1.37:g.247921358C>T							p.V117V	NM_012353	NP_036485	Q15619	OR1C1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	351	-	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	117			Helical; Name=3; (Potential).		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Silent	SNP	ENST00000408896.2	37	c.351G>A	CCDS41481.1																																																																																				0.488	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1			7	51	0	0	0	0.001984	0	7	51				
OR2T6	254879	broad.mit.edu	37	1	248551522	248551522	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr1:248551522G>T	ENST00000355728.2	+	1	613	c.613G>T	c.(613-615)Gca>Tca	p.A205S		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	205						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTGCTGCGTTGCAATGCTGCT	0.512																																							uc001iei.1		NA																	0				ovary(2)|skin(1)	3						c.(613-615)GCA>TCA		olfactory receptor, family 2, subfamily T,							287.0	215.0	239.0					1																	248551522		2203	4300	6503	SO:0001583	missense	254879				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248551522G>T	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.613G>T	1.37:g.248551522G>T	ENSP00000347965:p.Ala205Ser						p.A205S	NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	613	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		205			Helical; Name=5; (Potential).		A6NE36	Missense_Mutation	SNP	ENST00000355728.2	37	c.613G>T	CCDS31114.1	.	.	.	.	.	.	.	.	.	.	G	5.627	0.300437	0.10678	.	.	ENSG00000198104	ENST00000355728	T	0.37058	1.22	4.13	-1.43	0.08884	GPCR, rhodopsin-like superfamily (1);	0.923862	0.09089	N	0.850073	T	0.20210	0.0486	N	0.05330	-0.07	0.09310	N	1	B	0.23891	0.093	B	0.33121	0.158	T	0.39210	-0.9625	10	0.87932	D	0	.	5.6898	0.17823	0.3922:0.431:0.1768:0.0	.	205	Q8NHC8	OR2T6_HUMAN	S	205	ENSP00000347965:A205S	ENSP00000347965:A205S	A	+	1	0	OR2T6	246618145	0.000000	0.05858	0.011000	0.14972	0.023000	0.10783	-2.215000	0.01222	-0.364000	0.08088	-0.323000	0.08544	GCA		0.512	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471		38	58	1	0	3.61848e-18	0.007835	4.74332e-18	38	58				
NET1	10276	broad.mit.edu	37	10	5468684	5468685	+	Splice_Site	DNP	GG	GG	TT			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:5468684_5468685GG>TT	ENST00000355029.4	+	2	337	c.195_195GG>TT	c.(193-195)ttGG>ttTTg	p.L65F	NET1_ENST00000542715.1_5'UTR	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	65	Necessary for nuclear localization. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						ACTTCACTTTGGTGAGTAGATA	0.406																																							uc001iia.2		NA																	0				breast(1)	1						c.e2+1		neuroepithelial cell transforming gene 1 isoform																																				SO:0001630	splice_region_variant	10276				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell growth|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	Rho guanyl-nucleotide exchange factor activity	g.chr10:5468684_5468685GG>TT	AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	Exception_encountered	10.37:g.5468684_5468685delinsTT						NET1_uc010qar.1_Splice_Site	p.L65_splice	NM_001047160	NP_001040625	Q7Z628	ARHG8_HUMAN			2	333	+								Q12773|Q96D82|Q99903|Q9UEN6	Splice_Site	DNP	ENST00000355029.4	37	c.195_splice	CCDS41483.1																																																																																				0.406	NET1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046553.3	NM_005863	Missense_Mutation	13	31	0	0	0	0.004672	0	13	31				
PRPF18	8559	broad.mit.edu	37	10	13672265	13672265	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:13672265G>T	ENST00000378572.3	+	10	1114	c.954G>T	c.(952-954)ttG>ttT	p.L318F	RP11-295P9.3_ENST00000596044.1_5'Flank	NM_003675.3	NP_003666.1	Q99633	PRP18_HUMAN	pre-mRNA processing factor 18	318					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	potassium channel inhibitor activity (GO:0019870)			central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(5)|prostate(1)	17						CTTAGGGATTGAAGAGGTTAA	0.388																																							uc001imp.2		NA																	0				central_nervous_system(1)	1						c.(952-954)TTG>TTT		PRP18 pre-mRNA processing factor 18 homolog							191.0	170.0	177.0					10																	13672265		2203	4300	6503	SO:0001583	missense	8559				mRNA processing|RNA splicing	nuclear speck|spliceosomal complex		g.chr10:13672265G>T	U51990	CCDS7100.1	10p12.33	2013-06-10	2013-06-10		ENSG00000165630	ENSG00000165630			17351	protein-coding gene	gene with protein product		604993	"""PRP18 pre-mRNA processing factor 18 homolog (yeast)"", ""PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae)"""			9000057	Standard	XM_005252634		Approved	hPrp18	uc001imp.3	Q99633	OTTHUMG00000017702	ENST00000378572.3:c.954G>T	10.37:g.13672265G>T	ENSP00000367835:p.Leu318Phe					PRPF18_uc001imq.2_Intron	p.L318F	NM_003675	NP_003666	Q99633	PRP18_HUMAN			10	1102	+			318					Q5T9P9|Q9BUI9	Missense_Mutation	SNP	ENST00000378572.3	37	c.954G>T	CCDS7100.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.270186	0.40194	.	.	ENSG00000165630	ENST00000378572	.	.	.	5.66	4.76	0.60689	Prp18 (3);	0.000000	0.85682	D	0.000000	T	0.62877	0.2464	L	0.47016	1.485	0.80722	D	1	B	0.34147	0.438	B	0.43301	0.415	T	0.61207	-0.7109	9	0.35671	T	0.21	-13.6745	14.5785	0.68268	0.0702:0.0:0.9298:0.0	.	318	Q99633	PRP18_HUMAN	F	318	.	ENSP00000367835:L318F	L	+	3	2	PRPF18	13712271	1.000000	0.71417	0.996000	0.52242	0.969000	0.65631	3.642000	0.54367	1.401000	0.46761	0.591000	0.81541	TTG		0.388	PRPF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046879.1			23	54	1	0	6.32553e-13	0.004656	7.99255e-13	23	54				
GPR158	57512	broad.mit.edu	37	10	25885719	25885719	+	Splice_Site	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:25885719G>A	ENST00000376351.3	+	10	2504		c.e10+1		GPR158_ENST00000490549.1_Splice_Site	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158						protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						GGACATTCGGGTAATGCCAGT	0.483																																							uc001isj.2		NA																	0				ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.e10+1		G protein-coupled receptor 158 precursor							107.0	91.0	97.0					10																	25885719		2203	4300	6503	SO:0001630	splice_region_variant	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25885719G>A	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.2145+1G>A	10.37:g.25885719G>A						GPR158_uc001isk.2_Splice_Site_p.R90_splice	p.R715_splice	NM_020752	NP_065803	Q5T848	GP158_HUMAN			10	2205	+								Q6QR81|Q9ULT3	Splice_Site	SNP	ENST00000376351.3	37	c.2145_splice	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.533491	0.85812	.	.	ENSG00000151025	ENST00000376351	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GPR158	25925725	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	.		0.483	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	Intron	12	66	0	0	0	0.00245	0	12	66				
ANKRD26	22852	broad.mit.edu	37	10	27368065	27368065	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:27368065C>T	ENST00000376087.4	-	7	931	c.766G>A	c.(766-768)Gat>Aat	p.D256N	ANKRD26_ENST00000466890.1_5'UTR|ANKRD26_ENST00000436985.2_Missense_Mutation_p.D305N	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	256					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						GGCCATGAATCATCAACACCC	0.333																																							uc001ith.2		NA																	0				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						c.(766-768)GAT>AAT		ankyrin repeat domain 26							102.0	96.0	98.0					10																	27368065		1837	4088	5925	SO:0001583	missense	22852					centrosome		g.chr10:27368065C>T	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.766G>A	10.37:g.27368065C>T	ENSP00000365255:p.Asp256Asn					ANKRD26_uc001itg.2_5'UTR|ANKRD26_uc009xku.1_Missense_Mutation_p.D256N	p.D256N	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN			7	938	-			256					A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	37	c.766G>A	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.183357	0.57800	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.63096	4.34;-0.02	5.1	4.18	0.49190	.	.	.	.	.	T	0.69700	0.3140	L	0.58101	1.795	0.24754	N	0.992969	D;D	0.67145	0.996;0.994	P;P	0.62813	0.907;0.81	T	0.59150	-0.7508	9	0.12766	T	0.61	.	11.5353	0.50634	0.0:0.8188:0.1812:0.0	.	256;256	Q9UPS8-3;Q9UPS8	.;ANR26_HUMAN	N	256;305	ENSP00000365255:D256N;ENSP00000405112:D305N	ENSP00000365255:D256N	D	-	1	0	ANKRD26	27408071	0.014000	0.17966	0.008000	0.14137	0.008000	0.06430	0.504000	0.22626	1.137000	0.42214	-0.274000	0.10170	GAT		0.333	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1			15	47	0	0	0	0.010504	0	15	47				
PCDH15	65217	broad.mit.edu	37	10	55700715	55700715	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:55700715A>G	ENST00000320301.6	-	24	3537	c.3143T>C	c.(3142-3144)cTt>cCt	p.L1048P	PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395433.1_Missense_Mutation_p.L1026P|PCDH15_ENST00000361849.3_Missense_Mutation_p.L1048P|PCDH15_ENST00000437009.1_Missense_Mutation_p.L977P|PCDH15_ENST00000395430.1_Missense_Mutation_p.L1048P|PCDH15_ENST00000373965.2_Missense_Mutation_p.L1055P|PCDH15_ENST00000414778.1_Missense_Mutation_p.L1053P|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.L1011P|PCDH15_ENST00000395438.1_Missense_Mutation_p.L1048P|PCDH15_ENST00000409834.1_Missense_Mutation_p.L659P|PCDH15_ENST00000395445.1_Missense_Mutation_p.L1055P	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1048	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TTTGGTGGCAAGTTCACTTAC	0.363										HNSCC(58;0.16)																													uc001jju.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(3142-3144)CTT>CCT		protocadherin 15 isoform CD1-4 precursor							103.0	97.0	99.0					10																	55700715		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55700715A>G	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3143T>C	10.37:g.55700715A>G	ENSP00000322604:p.Leu1048Pro	HNSCC(58;0.16)				PCDH15_uc010qhq.1_Missense_Mutation_p.L1053P|PCDH15_uc010qhr.1_Missense_Mutation_p.L1048P|PCDH15_uc010qhs.1_Missense_Mutation_p.L1060P|PCDH15_uc010qht.1_Missense_Mutation_p.L1055P|PCDH15_uc010qhu.1_Missense_Mutation_p.L1048P|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.L1048P|PCDH15_uc010qhw.1_Missense_Mutation_p.L1011P|PCDH15_uc010qhx.1_Missense_Mutation_p.L977P|PCDH15_uc010qhy.1_Missense_Mutation_p.L1053P|PCDH15_uc010qhz.1_Missense_Mutation_p.L1048P|PCDH15_uc010qia.1_Missense_Mutation_p.L1026P|PCDH15_uc010qib.1_Missense_Mutation_p.L1026P	p.L1048P	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN			24	3538	-		Melanoma(3;0.117)|Lung SC(717;0.238)	1048			Cadherin 10.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.3143T>C	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	A	12.66	2.005407	0.35415	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;1.19;0.68;1.19;1.19;0.68	5.23	4.02	0.46733	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.59609	0.2206	L	0.58101	1.795	0.58432	D	0.999999	D;D;D;D;D;D;D;P;D;D;P;P;D	0.69078	0.996;0.992;0.983;0.983;0.997;0.992;0.993;0.916;0.983;0.983;0.757;0.953;0.983	D;D;D;P;D;D;D;P;P;P;P;P;D	0.71184	0.972;0.917;0.917;0.88;0.968;0.917;0.972;0.808;0.88;0.88;0.718;0.718;0.917	T	0.58323	-0.7656	9	0.42905	T	0.14	.	9.2868	0.37762	0.7246:0.2754:0.0:0.0	.	1026;1048;1048;1053;977;1011;1048;1048;1055;1055;1048;1053;1048	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	P	1055;1053;1048;1048;659;1055;1011;1048;1026;1048;1048;1053;977	ENSP00000363076:L1055P;ENSP00000410304:L1053P;ENSP00000378826:L1048P;ENSP00000386693:L659P;ENSP00000378832:L1055P;ENSP00000378820:L1011P;ENSP00000354950:L1048P;ENSP00000378821:L1026P;ENSP00000322604:L1048P;ENSP00000378818:L1048P;ENSP00000412628:L977P	ENSP00000322604:L1048P	L	-	2	0	PCDH15	55370721	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	1.657000	0.37366	2.103000	0.63969	0.397000	0.26171	CTT		0.363	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		15	22	0	0	0	0.00499	0	15	22				
PCDH15	65217	broad.mit.edu	37	10	55892662	55892662	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:55892662C>A	ENST00000320301.6	-	15	2284	c.1890G>T	c.(1888-1890)agG>agT	p.R630S	PCDH15_ENST00000373957.3_Missense_Mutation_p.R608S|PCDH15_ENST00000395433.1_Missense_Mutation_p.R608S|PCDH15_ENST00000361849.3_Missense_Mutation_p.R630S|PCDH15_ENST00000437009.1_Intron|PCDH15_ENST00000395430.1_Missense_Mutation_p.R630S|PCDH15_ENST00000373965.2_Missense_Mutation_p.R637S|PCDH15_ENST00000414778.1_Missense_Mutation_p.R635S|PCDH15_ENST00000395446.1_Missense_Mutation_p.R630S|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.R593S|PCDH15_ENST00000373955.1_Missense_Mutation_p.R630S|PCDH15_ENST00000395438.1_Missense_Mutation_p.R630S|PCDH15_ENST00000409834.1_Missense_Mutation_p.R241S|PCDH15_ENST00000395445.1_Missense_Mutation_p.R637S	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	630	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CAGCACCAACCCTCATGGCTT	0.408										HNSCC(58;0.16)																													uc001jju.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(1888-1890)AGG>AGT		protocadherin 15 isoform CD1-4 precursor							114.0	93.0	100.0					10																	55892662		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55892662C>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1890G>T	10.37:g.55892662C>A	ENSP00000322604:p.Arg630Ser	HNSCC(58;0.16)				PCDH15_uc010qhq.1_Missense_Mutation_p.R635S|PCDH15_uc010qhr.1_Missense_Mutation_p.R630S|PCDH15_uc010qhs.1_Missense_Mutation_p.R642S|PCDH15_uc010qht.1_Missense_Mutation_p.R637S|PCDH15_uc010qhu.1_Missense_Mutation_p.R630S|PCDH15_uc001jjv.1_Missense_Mutation_p.R608S|PCDH15_uc010qhv.1_Missense_Mutation_p.R630S|PCDH15_uc010qhw.1_Missense_Mutation_p.R593S|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Missense_Mutation_p.R635S|PCDH15_uc010qhz.1_Missense_Mutation_p.R630S|PCDH15_uc010qia.1_Missense_Mutation_p.R608S|PCDH15_uc010qib.1_Missense_Mutation_p.R608S|PCDH15_uc001jjw.2_Missense_Mutation_p.R630S	p.R630S	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN			15	2285	-		Melanoma(3;0.117)|Lung SC(717;0.238)	630			Cadherin 6.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.1890G>T	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.612102	0.66672	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.67	1.52	0.23074	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.43722	0.1260	N	0.16201	0.385	0.80722	D	1	D;D;D;P;D;D;D;D;D;D;D;D;P;D	0.89917	0.996;0.998;0.996;0.563;1.0;0.996;0.998;1.0;0.998;0.996;1.0;0.999;0.846;1.0	D;D;D;P;D;D;D;D;D;D;D;D;P;D	0.91635	0.998;0.983;0.977;0.607;0.994;0.998;0.987;0.994;0.983;0.966;0.999;0.984;0.781;0.994	T	0.30387	-0.9980	9	0.33940	T	0.23	.	5.3235	0.15893	0.1334:0.5696:0.0:0.297	.	608;630;630;635;593;630;630;637;637;630;635;630;608;630	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	S	637;635;630;630;241;637;630;593;630;608;608;630;630;635;630	ENSP00000363076:R637S;ENSP00000410304:R635S;ENSP00000378826:R630S;ENSP00000386693:R241S;ENSP00000378832:R637S;ENSP00000378833:R630S;ENSP00000378820:R593S;ENSP00000354950:R630S;ENSP00000378821:R608S;ENSP00000363068:R608S;ENSP00000322604:R630S;ENSP00000378818:R630S;ENSP00000363066:R630S	ENSP00000322604:R630S	R	-	3	2	PCDH15	55562668	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.344000	0.33941	0.428000	0.26173	0.591000	0.81541	AGG		0.408	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		12	14	1	0	7.03913e-09	0.013537	8.29527e-09	12	14				
EGR2	1959	broad.mit.edu	37	10	64573782	64573782	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:64573782G>A	ENST00000242480.3	-	2	941	c.616C>T	c.(616-618)Cct>Tct	p.P206S	EGR2_ENST00000411732.1_Missense_Mutation_p.P156S|EGR2_ENST00000439032.1_Missense_Mutation_p.P206S|EGR2_ENST00000493899.2_5'Flank	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	206					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					GGATAGGAAGGAGGTGGTGGG	0.572																																							uc010qim.1		NA																	0				ovary(2)	2						c.(616-618)CCT>TCT		early growth response 2 protein isoform a							92.0	88.0	89.0					10																	64573782		2203	4300	6503	SO:0001583	missense	1959				fat cell differentiation|protein export from nucleus|transcription from RNA polymerase II promoter	cytoplasm|nucleus	chromatin binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding	g.chr10:64573782G>A	BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.616C>T	10.37:g.64573782G>A	ENSP00000242480:p.Pro206Ser					EGR2_uc010qin.1_Missense_Mutation_p.P156S|EGR2_uc001jmi.2_Missense_Mutation_p.P206S|EGR2_uc010qio.1_Missense_Mutation_p.P219S|EGR2_uc009xph.2_Missense_Mutation_p.P206S	p.P206S	NM_001136177	NP_001129649	P11161	EGR2_HUMAN			3	770	-	Prostate(12;0.0297)|all_hematologic(501;0.228)		206					B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Missense_Mutation	SNP	ENST00000242480.3	37	c.616C>T	CCDS7267.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.184627	0.78677	.	.	ENSG00000122877	ENST00000242480;ENST00000439032;ENST00000411732;ENST00000432380	T;T;T	0.14516	2.5;2.5;2.55	5.15	5.15	0.70609	.	0.055638	0.64402	D	0.000001	T	0.33702	0.0872	M	0.62723	1.935	0.58432	D	0.999998	D;D	0.63880	0.993;0.975	P;P	0.62491	0.903;0.491	T	0.01195	-1.1422	10	0.49607	T	0.09	-10.348	18.4193	0.90584	0.0:0.0:1.0:0.0	.	156;206	P11161-2;P11161	.;EGR2_HUMAN	S	206;206;156;219	ENSP00000242480:P206S;ENSP00000402040:P206S;ENSP00000387634:P156S	ENSP00000242480:P206S	P	-	1	0	EGR2	64243788	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.965000	0.63708	2.661000	0.90470	0.655000	0.94253	CCT		0.572	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048245.2	NM_000399		17	69	0	0	0	0.012319	0	17	69				
MYPN	84665	broad.mit.edu	37	10	69961617	69961617	+	Silent	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:69961617G>T	ENST00000358913.5	+	18	4013	c.3525G>T	c.(3523-3525)ctG>ctT	p.L1175L	MYPN_ENST00000354393.2_Silent_p.L900L|MYPN_ENST00000540630.1_Silent_p.L1175L	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	1175	Ig-like 5.|Interaction with ACTN.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						CTGTGATCCTGGAGAAACTAC	0.483																																							uc001jnm.3		NA																	0				ovary(3)|skin(2)	5						c.(3523-3525)CTG>CTT		myopalladin							100.0	94.0	96.0					10																	69961617		2203	4300	6503	SO:0001819	synonymous_variant	84665					nucleus|sarcomere	actin binding	g.chr10:69961617G>T	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.3525G>T	10.37:g.69961617G>T						MYPN_uc001jnn.3_Silent_p.L900L|MYPN_uc001jno.3_Silent_p.L1175L|MYPN_uc009xpt.2_Silent_p.L1175L|MYPN_uc010qit.1_Silent_p.L881L|MYPN_uc010qiu.1_RNA	p.L1175L	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN			19	3710	+			1175			Interaction with ACTN.|Ig-like 5.		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Silent	SNP	ENST00000358913.5	37	c.3525G>T	CCDS7275.1																																																																																				0.483	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578		16	43	1	0	5.35267e-07	0.007413	6.18295e-07	16	43				
PBLD	64081	broad.mit.edu	37	10	70056701	70056701	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:70056701C>T	ENST00000358769.2	-	3	328	c.126G>A	c.(124-126)atG>atA	p.M42I	PBLD_ENST00000432941.1_Missense_Mutation_p.M42I|PBLD_ENST00000495025.2_Missense_Mutation_p.M42I|PBLD_ENST00000309049.4_Missense_Mutation_p.M42I|PBLD_ENST00000336578.1_Missense_Mutation_p.M9I	NM_022129.3	NP_071412.2	P30039	PBLD_HUMAN	phenazine biosynthesis-like protein domain containing	42					biosynthetic process (GO:0009058)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein import into nucleus (GO:0060392)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	isomerase activity (GO:0016853)			endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21						CAGAGAGGTTCATCTCCCTTG	0.373																																							uc001jns.1		NA																	0				skin(2)|ovary(1)	3						c.(124-126)ATG>ATA		MAWD binding protein isoform a							207.0	194.0	198.0					10																	70056701		2203	4300	6503	SO:0001583	missense	64081				biosynthetic process		isomerase activity	g.chr10:70056701C>T	AK027673	CCDS7277.2, CCDS44413.1	10q21.3	2006-11-27			ENSG00000108187	ENSG00000108187			23301	protein-coding gene	gene with protein product	MAWD binding protein	612189				11355021	Standard	XM_005270028		Approved	MAWBP, MAWDBP, FLJ14767	uc001jns.1	P30039	OTTHUMG00000073949	ENST00000358769.2:c.126G>A	10.37:g.70056701C>T	ENSP00000351619:p.Met42Ile					PBLD_uc001jnr.1_Missense_Mutation_p.M9I|PBLD_uc001jnt.1_Missense_Mutation_p.M42I|PBLD_uc001jnu.1_Missense_Mutation_p.M42I|PBLD_uc001jnv.1_Missense_Mutation_p.M42I	p.M42I	NM_022129	NP_071412	P30039	PBLD_HUMAN			3	329	-			42					A8MZJ3|C9JIM0|Q9HCC2	Missense_Mutation	SNP	ENST00000358769.2	37	c.126G>A	CCDS7277.2	.	.	.	.	.	.	.	.	.	.	C	24.9	4.583238	0.86748	.	.	ENSG00000108187	ENST00000336578;ENST00000358769;ENST00000309049;ENST00000432941;ENST00000277795	T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	M	0.71296	2.17	0.52501	D	0.999959	D;P;D	0.71674	0.998;0.793;0.988	D;P;P	0.80764	0.994;0.585;0.863	T	0.42430	-0.9452	10	0.22706	T	0.39	-28.9469	16.7747	0.85548	0.0:1.0:0.0:0.0	.	42;42;42	F8W7D0;C9JIM0;P30039	.;.;PBLD_HUMAN	I	9;42;42;42;42	ENSP00000338041:M9I;ENSP00000351619:M42I;ENSP00000308466:M42I;ENSP00000395534:M42I;ENSP00000277795:M42I	ENSP00000277795:M42I	M	-	3	0	PBLD	69726707	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.869000	0.69613	2.687000	0.91594	0.655000	0.94253	ATG		0.373	PBLD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048314.1	NM_022129		26	65	0	0	0	0.012213	0	26	65				
HK1	3098	broad.mit.edu	37	10	71144669	71144669	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:71144669G>A	ENST00000359426.6	+	12	1941	c.1837G>A	c.(1837-1839)Gcg>Acg	p.A613T	HK1_ENST00000494253.1_3'UTR|HK1_ENST00000360289.2_Missense_Mutation_p.A601T|HK1_ENST00000298649.3_Missense_Mutation_p.A612T|HK1_ENST00000448642.2_Missense_Mutation_p.A648T|HK1_ENST00000404387.2_Missense_Mutation_p.A617T	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	613	Catalytic.|Hexokinase type-1 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GAGTCTGGACGCGGTGAGTCT	0.592																																							uc001jpl.3		NA																	0				ovary(1)	1						c.(1837-1839)GCG>ACG		hexokinase 1 isoform HKI							128.0	122.0	124.0					10																	71144669		2203	4300	6503	SO:0001583	missense	3098				glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity	g.chr10:71144669G>A	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.1837G>A	10.37:g.71144669G>A	ENSP00000352398:p.Ala613Thr					HK1_uc001jpg.3_Missense_Mutation_p.A601T|HK1_uc001jph.3_Missense_Mutation_p.A617T|HK1_uc001jpi.3_Missense_Mutation_p.A617T|HK1_uc001jpj.3_Missense_Mutation_p.A648T|HK1_uc001jpk.3_Missense_Mutation_p.A612T|HK1_uc009xqd.2_Missense_Mutation_p.A491T	p.A613T	NM_000188	NP_000179	P19367	HXK1_HUMAN			12	1938	+			613			Catalytic.		E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	37	c.1837G>A	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.268948	0.59540	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.98947	-5.26;-5.26;-5.26;-5.26;-5.26	5.68	2.7	0.31948	Hexokinase, conserved site (1);Hexokinase, N-terminal (1);	0.417952	0.29791	N	0.011197	D	0.93083	0.7798	N	0.17248	0.465	0.46564	D	0.999103	B;B;B;B;B;P	0.38597	0.014;0.005;0.006;0.007;0.004;0.639	B;B;B;B;B;B	0.17433	0.007;0.003;0.002;0.006;0.002;0.018	D	0.89099	0.3488	10	0.49607	T	0.09	-2.3391	6.8644	0.24084	0.0698:0.1283:0.6688:0.1331	.	613;613;612;648;617;601	A8K7J7;P19367;P19367-2;E7ENR4;P19367-3;P19367-4	.;HXK1_HUMAN;.;.;.;.	T	601;648;617;612;613;613	ENSP00000353433:A601T;ENSP00000402103:A648T;ENSP00000384774:A617T;ENSP00000298649:A612T;ENSP00000352398:A613T	ENSP00000298649:A612T	A	+	1	0	HK1	70814675	0.391000	0.25221	0.389000	0.26208	0.842000	0.47809	2.908000	0.48750	0.288000	0.22398	0.591000	0.81541	GCG		0.592	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188		4	75	0	0	0	0.009096	0	4	75				
PIK3AP1	118788	broad.mit.edu	37	10	98412587	98412587	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:98412587C>A	ENST00000339364.5	-	4	699	c.580G>T	c.(580-582)Gtc>Ttc	p.V194F	PIK3AP1_ENST00000371110.2_Missense_Mutation_p.V16F|PIK3AP1_ENST00000468783.1_5'UTR	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	194	DBB. {ECO:0000255|PROSITE- ProRule:PRU00707}.				negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		ATAACATAGACAGTGGTTTCT	0.547																																							uc001kmq.2		NA																	0				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5						c.(580-582)GTC>TTC		phosphoinositide-3-kinase adaptor protein 1							140.0	133.0	136.0					10																	98412587		2203	4300	6503	SO:0001583	missense	118788					cytoplasm|plasma membrane		g.chr10:98412587C>A	AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.580G>T	10.37:g.98412587C>A	ENSP00000339826:p.Val194Phe					PIK3AP1_uc001kmp.2_Missense_Mutation_p.V16F	p.V194F	NM_152309	NP_689522	Q6ZUJ8	BCAP_HUMAN		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)	4	708	-		Colorectal(252;0.0442)	194			DBB.		Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Missense_Mutation	SNP	ENST00000339364.5	37	c.580G>T	CCDS31259.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727314	0.48833	.	.	ENSG00000155629	ENST00000339364;ENST00000371110	T;T	0.24151	2.53;1.87	6.03	4.2	0.49525	DBB domain (1);	0.181217	0.49916	D	0.000138	T	0.22085	0.0532	L	0.31926	0.97	0.80722	D	1	B	0.28820	0.224	B	0.33042	0.157	T	0.04961	-1.0915	10	0.87932	D	0	-18.4891	10.5498	0.45081	0.0:0.8524:0.0:0.1476	.	194	Q6ZUJ8	BCAP_HUMAN	F	194;16	ENSP00000339826:V194F;ENSP00000360151:V16F	ENSP00000339826:V194F	V	-	1	0	PIK3AP1	98402577	0.016000	0.18221	0.991000	0.47740	0.960000	0.62799	0.352000	0.20113	0.899000	0.36444	0.555000	0.69702	GTC		0.547	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049619.2	NM_152309		27	68	1	0	3.1745e-13	0.008361	4.02563e-13	27	68				
ENTPD7	57089	broad.mit.edu	37	10	101458401	101458401	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:101458401G>A	ENST00000370489.4	+	10	1299	c.1121G>A	c.(1120-1122)cGa>cAa	p.R374Q		NM_020354.3	NP_065087.1	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase 7	374						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		TTACATGTCCGAGGAAGAGGA	0.562																																							uc001kqa.3		NA																	0				ovary(1)	1						c.(1120-1122)CGA>CAA		ectonucleoside triphosphate diphosphohydrolase							113.0	101.0	105.0					10																	101458401		2203	4300	6503	SO:0001583	missense	57089					cytoplasmic vesicle membrane|integral to membrane	hydrolase activity	g.chr10:101458401G>A	AF269255	CCDS7480.1	10q23-q24	2004-07-01			ENSG00000198018	ENSG00000198018			19745	protein-coding gene	gene with protein product						11278936	Standard	NM_020354		Approved	LALP1, FLJ30978	uc001kqa.4	Q9NQZ7	OTTHUMG00000018888	ENST00000370489.4:c.1121G>A	10.37:g.101458401G>A	ENSP00000359520:p.Arg374Gln					ENTPD7_uc009xwl.2_Missense_Mutation_p.R376Q	p.R374Q	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)	10	1299	+		Colorectal(252;0.234)	374			Vesicular (Potential).		B2RB83|B3KP21|D3DR64	Missense_Mutation	SNP	ENST00000370489.4	37	c.1121G>A	CCDS7480.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.568148	0.28003	.	.	ENSG00000198018	ENST00000370489	T	0.11604	2.76	4.96	4.96	0.65561	.	0.072084	0.51477	D	0.000088	T	0.06050	0.0157	L	0.27975	0.815	0.30334	N	0.786342	P	0.37398	0.593	B	0.32583	0.148	T	0.13791	-1.0496	10	0.13470	T	0.59	-8.9004	7.6241	0.28202	0.0839:0.0:0.7505:0.1655	.	374	Q9NQZ7	ENTP7_HUMAN	Q	374	ENSP00000359520:R374Q	ENSP00000359520:R374Q	R	+	2	0	ENTPD7	101448391	1.000000	0.71417	0.994000	0.49952	0.037000	0.13140	5.368000	0.66133	2.583000	0.87209	0.655000	0.94253	CGA		0.562	ENTPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049809.2	NM_020354		11	41	0	0	0	0.010729	0	11	41				
PDCD11	22984	broad.mit.edu	37	10	105194595	105194595	+	Silent	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:105194595A>T	ENST00000369797.3	+	25	3802	c.3708A>T	c.(3706-3708)cgA>cgT	p.R1236R		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1236	S1 motif 11. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CCATGGGCCGAGTGGTGAAGG	0.537																																							uc001kwy.1		NA																	0				ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7						c.(3706-3708)CGA>CGT		programmed cell death 11							70.0	57.0	61.0					10																	105194595		2203	4300	6503	SO:0001819	synonymous_variant	22984				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding	g.chr10:105194595A>T	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.3708A>T	10.37:g.105194595A>T							p.R1236R	NM_014976	NP_055791	Q14690	RRP5_HUMAN		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)	25	3795	+		Colorectal(252;0.0747)|Breast(234;0.128)	1236			S1 motif 11.		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Silent	SNP	ENST00000369797.3	37	c.3708A>T	CCDS31276.1																																																																																				0.537	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1			4	23	0	0	0	0.000602	0	4	23				
ATRNL1	26033	broad.mit.edu	37	10	116919926	116919926	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:116919926G>T	ENST00000355044.3	+	6	1081	c.955G>T	c.(955-957)Gtg>Ttg	p.V319L	ATRNL1_ENST00000527407.1_Missense_Mutation_p.V319L|ATRNL1_ENST00000529665.1_3'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	319					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ATTTATGTGGGTGATTGGTGG	0.368																																							uc001lcg.2		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)	7						c.(955-957)GTG>TTG		attractin-like 1 precursor							221.0	228.0	225.0					10																	116919926		2203	4300	6503	SO:0001583	missense	26033					integral to membrane	sugar binding	g.chr10:116919926G>T	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.955G>T	10.37:g.116919926G>T	ENSP00000347152:p.Val319Leu					ATRNL1_uc001lce.2_RNA|ATRNL1_uc001lcf.2_Missense_Mutation_p.V319L|ATRNL1_uc009xyq.2_Missense_Mutation_p.V319L	p.V319L	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)	6	1341	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	319			Extracellular (Potential).|Kelch 1.		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	c.955G>T	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.237706	0.79800	.	.	ENSG00000107518	ENST00000526946;ENST00000355044	T;T	0.71461	1.25;-0.57	5.83	5.83	0.93111	.	0.114444	0.64402	D	0.000013	D	0.83413	0.5249	M	0.66939	2.045	0.80722	D	1	D;D;D	0.67145	0.994;0.984;0.996	D;D;D	0.77557	0.978;0.956;0.99	D	0.84108	0.0399	10	0.72032	D	0.01	-12.4215	18.2995	0.90158	0.0:0.0:1.0:0.0	.	252;319;319	E9PL90;Q5VV63;Q5VV63-2	.;ATRN1_HUMAN;.	L	252;319	ENSP00000431423:V252L;ENSP00000347152:V319L	ENSP00000347152:V319L	V	+	1	0	ATRNL1	116909916	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.835000	0.99442	2.763000	0.94921	0.555000	0.69702	GTG		0.368	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		19	67	1	0	1.40151e-16	0.010504	1.81677e-16	19	67				
BUB3	9184	broad.mit.edu	37	10	124914503	124914503	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:124914503C>T	ENST00000368865.4	+	2	279	c.70C>T	c.(70-72)Ccc>Tcc	p.P24S	BUB3_ENST00000538238.1_Intron|BUB3_ENST00000368859.2_Missense_Mutation_p.P24S|BUB3_ENST00000368858.5_Missense_Mutation_p.P24S	NM_004725.3	NP_004716.1	O43684	BUB3_HUMAN	BUB3 mitotic checkpoint protein	24					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|regulation of chromosome segregation (GO:0051983)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly checkpoint (GO:0071173)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	9		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)				GAAGTTCAGCCCCAACACCTC	0.612																																					GBM(161;1111 1985 17553 20049 26037)	GBM(161;1111 1985 17553 20049 26037)	uc001lhe.2		NA																	0				ovary(1)	1						c.(70-72)CCC>TCC		budding uninhibited by benzimidazoles 3 isoform							136.0	111.0	119.0					10																	124914503		2203	4300	6503	SO:0001583	missense	9184				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|attachment of spindle microtubules to kinetochore|cell division|meiosis|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle	condensed chromosome kinetochore|cytosol|nucleus	protein binding	g.chr10:124914503C>T	AF053304	CCDS7635.1, CCDS31306.1	10q24	2013-01-17	2013-01-17		ENSG00000154473	ENSG00000154473		"""WD repeat domain containing"""	1151	protein-coding gene	gene with protein product		603719	"""BUB3 (budding uninhibited by benzimidazoles 3, yeast) homolog"", ""budding uninhibited by benzimidazoles 3 homolog (yeast)"""			9660858	Standard	NM_004725		Approved	BUB3L	uc001lhe.2	O43684	OTTHUMG00000019197	ENST00000368865.4:c.70C>T	10.37:g.124914503C>T	ENSP00000357858:p.Pro24Ser					BUB3_uc009yah.2_5'UTR|BUB3_uc001lhf.3_Missense_Mutation_p.P24S|BUB3_uc001lhd.2_Missense_Mutation_p.P24S|BUB3_uc010qud.1_Intron	p.P24S	NM_004725	NP_004716	O43684	BUB3_HUMAN			2	312	+		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)	24			WD 1.		A6NJ42|B2R6E7|D3DRE9|O43685	Missense_Mutation	SNP	ENST00000368865.4	37	c.70C>T	CCDS7635.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963832	0.74131	.	.	ENSG00000154473	ENST00000368865;ENST00000368859;ENST00000368858;ENST00000407911	T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48	4.45	4.45	0.53987	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.72145	0.3424	L	0.58354	1.805	0.80722	D	1	P;B	0.37207	0.587;0.069	B;B	0.41946	0.371;0.066	T	0.76105	-0.3081	10	0.56958	D	0.05	-0.4063	17.101	0.86649	0.0:1.0:0.0:0.0	.	24;24	O43684;O43684-2	BUB3_HUMAN;.	S	24	ENSP00000357858:P24S;ENSP00000357852:P24S;ENSP00000357851:P24S;ENSP00000383941:P24S	ENSP00000357851:P24S	P	+	1	0	BUB3	124904493	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.029000	0.70895	2.011000	0.59026	0.555000	0.69702	CCC		0.612	BUB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050835.1			26	108	0	0	0	0.00632	0	26	108				
MKI67	4288	broad.mit.edu	37	10	129902974	129902974	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr10:129902974C>T	ENST00000368654.3	-	13	7505	c.7130G>A	c.(7129-7131)aGg>aAg	p.R2377K	MKI67_ENST00000368653.3_Missense_Mutation_p.R2017K	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2377	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGTTCGTTTCCTGAGTGCTAA	0.473																																							uc001lke.2		NA																	0				ovary(4)|central_nervous_system(2)|skin(1)	7						c.(7129-7131)AGG>AAG		antigen identified by monoclonal antibody Ki-67							353.0	351.0	352.0					10																	129902974		2203	4300	6503	SO:0001583	missense	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129902974C>T	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.7130G>A	10.37:g.129902974C>T	ENSP00000357643:p.Arg2377Lys					MKI67_uc001lkf.2_Missense_Mutation_p.R2017K|MKI67_uc009yav.1_Missense_Mutation_p.R1952K|MKI67_uc009yaw.1_Missense_Mutation_p.R1527K	p.R2377K	NM_002417	NP_002408	P46013	KI67_HUMAN			13	7325	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	2377			16 X 122 AA approximate repeats.|12.		Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	c.7130G>A	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	9.874	1.199870	0.22121	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02216	4.39;4.39	2.7	-0.375	0.12509	.	2.461470	0.01756	N	0.030224	T	0.05502	0.0145	L	0.42686	1.345	0.09310	N	1	B;D;P	0.76494	0.22;0.999;0.951	B;D;P	0.68483	0.047;0.958;0.76	T	0.53092	-0.8487	10	0.05525	T	0.97	.	4.1919	0.10424	0.0:0.5295:0.2174:0.2531	.	2376;2017;2377	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	K	2377;2017;2376	ENSP00000357643:R2377K;ENSP00000357642:R2017K	ENSP00000357642:R2017K	R	-	2	0	MKI67	129792964	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.718000	0.04980	-0.074000	0.12820	0.462000	0.41574	AGG		0.473	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		58	166	0	0	0	0.01441	0	58	166				
ABCC8	6833	broad.mit.edu	37	11	17464292	17464292	+	Silent	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:17464292G>C	ENST00000389817.3	-	10	1673	c.1605C>G	c.(1603-1605)gcC>gcG	p.A535A	ABCC8_ENST00000528202.1_5'UTR|ABCC8_ENST00000302539.4_Silent_p.A535A			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	535	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	AGATGGCAAAGGCCCTGAGGC	0.607																																							uc001mnc.2		NA																	0				ovary(1)	1						c.(1603-1605)GCC>GCG		ATP-binding cassette, sub-family C, member 8	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)						104.0	91.0	95.0					11																	17464292		2200	4293	6493	SO:0001819	synonymous_variant	6833				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity	g.chr11:17464292G>C	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.1605C>G	11.37:g.17464292G>C						ABCC8_uc010rcy.1_Silent_p.A534A	p.A535A	NM_000352	NP_000343	Q09428	ABCC8_HUMAN		READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	10	1731	-			535			Cytoplasmic (By similarity).|ABC transmembrane type-1 1.		A6NMX8|E3UYX6|O75948|Q16583	Silent	SNP	ENST00000389817.3	37	c.1605C>G	CCDS31437.1																																																																																				0.607	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352		4	44	0	0	0	0.009096	0	4	44				
IGSF22	283284	broad.mit.edu	37	11	18731128	18731128	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:18731128T>C	ENST00000513874.1	-	18	2943	c.2804A>G	c.(2803-2805)tAc>tGc	p.Y935C	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	834										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CTCAAGGATGTAGCCAGAGGG	0.587																																							uc009yht.2		NA																	0				ovary(4)|large_intestine(2)|kidney(1)	7						c.(2803-2805)TAC>TGC		immunoglobulin superfamily, member 22							64.0	68.0	67.0					11																	18731128		1957	4134	6091	SO:0001583	missense	283284							g.chr11:18731128T>C	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.2804A>G	11.37:g.18731128T>C	ENSP00000421191:p.Tyr935Cys					IGSF22_uc001mpa.2_RNA	p.Y935C	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN			18	2994	-			834			Fibronectin type-III 2.		A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	37	c.2804A>G	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	T	18.18	3.567744	0.65651	.	.	ENSG00000179057	ENST00000513874	T	0.81330	-1.48	4.58	3.46	0.39613	.	.	.	.	.	D	0.92237	0.7538	H	0.97291	3.975	0.31067	N	0.713436	D	0.89917	1.0	D	0.91635	0.999	D	0.89415	0.3706	9	0.87932	D	0	.	8.3253	0.32153	0.0:0.0911:0.0:0.9088	.	935	D6RGV7	.	C	935	ENSP00000421191:Y935C	ENSP00000322422:Y834C	Y	-	2	0	IGSF22	18687704	1.000000	0.71417	0.954000	0.39281	0.975000	0.68041	3.342000	0.52159	0.812000	0.34326	0.533000	0.62120	TAC		0.587	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588		3	34	0	0	0	0.004672	0	3	34				
DCDC1	341019	broad.mit.edu	37	11	30974034	30974034	+	Silent	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:30974034A>T	ENST00000597505.1	-	19	2672	c.2673T>A	c.(2671-2673)ctT>ctA	p.L891L	DCDC1_ENST00000339794.5_5'UTR|DCDC1_ENST00000437348.1_Intron|DCDC1_ENST00000406071.2_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					ACATGTAGGTAAGCTTGTTCC	0.423																																							uc009yjk.1		NA																	0					NA						c.(1015-1017)CTT>CTA		RecName: Full=Doublecortin domain-containing protein 5;							149.0	139.0	142.0					11																	30974034		1900	4122	6022	SO:0001819	synonymous_variant	0							g.chr11:30974034A>T	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.2673T>A	11.37:g.30974034A>T						uc009yjl.1_Intron|DCDC1_uc001msu.1_Silent_p.L510L	p.L339L							9	1086	-								A6PVL6|B7WNX6|Q6ZU04	Silent	SNP	ENST00000597505.1	37	c.1017T>A																																																																																					0.423	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1	NM_181807		5	16	0	0	0	0.001168	0	5	16				
LRRC4C	57689	broad.mit.edu	37	11	40136708	40136708	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:40136708T>A	ENST00000278198.2	-	2	3098	c.1135A>T	c.(1135-1137)Aca>Tca	p.T379S	LRRC4C_ENST00000528697.1_Missense_Mutation_p.T379S|LRRC4C_ENST00000530763.1_Missense_Mutation_p.T379S|LRRC4C_ENST00000527150.1_Missense_Mutation_p.T379S			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	379	Ig-like C2-type.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GTCAGGGATGTGGAGGCCCGA	0.502																																							uc001mxa.1		NA																	0				ovary(4)|skin(3)|central_nervous_system(1)	8						c.(1135-1137)ACA>TCA		netrin-G1 ligand precursor							104.0	94.0	98.0					11																	40136708		2203	4300	6503	SO:0001583	missense	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136708T>A	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1135A>T	11.37:g.40136708T>A	ENSP00000278198:p.Thr379Ser					LRRC4C_uc001mxc.1_Missense_Mutation_p.T375S|LRRC4C_uc001mxd.1_Missense_Mutation_p.T375S|LRRC4C_uc001mxb.1_Missense_Mutation_p.T375S	p.T379S	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN			2	3099	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	379			Ig-like C2-type.		A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	c.1135A>T	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	T	2.829	-0.243121	0.05906	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	5.87	5.87	0.94306	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000004	T	0.44973	0.1319	N	0.00637	-1.305	0.39965	D	0.97471	P	0.45078	0.85	P	0.48598	0.583	T	0.62927	-0.6750	10	0.33141	T	0.24	.	15.5103	0.75776	0.0:0.0:0.0:1.0	.	379	Q9HCJ2	LRC4C_HUMAN	S	379	ENSP00000278198:T379S;ENSP00000436976:T379S;ENSP00000437132:T379S;ENSP00000434761:T379S	ENSP00000278198:T379S	T	-	1	0	LRRC4C	40093284	1.000000	0.71417	0.999000	0.59377	0.282000	0.26991	6.077000	0.71275	2.258000	0.74832	0.529000	0.55759	ACA		0.502	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		17	62	0	0	0	0.00499	0	17	62				
OR4A16	81327	broad.mit.edu	37	11	55110797	55110797	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:55110797C>A	ENST00000314721.2	+	1	171	c.121C>A	c.(121-123)Ctc>Atc	p.L41I		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						GGTGGGAAACCTCCTCATTTG	0.428																																							uc010rie.1		NA																	0				large_intestine(2)|pancreas(1)	3						c.(121-123)CTC>ATC		olfactory receptor, family 4, subfamily A,							122.0	115.0	117.0					11																	55110797		2201	4296	6497	SO:0001583	missense	81327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55110797C>A	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.121C>A	11.37:g.55110797C>A	ENSP00000325128:p.Leu41Ile						p.L41I	NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN			1	121	+			41			Helical; Name=1; (Potential).		Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	37	c.121C>A	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	c	7.591	0.670790	0.14776	.	.	ENSG00000181961	ENST00000314721	T	0.00433	7.43	2.41	1.46	0.22682	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00356	0.0011	L	0.48174	1.505	0.09310	N	1	P	0.35714	0.517	B	0.37833	0.259	T	0.45160	-0.9280	9	0.59425	D	0.04	.	6.7077	0.23260	0.0:0.8361:0.0:0.1639	.	41	Q8NH70	O4A16_HUMAN	I	41	ENSP00000325128:L41I	ENSP00000325128:L41I	L	+	1	0	OR4A16	54867373	0.000000	0.05858	0.772000	0.31596	0.023000	0.10783	-0.898000	0.04105	1.353000	0.45828	0.185000	0.17295	CTC		0.428	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274		13	58	1	0	1.5739e-10	0.004007	1.893e-10	13	58				
OR5F1	338674	broad.mit.edu	37	11	55761300	55761300	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:55761300G>T	ENST00000278409.1	-	1	801	c.802C>A	c.(802-804)Ctg>Atg	p.L268M		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	268					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					TCCTGATTCAGGGAGTAGCTG	0.473																																							uc010riv.1		NA																	0				ovary(1)|pancreas(1)	2						c.(802-804)CTG>ATG		olfactory receptor, family 5, subfamily F,							93.0	92.0	93.0					11																	55761300		2201	4296	6497	SO:0001583	missense	338674				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55761300G>T	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.802C>A	11.37:g.55761300G>T	ENSP00000278409:p.Leu268Met						p.L268M	NM_003697	NP_003688	O95221	OR5F1_HUMAN			1	802	-	Esophageal squamous(21;0.00448)		268			Extracellular (Potential).		Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	c.802C>A	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	G	1.422	-0.572638	0.03882	.	.	ENSG00000149133	ENST00000278409	T	0.00123	8.7	2.99	0.758	0.18432	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00178	0.0005	L	0.43598	1.365	0.09310	N	1	D	0.61697	0.99	D	0.63703	0.917	T	0.39522	-0.9610	9	0.05436	T	0.98	.	2.4063	0.04414	0.126:0.1826:0.5059:0.1855	.	268	O95221	OR5F1_HUMAN	M	268	ENSP00000278409:L268M	ENSP00000278409:L268M	L	-	1	2	OR5F1	55517876	0.000000	0.05858	0.647000	0.29507	0.136000	0.21042	-3.904000	0.00338	1.417000	0.47077	0.289000	0.19496	CTG		0.473	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697		20	46	1	0	5.35356e-11	0.00278	6.46119e-11	20	46				
ESRRA	2101	broad.mit.edu	37	11	64074874	64074874	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:64074874C>T	ENST00000405666.1	+	2	457	c.223C>T	c.(223-225)Ccc>Tcc	p.P75S	RP11-783K16.10_ENST00000539086.1_RNA|ESRRA_ENST00000406310.1_Missense_Mutation_p.P75S|ESRRA_ENST00000000442.6_Missense_Mutation_p.P75S	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha	75	Repressor domain.				cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						CAGCTCCCTGCCCAAGCGCCT	0.657																																							uc001nzq.1		NA																	0					0						c.(223-225)CCC>TCC		estrogen-related receptor alpha							19.0	22.0	21.0					11																	64074874		2069	4197	6266	SO:0001583	missense	2101				positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein domain specific binding|sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding	g.chr11:64074874C>T	X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.223C>T	11.37:g.64074874C>T	ENSP00000384851:p.Pro75Ser					ESRRA_uc001nzr.1_Missense_Mutation_p.P75S|ESRRA_uc001nzs.1_Missense_Mutation_p.P75S	p.P75S	NM_004451	NP_004442	P11474	ERR1_HUMAN			2	400	+			75			Repressor domain.		Q14514	Missense_Mutation	SNP	ENST00000405666.1	37	c.223C>T	CCDS41667.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702727	0.68501	.	.	ENSG00000173153	ENST00000406310;ENST00000000442;ENST00000405666;ENST00000468670	D;D;D;D	0.95622	-2.99;-3.03;-3.03;-3.76	4.3	4.3	0.51218	Zinc finger, NHR/GATA-type (1);	0.116551	0.64402	D	0.000016	D	0.92629	0.7658	N	0.25031	0.7	0.80722	D	1	B;P	0.51449	0.018;0.945	B;P	0.48030	0.031;0.564	D	0.93412	0.6769	10	0.59425	D	0.04	.	14.6596	0.68861	0.0:1.0:0.0:0.0	.	75;75	P11474-2;P11474	.;ERR1_HUMAN	S	75	ENSP00000385971:P75S;ENSP00000000442:P75S;ENSP00000384851:P75S;ENSP00000441970:P75S	ENSP00000000442:P75S	P	+	1	0	ESRRA	63831450	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.329000	0.79170	2.399000	0.81585	0.462000	0.41574	CCC		0.657	ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319304.1	NM_004451		2	17	0	0	0	0.009096	0	2	17				
CDCA5	113130	broad.mit.edu	37	11	64850855	64850855	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:64850855G>A	ENST00000275517.3	-	4	396	c.224C>T	c.(223-225)tCa>tTa	p.S75L	ZFPL1_ENST00000526791.1_5'Flank|CDCA5_ENST00000404147.3_Missense_Mutation_p.S75L|ZFPL1_ENST00000294258.3_5'Flank|ZFPL1_ENST00000525509.1_5'Flank	NM_080668.3	NP_542399.1	Q96FF9	CDCA5_HUMAN	cell division cycle associated 5	75					double-strand break repair (GO:0006302)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|regulation of cohesin localization to chromatin (GO:0071922)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			large_intestine(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						CCTGCGAGGTGATTGGACAGC	0.507																																							uc001ocp.2		NA																	0					0						c.(223-225)TCA>TTA		cell division cycle associated 5							108.0	106.0	106.0					11																	64850855		2201	4297	6498	SO:0001583	missense	113130				cell division|double-strand break repair|G1/S transition of mitotic cell cycle|mitotic chromosome condensation|mitotic metaphase plate congression|mitotic sister chromatid cohesion|regulation of cohesin localization to chromatin	cytoplasm|nuclear chromatin|plasma membrane	chromatin binding|identical protein binding	g.chr11:64850855G>A	BG354578	CCDS8091.1	11q13.1	2011-01-31			ENSG00000146670	ENSG00000146670			14626	protein-coding gene	gene with protein product	"""sororin"""	609374				12188893, 15837422	Standard	NM_080668		Approved		uc001ocp.2	Q96FF9	OTTHUMG00000150420	ENST00000275517.3:c.224C>T	11.37:g.64850855G>A	ENSP00000275517:p.Ser75Leu					ZFPL1_uc009yqa.2_5'Flank|ZFPL1_uc001ocq.1_5'Flank|ZFPL1_uc010rnx.1_5'Flank	p.S75L	NM_080668	NP_542399	Q96FF9	CDCA5_HUMAN			4	389	-			75					A8K625	Missense_Mutation	SNP	ENST00000275517.3	37	c.224C>T	CCDS8091.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.433713	0.43224	.	.	ENSG00000146670	ENST00000275517;ENST00000404147	T;T	0.48836	0.88;0.8	4.09	3.18	0.36537	.	0.621055	0.15753	N	0.246304	T	0.37705	0.1013	L	0.44542	1.39	0.09310	N	1	B	0.17038	0.02	B	0.15052	0.012	T	0.32348	-0.9910	10	0.59425	D	0.04	.	7.7621	0.28959	0.1131:0.0:0.8869:0.0	.	75	Q96FF9	CDCA5_HUMAN	L	75	ENSP00000275517:S75L;ENSP00000385711:S75L	ENSP00000275517:S75L	S	-	2	0	CDCA5	64607431	0.055000	0.20627	0.002000	0.10522	0.097000	0.18754	3.817000	0.55668	1.298000	0.44778	0.561000	0.74099	TCA		0.507	CDCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385186.1	NM_080668		4	45	0	0	0	0.009096	0	4	45				
POLA2	23649	broad.mit.edu	37	11	65055233	65055233	+	Silent	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:65055233A>T	ENST00000265465.3	+	11	1584	c.1053A>T	c.(1051-1053)acA>acT	p.T351T	POLA2_ENST00000541089.1_Silent_p.T143T	NM_002689.2	NP_002680.2	Q14181	DPOA2_HUMAN	polymerase (DNA directed), alpha 2, accessory subunit	351					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein import into nucleus, translocation (GO:0000060)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|protein heterodimerization activity (GO:0046982)			endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	11					Dacarbazine(DB00851)	CATACACCACATCTGACAGCA	0.493																																							uc001odj.2		NA																	0					0						c.(1051-1053)ACA>ACT		DNA-directed DNA polymerase alpha 2	Dacarbazine(DB00851)						175.0	131.0	146.0					11																	65055233		2201	4297	6498	SO:0001819	synonymous_variant	23649				DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	nucleoplasm	DNA binding	g.chr11:65055233A>T	BC002990	CCDS8098.1	11q13	2012-05-18	2012-05-18		ENSG00000014138	ENSG00000014138		"""DNA polymerases"""	30073	protein-coding gene	gene with protein product	"""DNA polymerase alpha subunit B"", ""DNA polymerase alpha 70 kDa subunit"""		"""polymerase (DNA directed), alpha 2 (70kD subunit)"""			8223465, 11433027	Standard	NM_002689		Approved	FLJ21662	uc001odj.3	Q14181	OTTHUMG00000165951	ENST00000265465.3:c.1053A>T	11.37:g.65055233A>T						POLA2_uc010rod.1_Silent_p.T143T|POLA2_uc001odk.2_Silent_p.T48T	p.T351T	NM_002689	NP_002680	Q14181	DPOA2_HUMAN			11	1395	+			351					B4DNB4|Q9BPV3	Silent	SNP	ENST00000265465.3	37	c.1053A>T	CCDS8098.1	.	.	.	.	.	.	.	.	.	.	G	0.747	-0.774210	0.02951	.	.	ENSG00000014138	ENST00000525924	.	.	.	5.95	-11.9	0.00025	.	.	.	.	.	T	0.41719	0.1171	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51252	-0.8729	4	.	.	.	-19.9762	6.1905	0.20522	0.5373:0.2308:0.1669:0.0649	.	.	.	.	L	21	.	.	H	+	2	0	POLA2	64811809	0.000000	0.05858	0.069000	0.20011	0.023000	0.10783	-4.939000	0.00168	-2.325000	0.00638	-1.653000	0.00756	CAT		0.493	POLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387223.1	NM_002689		6	50	0	0	0	0.00308	0	6	50				
CCDC87	55231	broad.mit.edu	37	11	66358060	66358060	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:66358060C>T	ENST00000333861.3	-	1	2494	c.2427G>A	c.(2425-2427)atG>atA	p.M809I	CCS_ENST00000533244.1_5'Flank|CCS_ENST00000310190.4_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	809					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						TGTCACTCTTCATCTTGTCCA	0.537																																							uc001oiq.3		NA																	0				ovary(1)|skin(1)	2						c.(2425-2427)ATG>ATA		coiled-coil domain containing 87							205.0	215.0	212.0					11																	66358060		2200	4295	6495	SO:0001583	missense	55231							g.chr11:66358060C>T	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.2427G>A	11.37:g.66358060C>T	ENSP00000328487:p.Met809Ile					CCS_uc001oir.2_5'Flank	p.M809I	NM_018219	NP_060689	Q9NVE4	CCD87_HUMAN			1	2495	-			809					Q8NE76	Missense_Mutation	SNP	ENST00000333861.3	37	c.2427G>A	CCDS8145.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760739	0.49468	.	.	ENSG00000182791	ENST00000333861	T	0.27256	1.68	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000003	T	0.45155	0.1328	L	0.52905	1.665	0.43263	D	0.995205	D	0.69078	0.997	D	0.81914	0.995	T	0.11792	-1.0573	10	0.33141	T	0.24	.	14.8917	0.70614	0.0:1.0:0.0:0.0	.	809	Q9NVE4	CCD87_HUMAN	I	809	ENSP00000328487:M809I	ENSP00000328487:M809I	M	-	3	0	CCDC87	66114636	1.000000	0.71417	1.000000	0.80357	0.237000	0.25408	4.508000	0.60441	2.591000	0.87537	0.491000	0.48974	ATG		0.537	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	NM_018219		5	249	0	0	0	0.001168	0	5	249				
INTS4	92105	broad.mit.edu	37	11	77705651	77705651	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:77705651G>C	ENST00000534064.1	-	1	73	c.39C>G	c.(37-39)ttC>ttG	p.F13L	INTS4_ENST00000527522.1_Missense_Mutation_p.F13L|INTS4_ENST00000529807.1_Missense_Mutation_p.F13L	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	13					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			CCACTTTCGTGAATTCCTCAT	0.582																																							uc001oys.2		NA																	0				ovary(2)	2						c.(37-39)TTC>TTG		integrator complex subunit 4							94.0	87.0	90.0					11																	77705651		2200	4292	6492	SO:0001583	missense	92105				snRNA processing	integrator complex	protein binding	g.chr11:77705651G>C	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.39C>G	11.37:g.77705651G>C	ENSP00000434466:p.Phe13Leu					INTS4_uc001oyt.2_RNA|INTS4_uc001oyu.1_Missense_Mutation_p.F13L|INTS4_uc001oyv.1_RNA	p.F13L	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)		1	67	-	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		13					Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	37	c.39C>G	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	G	29.4	4.999162	0.93227	.	.	ENSG00000149262	ENST00000534064;ENST00000529807;ENST00000527522	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.78698	0.4324	M	0.71581	2.175	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.79438	-0.1803	9	0.72032	D	0.01	-18.106	19.5509	0.95319	0.0:0.0:1.0:0.0	.	13	Q96HW7	INT4_HUMAN	L	13	.	ENSP00000407787:F13L	F	-	3	2	INTS4	77383299	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	4.401000	0.59716	2.852000	0.98041	0.643000	0.83706	TTC		0.582	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547		12	86	0	0	0	0.00245	0	12	86				
NOX4	50507	broad.mit.edu	37	11	89088169	89088169	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:89088169G>T	ENST00000263317.4	-	13	1416	c.1178C>A	c.(1177-1179)tCc>tAc	p.S393Y	NOX4_ENST00000343727.5_Missense_Mutation_p.S369Y|NOX4_ENST00000528341.1_Missense_Mutation_p.S368Y|NOX4_ENST00000531342.1_Missense_Mutation_p.S86Y|NOX4_ENST00000424319.1_Missense_Mutation_p.S369Y|NOX4_ENST00000413594.2_Missense_Mutation_p.S414Y|NOX4_ENST00000534731.1_Missense_Mutation_p.S393Y|NOX4_ENST00000527626.1_Missense_Mutation_p.S227Y|NOX4_ENST00000535633.1_Missense_Mutation_p.S369Y|NOX4_ENST00000532825.1_Missense_Mutation_p.S369Y|NOX4_ENST00000525196.1_Intron|NOX4_ENST00000542487.1_Missense_Mutation_p.S369Y|NOX4_ENST00000375979.3_Missense_Mutation_p.S86Y|NOX4_ENST00000527956.1_Missense_Mutation_p.S369Y			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	393	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.|Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				CAGAATTTCGGAGTCTTGACT	0.368																																							uc001pct.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1177-1179)TCC>TAC		NADPH oxidase 4 isoform a							52.0	52.0	52.0					11																	89088169		2201	4295	6496	SO:0001583	missense	50507				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity	g.chr11:89088169G>T	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1178C>A	11.37:g.89088169G>T	ENSP00000263317:p.Ser393Tyr					NOX4_uc009yvr.2_Missense_Mutation_p.S368Y|NOX4_uc001pcu.2_Missense_Mutation_p.S319Y|NOX4_uc001pcw.2_Missense_Mutation_p.S86Y|NOX4_uc001pcx.2_Missense_Mutation_p.S86Y|NOX4_uc001pcv.2_Missense_Mutation_p.S393Y|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_Missense_Mutation_p.S227Y|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Missense_Mutation_p.S369Y|NOX4_uc009yvq.2_Missense_Mutation_p.S369Y	p.S393Y	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN			13	1417	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)	393			FAD-binding FR-type.|Extracellular (Potential).|Mediates interaction with TLR4.		A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	37	c.1178C>A	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	G	9.358	1.067211	0.20067	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594;ENST00000531342;ENST00000375979	D;D;D;D;D;D;D;D;D;D;D;D;D	0.95724	-3.76;-3.76;-3.76;-3.66;-3.68;-3.75;-3.76;-3.76;-3.48;-3.73;-3.79;-3.07;-3.13	5.31	5.31	0.75309	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.248975	0.35970	N	0.002863	D	0.96719	0.8929	L	0.58354	1.805	0.39553	D	0.969002	P;P;P;D;P;B;B	0.64830	0.759;0.843;0.908;0.994;0.63;0.05;0.31	P;P;P;D;B;B;B	0.74348	0.463;0.49;0.587;0.983;0.243;0.061;0.232	D	0.96630	0.9466	9	.	.	.	-14.459	14.4891	0.67639	0.0:0.0:1.0:0.0	.	369;227;368;86;86;393;393	E9PMY6;E9PR43;E9PPP2;Q9NPH5-3;Q9NPH5-4;Q9NPH5-6;Q9NPH5	.;.;.;.;.;.;NOX4_HUMAN	Y	369;369;369;393;393;369;369;369;227;368;414;86;86	ENSP00000412446:S369Y;ENSP00000440172:S369Y;ENSP00000344747:S369Y;ENSP00000436892:S393Y;ENSP00000263317:S393Y;ENSP00000434924:S369Y;ENSP00000433797:S369Y;ENSP00000439373:S369Y;ENSP00000436093:S227Y;ENSP00000436970:S368Y;ENSP00000405705:S414Y;ENSP00000435039:S86Y;ENSP00000365146:S86Y	.	S	-	2	0	NOX4	88727817	0.990000	0.36364	1.000000	0.80357	0.920000	0.55202	3.670000	0.54569	2.479000	0.83701	0.563000	0.77884	TCC		0.368	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931		5	12	1	0	0.00198382	0.001984	0.00209137	5	12				
NAALAD2	10003	broad.mit.edu	37	11	89885504	89885504	+	Silent	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:89885504C>A	ENST00000534061.1	+	6	878	c.648C>A	c.(646-648)atC>atA	p.I216I	NAALAD2_ENST00000375944.3_Silent_p.I216I|NAALAD2_ENST00000525171.1_Silent_p.I216I|NAALAD2_ENST00000321955.4_Silent_p.I216I	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	216					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TAGGAATCATCTTGTACTCAG	0.438																																							uc001pdf.3		NA																	0				pancreas(1)|skin(1)	2						c.(646-648)ATC>ATA		N-acetylated alpha-linked acidic dipeptidase 2							120.0	102.0	108.0					11																	89885504		2201	4299	6500	SO:0001819	synonymous_variant	10003				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity	g.chr11:89885504C>A	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.648C>A	11.37:g.89885504C>A						NAALAD2_uc009yvx.2_Silent_p.I216I|NAALAD2_uc009yvy.2_Silent_p.I216I|NAALAD2_uc001pdd.2_Silent_p.I216I|NAALAD2_uc001pde.2_Silent_p.I216I	p.I216I	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN			6	757	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)	216			Extracellular (Potential).		B3KQR4|Q4KKV4|Q4VAM9	Silent	SNP	ENST00000534061.1	37	c.648C>A	CCDS8288.1																																																																																				0.438	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467		6	34	1	0	0.00307968	0.00308	0.00321758	6	34				
CNTN5	53942	broad.mit.edu	37	11	100211914	100211914	+	Missense_Mutation	SNP	G	G	A	rs201638465		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:100211914G>A	ENST00000524871.1	+	23	3297	c.3007G>A	c.(3007-3009)Gaa>Aaa	p.E1003K	CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000279463.3_Missense_Mutation_p.E1003K|CNTN5_ENST00000418526.2_Missense_Mutation_p.E929K|CNTN5_ENST00000528682.1_Missense_Mutation_p.E1003K	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	1003	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ATTAGCCAACGAATCTGAAGT	0.433																																							uc001pga.2		NA																	0				skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(3007-3009)GAA>AAA		contactin 5 isoform long							139.0	137.0	137.0					11																	100211914		1866	4109	5975	SO:0001583	missense	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:100211914G>A	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.3007G>A	11.37:g.100211914G>A	ENSP00000435637:p.Glu1003Lys					CNTN5_uc001pgb.2_Missense_Mutation_p.E929K|CNTN5_uc010ruk.1_Missense_Mutation_p.E274K	p.E1003K	NM_014361	NP_055176	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	23	3346	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	1003			Fibronectin type-III 4.		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	c.3007G>A	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703237	0.88924	.	.	ENSG00000149972	ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	5.46	5.46	0.80206	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.72293	0.3442	M	0.83312	2.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	T	0.74523	-0.3637	9	.	.	.	.	18.288	0.90120	0.0:0.0:1.0:0.0	.	929;1003	O94779-2;O94779	.;CNTN5_HUMAN	K	1003;1003;929;1003	ENSP00000436185:E1003K;ENSP00000435637:E1003K;ENSP00000393229:E929K;ENSP00000279463:E1003K	.	E	+	1	0	CNTN5	99717124	1.000000	0.71417	0.978000	0.43139	0.872000	0.50106	8.972000	0.93424	2.566000	0.86566	0.655000	0.94253	GAA		0.433	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		21	58	0	0	0	0.00333	0	21	58				
PGR	5241	broad.mit.edu	37	11	100999577	100999577	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:100999577C>A	ENST00000325455.5	-	1	1678	c.225G>T	c.(223-225)caG>caT	p.Q75H	PGR_ENST00000534013.1_Intron|PGR_ENST00000263463.5_Missense_Mutation_p.Q75H	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	75	Modulating, Pro-Rich.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	ACTGCTGGTCCTGCGTCTTTT	0.612																																					Pancreas(124;2271 2354 21954 22882)	Pancreas(124;2271 2354 21954 22882)	uc001pgh.2		NA																	0				lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4						c.(223-225)CAG>CAT		progesterone receptor	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)						64.0	55.0	58.0					11																	100999577		2203	4300	6503	SO:0001583	missense	5241				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr11:100999577C>A	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.225G>T	11.37:g.100999577C>A	ENSP00000325120:p.Gln75His					PGR_uc001pgi.2_Missense_Mutation_p.Q75H|PGR_uc009yww.1_RNA|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA|uc010rum.1_5'Flank	p.Q75H	NM_000926	NP_000917	P06401	PRGR_HUMAN		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	1	968	-		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)	75			Modulating, Pro-Rich.		A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	37	c.225G>T	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.564844	0.27915	.	.	ENSG00000082175	ENST00000325455;ENST00000263463;ENST00000537623	T;T	0.08984	3.03;3.03	4.2	0.83	0.18854	.	1.724340	0.03456	N	0.211384	T	0.13841	0.0335	M	0.61703	1.905	0.09310	N	1	P;P	0.37573	0.6;0.6	B;B	0.42959	0.403;0.403	T	0.27773	-1.0064	10	0.72032	D	0.01	.	3.5157	0.07723	0.0:0.5319:0.2145:0.2536	.	75;75	Q8TDS3;P06401	.;PRGR_HUMAN	H	75	ENSP00000325120:Q75H;ENSP00000263463:Q75H	ENSP00000263463:Q75H	Q	-	3	2	PGR	100504787	0.000000	0.05858	0.013000	0.15412	0.262000	0.26303	-0.982000	0.03762	0.369000	0.24510	0.561000	0.74099	CAG		0.612	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1			8	19	1	0	0.000274275	0.004482	0.000298125	8	19				
NCAM1	4684	broad.mit.edu	37	11	113103043	113103043	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:113103043G>C	ENST00000533760.1	+	10	1607	c.1008G>C	c.(1006-1008)aaG>aaC	p.K336N	NCAM1_ENST00000316851.7_Missense_Mutation_p.K454N|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Missense_Mutation_p.K463N	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	464	Ig-like C2-type 4.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GCAATATCAAGATCTACAACA	0.527																																							uc009yyq.1		NA																	0				ovary(1)	1						c.(1114-1116)AAG>AAC		neural cell adhesion molecule 1 isoform 3							79.0	78.0	78.0					11																	113103043		2011	4185	6196	SO:0001583	missense	4684				axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane		g.chr11:113103043G>C		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1008G>C	11.37:g.113103043G>C	ENSP00000473281:p.Lys336Asn						p.K372N	NM_001076682	NP_001070150	P13591	NCAM1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)	12	1810	+		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)	464			Ig-like C2-type 5.|Extracellular (Potential).		A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37	c.1116G>C		.	.	.	.	.	.	.	.	.	.	G	22.6	4.310974	0.81358	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.68624	-0.34;-0.34	5.73	5.73	0.89815	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	T	0.80618	0.4657	.	.	.	0.80722	D	1	D;D;D;D	0.64830	0.99;0.994;0.992;0.981	D;D;D;D	0.66716	0.909;0.909;0.946;0.93	T	0.82137	-0.0606	9	0.87932	D	0	-36.2048	13.485	0.61359	0.0715:0.0:0.9285:0.0	.	464;454;464;454	P13591-5;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	N	336;463;454	ENSP00000384055:K463N;ENSP00000318472:K454N	ENSP00000318472:K454N	K	+	3	2	NCAM1	112608253	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.598000	0.67585	2.868000	0.98415	0.557000	0.71058	AAG		0.527	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615		10	51	0	0	0	0.004007	0	10	51				
BUD13	84811	broad.mit.edu	37	11	116633454	116633454	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:116633454C>G	ENST00000260210.4	-	4	874	c.851G>C	c.(850-852)aGa>aCa	p.R284T	BUD13_ENST00000375445.3_Intron	NM_032725.3	NP_116114.1	Q9BRD0	BUD13_HUMAN	BUD13 homolog (S. cerevisiae)	284					mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	nucleus (GO:0005634)|RES complex (GO:0070274)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|pancreas(2)|skin(1)|urinary_tract(1)	22	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		ACTTTTGGTTCTGGGCAGGGA	0.498																																							uc001ppn.2		NA																	0				large_intestine(1)|pancreas(1)	2						c.(850-852)AGA>ACA		BUD13 homolog isoform 1							121.0	127.0	125.0					11																	116633454		2201	4296	6497	SO:0001583	missense	84811							g.chr11:116633454C>G	BC006350	CCDS8374.1, CCDS53712.1	11q23.3	2012-06-07	2007-01-12		ENSG00000137656	ENSG00000137656			28199	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 71"""		"""BUD13 homolog (yeast)"""			12477932	Standard	NM_032725		Approved	MGC13125, fSAP71, Cwc26	uc001ppn.3	Q9BRD0	OTTHUMG00000045136	ENST00000260210.4:c.851G>C	11.37:g.116633454C>G	ENSP00000260210:p.Arg284Thr					BUD13_uc001ppo.2_Intron|BUD13_uc009yzc.2_Missense_Mutation_p.R284T	p.R284T	NM_032725	NP_116114	Q9BRD0	BUD13_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)	4	885	-	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)	284					A8K0S0|Q96LS7	Missense_Mutation	SNP	ENST00000260210.4	37	c.851G>C	CCDS8374.1	.	.	.	.	.	.	.	.	.	.	C	9.183	1.024113	0.19433	.	.	ENSG00000137656	ENST00000260210	T	0.18657	2.2	4.75	1.71	0.24356	.	0.395100	0.23957	N	0.042881	T	0.18257	0.0438	M	0.68952	2.095	0.37421	D	0.913624	B;B	0.32245	0.361;0.361	B;B	0.27608	0.081;0.081	T	0.08351	-1.0726	10	0.87932	D	0	-5.4934	4.4286	0.11517	0.0:0.5365:0.1636:0.2999	.	284;284	A8K4Z6;Q9BRD0	.;BUD13_HUMAN	T	284	ENSP00000260210:R284T	ENSP00000260210:R284T	R	-	2	0	BUD13	116138664	0.204000	0.23447	0.897000	0.35233	0.112000	0.19704	0.407000	0.21049	0.259000	0.21709	-0.136000	0.14681	AGA		0.498	BUD13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000104864.1	NM_032725		10	72	0	0	0	0.006214	0	10	72				
ZNF202	7753	broad.mit.edu	37	11	123601409	123601409	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:123601409G>C	ENST00000529691.1	-	2	407	c.188C>G	c.(187-189)gCt>gGt	p.A63G	ZNF202_ENST00000530393.1_Missense_Mutation_p.A63G|ZNF202_ENST00000336139.4_Missense_Mutation_p.A63G			O95125	ZN202_HUMAN	zinc finger protein 202	63	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		TCTGATGAGAGCTTCTCTAGG	0.557																																							uc001pzd.1		NA																	0				ovary(1)	1						c.(187-189)GCT>GGT		zinc finger protein 202							106.0	103.0	104.0					11																	123601409		2202	4299	6501	SO:0001583	missense	7753				lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr11:123601409G>C	AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.188C>G	11.37:g.123601409G>C	ENSP00000433881:p.Ala63Gly					ZNF202_uc001pzc.1_5'UTR|ZNF202_uc001pze.1_Missense_Mutation_p.A63G|ZNF202_uc001pzf.1_Missense_Mutation_p.A63G	p.A63G	NM_003455	NP_003446	O95125	ZN202_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)	4	588	-		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	63			SCAN box.		B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Missense_Mutation	SNP	ENST00000529691.1	37	c.188C>G	CCDS8443.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.349084	0.82132	.	.	ENSG00000166261	ENST00000336139;ENST00000530393;ENST00000529691;ENST00000533463	T;T;T;T	0.06768	3.26;3.26;3.26;3.26	4.57	4.57	0.56435	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.47852	D	0.000218	T	0.42630	0.1211	H	0.96633	3.855	0.41438	D	0.987902	D	0.76494	0.999	D	0.81914	0.995	T	0.62647	-0.6810	10	0.87932	D	0	-17.9669	14.9073	0.70730	0.0:0.0:1.0:0.0	.	63	O95125	ZN202_HUMAN	G	63	ENSP00000337724:A63G;ENSP00000432504:A63G;ENSP00000433881:A63G;ENSP00000431223:A63G	ENSP00000337724:A63G	A	-	2	0	ZNF202	123106619	0.932000	0.31603	1.000000	0.80357	0.967000	0.64934	2.007000	0.40883	2.369000	0.80426	0.455000	0.32223	GCT		0.557	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387419.1	NM_003455		7	35	0	0	0	0.001984	0	7	35				
OR6X1	390260	broad.mit.edu	37	11	123625181	123625181	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr11:123625181G>T	ENST00000327930.2	-	1	72	c.46C>A	c.(46-48)Cct>Act	p.P16T		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TGGATAACAGGAAAGCCTAGC	0.433																																							uc010rzy.1		NA																	0				ovary(2)|skin(1)	3						c.(46-48)CCT>ACT		olfactory receptor, family 6, subfamily X,							109.0	102.0	104.0					11																	123625181		2202	4297	6499	SO:0001583	missense	390260				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123625181G>T	AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.46C>A	11.37:g.123625181G>T	ENSP00000333724:p.Pro16Thr						p.P16T	NM_001005188	NP_001005188	Q8NH79	OR6X1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)	1	46	-		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	16			Extracellular (Potential).		B9EGW9|Q6IFA0	Missense_Mutation	SNP	ENST00000327930.2	37	c.46C>A	CCDS31695.1	.	.	.	.	.	.	.	.	.	.	G	3.807	-0.040411	0.07497	.	.	ENSG00000221931	ENST00000327930	T	0.00424	7.45	4.24	3.33	0.38152	.	.	.	.	.	T	0.00241	0.0007	L	0.33189	0.99	0.09310	N	1	B	0.34015	0.435	B	0.33121	0.158	T	0.11817	-1.0572	9	0.02654	T	1	-7.4607	6.4752	0.22031	0.2183:0.0:0.7817:0.0	.	16	Q8NH79	OR6X1_HUMAN	T	16	ENSP00000333724:P16T	ENSP00000333724:P16T	P	-	1	0	OR6X1	123130391	0.003000	0.15002	0.449000	0.26957	0.589000	0.36550	0.180000	0.16860	1.017000	0.39495	0.585000	0.79938	CCT		0.433	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387436.1	NM_001005188		12	70	1	0	2.62699e-14	0.003163	3.34344e-14	12	70				
C1RL	51279	broad.mit.edu	37	12	7249397	7249397	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:7249397C>A	ENST00000266542.4	-	6	1146	c.1054G>T	c.(1054-1056)Ggc>Tgc	p.G352C	C1RL_ENST00000545280.1_Intron|C1RL_ENST00000544702.1_3'UTR|C1RL_ENST00000504702.2_Intron	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	352	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						ACGTTGGGGCCCAGGGGGATG	0.612																																							uc001qsn.2		NA																	0				pancreas(1)	1						c.(1054-1056)GGC>TGC		complement component 1, r subcomponent-like							83.0	71.0	75.0					12																	7249397		2203	4300	6503	SO:0001583	missense	51279				complement activation, classical pathway|innate immune response|proteolysis		serine-type endopeptidase activity	g.chr12:7249397C>A	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.1054G>T	12.37:g.7249397C>A	ENSP00000266542:p.Gly352Cys					C1RL_uc009zft.2_3'UTR	p.G352C	NM_016546	NP_057630	Q9NZP8	C1RL_HUMAN			6	1071	-			352			Peptidase S1.		Q53GX9	Missense_Mutation	SNP	ENST00000266542.4	37	c.1054G>T	CCDS8573.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.26|13.26	2.184945|2.184945	0.38609|0.38609	.|.	.|.	ENSG00000139178|ENSG00000139178	ENST00000266542;ENST00000396661|ENST00000534950	T|.	0.46819|.	0.86|.	4.98|4.98	4.01|4.01	0.46588|0.46588	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);|.	0.144872|0.144872	0.48767|0.48767	D|D	0.000178|0.000178	T|T	0.75700|0.75700	0.3885|0.3885	M|M	0.87900|0.87900	2.915|2.915	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.77869|0.77869	-0.2427|-0.2427	10|6	0.87932|.	D|.	0|.	.|.	8.9858|8.9858	0.35992|0.35992	0.0:0.8253:0.0:0.1747|0.0:0.8253:0.0:0.1747	.|.	352|.	Q9NZP8|.	C1RL_HUMAN|.	C|V	352|184	ENSP00000266542:G352C|.	ENSP00000266542:G352C|.	G|G	-|-	1|2	0|0	C1RL|C1RL	7140539|7140539	0.990000|0.990000	0.36364|0.36364	0.985000|0.985000	0.45067|0.45067	0.121000|0.121000	0.20230|0.20230	2.640000|2.640000	0.46579|0.46579	2.595000|2.595000	0.87683|0.87683	0.511000|0.511000	0.50034|0.50034	GGC|GGG		0.612	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398367.1	NM_016546		4	31	1	0	0.000602214	0.000602	0.000642607	4	31				
PHC1	1911	broad.mit.edu	37	12	9074263	9074263	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:9074263G>C	ENST00000543824.1	+	6	705	c.373G>C	c.(373-375)Gct>Cct	p.A125P	PHC1_ENST00000433847.2_3'UTR|PHC1_ENST00000433083.2_Missense_Mutation_p.A88P|PHC1_ENST00000536844.1_5'UTR|PHC1_ENST00000544916.1_Missense_Mutation_p.A125P			P78364	PHC1_HUMAN	polyhomeotic homolog 1 (Drosophila)	125					cellular response to retinoic acid (GO:0071300)|histone ubiquitination (GO:0016574)|multicellular organismal development (GO:0007275)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|large_intestine(8)|liver(2)|lung(3)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	27						CTCTCCCAGTGCTACCACCTT	0.567																																							uc001qvd.2		NA																	0				ovary(1)|breast(1)	2						c.(373-375)GCT>CCT		polyhomeotic 1-like							97.0	85.0	89.0					12																	9074263		2203	4294	6497	SO:0001583	missense	1911				multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding	g.chr12:9074263G>C	U89277	CCDS8597.1	12p13	2013-01-10	2006-09-12	2002-11-15	ENSG00000111752	ENSG00000111752		"""Sterile alpha motif (SAM) domain containing"""	3182	protein-coding gene	gene with protein product		602978	"""early development regulator 1 (homolog of polyhomeotic 1)"", ""polyhomeotic-like 1 (Drosophila)"""	EDR1		9121482	Standard	XM_005253334		Approved	HPH1, RAE28	uc001qvd.3	P78364	OTTHUMG00000168275	ENST00000543824.1:c.373G>C	12.37:g.9074263G>C	ENSP00000440674:p.Ala125Pro					PHC1_uc001qvc.1_Missense_Mutation_p.A88P|PHC1_uc010sgn.1_Missense_Mutation_p.A125P|PHC1_uc001qve.2_Missense_Mutation_p.A125P	p.A125P	NM_004426	NP_004417	P78364	PHC1_HUMAN			5	529	+			125					D3DUV4|Q8WVM3|Q9BU63	Missense_Mutation	SNP	ENST00000543824.1	37	c.373G>C	CCDS8597.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266503	0.80358	.	.	ENSG00000111752	ENST00000538657;ENST00000543824;ENST00000251757;ENST00000433083;ENST00000544916;ENST00000544539;ENST00000541181	T;T;T;T	0.31510	1.49;1.49;1.52;1.49	5.59	4.71	0.59529	.	0.000000	0.64402	D	0.000002	T	0.43411	0.1246	L	0.29908	0.895	0.80722	D	1	D;P;P	0.76494	0.999;0.517;0.517	D;B;B	0.80764	0.994;0.39;0.39	T	0.42344	-0.9457	10	0.72032	D	0.01	-13.804	14.1923	0.65646	0.0725:0.0:0.9275:0.0	.	125;125;125	B4DF21;P78364;B2RXH1	.;PHC1_HUMAN;.	P	125;125;125;88;125;125;142	ENSP00000440674:A125P;ENSP00000251757:A125P;ENSP00000399194:A88P;ENSP00000437659:A125P	ENSP00000251757:A125P	A	+	1	0	PHC1	8965530	1.000000	0.71417	0.993000	0.49108	0.888000	0.51559	3.040000	0.49799	1.368000	0.46115	0.655000	0.94253	GCT		0.567	PHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399115.1	NM_004426		4	40	0	0	0	0.001168	0	4	40				
CLEC1B	51266	broad.mit.edu	37	12	10150953	10150953	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:10150953G>C	ENST00000298527.6	-	2	270	c.91C>G	c.(91-93)Cgt>Ggt	p.R31G	CLEC1B_ENST00000348658.4_Intron|CLEC1B_ENST00000428126.2_Intron	NM_016509.3	NP_057593.3	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B	31					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|platelet formation (GO:0030220)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(12)|stomach(1)|urinary_tract(1)	19						GCCATCACACGCCACCAGGAG	0.532																																							uc001qwu.2		NA																	0					0						c.(91-93)CGT>GGT		C-type lectin domain family 1, member B isoform							107.0	115.0	113.0					12																	10150953		2106	4211	6317	SO:0001583	missense	51266				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	protein binding|sugar binding|transmembrane receptor activity	g.chr12:10150953G>C	AF124841	CCDS41751.1, CCDS41752.1	12p13.31	2006-04-12				ENSG00000165682		"""C-type lectin domain containing"""	24356	protein-coding gene	gene with protein product		606783				10671229, 11745369	Standard	NM_016509		Approved	CLEC2	uc001qwu.3	Q9P126		ENST00000298527.6:c.91C>G	12.37:g.10150953G>C	ENSP00000298527:p.Arg31Gly					CLEC1B_uc009zhd.2_Intron	p.R31G	NM_016509	NP_057593	Q9P126	CLC1B_HUMAN			2	291	-			31			Cytoplasmic (Potential).		Q6UWX7|Q8NHR6	Missense_Mutation	SNP	ENST00000298527.6	37	c.91C>G	CCDS41752.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022259	0.54683	.	.	ENSG00000165682	ENST00000298527	T	0.01804	4.63	4.37	4.37	0.52481	C-type lectin-like (1);	0.000000	0.52532	D	0.000070	T	0.11965	0.0291	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00349	-1.1798	10	0.66056	D	0.02	.	12.3952	0.55380	0.0:0.0:1.0:0.0	.	31	Q9P126	CLC1B_HUMAN	G	31	ENSP00000298527:R31G	ENSP00000298527:R31G	R	-	1	0	CLEC1B	10042220	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	4.595000	0.61048	1.968000	0.57251	0.305000	0.20034	CGT		0.532	CLEC1B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399922.1	NM_016509		34	61	0	0	0	0.00623	0	34	61				
ARHGDIB	397	broad.mit.edu	37	12	15095501	15095501	+	Silent	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:15095501G>A	ENST00000228945.4	-	6	705	c.561C>T	c.(559-561)ctC>ctT	p.L187L	ARHGDIB_ENST00000541644.1_Silent_p.L187L|ARHGDIB_ENST00000539131.1_5'UTR|ARHGDIB_ENST00000541546.1_Silent_p.L187L	NM_001175.4	NP_001166.3	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta	187					actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of cell adhesion (GO:0007162)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	15						ACTCCCAGCTGAGGTGGTCTT	0.552																																							uc001rcq.1		NA																	0					0						c.(559-561)CTC>CTT		Rho GDP dissociation inhibitor (GDI) beta							238.0	182.0	201.0					12																	15095501		2203	4300	6503	SO:0001819	synonymous_variant	397				actin cytoskeleton organization|cellular component movement|immune response|multicellular organismal development|negative regulation of cell adhesion|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoplasmic membrane-bounded vesicle|cytoskeleton|cytosol	GTPase activator activity|Rho GDP-dissociation inhibitor activity	g.chr12:15095501G>A	L07916	CCDS8671.1	12p12.3	2014-01-30				ENSG00000111348		"""Endogenous ligands"""	679	protein-coding gene	gene with protein product		602843		RAP1GN1, GDIA2, GDID4		8434008, 8356058	Standard	NM_001175		Approved	Ly-GDI, RhoGDI2	uc001rcq.1	P52566		ENST00000228945.4:c.561C>T	12.37:g.15095501G>A						ARHGDIB_uc001rcp.1_RNA	p.L187L	NM_001175	NP_001166	P52566	GDIR2_HUMAN			6	665	-			187					B5BU79	Silent	SNP	ENST00000228945.4	37	c.561C>T	CCDS8671.1	.	.	.	.	.	.	.	.	.	.	G	9.861	1.196265	0.22037	.	.	ENSG00000111348	ENST00000536592	.	.	.	4.73	-2.52	0.06346	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.1983	2.0005	0.03466	0.2493:0.3713:0.2534:0.126	.	.	.	.	X	181	.	.	Q	-	1	0	ARHGDIB	14986768	0.980000	0.34600	0.975000	0.42487	0.995000	0.86356	0.192000	0.17096	-0.576000	0.05974	0.650000	0.86243	CAG		0.552	ARHGDIB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400871.1	NM_001175		12	84	0	0	0	0.003163	0	12	84				
KCNJ8	3764	broad.mit.edu	37	12	21919149	21919149	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:21919149C>T	ENST00000240662.2	-	3	1128	c.783G>A	c.(781-783)ctG>ctA	p.L261L	RP11-59N23.1_ENST00000542489.1_RNA	NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	261					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	AAGGGGCCACCAGAAAAATGT	0.478																																							uc001rff.2		NA																	0					0						c.(781-783)CTG>CTA		potassium inwardly-rectifying channel J8	Levosimendan(DB00922)						81.0	76.0	78.0					12																	21919149		2203	4300	6503	SO:0001819	synonymous_variant	3764					voltage-gated potassium channel complex		g.chr12:21919149C>T	BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.783G>A	12.37:g.21919149C>T							p.L261L	NM_004982	NP_004973	Q15842	IRK8_HUMAN			3	1121	-			261			Cytoplasmic (By similarity).		O00657	Silent	SNP	ENST00000240662.2	37	c.783G>A	CCDS8692.1																																																																																				0.478	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402226.1	NM_004982		7	9	0	0	0	0.00308	0	7	9				
DNAJC22	79962	broad.mit.edu	37	12	49742929	49742929	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:49742929G>T	ENST00000549441.2	+	3	1478	c.274G>T	c.(274-276)Ggc>Tgc	p.G92C	DNAJC22_ENST00000395069.3_Missense_Mutation_p.G92C			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	92						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						CATCTATTTTGGCCTTGTGGC	0.567																																							uc001rua.2		NA																	0				ovary(1)	1						c.(274-276)GGC>TGC		DnaJ (Hsp40) homolog, subfamily C, member 22							167.0	172.0	170.0					12																	49742929		2203	4300	6503	SO:0001583	missense	79962				protein folding	integral to membrane	heat shock protein binding|unfolded protein binding	g.chr12:49742929G>T	AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.274G>T	12.37:g.49742929G>T	ENSP00000446830:p.Gly92Cys					DNAJC22_uc001rub.2_Missense_Mutation_p.G92C	p.G92C	NM_024902	NP_079178	Q8N4W6	DJC22_HUMAN			2	675	+			92			Helical; (Potential).		B3KP54	Missense_Mutation	SNP	ENST00000549441.2	37	c.274G>T	CCDS8785.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273524	0.80580	.	.	ENSG00000178401	ENST00000549441;ENST00000395069	T;T	0.53857	0.6;0.6	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.70762	0.3261	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74057	-0.3787	10	0.87932	D	0	-14.1769	17.4091	0.87481	0.0:0.0:1.0:0.0	.	92	Q8N4W6	DJC22_HUMAN	C	92	ENSP00000446830:G92C;ENSP00000378508:G92C	ENSP00000378508:G92C	G	+	1	0	DNAJC22	48029196	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.895000	0.92512	2.464000	0.83262	0.561000	0.74099	GGC		0.567	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404302.2	NM_024902		30	71	1	0	9.78485e-24	0.013726	1.30714e-23	30	71				
OR6C6	283365	broad.mit.edu	37	12	55688659	55688659	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:55688659G>A	ENST00000358433.2	-	1	357	c.358C>T	c.(358-360)Cgc>Tgc	p.R120C		NM_001005493.1	NP_001005493.1	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C, member 6	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GCAACGTAGCGGTCATAGGAC	0.393																																							uc010sph.1		NA																	0				large_intestine(1)|skin(1)	2						c.(358-360)CGC>TGC		olfactory receptor, family 6, subfamily C,							63.0	60.0	61.0					12																	55688659		2203	4300	6503	SO:0001583	missense	283365				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55688659G>A		CCDS31817.1	12q13.13	2012-08-09			ENSG00000188324	ENSG00000188324		"""GPCR / Class A : Olfactory receptors"""	31293	protein-coding gene	gene with protein product							Standard	NM_001005493		Approved		uc010sph.2	A6NF89	OTTHUMG00000168101	ENST00000358433.2:c.358C>T	12.37:g.55688659G>A	ENSP00000351211:p.Arg120Cys						p.R120C	NM_001005493	NP_001005493	A6NF89	OR6C6_HUMAN			1	358	-			120			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000358433.2	37	c.358C>T	CCDS31817.1	.	.	.	.	.	.	.	.	.	.	-	9.407	1.079483	0.20309	.	.	ENSG00000188324	ENST00000358433	T	0.77358	-1.09	4.24	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000102	T	0.74627	0.3741	M	0.83953	2.67	0.48135	D	0.999597	B	0.29136	0.234	B	0.20955	0.032	T	0.70691	-0.4802	10	0.62326	D	0.03	.	9.1407	0.36901	0.2476:0.0:0.7524:0.0	.	120	A6NF89	OR6C6_HUMAN	C	120	ENSP00000351211:R120C	ENSP00000351211:R120C	R	-	1	0	OR6C6	53974926	0.085000	0.21516	0.974000	0.42286	0.291000	0.27294	0.323000	0.19593	0.185000	0.20105	-0.233000	0.12211	CGC		0.393	OR6C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398151.1			10	16	0	0	0	0.013537	0	10	16				
R3HDM2	22864	broad.mit.edu	37	12	57648586	57648586	+	Silent	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:57648586C>A	ENST00000347140.3	-	24	3291	c.2901G>T	c.(2899-2901)ctG>ctT	p.L967L	R3HDM2_ENST00000441731.2_Silent_p.L662L|R3HDM2_ENST00000402412.1_Silent_p.L981L|R3HDM2_ENST00000403821.2_Silent_p.L1001L|R3HDM2_ENST00000413953.2_Intron|RP11-123K3.4_ENST00000548184.1_Intron|R3HDM2_ENST00000358907.2_Silent_p.L967L			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	967						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CCAGGATCCTCAGGTCATAGT	0.557																																							uc009zpm.1		NA																	0				ovary(2)	2						c.(2899-2901)CTG>CTT		R3H domain containing 2							69.0	64.0	66.0					12																	57648586		2203	4300	6503	SO:0001819	synonymous_variant	22864					nucleus	nucleic acid binding	g.chr12:57648586C>A	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.2901G>T	12.37:g.57648586C>A						R3HDM2_uc010srn.1_Intron|R3HDM2_uc001snu.2_Silent_p.L662L|R3HDM2_uc001snr.2_Silent_p.L694L|R3HDM2_uc001sns.2_Silent_p.L967L|R3HDM2_uc001snt.2_Silent_p.L981L|R3HDM2_uc009zpn.1_Intron	p.L967L	NM_014925	NP_055740	Q9Y2K5	R3HD2_HUMAN			22	2936	-			967					Q2M1T9|Q3ZCT5	Silent	SNP	ENST00000347140.3	37	c.2901G>T	CCDS8937.2																																																																																				0.557	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925		5	29	1	0	0.00198382	0.001984	0.00209137	5	29				
RAP1B	5908	broad.mit.edu	37	12	69050962	69050962	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:69050962C>T	ENST00000250559.9	+	7	781	c.550C>T	c.(550-552)Ctt>Ttt	p.L184F	RAP1B_ENST00000341355.5_Missense_Mutation_p.L184F|RAP1B_ENST00000450214.2_Missense_Mutation_p.L142F|RAP1B_ENST00000537460.1_Missense_Mutation_p.L184F|RAP1B_ENST00000540209.1_Missense_Mutation_p.L165F|RAP1B_ENST00000539091.1_Missense_Mutation_p.L142F|RAP1B_ENST00000463493.1_3'UTR|RAP1B_ENST00000378985.3_Missense_Mutation_p.L118F|RAP1B_ENST00000543697.1_Missense_Mutation_p.L136F|RAP1B_ENST00000543393.1_Missense_Mutation_p.L118F|RAP1B_ENST00000393436.5_Missense_Mutation_p.L184F|RAP1B_ENST00000542145.1_Missense_Mutation_p.L137F	NM_001010942.2|NM_001251921.1|NM_001251922.1|NM_015646.5	NP_001010942.1|NP_001238850.1|NP_001238851.1|NP_056461.1	P61224	RAP1B_HUMAN	RAP1B, member of RAS oncogene family	184					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of establishment of cell polarity (GO:2000114)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(2)|urinary_tract(2)	12	Breast(13;1.24e-05)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)	GBM - Glioblastoma multiforme(7;0.000306)		ATGTCAGCTGCTTTAATATAC	0.383																																							uc001sub.2		NA																	0					0						c.(550-552)CTT>TTT		SubName: Full=Ras-related protein Rap-1A; SubName: Full=cDNA FLJ75985, highly similar to Homo sapiens RAP1A, member of RAS oncogene family (RAP1A), transcript variant 2, mRNA; SubName: Full=RAP1A, member of RAS oncogene family;							110.0	112.0	111.0					12																	69050962		2203	4300	6503	SO:0001583	missense	5908				blood coagulation|energy reserve metabolic process|regulation of establishment of cell polarity|regulation of insulin secretion	cell-cell junction|cytosol	GDP binding|GTP binding|GTPase activity|protein binding	g.chr12:69050962C>T		CCDS8984.1, CCDS58252.1, CCDS58253.1, CCDS58254.1	12q14	2014-05-09			ENSG00000127314	ENSG00000127314			9857	protein-coding gene	gene with protein product		179530				3137530, 12089143	Standard	NM_015646		Approved	K-REV, RAL1B, DKFZp586H0723	uc001suc.3	P61224	OTTHUMG00000133660	ENST00000250559.9:c.550C>T	12.37:g.69050962C>T	ENSP00000250559:p.Leu184Phe					RAP1B_uc010ste.1_Missense_Mutation_p.L118F|RAP1B_uc001suc.2_Missense_Mutation_p.L184F|RAP1B_uc010stf.1_Missense_Mutation_p.L165F|RAP1B_uc010stg.1_Missense_Mutation_p.L142F|RAP1B_uc010sth.1_Missense_Mutation_p.L142F|RAP1B_uc010sti.1_Missense_Mutation_p.L137F	p.L184F	NM_001089704	NP_001083173	P61224	RAP1B_HUMAN	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)	GBM - Glioblastoma multiforme(7;0.000306)	7	713	+	Breast(13;1.24e-05)		184					B2R5Z2|B4DQI8|B4DW74|B4DW94|P09526|Q502X3|Q5TZR4|Q6DCA1|Q6LES0	Missense_Mutation	SNP	ENST00000250559.9	37	c.550C>T	CCDS8984.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338993	0.60963	.	.	ENSG00000127314	ENST00000250559;ENST00000393436;ENST00000341355;ENST00000537460;ENST00000450214;ENST00000543393;ENST00000378985;ENST00000540209;ENST00000539091;ENST00000542145;ENST00000543697	T;T;T;T;T;T;T;T;T;T;T	0.80653	-0.3;-0.3;-0.3;-0.3;-0.31;-0.61;-0.61;-0.37;-0.31;-1.4;-0.97	5.58	4.68	0.58851	.	0.133192	0.50627	D	0.000103	T	0.76463	0.3991	L	0.55017	1.72	0.80722	D	1	B;P;B;B	0.36222	0.13;0.544;0.183;0.215	B;B;B;B	0.35727	0.093;0.209;0.062;0.093	T	0.74951	-0.3489	9	.	.	.	.	15.5729	0.76354	0.0:0.9302:0.0:0.0698	.	137;142;165;184	B4DW94;B4DW74;B4DQI8;P61224	.;.;.;RAP1B_HUMAN	F	184;184;184;184;142;118;118;165;142;137;136	ENSP00000250559:L184F;ENSP00000377085:L184F;ENSP00000441275:L184F;ENSP00000439966:L184F;ENSP00000399986:L142F;ENSP00000445090:L118F;ENSP00000368270:L118F;ENSP00000446318:L165F;ENSP00000444830:L142F;ENSP00000440014:L137F;ENSP00000440708:L136F	.	L	+	1	0	RAP1B	67337229	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.288000	0.78691	2.817000	0.96982	0.644000	0.83932	CTT		0.383	RAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257821.3	NM_001010942		21	30	0	0	0	0.00333	0	21	30				
FRS2	10818	broad.mit.edu	37	12	69962837	69962837	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:69962837T>A	ENST00000550389.1	+	3	273	c.27T>A	c.(25-27)gaT>gaA	p.D9E	FRS2_ENST00000299293.2_Missense_Mutation_p.D9E|FRS2_ENST00000549921.1_Missense_Mutation_p.D9E|FRS2_ENST00000397997.2_Missense_Mutation_p.D9E	NM_001278353.1|NM_001278357.1	NP_001265282.1|NP_001265286.1	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	9					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification, embryo (GO:0008595)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation with mouth forming second (GO:0001702)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lens fiber cell development (GO:0070307)|neuroblast proliferation (GO:0007405)|neurotrophin TRK receptor signaling pathway (GO:0048011)|optic placode formation involved in camera-type eye formation (GO:0046619)|organ induction (GO:0001759)|phosphatidylinositol-mediated signaling (GO:0048015)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of apoptotic process (GO:0042981)|regulation of epithelial cell proliferation (GO:0050678)|regulation of ERK1 and ERK2 cascade (GO:0070372)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatase activator activity (GO:0019211)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			GCTGTCCAGATAAAGACACTG	0.363																																							uc001suy.2		NA																	0				prostate(1)|kidney(1)	2						c.(25-27)GAT>GAA		fibroblast growth factor receptor substrate 2							92.0	88.0	89.0					12																	69962837		1841	4094	5935	SO:0001583	missense	10818				activation of MAPKK activity|activation of phospholipase C activity|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|transmembrane receptor protein tyrosine phosphatase signaling pathway	endomembrane system|endosome|integral to plasma membrane|membrane fraction	fibroblast growth factor receptor binding|insulin receptor binding|phosphatase activator activity|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr12:69962837T>A	AF036717	CCDS41809.1	12q15	2008-02-05				ENSG00000166225			16971	protein-coding gene	gene with protein product		607743				8761293, 9660748	Standard	NM_001278351		Approved	SNT-1, FRS2alpha, SNT1, FRS2A	uc001suz.3	Q8WU20		ENST00000550389.1:c.27T>A	12.37:g.69962837T>A	ENSP00000447241:p.Asp9Glu					FRS2_uc001suz.2_Missense_Mutation_p.D9E|FRS2_uc009zrj.2_Missense_Mutation_p.D9E|FRS2_uc009zrk.2_Missense_Mutation_p.D9E	p.D9E	NM_006654	NP_006645	Q8WU20	FRS2_HUMAN	Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)		6	537	+	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		9					B0LPF2|B2R684|O43558|Q7LDQ6	Missense_Mutation	SNP	ENST00000550389.1	37	c.27T>A	CCDS41809.1	.	.	.	.	.	.	.	.	.	.	T	13.28	2.190070	0.38707	.	.	ENSG00000166225	ENST00000547219;ENST00000299293;ENST00000549921;ENST00000550316;ENST00000548154;ENST00000550389;ENST00000550937;ENST00000549092;ENST00000550169;ENST00000397997;ENST00000551325	D;D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67	5.22	4.05	0.47172	.	0.100588	0.64402	N	0.000002	T	0.75228	0.3821	L	0.47716	1.5	0.42068	D	0.991199	B	0.32467	0.372	B	0.26416	0.069	T	0.70368	-0.4891	9	.	.	.	-11.5698	12.643	0.56720	0.0:0.0:0.1379:0.8621	.	9	Q8WU20	FRS2_HUMAN	E	9	ENSP00000299293:D9E;ENSP00000450048:D9E;ENSP00000447241:D9E;ENSP00000447804:D9E;ENSP00000381083:D9E;ENSP00000449432:D9E	.	D	+	3	2	FRS2	68249104	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.283000	0.33237	0.897000	0.36392	0.533000	0.62120	GAT		0.363	FRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403760.1	NM_006654		9	22	0	0	0	0.010729	0	9	22				
NAV3	89795	broad.mit.edu	37	12	78388619	78388619	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:78388619T>A	ENST00000397909.2	+	6	881	c.708T>A	c.(706-708)agT>agA	p.S236R	NAV3_ENST00000536525.2_Missense_Mutation_p.S236R|NAV3_ENST00000266692.7_Missense_Mutation_p.S236R|NAV3_ENST00000228327.6_Missense_Mutation_p.S236R			Q8IVL0	NAV3_HUMAN	neuron navigator 3	236						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CTAATCACAGTGGAATTGCAA	0.348										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(706-708)AGT>AGA		neuron navigator 3							140.0	131.0	134.0					12																	78388619		1825	4096	5921	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78388619T>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.708T>A	12.37:g.78388619T>A	ENSP00000381007:p.Ser236Arg	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.S236R	p.S236R	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			6	881	+			236					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.708T>A		.	.	.	.	.	.	.	.	.	.	T	18.68	3.675170	0.67928	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	5.95	5.95	0.96441	.	0.327534	0.20698	U	0.087331	T	0.45357	0.1338	N	0.14661	0.345	0.80722	D	1	B;D	0.71674	0.361;0.998	B;P	0.62089	0.092;0.898	T	0.40421	-0.9564	10	0.30854	T	0.27	-18.5622	16.4237	0.83790	0.0:0.0:0.0:1.0	.	236;236	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	R	236	ENSP00000446628:S236R;ENSP00000446132:S236R;ENSP00000381007:S236R;ENSP00000228327:S236R;ENSP00000266692:S236R	ENSP00000228327:S236R	S	+	3	2	NAV3	76912750	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.336000	0.65935	2.279000	0.76181	0.533000	0.62120	AGT		0.348	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		12	23	0	0	0	0.004007	0	12	23				
SCYL2	55681	broad.mit.edu	37	12	100723039	100723039	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:100723039G>T	ENST00000360820.2	+	13	2140	c.1703G>T	c.(1702-1704)gGa>gTa	p.G568V		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	568					endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						CAGCTGGCCGGAAAAGTGTTG	0.333																																							uc001thn.2		NA																	0				lung(3)|ovary(2)|skin(1)	6						c.(1702-1704)GGA>GTA		SCY1-like 2 protein							78.0	84.0	82.0					12																	100723039		2203	4299	6502	SO:0001583	missense	55681				endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding	g.chr12:100723039G>T	AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.1703G>T	12.37:g.100723039G>T	ENSP00000354061:p.Gly568Val					SCYL2_uc001thm.1_Missense_Mutation_p.G568V	p.G568V	NM_017988	NP_060458	Q6P3W7	SCYL2_HUMAN			13	1753	+			568					A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	ENST00000360820.2	37	c.1703G>T	CCDS9076.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882200	0.33255	.	.	ENSG00000136021	ENST00000549687;ENST00000360820	T;T	0.31769	1.48;1.48	5.22	5.22	0.72569	Armadillo-type fold (1);	0.162484	0.53938	D	0.000052	T	0.32224	0.0822	L	0.46157	1.445	0.80722	D	1	B	0.23058	0.079	B	0.25987	0.065	T	0.05338	-1.0891	10	0.28530	T	0.3	.	19.2089	0.93746	0.0:0.0:1.0:0.0	.	568	Q6P3W7	SCYL2_HUMAN	V	568	ENSP00000448366:G568V;ENSP00000354061:G568V	ENSP00000354061:G568V	G	+	2	0	SCYL2	99247170	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	6.329000	0.72920	2.611000	0.88343	0.586000	0.80456	GGA		0.333	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2	NM_017988		17	26	1	0	3.8784e-16	0.012319	5.00901e-16	17	26				
ACACB	32	broad.mit.edu	37	12	109614007	109614007	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:109614007G>A	ENST00000338432.7	+	9	1495	c.1376G>A	c.(1375-1377)gGc>gAc	p.G459D	ACACB_ENST00000543080.1_3'UTR|ACACB_ENST00000377848.3_Missense_Mutation_p.G459D|ACACB_ENST00000377854.5_Missense_Mutation_p.G459D			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	459	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TCTGAAGGTGGCGGAGGGAAG	0.493																																							uc001tob.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8						c.(1375-1377)GGC>GAC		acetyl-Coenzyme A carboxylase beta	Biotin(DB00121)						251.0	263.0	259.0					12																	109614007		2203	4300	6503	SO:0001583	missense	32				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding	g.chr12:109614007G>A	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.1376G>A	12.37:g.109614007G>A	ENSP00000341044:p.Gly459Asp					ACACB_uc001toc.2_Missense_Mutation_p.G459D	p.G459D	NM_001093	NP_001084	O00763	ACACB_HUMAN			9	1495	+			459			Biotin carboxylation.|ATP-grasp.|ATP (Potential).		A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	c.1376G>A	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	G	33	5.268198	0.95429	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	D;D;D	0.98090	-4.71;-4.71;-4.71	5.91	5.91	0.95273	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (2);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.99498	0.9821	H	0.99806	4.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97754	1.0216	10	0.87932	D	0	.	20.3052	0.98627	0.0:0.0:1.0:0.0	.	459	O00763	ACACB_HUMAN	D	459	ENSP00000341044:G459D;ENSP00000367079:G459D;ENSP00000367085:G459D	ENSP00000341044:G459D	G	+	2	0	ACACB	108098390	1.000000	0.71417	0.380000	0.26093	0.948000	0.59901	9.808000	0.99193	2.808000	0.96608	0.655000	0.94253	GGC		0.493	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093		70	132	0	0	0	0.01441	0	70	132				
RSRC2	65117	broad.mit.edu	37	12	122992965	122992965	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr12:122992965C>A	ENST00000331738.7	-	8	980	c.835G>T	c.(835-837)Gtt>Ttt	p.V279F	RSRC2_ENST00000354654.2_Missense_Mutation_p.V231F|RSRC2_ENST00000392442.2_5'UTR	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2	279							poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		AGGGCAGCAACATTGAGAACA	0.433																																							uc001ucr.2		NA																	0				ovary(1)	1						c.(835-837)GTT>TTT		arginine/serine-rich coiled-coil 2 isoform a							48.0	43.0	45.0					12																	122992965		2203	4300	6503	SO:0001583	missense	65117							g.chr12:122992965C>A	AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.835G>T	12.37:g.122992965C>A	ENSP00000330188:p.Val279Phe					RSRC2_uc001uco.2_Missense_Mutation_p.V48F|RSRC2_uc001ucp.2_Missense_Mutation_p.V220F|RSRC2_uc001ucq.2_Missense_Mutation_p.V47F|RSRC2_uc001ucs.2_Missense_Mutation_p.V48F|RSRC2_uc001uct.2_Missense_Mutation_p.V231F|RSRC2_uc001ucu.2_Missense_Mutation_p.V280F	p.V279F	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)	8	981	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		279					Q6N040|Q6NW16|Q9H864	Missense_Mutation	SNP	ENST00000331738.7	37	c.835G>T	CCDS31920.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.850482	0.91277	.	.	ENSG00000111011	ENST00000331738;ENST00000354654;ENST00000418773;ENST00000344591	T;T;T	0.63913	1.26;0.79;-0.07	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.75087	0.3802	L	0.51422	1.61	0.80722	D	1	D;D;D;D;D	0.71674	0.994;0.998;0.994;0.994;0.984	D;D;D;D;P	0.73380	0.98;0.961;0.98;0.98;0.904	T	0.74216	-0.3737	10	0.44086	T	0.13	.	19.0014	0.92836	0.0:1.0:0.0:0.0	.	280;231;279;220;48	F5GXM2;Q7L4I2-2;Q7L4I2;E1B6W4;B3KMH4	.;.;RSRC2_HUMAN;.;.	F	279;231;280;220	ENSP00000330188:V279F;ENSP00000346678:V231F;ENSP00000343315:V220F	ENSP00000330188:V279F	V	-	1	0	RSRC2	121558918	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.482000	0.81143	2.546000	0.85860	0.655000	0.94253	GTT		0.433	RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395096.3	NM_023012		3	12	1	0	6.4e-05	0.004672	7.08861e-05	3	12				
STARD13	90627	broad.mit.edu	37	13	33703375	33703375	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr13:33703375T>C	ENST00000336934.5	-	5	1555	c.1439A>G	c.(1438-1440)gAt>gGt	p.D480G	STARD13_ENST00000255486.4_Missense_Mutation_p.D472G|STARD13_ENST00000399365.3_Missense_Mutation_p.D362G	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	480					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		GAAAAGGTCATCTTTCTCCAA	0.502																																							uc001uuw.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1438-1440)GAT>GGT		StAR-related lipid transfer (START) domain							115.0	106.0	109.0					13																	33703375		2203	4300	6503	SO:0001583	missense	90627				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding	g.chr13:33703375T>C	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.1439A>G	13.37:g.33703375T>C	ENSP00000338785:p.Asp480Gly					STARD13_uc001uuu.2_Missense_Mutation_p.D472G|STARD13_uc001uuv.2_Missense_Mutation_p.D362G|STARD13_uc001uux.2_Missense_Mutation_p.D445G|STARD13_uc010tec.1_RNA|STARD13_uc010abh.1_Missense_Mutation_p.D465G	p.D480G	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)	5	1565	-	all_epithelial(80;0.155)	Lung SC(185;0.0367)	480					A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	ENST00000336934.5	37	c.1439A>G	CCDS9348.1	.	.	.	.	.	.	.	.	.	.	T	13.55	2.269677	0.40095	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934;ENST00000399364	T;T;T	0.07327	3.2;3.2;3.21	5.91	5.91	0.95273	.	0.138785	0.64402	D	0.000004	T	0.10766	0.0263	L	0.48362	1.52	0.80722	D	1	B;B;B;B	0.19583	0.016;0.016;0.009;0.037	B;B;B;B	0.28011	0.02;0.017;0.012;0.085	T	0.06770	-1.0808	10	0.44086	T	0.13	.	12.1952	0.54292	0.0:0.068:0.0:0.932	.	472;445;480;472	Q9Y3M8-5;Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;.;STA13_HUMAN;.	G	362;472;480;472	ENSP00000382300:D362G;ENSP00000255486:D472G;ENSP00000338785:D480G	ENSP00000255486:D472G	D	-	2	0	STARD13	32601375	1.000000	0.71417	0.860000	0.33809	0.756000	0.42949	6.134000	0.71689	2.259000	0.74868	0.528000	0.53228	GAT		0.502	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466		27	31	0	0	0	0.007291	0	27	31				
NBEA	26960	broad.mit.edu	37	13	35615154	35615154	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr13:35615154C>A	ENST00000400445.3	+	2	913	c.379C>A	c.(379-381)Cac>Aac	p.H127N	NBEA_ENST00000540320.1_Missense_Mutation_p.H127N|NBEA_ENST00000379939.2_Missense_Mutation_p.H127N|NBEA_ENST00000310336.4_Missense_Mutation_p.H127N	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	127					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GCTTTTGGAGCACTGTGATGT	0.393																																							uc001uvb.2		NA																	0				ovary(9)|large_intestine(2)	11						c.(379-381)CAC>AAC		neurobeachin							139.0	126.0	130.0					13																	35615154		1891	4150	6041	SO:0001583	missense	26960					cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding	g.chr13:35615154C>A	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.379C>A	13.37:g.35615154C>A	ENSP00000383295:p.His127Asn						p.H127N	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)	3	585	+		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)	127					B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	c.379C>A	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839853	0.51057	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.43	5.43	0.79202	.	0.055365	0.64402	D	0.000001	T	0.39682	0.1087	L	0.38175	1.15	0.80722	D	1	B	0.34061	0.436	B	0.30855	0.121	T	0.16188	-1.0411	10	0.21540	T	0.41	.	19.2626	0.93974	0.0:1.0:0.0:0.0	.	127	Q5T321	.	N	127	ENSP00000440951:H127N;ENSP00000383295:H127N;ENSP00000369271:H127N;ENSP00000308534:H127N	ENSP00000308534:H127N	H	+	1	0	NBEA	34513154	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	4.060000	0.57477	2.544000	0.85801	0.585000	0.79938	CAC		0.393	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678		23	46	1	0	1.17739e-12	0.005443	1.47702e-12	23	46				
NALCN	259232	broad.mit.edu	37	13	101717763	101717763	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr13:101717763C>T	ENST00000251127.6	-	40	4678	c.4597G>A	c.(4597-4599)Gtc>Atc	p.V1533I		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1533					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TACCTCAGGACATCATGGAAG	0.542																																							uc001vox.1		NA																	0				ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(4597-4599)GTC>ATC		voltage gated channel like 1							151.0	125.0	134.0					13																	101717763		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101717763C>T	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4597G>A	13.37:g.101717763C>T	ENSP00000251127:p.Val1533Ile						p.V1533I	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN			40	4786	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		1533			Cytoplasmic (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.4597G>A	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.748921	0.89753	.	.	ENSG00000102452	ENST00000251127	D	0.98178	-4.77	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.97810	0.9281	L	0.56199	1.76	0.80722	D	1	D	0.55172	0.97	P	0.52217	0.693	D	0.96946	0.9691	10	0.22706	T	0.39	.	19.8625	0.96789	0.0:1.0:0.0:0.0	.	1533	Q8IZF0	NALCN_HUMAN	I	1533	ENSP00000251127:V1533I	ENSP00000251127:V1533I	V	-	1	0	NALCN	100515764	1.000000	0.71417	0.898000	0.35279	0.645000	0.38454	7.482000	0.81143	2.689000	0.91719	0.655000	0.94253	GTC		0.542	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		27	61	0	0	0	0.012213	0	27	61				
CUL4A	8451	broad.mit.edu	37	13	113907459	113907459	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr13:113907459C>T	ENST00000375440.4	+	16	1786	c.1702C>T	c.(1702-1704)Cag>Tag	p.Q568*	CUL4A_ENST00000326335.4_Nonsense_Mutation_p.Q468*|CUL4A_ENST00000451881.1_Nonsense_Mutation_p.Q468*|CUL4A_ENST00000375441.3_Nonsense_Mutation_p.Q468*	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	568					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			TCGAAAACTTCAGTGGCAAAC	0.313																																							uc010tjy.1		NA																	0				central_nervous_system(2)|skin(1)	3						c.(1702-1704)CAG>TAG		cullin 4A isoform 1							114.0	113.0	113.0					13																	113907459		2203	4300	6503	SO:0001587	stop_gained	8451				cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	ubiquitin protein ligase binding	g.chr13:113907459C>T	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.1702C>T	13.37:g.113907459C>T	ENSP00000364589:p.Gln568*					CUL4A_uc010tjx.1_Nonsense_Mutation_p.Q468*|CUL4A_uc010agu.2_Nonsense_Mutation_p.Q429*|CUL4A_uc010tjz.1_Nonsense_Mutation_p.Q247*	p.Q568*	NM_001008895	NP_001008895	Q13619	CUL4A_HUMAN	all cancers(43;0.112)		17	1713	+	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	568					A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Nonsense_Mutation	SNP	ENST00000375440.4	37	c.1702C>T	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	C	43	10.213477	0.99360	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	.	.	.	5.16	5.16	0.70880	.	0.051620	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-34.6569	19.0113	0.92874	0.0:1.0:0.0:0.0	.	.	.	.	X	468;468;468;568	.	ENSP00000322132:Q468X	Q	+	1	0	CUL4A	112955460	1.000000	0.71417	0.821000	0.32701	0.934000	0.57294	7.637000	0.83313	2.566000	0.86566	0.484000	0.47621	CAG		0.313	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045888.3	NM_003589		14	42	0	0	0	0.00499	0	14	42				
RNASE3	6037	broad.mit.edu	37	14	21359990	21359990	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr14:21359990C>G	ENST00000304639.3	+	2	203	c.145C>G	c.(145-147)Cga>Gga	p.R49G		NM_002935.2	NP_002926.2	P12724	ECP_HUMAN	ribonuclease, RNase A family, 3	49	Required for nearly all of the bactericidal activity; partially involved in LPS-binding and bacterial membrane depolarization.				antibacterial humoral response (GO:0019731)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)	9	all_cancers(95;0.00453)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	Pranlukast(DB01411)	GAACCCCCCTCGATGCACCAT	0.478																																							uc001vyj.2		NA																	0					0						c.(145-147)CGA>GGA		ribonuclease, RNase A family, 3 (eosinophil	Pranlukast(DB01411)						110.0	116.0	114.0					14																	21359990		2192	4300	6492	SO:0001583	missense	6037				defense response to bacterium|RNA catabolic process	extracellular region|soluble fraction	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:21359990C>G	X55990	CCDS9560.1	14q11.2	2014-03-13	2010-05-07		ENSG00000169397	ENSG00000169397	3.1.27.-	"""Ribonucleases, RNase A"""	10046	protein-coding gene	gene with protein product	"""eosinophil cationic protein"""	131398		RNS3		1577491	Standard	NM_002935		Approved	ECP	uc001vyj.3	P12724	OTTHUMG00000029604	ENST00000304639.3:c.145C>G	14.37:g.21359990C>G	ENSP00000302324:p.Arg49Gly						p.R49G	NM_002935	NP_002926	P12724	ECP_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	2	199	+	all_cancers(95;0.00453)		49					Q4VBC1|Q8WTP7|Q8WZ62|Q9GZN9	Missense_Mutation	SNP	ENST00000304639.3	37	c.145C>G	CCDS9560.1	.	.	.	.	.	.	.	.	.	.	c	6.569	0.473388	0.12461	.	.	ENSG00000169397	ENST00000304639	T	0.73152	-0.72	2.33	-0.941	0.10402	Ribonuclease A, domain (4);	2.291250	0.02773	U	0.119870	T	0.61627	0.2362	L	0.53249	1.67	0.09310	N	1	P	0.37038	0.579	B	0.31869	0.137	T	0.49597	-0.8923	10	0.54805	T	0.06	.	3.6993	0.08376	0.4046:0.46:0.0:0.1354	.	49	P12724	ECP_HUMAN	G	49	ENSP00000302324:R49G	ENSP00000302324:R49G	R	+	1	2	RNASE3	20429830	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.663000	0.05299	-0.290000	0.09025	-0.652000	0.03908	CGA		0.478	RNASE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073795.2	NM_002935		5	91	0	0	0	0.000602	0	5	91				
LRP10	26020	broad.mit.edu	37	14	23344587	23344587	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr14:23344587G>A	ENST00000359591.4	+	5	1121	c.430G>A	c.(430-432)Gag>Aag	p.E144K	LRP10_ENST00000546834.1_Missense_Mutation_p.E144K	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	144	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		CCTGCAGGAAGAGTTTCAGTG	0.577																																							uc001whd.2		NA																	0				central_nervous_system(1)	1						c.(430-432)GAG>AAG		low density lipoprotein receptor-related protein							110.0	85.0	94.0					14																	23344587		2203	4300	6503	SO:0001583	missense	26020				endocytosis	coated pit|integral to membrane		g.chr14:23344587G>A	AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.430G>A	14.37:g.23344587G>A	ENSP00000352601:p.Glu144Lys					LRP10_uc001whe.2_Missense_Mutation_p.E20K	p.E144K	NM_014045	NP_054764	Q7Z4F1	LRP10_HUMAN		GBM - Glioblastoma multiforme(265;0.00549)	5	983	+	all_cancers(95;4.69e-05)		144			LDL-receptor class A 1.|Extracellular (Potential).		A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Missense_Mutation	SNP	ENST00000359591.4	37	c.430G>A	CCDS9578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.51|18.51	3.640355|3.640355	0.67244|0.67244	.|.	.|.	ENSG00000197324|ENSG00000197324	ENST00000359591;ENST00000546834|ENST00000551466	D;D|.	0.95949|.	-3.86;-3.86|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	0.544469|.	0.20698|.	N|.	0.087327|.	T|T	0.71728|0.71728	0.3374|0.3374	L|L	0.57130|0.57130	1.785|1.785	0.37738|0.37738	D|D	0.925508|0.925508	P|.	0.44521|.	0.837|.	B|.	0.44315|.	0.446|.	T|T	0.71679|0.71679	-0.4520|-0.4520	10|5	0.72032|.	D|.	0.01|.	-19.2323|-19.2323	17.4811|17.4811	0.87673|0.87673	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	144|.	Q7Z4F1|.	LRP10_HUMAN|.	K|K	144|45	ENSP00000352601:E144K;ENSP00000447559:E144K|.	ENSP00000352601:E144K|.	E|R	+|+	1|2	0|0	LRP10|LRP10	22414427|22414427	0.998000|0.998000	0.40836|0.40836	0.997000|0.997000	0.53966|0.53966	0.694000|0.694000	0.40290|0.40290	2.689000|2.689000	0.46993|0.46993	2.732000|2.732000	0.93576|0.93576	0.655000|0.655000	0.94253|0.94253	GAG|AGA		0.577	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071663.3			13	72	0	0	0	0.006122	0	13	72				
LTB4R	1241	broad.mit.edu	37	14	24785492	24785493	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr14:24785492_24785493GC>TT	ENST00000396789.4	+	2	2360_2361	c.635_636GC>TT	c.(634-636)cGC>cTT	p.R212L	LTB4R_ENST00000396782.2_Missense_Mutation_p.R212L|LTB4R_ENST00000345363.3_Missense_Mutation_p.R212L	NM_181657.3	NP_858043.1	Q15722	LT4R1_HUMAN	leukotriene B4 receptor	212					cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|muscle contraction (GO:0006936)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(265;0.018)		CAGGCCCGGCGCTTCCGCCGCA	0.673																																							uc001wos.2		NA																	0					0						c.(634-636)CGC>CTT		leukotriene B4 receptor																																				SO:0001583	missense	1241				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular component movement|immune response|inflammatory response|muscle contraction	integral to plasma membrane	nucleotide binding	g.chr14:24785492_24785493GC>TT	X98356	CCDS9626.1	14q11.2-q12	2012-08-10			ENSG00000213903	ENSG00000213903		"""GPCR / Class A : Leukotriene receptors"""	6713	protein-coding gene	gene with protein product		601531		P2RY7, GPR16, CMKRL1		8921391, 8702478	Standard	NM_181657		Approved	BLTR, P2Y7, LTB4R1	uc001wos.3	Q15722	OTTHUMG00000029346	Exception_encountered	14.37:g.24785492_24785493delinsTT	ENSP00000380008:p.Arg212Leu					LTB4R_uc010alp.2_Missense_Mutation_p.R212L|LTB4R_uc001wou.2_Missense_Mutation_p.R212L	p.R212L	NM_001143919	NP_001137391	Q15722	LT4R1_HUMAN		GBM - Glioblastoma multiforme(265;0.018)	2	956_957	+			212			Cytoplasmic (Potential).		Q13305|Q53XV5|Q92641|Q9BSU5	Missense_Mutation	DNP	ENST00000396789.4	37	c.635_636GC>TT	CCDS9626.1																																																																																				0.673	LTB4R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073198.4			4	14	0	0	0	0.004672	0	4	14				
PRKD1	5587	broad.mit.edu	37	14	30194845	30194845	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr14:30194845C>T	ENST00000331968.5	-	2	529	c.300G>A	c.(298-300)aaG>aaA	p.K100K	PRKD1_ENST00000415220.2_Silent_p.K100K	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	100					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AAAGCAGGATCTTATCATACA	0.393																																							uc001wqh.2		NA																	0				lung(3)|large_intestine(2)|ovary(2)|skin(1)	8						c.(298-300)AAG>AAA		protein kinase D1							119.0	107.0	111.0					14																	30194845		2203	4300	6503	SO:0001819	synonymous_variant	5587				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity	g.chr14:30194845C>T		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.300G>A	14.37:g.30194845C>T							p.K100K	NM_002742	NP_002733	Q15139	KPCD1_HUMAN	LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)	2	481	-	Hepatocellular(127;0.0604)		100					A6NL64|B2RAF6	Silent	SNP	ENST00000331968.5	37	c.300G>A	CCDS9637.1																																																																																				0.393	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742		16	73	0	0	0	0.006122	0	16	73				
HEATR5A	25938	broad.mit.edu	37	14	31771573	31771573	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr14:31771573C>G	ENST00000389961.3	-	32	5373	c.5374G>C	c.(5374-5376)Gaa>Caa	p.E1792Q	RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000543095.2_Missense_Mutation_p.E1798Q|HEATR5A_ENST00000439348.1_Intron|HEATR5A_ENST00000439727.1_Missense_Mutation_p.E1505Q			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1792										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		CGGCTCTTTTCTGCCCGGGCC	0.483																																							uc001wrf.3		NA																	0				ovary(1)	1						c.(4513-4515)GAA>CAA		HEAT repeat containing 5A							45.0	44.0	44.0					14																	31771573		1865	4091	5956	SO:0001583	missense	25938						binding	g.chr14:31771573C>G	AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.5374G>C	14.37:g.31771573C>G	ENSP00000374611:p.Glu1792Gln					HEATR5A_uc010ami.2_Intron	p.E1505Q	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)	27	4590	-	Hepatocellular(127;0.0877)|Breast(36;0.137)		1792					Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	ENST00000389961.3	37	c.4513G>C		.	.	.	.	.	.	.	.	.	.	C	14.94	2.685840	0.47991	.	.	ENSG00000129493	ENST00000389961;ENST00000439727;ENST00000543095	T;T;T	0.66460	-0.21;-0.21;-0.21	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.79604	0.4474	M	0.73962	2.25	0.80722	D	1	.	.	.	.	.	.	T	0.80555	-0.1330	8	0.48119	T	0.1	.	18.3877	0.90472	0.0:1.0:0.0:0.0	.	.	.	.	Q	1792;1505;1798	ENSP00000374611:E1792Q;ENSP00000408681:E1505Q;ENSP00000437968:E1798Q	ENSP00000374611:E1792Q	E	-	1	0	HEATR5A	30841324	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	7.339000	0.79282	2.429000	0.82318	0.655000	0.94253	GAA		0.483	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473		5	14	0	0	0	0.001168	0	5	14				
LRFN5	145581	broad.mit.edu	37	14	42356780	42356780	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr14:42356780A>C	ENST00000298119.4	+	3	2141	c.952A>C	c.(952-954)Att>Ctt	p.I318L	LRFN5_ENST00000554171.1_Missense_Mutation_p.I318L|LRFN5_ENST00000554120.1_Missense_Mutation_p.I318L	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	318	Ig-like.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGAGCCTGCAATTCACTGGAT	0.463										HNSCC(30;0.082)																													uc001wvm.2		NA																	0				ovary(5)|pancreas(2)|central_nervous_system(1)	8						c.(952-954)ATT>CTT		leucine rich repeat and fibronectin type III							119.0	116.0	117.0					14																	42356780		2203	4300	6503	SO:0001583	missense	145581					integral to membrane		g.chr14:42356780A>C	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.952A>C	14.37:g.42356780A>C	ENSP00000298119:p.Ile318Leu	HNSCC(30;0.082)				LRFN5_uc010ana.2_Missense_Mutation_p.I318L	p.I318L	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	3	2150	+			318			Extracellular (Potential).|Ig-like.		B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	c.952A>C	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	A	17.72	3.458943	0.63401	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.71103	-0.54;-0.54;-0.54	5.4	5.4	0.78164	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000023	D	0.82609	0.5074	M	0.80508	2.5	0.52099	D	0.999943	P;P	0.42649	0.756;0.786	P;P	0.57548	0.461;0.823	D	0.84894	0.0838	10	0.87932	D	0	.	13.6708	0.62424	1.0:0.0:0.0:0.0	.	318;318	G3V364;Q96NI6	.;LRFN5_HUMAN	L	318	ENSP00000298119:I318L;ENSP00000451897:I318L;ENSP00000451067:I318L	ENSP00000298119:I318L	I	+	1	0	LRFN5	41426530	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.526000	0.81920	2.165000	0.68154	0.460000	0.39030	ATT		0.463	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		4	104	0	0	0	0.000602	0	4	104				
ADAM20	8748	broad.mit.edu	37	14	70991355	70991355	+	Silent	SNP	T	T	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr14:70991355T>C	ENST00000256389.3	-	2	514	c.270A>G	c.(268-270)ccA>ccG	p.P90P	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	40					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		TCACCACTTCTGGAGAAGTGA	0.532																																							uc001xme.2		NA																	0				skin(1)	1						c.(268-270)CCA>CCG		ADAM metallopeptidase domain 20 preproprotein							68.0	64.0	66.0					14																	70991355		2203	4300	6503	SO:0001819	synonymous_variant	8748				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr14:70991355T>C	AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.270A>G	14.37:g.70991355T>C							p.P90P	NM_003814	NP_003805	O43506	ADA20_HUMAN	KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)	2	515	-			40					Q6GTZ1|Q9UKJ9	Silent	SNP	ENST00000256389.3	37	c.270A>G	CCDS32111.1																																																																																				0.532	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395004.2			5	22	0	0	0	0.001168	0	5	22				
SAMD15	161394	broad.mit.edu	37	14	77844488	77844488	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr14:77844488G>A	ENST00000216471.4	+	1	1013	c.727G>A	c.(727-729)Gag>Aag	p.E243K	TMED8_ENST00000216468.7_5'Flank|SAMD15_ENST00000533095.2_Intron	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	243										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GACTCCAGAGGAGACACAAAG	0.468																																							uc001xtq.1		NA																	0					0						c.(727-729)GAG>AAG		hypothetical protein LOC161394							75.0	83.0	80.0					14																	77844488		2203	4298	6501	SO:0001583	missense	161394							g.chr14:77844488G>A	AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.727G>A	14.37:g.77844488G>A	ENSP00000216471:p.Glu243Lys					TMED8_uc010ast.1_5'Flank|TMED8_uc001xto.1_5'Flank	p.E243K	NM_001010860	NP_001010860	Q9P1V8	SAM15_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0278)	1	727	+			243					Q2M3P3	Missense_Mutation	SNP	ENST00000216471.4	37	c.727G>A	CCDS32126.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527787	0.44969	.	.	ENSG00000100583	ENST00000216471	T	0.30182	1.54	5.45	4.57	0.56435	.	0.000000	0.34555	N	0.003862	T	0.27697	0.0681	L	0.57536	1.79	0.19300	N	0.999976	B	0.32203	0.36	B	0.32211	0.142	T	0.21280	-1.0250	10	0.40728	T	0.16	-7.639	7.2125	0.25941	0.0867:0.0:0.7454:0.1679	.	243	Q9P1V8	SAM15_HUMAN	K	243	ENSP00000216471:E243K	ENSP00000216471:E243K	E	+	1	0	SAMD15	76914241	0.960000	0.32886	0.184000	0.23157	0.078000	0.17371	2.677000	0.46892	1.310000	0.45006	0.555000	0.69702	GAG		0.468	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394587.2	NM_001010860		7	23	0	0	0	0.001984	0	7	23				
TYRO3	7301	broad.mit.edu	37	15	41870191	41870191	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr15:41870191C>T	ENST00000263798.3	+	19	2614	c.2390C>T	c.(2389-2391)tCt>tTt	p.S797F	TYRO3_ENST00000559066.1_Missense_Mutation_p.S752F	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	797					apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TCTGTGCTATCTGCCAGCCAG	0.587																																							uc001zof.1		NA																	0				ovary(3)|lung(2)|central_nervous_system(1)	6						c.(2389-2391)TCT>TTT		TYRO3 protein tyrosine kinase precursor							43.0	48.0	46.0					15																	41870191		2203	4300	6503	SO:0001583	missense	7301					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr15:41870191C>T	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.2390C>T	15.37:g.41870191C>T	ENSP00000263798:p.Ser797Phe						p.S797F	NM_006293	NP_006284	Q06418	TYRO3_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)	19	2614	+		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)	797			Cytoplasmic (Potential).		O14953|Q86VR3	Missense_Mutation	SNP	ENST00000263798.3	37	c.2390C>T	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.056615	0.55325	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.62105	0.05	5.95	5.95	0.96441	Protein kinase-like domain (1);	0.000000	0.40144	N	0.001169	T	0.71753	0.3377	L	0.29908	0.895	0.53688	D	0.999978	D	0.76494	0.999	D	0.70935	0.971	T	0.72340	-0.4323	10	0.59425	D	0.04	-22.7838	20.3932	0.98965	0.0:1.0:0.0:0.0	.	797	Q06418	TYRO3_HUMAN	F	729;797	ENSP00000263798:S797F	ENSP00000263798:S797F	S	+	2	0	TYRO3	39657483	0.950000	0.32346	0.987000	0.45799	0.094000	0.18550	3.510000	0.53393	2.824000	0.97209	0.655000	0.94253	TCT		0.587	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2			6	27	0	0	0	0.001984	0	6	27				
SLC30A4	7782	broad.mit.edu	37	15	45803358	45803358	+	Silent	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr15:45803358G>A	ENST00000261867.4	-	3	830	c.516C>T	c.(514-516)ttC>ttT	p.F172F	HMGN2P46_ENST00000409454.1_RNA|RP11-519G16.3_ENST00000560647.1_RNA|SLC30A4_ENST00000559667.1_5'UTR	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	172					regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		ATCCAAAGGTGAATCTTTTGG	0.368																																							uc001zvj.2		NA																	0					0						c.(514-516)TTC>TTT		solute carrier family 30 (zinc transporter),							276.0	262.0	267.0					15																	45803358		2198	4298	6496	SO:0001819	synonymous_variant	7782				regulation of sequestering of zinc ion|response to toxin	endosome membrane|integral to membrane|late endosome	zinc ion transmembrane transporter activity	g.chr15:45803358G>A		CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.516C>T	15.37:g.45803358G>A						C15orf21_uc001zvk.2_RNA|C15orf21_uc010beg.1_RNA|C15orf21_uc010beh.1_RNA|C15orf21_uc010bei.1_RNA|C15orf21_uc010bej.1_RNA|C15orf21_uc001zvm.1_RNA|C15orf21_uc001zvn.1_RNA	p.F172F	NM_013309	NP_037441	O14863	ZNT4_HUMAN		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)	3	828	-		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	172			Cytoplasmic (Potential).		Q8TC39	Silent	SNP	ENST00000261867.4	37	c.516C>T	CCDS10125.1																																																																																				0.368	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254236.1			9	156	0	0	0	0.008291	0	9	156				
UACA	55075	broad.mit.edu	37	15	70976696	70976696	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr15:70976696G>A	ENST00000322954.6	-	8	877	c.692C>T	c.(691-693)gCg>gTg	p.A231V	UACA_ENST00000379983.2_Missense_Mutation_p.A218V|UACA_ENST00000559183.1_5'Flank|UACA_ENST00000539319.1_Intron|UACA_ENST00000560441.1_Missense_Mutation_p.A218V	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	231					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.A218V(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						ATGGCCAAGCGCATCCAGCAA	0.408																																							uc002asr.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(691-693)GCG>GTG		uveal autoantigen with coiled-coil domains and							192.0	181.0	185.0					15																	70976696		2199	4297	6496	SO:0001583	missense	55075					cytoskeleton|extracellular region		g.chr15:70976696G>A	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.692C>T	15.37:g.70976696G>A	ENSP00000314556:p.Ala231Val					UACA_uc010uke.1_Intron|UACA_uc002asq.2_Missense_Mutation_p.A218V|UACA_uc010bin.1_Missense_Mutation_p.A217V	p.A231V	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN			8	796	-			231					G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	c.692C>T	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.255354	0.80135	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000395362	T;T	0.52983	0.64;0.64	5.4	4.48	0.54585	Ankyrin repeat-containing domain (3);	0.119029	0.37955	N	0.001868	T	0.43211	0.1237	N	0.12182	0.205	0.80722	D	1	D;D;D	0.76494	0.997;0.997;0.999	P;P;P	0.60117	0.743;0.743;0.869	T	0.35301	-0.9794	10	0.34782	T	0.22	-11.5689	10.1704	0.42906	0.0774:0.1459:0.7767:0.0	.	231;231;218	B7ZKM6;Q9BZF9;G3XAG2	.;UACA_HUMAN;.	V	231;218;218	ENSP00000314556:A231V;ENSP00000369319:A218V	ENSP00000314556:A231V	A	-	2	0	UACA	68763750	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	1.570000	0.36439	1.416000	0.47057	0.462000	0.41574	GCG		0.408	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2			29	68	0	0	0	0.012213	0	29	68				
PIGQ	9091	broad.mit.edu	37	16	633139	633139	+	Silent	SNP	G	G	A	rs150021665		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:633139G>A	ENST00000026218.5	+	10	1876	c.1788G>A	c.(1786-1788)acG>acA	p.T596T	PIGQ_ENST00000321878.5_3'UTR	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	596					C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				CTTTGTGGACGCTGCTGTGTG	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		19836	0.001		0.0	False		,,,				2504	0.0						uc002cho.2		NA																	0				central_nervous_system(1)	1						c.(1786-1788)ACG>ACA		phosphatidylinositol glycan anchor biosynthesis,		G	,	1,4401	4.2+/-10.8	0,1,2200	102.0	101.0	101.0		,1788	1.2	0.0	16	dbSNP_134	101	1,8599	1.2+/-3.3	0,1,4299	no	utr-3,coding-synonymous	PIGQ	NM_004204.3,NM_148920.1	,	0,2,6499	AA,AG,GG		0.0116,0.0227,0.0154	,	,596/761	633139	2,13000	2201	4300	6501	SO:0001819	synonymous_variant	9091				C-terminal protein lipidation|carbohydrate metabolic process|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity	g.chr16:633139G>A	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1788G>A	16.37:g.633139G>A						PIGQ_uc010bqw.2_3'UTR|PIGQ_uc002chn.2_3'UTR|PIGQ_uc010uui.1_3'UTR|PIGQ_uc002chp.2_Silent_p.T166T|uc010uuj.1_3'UTR	p.T596T	NM_148920	NP_683721	Q9BRB3	PIGQ_HUMAN			10	1890	+		Hepatocellular(780;0.00335)	596					A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Silent	SNP	ENST00000026218.5	37	c.1788G>A	CCDS10411.1																																																																																				0.647	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000239270.2	NM_004204		10	83	0	0	0	0.013537	0	10	83				
CACNA1H	8912	broad.mit.edu	37	16	1261984	1261984	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:1261984C>T	ENST00000348261.5	+	25	4853	c.4605C>T	c.(4603-4605)ttC>ttT	p.F1535F	CACNA1H_ENST00000358590.4_Silent_p.F1535F|CACNA1H_ENST00000565831.1_Silent_p.F1535F	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1535					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	TGCTGTACTTCATCTCCTTCC	0.642																																							uc002cks.2		NA																	0				breast(2)	2						c.(4603-4605)TTC>TTT		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Mibefradil(DB01388)						256.0	276.0	269.0					16																	1261984		2173	4268	6441	SO:0001819	synonymous_variant	8912				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity	g.chr16:1261984C>T	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.4605C>T	16.37:g.1261984C>T						CACNA1H_uc002ckt.2_Silent_p.F1535F|CACNA1H_uc002cku.2_Silent_p.F241F|CACNA1H_uc010brj.2_Silent_p.F241F|CACNA1H_uc002ckv.2_Silent_p.F241F	p.F1535F	NM_021098	NP_066921	O95180	CAC1H_HUMAN			25	4853	+		Hepatocellular(780;0.00369)	1535			Helical; Name=S6 of repeat III; (Potential).|III.		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	ENST00000348261.5	37	c.4605C>T	CCDS45375.1																																																																																				0.642	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407		13	228	0	0	0	0.00499	0	13	228				
E4F1	1877	broad.mit.edu	37	16	2282276	2282276	+	Missense_Mutation	SNP	G	G	T	rs576266110		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:2282276G>T	ENST00000301727.4	+	4	568	c.520G>T	c.(520-522)Gca>Tca	p.A174S	E4F1_ENST00000564139.1_Missense_Mutation_p.A174S|E4F1_ENST00000565090.1_Missense_Mutation_p.A174S	NM_004424.3	NP_004415.2	Q66K89	E4F1_HUMAN	E4F transcription factor 1	174					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|mitotic cell cycle arrest (GO:0071850)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell cycle process (GO:0010564)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle, embryonic (GO:0009794)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			ovary(1)	1						GCTGGGGCTCGCAGGGGAGGG	0.667																																							uc002cpm.2		NA																	0				ovary(1)	1						c.(520-522)GCA>TCA		p120E4F							41.0	49.0	46.0					16																	2282276		2196	4300	6496	SO:0001583	missense	1877				cell division|cell proliferation|interspecies interaction between organisms|mitosis|regulation of growth	cytoplasm|nucleoplasm	DNA binding|ligase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr16:2282276G>T	U87269	CCDS32370.1, CCDS73809.1, CCDS73810.1	16p13.3	2013-01-08				ENSG00000167967		"""Zinc fingers, C2H2-type"""	3121	protein-coding gene	gene with protein product		603022				9763670, 8828041	Standard	XM_005255155		Approved	E4F	uc002cpm.3	Q66K89		ENST00000301727.4:c.520G>T	16.37:g.2282276G>T	ENSP00000301727:p.Ala174Ser					E4F1_uc010bsi.2_Missense_Mutation_p.A174S|E4F1_uc010bsj.2_Missense_Mutation_p.A174S	p.A174S	NM_004424	NP_004415	Q66K89	E4F1_HUMAN			4	568	+			174					A8K2R4|O00146	Missense_Mutation	SNP	ENST00000301727.4	37	c.520G>T	CCDS32370.1	.	.	.	.	.	.	.	.	.	.	g	7.674	0.687658	0.14973	.	.	ENSG00000167967	ENST00000301727	T	0.06849	3.25	4.93	-7.06	0.01568	.	1.280060	0.05102	N	0.487242	T	0.03915	0.0110	L	0.33485	1.01	0.09310	N	1	B;B;B	0.15141	0.012;0.0;0.001	B;B;B	0.11329	0.006;0.001;0.002	T	0.44081	-0.9351	10	0.02654	T	1	0.8147	1.0807	0.01642	0.2902:0.0946:0.3258:0.2894	.	170;174;174	E9PFZ8;E7EMF7;Q66K89	.;.;E4F1_HUMAN	S	174	ENSP00000301727:A174S	ENSP00000301727:A174S	A	+	1	0	E4F1	2222277	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.475000	0.00987	-1.290000	0.02372	-0.980000	0.02579	GCA		0.667	E4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435225.1	NM_004424		17	16	1	0	2.35188e-11	0.006122	2.87818e-11	17	16				
CCDC64B	146439	broad.mit.edu	37	16	3078218	3078218	+	Silent	SNP	C	C	G	rs372816118		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:3078218C>G	ENST00000572449.1	-	10	1478	c.1416G>C	c.(1414-1416)ctG>ctC	p.L472L	CCDC64B_ENST00000389347.4_Silent_p.L472L|CCDC64B_ENST00000573514.1_Silent_p.L265L			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	472										breast(1)|endometrium(2)|large_intestine(1)	4						CGGAGGCGCTCAGCTCCTTCT	0.736																																							uc002ctf.3		NA																	0					0						c.(1414-1416)CTG>CTC		coiled-coil domain containing 64B		C		1,3823		0,1,1911	7.0	8.0	8.0		1416	0.1	0.4	16		8	0,7982		0,0,3991	no	coding-synonymous	CCDC64B	NM_001103175.1		0,1,5902	GG,GC,CC		0.0,0.0262,0.0085		472/509	3078218	1,11805	1912	3991	5903	SO:0001819	synonymous_variant	146439							g.chr16:3078218C>G	BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.1416G>C	16.37:g.3078218C>G						CCDC64B_uc002cte.3_Silent_p.L265L	p.L472L	NM_001103175	NP_001096645	A1A5D9	BICR2_HUMAN			9	1461	-			472					Q658L9	Silent	SNP	ENST00000572449.1	37	c.1416G>C	CCDS45393.1																																																																																				0.736	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436991.1			2	5	0	0	0	0.004672	0	2	5				
ACSM2A	123876	broad.mit.edu	37	16	20492237	20492237	+	Silent	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:20492237A>T	ENST00000573854.1	+	12	1617	c.1503A>T	c.(1501-1503)cgA>cgT	p.R501R	ACSM2A_ENST00000396104.2_Silent_p.R501R|ACSM2A_ENST00000417235.2_Silent_p.R422R|ACSM2A_ENST00000575690.1_Silent_p.R501R|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000219054.6_Silent_p.R501R|ACSM2A_ENST00000536134.1_Silent_p.R273R	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	501					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						ACCCCGTCCGAGGAGAGGTGA	0.562																																							uc010bwe.2		NA																	0				skin(2)|breast(1)	3						c.(1501-1503)CGA>CGT		acyl-CoA synthetase medium-chain family member							65.0	62.0	63.0					16																	20492237		2203	4298	6501	SO:0001819	synonymous_variant	123876				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding	g.chr16:20492237A>T	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1503A>T	16.37:g.20492237A>T						ACSM2A_uc010vax.1_Silent_p.R422R|ACSM2A_uc002dhf.3_Silent_p.R501R|ACSM2A_uc002dhg.3_Silent_p.R501R|ACSM2A_uc010vay.1_Silent_p.R422R|ACSM2A_uc002dhh.3_Silent_p.R131R	p.R501R	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN			13	1742	+			501				Coenzyme A.	B3KTT9|O75202	Silent	SNP	ENST00000573854.1	37	c.1503A>T	CCDS32401.1																																																																																				0.562	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845		12	33	0	0	0	0.00245	0	12	33				
ZP2	7783	broad.mit.edu	37	16	21213302	21213302	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:21213302G>C	ENST00000574002.1	-	13	1812	c.1330C>G	c.(1330-1332)Ctc>Gtc	p.L444V	ZP2_ENST00000574091.1_Missense_Mutation_p.L444V|ZP2_ENST00000219593.4_Missense_Mutation_p.L444V|AF001550.7_ENST00000572747.1_RNA			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	444	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		TCCGTCCAGAGAGCATGTATT	0.373																																							uc002dii.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1330-1332)CTC>GTC		zona pellucida glycoprotein 2 preproprotein							102.0	98.0	100.0					16																	21213302		2200	4300	6500	SO:0001583	missense	7783				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity	g.chr16:21213302G>C	M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.1330C>G	16.37:g.21213302G>C	ENSP00000460971:p.Leu444Val					ZP2_uc010bwn.1_Missense_Mutation_p.L483V	p.L444V	NM_003460	NP_003451	Q05996	ZP2_HUMAN		GBM - Glioblastoma multiforme(48;0.0573)	12	1330	-			444			Extracellular (Potential).|ZP.		B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	ENST00000574002.1	37	c.1330C>G	CCDS10596.1	.	.	.	.	.	.	.	.	.	.	G	11.81	1.749051	0.30955	.	.	ENSG00000103310	ENST00000219593	D	0.82081	-1.57	5.83	2.81	0.32909	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.202284	0.34362	N	0.004026	T	0.79992	0.4542	L	0.42581	1.335	0.35083	D	0.763617	B;B	0.28667	0.219;0.219	B;B	0.41813	0.367;0.367	T	0.78140	-0.2320	10	0.44086	T	0.13	-4.5786	7.6864	0.28542	0.2026:0.1192:0.6783:0.0	.	444;444	Q4VAP1;Q05996	.;ZP2_HUMAN	V	444	ENSP00000219593:L444V	ENSP00000219593:L444V	L	-	1	0	ZP2	21120803	1.000000	0.71417	0.975000	0.42487	0.402000	0.30811	2.810000	0.47979	0.381000	0.24851	0.467000	0.42956	CTC		0.373	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207365.2			8	65	0	0	0	0.004482	0	8	65				
XPO6	23214	broad.mit.edu	37	16	28128693	28128693	+	Silent	SNP	G	G	A	rs372282404		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:28128693G>A	ENST00000304658.5	-	15	2450	c.1950C>T	c.(1948-1950)ttC>ttT	p.F650F	XPO6_ENST00000565698.1_Silent_p.F636F	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	650					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						TGAGTGTCACGAACTGCTGCG	0.502																																							uc002dpa.1		NA																	0				ovary(1)|skin(1)	2						c.(1948-1950)TTC>TTT		exportin 6		G		0,4084		0,0,2042	233.0	224.0	227.0		1950	-8.2	0.4	16		227	1,8375		0,1,4187	no	coding-synonymous	XPO6	NM_015171.2		0,1,6229	AA,AG,GG		0.0119,0.0,0.0080		650/1126	28128693	1,12459	2042	4188	6230	SO:0001819	synonymous_variant	23214				protein export from nucleus		protein binding|protein transporter activity	g.chr16:28128693G>A	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.1950C>T	16.37:g.28128693G>A						XPO6_uc002dpb.1_Silent_p.F636F|XPO6_uc010vcp.1_Silent_p.F650F	p.F650F	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN			15	2451	-			650					A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Silent	SNP	ENST00000304658.5	37	c.1950C>T	CCDS42135.1																																																																																				0.502	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195		15	107	0	0	0	0.00499	0	15	107				
GNAO1	2775	broad.mit.edu	37	16	56226258	56226258	+	Silent	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:56226258C>A	ENST00000262493.6	+	1	957	c.111C>A	c.(109-111)ctC>ctA	p.L37L	CTD-2050B12.2_ENST00000567381.1_RNA|RP11-461O7.1_ENST00000501259.1_lincRNA|GNAO1_ENST00000569295.1_3'UTR|GNAO1_ENST00000262494.7_Silent_p.L37L	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O	37					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				TGAAATTACTCCTGCTCGGTA	0.662																																							uc002eit.3		NA																	0				lung(1)|breast(1)	2						c.(109-111)CTC>CTA		guanine nucleotide binding protein, alpha							35.0	39.0	38.0					16																	56226258		2198	4300	6498	SO:0001819	synonymous_variant	2775				dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity	g.chr16:56226258C>A		CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.111C>A	16.37:g.56226258C>A						GNAO1_uc002eiu.3_Silent_p.L37L|LOC283856_uc002eis.1_5'Flank	p.L37L	NM_138736	NP_620073	P09471	GNAO_HUMAN			1	1008	+		all_neural(199;0.159)	37					P29777|Q8TD72|Q9UMV4	Silent	SNP	ENST00000262493.6	37	c.111C>A	CCDS10756.1																																																																																				0.662	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256981.2	NM_020988		5	33	1	0	8.12818e-05	0.001984	8.94611e-05	5	33				
NLRC5	84166	broad.mit.edu	37	16	57073730	57073730	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:57073730G>A	ENST00000262510.6	+	16	3064	c.2839G>A	c.(2839-2841)Gag>Aag	p.E947K	NLRC5_ENST00000436936.1_Missense_Mutation_p.E947K|NLRC5_ENST00000308149.7_Missense_Mutation_p.E947K|NLRC5_ENST00000539144.1_Missense_Mutation_p.E947K	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	947					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GTTTGCCCAGGAGCCAGAGGA	0.542																																							uc002ekk.1		NA																	0				ovary(4)|skin(2)|breast(1)	7						c.(2839-2841)GAG>AAG		nucleotide-binding oligomerization domains 27							111.0	114.0	113.0					16																	57073730		2198	4300	6498	SO:0001583	missense	84166				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding	g.chr16:57073730G>A	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.2839G>A	16.37:g.57073730G>A	ENSP00000262510:p.Glu947Lys					NLRC5_uc010ccq.1_RNA|NLRC5_uc002ekn.2_Missense_Mutation_p.E696K|NLRC5_uc002ekl.2_Missense_Mutation_p.E752K|NLRC5_uc002ekm.2_Missense_Mutation_p.E752K|NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_RNA|NLRC5_uc002eko.1_5'Flank|NLRC5_uc002ekp.1_5'Flank	p.E947K	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN			16	3064	+		all_neural(199;0.225)	947			LRR 7.		B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	c.2839G>A	CCDS10773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.58|11.58	1.681442|1.681442	0.29872|0.29872	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030|ENST00000538805	T;T;T;T;T;T|.	0.73258|.	-0.52;-0.55;-0.73;-0.55;2.38;2.26|.	4.59|4.59	1.6|1.6	0.23607|0.23607	.|.	0.476261|.	0.15547|.	N|.	0.256610|.	T|T	0.42381|0.42381	0.1200|0.1200	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	P;B;P;B|.	0.39782|.	0.496;0.404;0.688;0.008|.	B;B;B;B|.	0.39419|.	0.124;0.167;0.299;0.023|.	T|T	0.30621|0.30621	-0.9972|-0.9972	10|5	0.15499|.	T|.	0.54|.	.|.	6.9099|6.9099	0.24329|0.24329	0.2833:0.0:0.7167:0.0|0.2833:0.0:0.7167:0.0	.|.	947;947;947;947|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	K|E	947;947;947;421;947;454;246|699	ENSP00000262510:E947K;ENSP00000308886:E947K;ENSP00000389739:E947K;ENSP00000441727:E947K;ENSP00000441597:E454K;ENSP00000440153:E246K|.	ENSP00000262510:E947K|.	E|G	+|+	1|2	0|0	NLRC5|NLRC5	55631231|55631231	0.136000|0.136000	0.22515|0.22515	0.004000|0.004000	0.12327|0.12327	0.002000|0.002000	0.02628|0.02628	1.746000|1.746000	0.38288|0.38288	0.431000|0.431000	0.26258|0.26258	-0.157000|-0.157000	0.13467|0.13467	GAG|GGA		0.542	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206		14	75	0	0	0	0.007413	0	14	75				
LCAT	3931	broad.mit.edu	37	16	67974229	67974229	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:67974229C>T	ENST00000264005.5	-	6	930	c.901G>A	c.(901-903)Gac>Aac	p.D301N		NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	301					cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		CGTTGGAAGTCACGGCCTGTG	0.582																																							uc002euy.1		NA																	0					0						c.(901-903)GAC>AAC		lecithin-cholesterol acyltransferase precursor							121.0	103.0	109.0					16																	67974229		2198	4300	6498	SO:0001583	missense	3931				cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|high-density lipoprotein particle remodeling|phosphatidylcholine biosynthetic process|reverse cholesterol transport|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle	apolipoprotein A-I binding|phosphatidylcholine-sterol O-acyltransferase activity	g.chr16:67974229C>T		CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.901G>A	16.37:g.67974229C>T	ENSP00000264005:p.Asp301Asn						p.D301N	NM_000229	NP_000220	P04180	LCAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)	6	912	-		Ovarian(137;0.0563)	301					Q53XQ3	Missense_Mutation	SNP	ENST00000264005.5	37	c.901G>A	CCDS10854.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.213261	0.58452	.	.	ENSG00000213398	ENST00000264005	D	0.96041	-3.89	5.88	4.75	0.60458	.	0.066332	0.56097	U	0.000024	D	0.92743	0.7693	L	0.52573	1.65	0.39142	D	0.962068	B	0.29162	0.235	B	0.29598	0.104	D	0.90863	0.4740	10	0.35671	T	0.21	-22.0774	13.1613	0.59547	0.0:0.9106:0.0:0.0894	.	301	P04180	LCAT_HUMAN	N	301	ENSP00000264005:D301N	ENSP00000264005:D301N	D	-	1	0	LCAT	66531730	1.000000	0.71417	0.997000	0.53966	0.862000	0.49288	4.906000	0.63293	2.788000	0.95919	0.555000	0.69702	GAC		0.582	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3			3	58	0	0	0	0.004672	0	3	58				
CNTNAP4	85445	broad.mit.edu	37	16	76482781	76482781	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:76482781C>A	ENST00000476707.1	+	5	1008	c.869C>A	c.(868-870)aCa>aAa	p.T290K	CNTNAP4_ENST00000307431.8_Missense_Mutation_p.T286K|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.T262K|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.T286K|CNTNAP4_ENST00000469589.1_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	287	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						GTCAACTTCACAGTGGACGAA	0.458																																							uc002feu.1		NA																	0				ovary(1)|pancreas(1)	2						c.(859-861)ACA>AAA		cell recognition protein CASPR4 isoform 1							143.0	108.0	120.0					16																	76482781		2198	4300	6498	SO:0001583	missense	85445				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr16:76482781C>A	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.869C>A	16.37:g.76482781C>A	ENSP00000417628:p.Thr290Lys					CNTNAP4_uc002fev.1_Missense_Mutation_p.T199K|CNTNAP4_uc010chb.1_Missense_Mutation_p.T262K|CNTNAP4_uc002fex.1_Missense_Mutation_p.T290K|CNTNAP4_uc002few.2_Missense_Mutation_p.T262K	p.T287K	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN			8	1245	+			287			Extracellular (Potential).|Laminin G-like 1.		E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37	c.860C>A		.	.	.	.	.	.	.	.	.	.	C	21.3	4.135740	0.77662	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.34	5.34	0.76211	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.350050	0.20520	N	0.090710	D	0.87629	0.6225	.	.	.	0.42717	D	0.993661	D;D;D;D	0.67145	0.996;0.983;0.98;0.985	D;D;D;D	0.74023	0.973;0.958;0.982;0.938	D	0.88563	0.3124	9	0.87932	D	0	.	14.7768	0.69736	0.0:0.856:0.144:0.0	.	262;290;262;287	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	K	286;286;262;290	ENSP00000306893:T286K;ENSP00000439733:T286K;ENSP00000418741:T262K;ENSP00000417628:T290K	ENSP00000306893:T286K	T	+	2	0	CNTNAP4	75040282	1.000000	0.71417	0.131000	0.22000	0.967000	0.64934	5.406000	0.66357	2.773000	0.95371	0.655000	0.94253	ACA		0.458	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401		4	17	1	0	0.000602214	0.000602	0.000642607	4	17				
DYNLRB2	83657	broad.mit.edu	37	16	80577179	80577179	+	Missense_Mutation	SNP	G	G	T	rs149421698	byFrequency	TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:80577179G>T	ENST00000305904.6	+	2	130	c.10G>T	c.(10-12)Gtg>Ttg	p.V4L	RP11-525K10.3_ENST00000565050.1_RNA|RP11-525K10.3_ENST00000563267.1_RNA|RP11-525K10.3_ENST00000568776.1_RNA|RP11-525K10.3_ENST00000564411.1_RNA|DYNLRB2_ENST00000562982.1_Missense_Mutation_p.V33L|DYNLRB2_ENST00000568035.1_Missense_Mutation_p.V4L|RP11-525K10.3_ENST00000568552.1_RNA|RP11-525K10.3_ENST00000568819.1_RNA	NM_130897.1	NP_570967.1	Q8TF09	DLRB2_HUMAN	dynein, light chain, roadblock-type 2	4					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	cytoplasmic dynein complex (GO:0005868)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			large_intestine(1)|lung(4)|prostate(1)	6						TCAGGCAGAGGTGGAGGAAAC	0.413																																							uc002ffo.2		NA																	0					0						c.(10-12)GTG>TTG		dynein, light chain, roadblock-type 2							127.0	126.0	126.0					16																	80577179		2203	4300	6503	SO:0001583	missense	83657				microtubule-based movement|transport	cytoplasmic dynein complex|microtubule	microtubule motor activity	g.chr16:80577179G>T	AF125108	CCDS10929.1	16q23.3	2008-02-05	2005-11-25	2005-11-25	ENSG00000168589	ENSG00000168589		"""Cytoplasmic dyneins"""	15467	protein-coding gene	gene with protein product	"""roadblock domain containing 2"""	607168	"""dynein, cytoplasmic, light polypeptide 2B"""	DNCL2B		11750132, 16260502	Standard	NM_130897		Approved	DNLC2B, ROBLD2	uc002ffo.3	Q8TF09	OTTHUMG00000137622	ENST00000305904.6:c.10G>T	16.37:g.80577179G>T	ENSP00000302936:p.Val4Leu					DYNLRB2_uc002ffp.2_RNA|DYNLRB2_uc002ffq.2_RNA	p.V4L	NM_130897	NP_570967	Q8TF09	DLRB2_HUMAN			4	130	+			4						Missense_Mutation	SNP	ENST00000305904.6	37	c.10G>T	CCDS10929.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.830106	0.50845	.	.	ENSG00000168589	ENST00000305904;ENST00000338542	T;T	0.25414	1.8;1.8	5.66	4.71	0.59529	.	0.153194	0.40640	N	0.001053	T	0.24586	0.0596	.	.	.	0.28531	N	0.912572	B	0.12630	0.006	B	0.31245	0.126	T	0.12734	-1.0536	9	0.46703	T	0.11	-25.5341	12.7718	0.57426	0.0794:0.0:0.9206:0.0	.	4	Q8TF09	DLRB2_HUMAN	L	4	ENSP00000302936:V4L;ENSP00000342009:V4L	ENSP00000302936:V4L	V	+	1	0	DYNLRB2	79134680	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.462000	0.80851	2.665000	0.90641	0.655000	0.94253	GTG		0.413	DYNLRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269043.1	NM_130897		13	39	1	0	0.000422831	0.004007	0.000456762	13	39				
PKD1L2	114780	broad.mit.edu	37	16	81183335	81183335	+	RNA	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:81183335C>A	ENST00000525539.1	-	0	4712				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TGGGGACCCCCCAGAACATGA	0.597																																							uc002fgh.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(4711-4713)TGG>TGT		polycystin 1-like 2 isoform a							41.0	43.0	43.0					16																	81183335		1974	4175	6149			114780				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding	g.chr16:81183335C>A	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81183335C>A						PKD1L2_uc002fgg.1_RNA	p.W1571C	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN			28	4713	-			1571			Helical; (Potential).		Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37	c.4713G>T																																																																																					0.597	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2			5	14	1	0	1.23904e-05	0.000602	1.39442e-05	5	14				
PKD1L2	114780	broad.mit.edu	37	16	81214828	81214828	+	RNA	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:81214828G>C	ENST00000527937.1	-	0	104				PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000337114.4_RNA|PKD1L2_ENST00000525539.1_RNA|PKD1L2_ENST00000531391.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TGGTGACCCTGAGCAGAATGT	0.532																																							uc002fgh.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2044-2046)CTC>CTG		polycystin 1-like 2 isoform a							139.0	133.0	135.0					16																	81214828		2054	4212	6266			114780				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding	g.chr16:81214828G>C	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81214828G>C						PKD1L2_uc002fgg.1_RNA|PKD1L2_uc002fgi.2_5'UTR|PKD1L2_uc002fgj.2_Silent_p.L682L|PKD1L2_uc002fgl.1_5'UTR	p.L682L	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN			12	2046	-			682			REJ.|Extracellular (Potential).		Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	ENST00000527937.1	37	c.2046C>G		.	.	.	.	.	.	.	.	.	.	G	9.713	1.157661	0.21454	.	.	ENSG00000166473	ENST00000526632	.	.	.	4.9	1.64	0.23874	.	.	.	.	.	T	0.55673	0.1935	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51663	-0.8677	4	.	.	.	-21.2405	7.86	0.29504	0.0915:0.3446:0.5639:0.0	.	.	.	.	E	210	.	.	Q	-	1	0	PKD1L2	79772329	0.159000	0.22864	0.923000	0.36655	0.873000	0.50193	-0.046000	0.11983	1.169000	0.42739	0.563000	0.77884	CAG		0.532	PKD1L2-007	KNOWN	basic|exp_conf	protein_coding	polymorphic_pseudogene	OTTHUMT00000387978.1			13	60	0	0	0	0.004007	0	13	60				
PRDM7	11105	broad.mit.edu	37	16	90130098	90130098	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr16:90130098C>A	ENST00000449207.2	-	5	449	c.430G>T	c.(430-432)Gac>Tac	p.D144Y	PRDM7_ENST00000325921.6_5'Flank|PRDM7_ENST00000407825.1_5'UTR	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	144					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		TGCTCTGAGTCACTTGTATTC	0.423																																							uc010cje.2		NA																	0				ovary(1)	1						c.(430-432)GAC>TAC		PR domain containing 7 isoform 1							112.0	109.0	110.0					16																	90130098		1879	4108	5987	SO:0001583	missense	11105					chromosome|nucleus	nucleic acid binding	g.chr16:90130098C>A	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.430G>T	16.37:g.90130098C>A	ENSP00000396732:p.Asp144Tyr					PRDM7_uc002fqo.2_5'Flank|PRDM7_uc010cjf.2_Intron|PRDM7_uc010cjg.1_5'Flank|PRDM7_uc010cjh.1_Intron	p.D144Y	NM_001098173	NP_001091643	Q9NQW5	PRDM7_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0278)	5	450	-		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)	144					A4Q9G8|Q08EM4|Q9NQW4	Missense_Mutation	SNP	ENST00000449207.2	37	c.430G>T	CCDS45557.1	.	.	.	.	.	.	.	.	.	.	.	5.843	0.339785	0.11069	.	.	ENSG00000126856	ENST00000449207	T	0.14022	2.54	1.6	-0.488	0.12056	.	.	.	.	.	T	0.06234	0.0161	N	0.14661	0.345	0.09310	N	0.999996	B	0.15141	0.012	B	0.08055	0.003	T	0.42582	-0.9443	8	.	.	.	-0.945	4.2038	0.10480	0.0:0.6048:0.0:0.3952	.	144	Q9NQW5	PRDM7_HUMAN	Y	144	ENSP00000396732:D144Y	.	D	-	1	0	PRDM7	88657599	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	0.018000	0.13422	-0.109000	0.12044	0.491000	0.48974	GAC		0.423	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420560.1			15	20	1	0	3.51602e-12	0.008871	4.39502e-12	15	20				
SMYD4	114826	broad.mit.edu	37	17	1686381	1686381	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:1686381T>C	ENST00000305513.7	-	10	2376	c.2209A>G	c.(2209-2211)Agt>Ggt	p.S737G		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	737							metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						ATTTCAACACTGGACGGCCCG	0.517																																							uc002ftm.3		NA																	0				skin(3)|kidney(2)	5						c.(2209-2211)AGT>GGT		SET and MYND domain containing 4							75.0	78.0	77.0					17																	1686381		2203	4300	6503	SO:0001583	missense	114826						zinc ion binding	g.chr17:1686381T>C	AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.2209A>G	17.37:g.1686381T>C	ENSP00000304360:p.Ser737Gly					SMYD4_uc002ftn.1_Missense_Mutation_p.S592G	p.S737G	NM_052928	NP_443160	Q8IYR2	SMYD4_HUMAN			10	2377	-			737					Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	ENST00000305513.7	37	c.2209A>G	CCDS11013.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.987499	0.74589	.	.	ENSG00000186532	ENST00000305513	T	0.63255	-0.03	5.84	5.84	0.93424	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.81014	0.4735	M	0.83483	2.645	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	T	0.83295	-0.0031	10	0.59425	D	0.04	-17.6696	16.2225	0.82267	0.0:0.0:0.0:1.0	.	737	Q8IYR2	SMYD4_HUMAN	G	737	ENSP00000304360:S737G	ENSP00000304360:S737G	S	-	1	0	SMYD4	1633131	1.000000	0.71417	1.000000	0.80357	0.430000	0.31655	6.431000	0.73395	2.235000	0.73313	0.379000	0.24179	AGT		0.517	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207108.4	XM_056082		13	23	0	0	0	0.001855	0	13	23				
TP53	7157	broad.mit.edu	37	17	7579533	7579533	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:7579533G>A	ENST00000269305.4	-	4	343	c.154C>T	c.(154-156)Caa>Taa	p.Q52*	TP53_ENST00000413465.2_Nonsense_Mutation_p.Q52*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q52*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q52*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q52*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q52*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	52	Interaction with HRMT1L2.		Q -> H (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q52*(12)|p.0?(8)|p.Q52>P*(1)|p.E51fs*59(1)|p.I50fs*4(1)|p.D48fs*55(1)|p.Q52fs*67(1)|p.Q52fs*6(1)|p.E51_Q52insX(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGAACCATTGTTCAATATCG	0.592		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		29	Substitution - Nonsense(12)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(1)|Insertion - In frame(1)|Complex - insertion inframe(1)	p.0?(7)|p.Q52*(6)|p.Q52>P*(1)|p.Q52H(1)|p.E51fs*59(1)|p.I50fs*4(1)|p.D48fs*55(1)|p.Q52fs*67(1)|p.Q52fs*6(1)|p.E51_Q52insX(1)|p.P13fs*18(1)|p.S33fs*23(1)	upper_aerodigestive_tract(6)|prostate(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|urinary_tract(3)|stomach(2)|central_nervous_system(2)|large_intestine(1)|kidney(1)|endometrium(1)|breast(1)|pancreas(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(154-156)CAA>TAA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							168.0	167.0	167.0					17																	7579533		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7579533G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.154C>T	17.37:g.7579533G>A	ENSP00000269305:p.Gln52*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Nonsense_Mutation_p.Q52*|TP53_uc002gih.2_Nonsense_Mutation_p.Q52*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Nonsense_Mutation_p.Q52*|TP53_uc010cni.1_Nonsense_Mutation_p.Q52*|TP53_uc002gij.2_Nonsense_Mutation_p.Q52*|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Nonsense_Mutation_p.Q13*|TP53_uc010cnk.1_Nonsense_Mutation_p.Q67*	p.Q52*	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	4	348	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	52		Q -> H (in a sporadic cancer; somatic mutation).	TADII.|Interaction with HRMT1L2.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.154C>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.125595	0.37533	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	3.95	-3.61	0.04556	.	1.917440	0.02364	N	0.077219	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-0.5405	7.1769	0.25749	0.0:0.5269:0.1712:0.3019	.	.	.	.	X	52	.	ENSP00000269305:Q52X	Q	-	1	0	TP53	7520258	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.233000	0.09041	-0.824000	0.04295	-1.083000	0.02208	CAA		0.592	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		61	97	0	0	0	0.01441	0	61	97				
MAP2K3	5606	broad.mit.edu	37	17	21217498	21217498	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:21217498G>A	ENST00000342679.4	+	12	1249	c.1000G>A	c.(1000-1002)Gac>Aac	p.D334N	MAP2K3_ENST00000316920.6_Missense_Mutation_p.D305N|MAP2K3_ENST00000361818.5_Missense_Mutation_p.D305N	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	334					activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CAAGAAGACGGACATTGCTGC	0.627																																							uc002gys.2		NA																	0					0						c.(1000-1002)GAC>AAC		mitogen-activated protein kinase kinase 3							331.0	318.0	322.0					17																	21217498		2203	4300	6503	SO:0001583	missense	5606				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr17:21217498G>A	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.1000G>A	17.37:g.21217498G>A	ENSP00000345083:p.Asp334Asn					MAP2K3_uc002gyt.2_Missense_Mutation_p.D305N|MAP2K3_uc002gyu.2_Missense_Mutation_p.D305N	p.D334N	NM_145109	NP_659731	P46734	MP2K3_HUMAN		COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)	12	1265	+			334					B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	ENST00000342679.4	37	c.1000G>A	CCDS11217.1	.	.	.	.	.	.	.	.	.	.	G	31	5.074140	0.94000	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000316920	T;T	0.72615	-0.67;-0.65	5.0	5.0	0.66597	.	0.105878	0.41294	D	0.000920	T	0.76328	0.3972	L	0.51853	1.615	0.80722	D	1	P	0.51240	0.943	P	0.54026	0.74	T	0.76096	-0.3084	10	0.40728	T	0.16	-26.685	18.2864	0.90115	0.0:0.0:1.0:0.0	.	334	P46734	MP2K3_HUMAN	N	334;305;305;338	ENSP00000345083:D334N;ENSP00000355081:D305N	ENSP00000319139:D338N	D	+	1	0	MAP2K3	21158091	1.000000	0.71417	0.928000	0.36995	0.637000	0.38172	8.970000	0.93415	2.304000	0.77564	0.491000	0.48974	GAC		0.627	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109		57	386	0	0	0	0.01441	0	57	386				
UBBP4	23666	broad.mit.edu	37	17	21730906	21730906	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:21730906G>C	ENST00000578713.1	+	1	212	c.208G>C	c.(208-210)Gtc>Ctc	p.V70L	UBBP4_ENST00000583708.1_Intron|UBBP4_ENST00000584755.1_Missense_Mutation_p.V70L|UBBP4_ENST00000584398.1_Intron					ubiquitin B pseudogene 4											endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						CCTGCATCTGGTCCTGCGTCG	0.552																																							uc002gyy.3		NA																	0					NA						c.(208-210)GTC>CTC		SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																																				SO:0001583	missense	0							g.chr17:21730906G>C	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.208G>C	17.37:g.21730906G>C	ENSP00000464265:p.Val70Leu						p.V70L							2	333	+									Missense_Mutation	SNP	ENST00000578713.1	37	c.208G>C																																																																																					0.552	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444589.2			16	40	0	0	0	0.010504	0	16	40				
ACLY	47	broad.mit.edu	37	17	40070111	40070111	+	Missense_Mutation	SNP	T	T	C	rs367736290		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:40070111T>C	ENST00000352035.2	-	2	146	c.16A>G	c.(16-18)Att>Gtt	p.I6V	ACLY_ENST00000393896.2_Missense_Mutation_p.I6V|ACLY_ENST00000353196.1_Missense_Mutation_p.I6V|ACLY_ENST00000537919.1_Missense_Mutation_p.I6V|ACLY_ENST00000590151.1_Missense_Mutation_p.I6V	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	6	ATP-grasp.				ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				TGCTCTGAAATTGCCTTGGCC	0.547																																					Colon(64;807 1396 15971 30971)	Colon(64;807 1396 15971 30971)	uc002hyg.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(16-18)ATT>GTT		ATP citrate lyase isoform 1		T	VAL/ILE,VAL/ILE	0,4406		0,0,2203	170.0	152.0	158.0		16,16	5.5	1.0	17		158	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ACLY	NM_001096.2,NM_198830.1	29,29	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	6/1102,6/1092	40070111	1,13005	2203	4300	6503	SO:0001583	missense	47				ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity	g.chr17:40070111T>C	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.16A>G	17.37:g.40070111T>C	ENSP00000253792:p.Ile6Val					ACLY_uc002hyh.2_Missense_Mutation_p.I6V|ACLY_uc002hyi.2_Missense_Mutation_p.I60V|ACLY_uc010wfx.1_Missense_Mutation_p.I60V|ACLY_uc010wfy.1_Missense_Mutation_p.I6V	p.I6V	NM_001096	NP_001087	P53396	ACLY_HUMAN			2	179	-		Breast(137;0.000143)	6					B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	ENST00000352035.2	37	c.16A>G	CCDS11412.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.701023	0.48307	0.0	1.16E-4	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.83004	0.5160	M	0.71920	2.185	0.80722	D	1	B;P;P;D;P	0.67145	0.001;0.849;0.849;0.996;0.849	B;P;P;D;P	0.83275	0.001;0.858;0.858;0.996;0.858	D	0.83488	0.0068	10	0.46703	T	0.11	.	15.8852	0.79241	0.0:0.0:0.0:1.0	.	6;60;60;6;6	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	V	6;60;6;6;6	ENSP00000253792:I6V;ENSP00000345398:I6V;ENSP00000445349:I6V;ENSP00000377474:I6V	ENSP00000253792:I6V	I	-	1	0	ACLY	37323637	1.000000	0.71417	0.995000	0.50966	0.608000	0.37181	6.043000	0.71004	2.208000	0.71279	0.460000	0.39030	ATT		0.547	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096		14	127	0	0	0	0.006122	0	14	127				
ATP6V0A1	535	broad.mit.edu	37	17	40652901	40652901	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:40652901C>T	ENST00000343619.4	+	16	1979	c.1856C>T	c.(1855-1857)tCc>tTc	p.S619F	ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.S576F|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.S626F|ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.S619F|ATP6V0A1_ENST00000544137.1_Missense_Mutation_p.S265F|ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.S576F|ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.S619F	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	619					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		TTCCTCTTTTCCTACCCAGAG	0.428																																							uc002hzr.2		NA																	0				pancreas(1)	1						c.(1855-1857)TCC>TTC		ATPase, H+ transporting, lysosomal V0 subunit a1							178.0	164.0	169.0					17																	40652901		2203	4300	6503	SO:0001583	missense	535				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity	g.chr17:40652901C>T	U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.1856C>T	17.37:g.40652901C>T	ENSP00000342951:p.Ser619Phe					ATP6V0A1_uc002hzq.2_Missense_Mutation_p.S619F|ATP6V0A1_uc002hzs.2_Missense_Mutation_p.S626F|ATP6V0A1_uc010wgj.1_Missense_Mutation_p.S576F|ATP6V0A1_uc010wgk.1_Missense_Mutation_p.S576F|ATP6V0A1_uc010cyg.2_Missense_Mutation_p.S265F|ATP6V0A1_uc010wgl.1_Missense_Mutation_p.S478F	p.S619F	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.137)	16	2023	+		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)	619			Helical; (Potential).		B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	ENST00000343619.4	37	c.1856C>T	CCDS45684.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.410280	0.62399	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728;ENST00000544137	D;D;D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12;-2.12;-2.12	4.91	2.87	0.33458	.	0.307798	0.39687	N	0.001300	D	0.87896	0.6293	M	0.62209	1.925	0.53688	D	0.99997	P;B;B;P;P	0.44734	0.708;0.404;0.404;0.842;0.659	P;B;B;P;P	0.53593	0.608;0.315;0.315;0.73;0.473	D	0.85598	0.1250	10	0.59425	D	0.04	-7.5697	5.6707	0.17721	0.1444:0.6416:0.1394:0.0746	.	576;576;626;619;619	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1	.;.;.;VPP1_HUMAN;.	F	619;619;619;626;576;265	ENSP00000342951:S619F;ENSP00000444676:S619F;ENSP00000377415:S619F;ENSP00000264649:S626F;ENSP00000443991:S576F;ENSP00000446377:S265F	ENSP00000264649:S626F	S	+	2	0	ATP6V0A1	37906427	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	1.622000	0.36997	0.749000	0.32854	0.561000	0.74099	TCC		0.428	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450364.1	NM_001130020		4	130	0	0	0	0.000602	0	4	130				
C17orf53	78995	broad.mit.edu	37	17	42228409	42228409	+	Silent	SNP	A	A	G	rs370671551		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:42228409A>G	ENST00000319977.4	+	4	1542	c.1305A>G	c.(1303-1305)acA>acG	p.T435T	C17orf53_ENST00000245382.6_Intron|C17orf53_ENST00000585683.1_Silent_p.T435T	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	435										NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		AATTCCAGACAGAGGTAACTT	0.502																																							uc002ifi.1		NA																	0					0						c.(1303-1305)ACA>ACG		hypothetical protein LOC78995							60.0	51.0	54.0					17																	42228409		2203	4300	6503	SO:0001819	synonymous_variant	78995							g.chr17:42228409A>G	AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.1305A>G	17.37:g.42228409A>G						C17orf53_uc010czq.1_Silent_p.T435T|C17orf53_uc002ifj.1_Intron|C17orf53_uc002ifk.1_Intron	p.T435T	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.114)	4	1490	+		Breast(137;0.0364)|Prostate(33;0.0376)	435					A8K7A9|Q9BWM9|Q9HAI1	Silent	SNP	ENST00000319977.4	37	c.1305A>G	CCDS11477.1																																																																																				0.502	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457697.1	NM_024032		7	18	0	0	0	0.00308	0	7	18				
GRN	2896	broad.mit.edu	37	17	42427843	42427843	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:42427843C>T	ENST00000053867.3	+	6	558	c.496C>T	c.(496-498)Ccg>Tcg	p.P166S	GRN_ENST00000589265.1_Intron	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	166					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GCACTGCTGTCCGCACGGTGC	0.632											OREG0024459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002igp.1		NA																	0				ovary(2)|central_nervous_system(2)|skin(1)	5						c.(496-498)CCG>TCG		granulin precursor							121.0	116.0	118.0					17																	42427843		2203	4300	6503	SO:0001583	missense	2896				signal transduction	extracellular space	cytokine activity|growth factor activity	g.chr17:42427843C>T	M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.496C>T	17.37:g.42427843C>T	ENSP00000053867:p.Pro166Ser		OREG0024459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	908	GRN_uc002igq.1_3'UTR|GRN_uc002igr.1_5'UTR	p.P166S	NM_002087	NP_002078	P28799	GRN_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.189)	6	715	+		Prostate(33;0.0181)	166					D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Missense_Mutation	SNP	ENST00000053867.3	37	c.496C>T	CCDS11483.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128954	0.77549	.	.	ENSG00000030582	ENST00000053867;ENST00000357351	D	0.81739	-1.53	4.43	4.43	0.53597	Granulin (3);	0.000000	0.64402	D	0.000014	D	0.92551	0.7634	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94513	0.7720	10	0.66056	D	0.02	-21.2096	14.5871	0.68335	0.0:1.0:0.0:0.0	.	166	P28799	GRN_HUMAN	S	166	ENSP00000053867:P166S	ENSP00000053867:P166S	P	+	1	0	GRN	39783369	0.996000	0.38824	0.886000	0.34754	0.485000	0.33311	3.442000	0.52900	2.289000	0.77006	0.462000	0.41574	CCG		0.632	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457766.1	NM_002087		19	191	0	0	0	0.007291	0	19	191				
KIF2B	84643	broad.mit.edu	37	17	51902313	51902313	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:51902313G>T	ENST00000268919.4	+	1	2075	c.1919G>T	c.(1918-1920)cGg>cTg	p.R640L		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	640					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TGCATTGCCCGGTCTTTGTCC	0.443																																							uc002iua.2		NA																	0				ovary(5)|skin(3)	8						c.(1918-1920)CGG>CTG		kinesin family member 2B							153.0	140.0	145.0					17																	51902313		2203	4300	6503	SO:0001583	missense	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51902313G>T	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1919G>T	17.37:g.51902313G>T	ENSP00000268919:p.Arg640Leu					uc010wna.1_RNA	p.R640L	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN			1	2075	+			640			Potential.		Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	c.1919G>T	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	G	6.184	0.402047	0.11696	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.73897	-0.79	5.65	4.58	0.56647	.	0.363268	0.19967	N	0.102061	T	0.55497	0.1924	N	0.08118	0	0.20074	N	0.999934	B	0.17465	0.022	B	0.17722	0.019	T	0.52586	-0.8556	10	0.72032	D	0.01	.	10.7336	0.46111	0.9245:0.0:0.0755:0.0	.	640	Q8N4N8	KIF2B_HUMAN	L	640;528	ENSP00000268919:R640L	ENSP00000268919:R640L	R	+	2	0	KIF2B	49257312	1.000000	0.71417	0.999000	0.59377	0.037000	0.13140	3.262000	0.51538	1.087000	0.41251	-0.238000	0.12139	CGG		0.443	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		19	28	1	0	1.22574e-08	0.014323	1.43481e-08	19	28				
C17orf47	284083	broad.mit.edu	37	17	56621498	56621498	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:56621498C>G	ENST00000321691.3	-	1	231	c.50G>C	c.(49-51)aGa>aCa	p.R17T	RP11-112H10.4_ENST00000580589.1_RNA|RP11-112H10.4_ENST00000578022.1_RNA|RP11-112H10.4_ENST00000580769.1_RNA	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	17										NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTCAGACCCTCTCTGTGCTGA	0.517																																							uc002iwq.1		NA																	0				breast(1)	1						c.(49-51)AGA>ACA		hypothetical protein LOC284083							147.0	134.0	139.0					17																	56621498		2203	4300	6503	SO:0001583	missense	284083							g.chr17:56621498C>G		CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.50G>C	17.37:g.56621498C>G	ENSP00000354874:p.Arg17Thr						p.R17T	NM_001038704	NP_001033793	Q8NEP4	CQ047_HUMAN			1	186	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		17					Q8N821	Missense_Mutation	SNP	ENST00000321691.3	37	c.50G>C	CCDS32691.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.139787	0.56936	.	.	ENSG00000181013	ENST00000321691	T	0.39592	1.07	5.41	0.284	0.15701	.	0.514491	0.19659	N	0.109040	T	0.36138	0.0956	N	0.24115	0.695	0.24503	N	0.994245	P	0.51351	0.944	P	0.52957	0.714	T	0.25433	-1.0132	10	0.66056	D	0.02	-3.9269	8.4261	0.32729	0.0:0.7686:0.0:0.2314	.	17	Q8NEP4	CQ047_HUMAN	T	17	ENSP00000354874:R17T	ENSP00000354874:R17T	R	-	2	0	C17orf47	53976497	0.649000	0.27322	0.163000	0.22734	0.664000	0.39144	0.061000	0.14366	-0.136000	0.11475	0.655000	0.94253	AGA		0.517	C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445443.1	NM_001038704		14	94	0	0	0	0.00245	0	14	94				
INTS2	57508	broad.mit.edu	37	17	59972721	59972721	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:59972721C>G	ENST00000444766.3	-	12	1617	c.1542G>C	c.(1540-1542)ttG>ttC	p.L514F	INTS2_ENST00000251334.6_Missense_Mutation_p.L506F	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	514					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						TCATCCTGCTCAAGGAGCTTG	0.289																																							uc002izn.2		NA																	0				ovary(1)|lung(1)|pancreas(1)	3						c.(1540-1542)TTG>TTC		integrator complex subunit 2							32.0	31.0	31.0					17																	59972721		1792	4054	5846	SO:0001583	missense	57508				snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding	g.chr17:59972721C>G	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.1542G>C	17.37:g.59972721C>G	ENSP00000414237:p.Leu514Phe					INTS2_uc002izm.2_Missense_Mutation_p.L506F	p.L514F	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN			12	1618	-			514					Q9ULD3	Missense_Mutation	SNP	ENST00000444766.3	37	c.1542G>C	CCDS45750.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.148459	0.57151	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.55234	0.53	5.08	4.09	0.47781	.	0.000000	0.85682	D	0.000000	T	0.66655	0.2811	M	0.65498	2.005	0.58432	D	0.999991	D	0.76494	0.999	D	0.83275	0.996	T	0.66035	-0.6023	9	.	.	.	-7.6	9.2042	0.37278	0.1437:0.7814:0.0:0.0749	.	514	Q9H0H0	INT2_HUMAN	F	514;513	ENSP00000414237:L514F	.	L	-	3	2	INTS2	57327503	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	0.422000	0.21296	1.240000	0.43803	0.650000	0.86243	TTG		0.289	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748		2	7	0	0	0	0.004672	0	2	7				
SLC38A10	124565	broad.mit.edu	37	17	79246348	79246348	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:79246348C>T	ENST00000374759.3	-	9	1375	c.992G>A	c.(991-993)gGa>gAa	p.G331E	SLC38A10_ENST00000288439.5_Missense_Mutation_p.G331E|SLC38A10_ENST00000546352.1_Intron	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	331					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			AACCATGGTTCCAAACACCAC	0.557																																							uc002jzz.1		NA																	0				pancreas(1)|skin(1)	2						c.(991-993)GGA>GAA		solute carrier family 38, member 10 isoform a							73.0	73.0	73.0					17																	79246348		2203	4300	6503	SO:0001583	missense	124565				amino acid transport|sodium ion transport	integral to membrane		g.chr17:79246348C>T	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.992G>A	17.37:g.79246348C>T	ENSP00000363891:p.Gly331Glu					SLC38A10_uc002jzy.1_Missense_Mutation_p.G249E|SLC38A10_uc002kab.2_Missense_Mutation_p.G331E	p.G331E	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)		9	1367	-	all_neural(118;0.0804)|Melanoma(429;0.242)		331			Helical; (Potential).		Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	ENST00000374759.3	37	c.992G>A	CCDS42397.1	.	.	.	.	.	.	.	.	.	.	C	19.33	3.807288	0.70797	.	.	ENSG00000157637	ENST00000374759;ENST00000288439	T;T	0.02280	4.36;4.36	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.10294	0.0252	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	0.988;1.0	D;D	0.97110	0.914;1.0	T	0.08106	-1.0738	10	0.40728	T	0.16	-15.3537	19.2396	0.93875	0.0:1.0:0.0:0.0	.	331;331	Q9HBR0-2;Q9HBR0	.;S38AA_HUMAN	E	331	ENSP00000363891:G331E;ENSP00000288439:G331E	ENSP00000288439:G331E	G	-	2	0	SLC38A10	76860943	1.000000	0.71417	0.985000	0.45067	0.243000	0.25628	7.170000	0.77587	2.545000	0.85829	0.561000	0.74099	GGA		0.557	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1	NM_138570		14	79	0	0	0	0.004007	0	14	79				
FASN	2194	broad.mit.edu	37	17	80041265	80041265	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:80041265C>A	ENST00000306749.2	-	32	5596	c.5378G>T	c.(5377-5379)gGg>gTg	p.G1793V	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1793	Enoyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CAGTAGGACCCCGTGGAATGT	0.647																																					Colon(59;314 1043 11189 28578 32273)	Colon(59;314 1043 11189 28578 32273)	uc002kdu.2		NA																	0				central_nervous_system(1)	1						c.(5377-5379)GGG>GTG		fatty acid synthase	Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)						71.0	70.0	70.0					17																	80041265		2202	4298	6500	SO:0001583	missense	2194				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding	g.chr17:80041265C>A	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5378G>T	17.37:g.80041265C>A	ENSP00000304592:p.Gly1793Val					FASN_uc002kdv.1_5'Flank	p.G1793V	NM_004104	NP_004095	P49327	FAS_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		32	5495	-	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		1793			Enoyl reductase (By similarity).		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	c.5378G>T	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	C	16.40	3.112784	0.56398	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.11930	2.73	4.1	4.1	0.47936	Alcohol dehydrogenase, C-terminal (1);Polyketide synthase, enoylreductase (1);NAD(P)-binding domain (1);	0.110695	0.64402	D	0.000010	T	0.38453	0.1041	M	0.75085	2.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.40079	-0.9582	10	0.87932	D	0	-41.2739	16.4764	0.84133	0.0:1.0:0.0:0.0	.	1793	P49327	FAS_HUMAN	V	1793;758	ENSP00000304592:G1793V	ENSP00000304592:G1793V	G	-	2	0	FASN	77634554	1.000000	0.71417	0.940000	0.37924	0.035000	0.12851	7.356000	0.79445	2.088000	0.63022	0.561000	0.74099	GGG		0.647	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104		10	21	1	0	9.31168e-06	0.001855	1.05472e-05	10	21				
ANKRD30B	374860	broad.mit.edu	37	18	14848862	14848862	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr18:14848862C>T	ENST00000358984.4	+	34	3152	c.2972C>T	c.(2971-2973)gCg>gTg	p.A991V		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	991										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						CTGTCAGAAGCGAAAGAAATA	0.328																																							uc010dlo.2		NA																	0				ovary(1)|skin(1)	2						c.(2971-2973)GCG>GTG		ankyrin repeat domain 30B							85.0	70.0	74.0					18																	14848862		692	1587	2279	SO:0001583	missense	374860							g.chr18:14848862C>T	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2972C>T	18.37:g.14848862C>T	ENSP00000351875:p.Ala991Val					ANKRD30B_uc010xal.1_Missense_Mutation_p.A133V	p.A991V	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN			34	3152	+			1076			Potential.		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	c.2972C>T	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	c	0.058	-1.231985	0.01505	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.15834	2.39	1.48	-0.466	0.12153	.	.	.	.	.	T	0.14399	0.0348	L	0.50333	1.59	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27773	-1.0064	9	0.59425	D	0.04	.	5.6303	0.17506	0.0:0.6549:0.0:0.3451	.	1076;991	Q9BXX2;F8WAG3	AN30B_HUMAN;.	V	991;385;411	ENSP00000351875:A991V	ENSP00000277669:A411V	A	+	2	0	ANKRD30B	14838862	0.059000	0.20769	0.000000	0.03702	0.024000	0.10985	0.157000	0.16402	-0.158000	0.11040	-1.250000	0.01514	GCG		0.328	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		3	5	0	0	0	0.000602	0	3	5				
CCDC178	374864	broad.mit.edu	37	18	30873179	30873179	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr18:30873179C>T	ENST00000383096.3	-	12	1302	c.1120G>A	c.(1120-1122)Gaa>Aaa	p.E374K	CCDC178_ENST00000583930.1_Missense_Mutation_p.E374K|CCDC178_ENST00000300227.8_Missense_Mutation_p.E374K|CCDC178_ENST00000406524.2_Missense_Mutation_p.E374K|CCDC178_ENST00000402325.1_Missense_Mutation_p.E374K|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000403303.1_Missense_Mutation_p.E374K|CCDC178_ENST00000579947.1_Missense_Mutation_p.E374K			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	374																	CTTATTGCTTCAGTCACTTCC	0.279																																							uc002kxn.2		NA																	0				ovary(1)	1						c.(1120-1122)GAA>AAA		hypothetical protein LOC374864 isoform 1							123.0	117.0	119.0					18																	30873179		2200	4296	6496	SO:0001583	missense	374864							g.chr18:30873179C>T	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.1120G>A	18.37:g.30873179C>T	ENSP00000372576:p.Glu374Lys					C18orf34_uc010xbr.1_Missense_Mutation_p.E374K|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Missense_Mutation_p.E374K|C18orf34_uc002kxp.2_Missense_Mutation_p.E374K	p.E374K	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN			11	1262	-			374			Potential.		A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	c.1120G>A	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.495316	0.44352	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	3.59	2.71	0.32032	.	.	.	.	.	T	0.51584	0.1683	L	0.52573	1.65	0.09310	N	1	D;P;P;P	0.67145	0.996;0.539;0.539;0.539	D;B;B;B	0.77557	0.99;0.119;0.119;0.119	T	0.32693	-0.9897	9	0.23302	T	0.38	-2.4667	7.2688	0.26244	0.0:0.8773:0.0:0.1227	.	374;374;374;374	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	K	374	ENSP00000385591:E374K;ENSP00000372576:E374K;ENSP00000300227:E374K;ENSP00000385867:E374K;ENSP00000385234:E374K	ENSP00000300227:E374K	E	-	1	0	C18orf34	29127177	0.006000	0.16342	0.003000	0.11579	0.098000	0.18820	1.644000	0.37228	1.070000	0.40811	0.491000	0.48974	GAA		0.279	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		8	22	0	0	0	0.004482	0	8	22				
SETBP1	26040	broad.mit.edu	37	18	42530277	42530277	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr18:42530277G>T	ENST00000282030.5	+	4	1268	c.972G>T	c.(970-972)gaG>gaT	p.E324D		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	324						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GTACAAAGGAGCCCCCAGAAC	0.542									Schinzel-Giedion syndrome																														uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(970-972)GAG>GAT		SET binding protein 1 isoform a							68.0	74.0	72.0					18																	42530277		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42530277G>T	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.972G>T	18.37:g.42530277G>T	ENSP00000282030:p.Glu324Asp						p.E324D	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	1268	+			324					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.972G>T	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	9.812	1.183441	0.21870	.	.	ENSG00000152217	ENST00000282030	T	0.35973	1.28	5.61	-5.07	0.02938	.	0.382752	0.27659	N	0.018397	T	0.11495	0.0280	N	0.14661	0.345	0.09310	N	0.999993	B	0.02656	0.0	B	0.06405	0.002	T	0.23190	-1.0195	10	0.13108	T	0.6	.	0.099	0.00046	0.3287:0.1781:0.1998:0.2933	.	324	Q9Y6X0	SETBP_HUMAN	D	324	ENSP00000282030:E324D	ENSP00000282030:E324D	E	+	3	2	SETBP1	40784275	0.027000	0.19231	0.613000	0.29037	0.992000	0.81027	0.028000	0.13644	-1.390000	0.02087	-0.136000	0.14681	GAG		0.542	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		9	25	1	0	7.48243e-07	0.006214	8.61464e-07	9	25				
CXXC1	30827	broad.mit.edu	37	18	47809014	47809014	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr18:47809014C>T	ENST00000285106.6	-	15	2634	c.1920G>A	c.(1918-1920)acG>acA	p.T640T	MBD1_ENST00000398495.2_5'Flank|MBD1_ENST00000424334.2_5'Flank|CXXC1_ENST00000412036.2_Silent_p.T644T|MBD1_ENST00000436910.1_5'Flank|MBD1_ENST00000398493.1_5'Flank|MBD1_ENST00000269471.5_5'Flank|MBD1_ENST00000588937.1_5'Flank|MBD1_ENST00000590208.1_5'Flank|MBD1_ENST00000585672.1_5'Flank|MBD1_ENST00000353909.3_5'Flank|MBD1_ENST00000591535.1_5'Flank|MBD1_ENST00000591416.1_5'Flank|MBD1_ENST00000269468.5_5'Flank|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000339998.6_5'Flank|MBD1_ENST00000585595.1_5'Flank|CXXC1_ENST00000589940.1_3'UTR|MBD1_ENST00000457839.2_5'Flank|MBD1_ENST00000347968.3_5'Flank|MBD1_ENST00000587605.1_5'Flank|MBD1_ENST00000398488.1_5'Flank|MBD1_ENST00000382948.5_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	640					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						CGTGCTGGATCGTCTGGTGCA	0.642																																							uc002leq.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1918-1920)ACG>ACA		CXXC finger 1 (PHD domain) isoform 2							123.0	107.0	113.0					18																	47809014		2203	4300	6503	SO:0001819	synonymous_variant	30827				histone H3-K4 methylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck|Set1C/COMPASS complex	protein binding|unmethylated CpG binding|zinc ion binding	g.chr18:47809014C>T	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1920G>A	18.37:g.47809014C>T						MBD1_uc002leg.2_5'Flank|MBD1_uc010dow.1_5'Flank|MBD1_uc010xdi.1_5'Flank|MBD1_uc002leh.3_5'Flank|MBD1_uc002len.2_5'Flank|MBD1_uc002lei.3_5'Flank|MBD1_uc002lej.3_5'Flank|MBD1_uc002lek.3_5'Flank|MBD1_uc002lel.3_5'Flank|MBD1_uc002lem.3_5'Flank|MBD1_uc010xdj.1_5'Flank|MBD1_uc010xdk.1_5'Flank|MBD1_uc010dox.1_5'Flank|MBD1_uc002leo.2_5'Flank|CXXC1_uc002lep.3_Silent_p.T497T|CXXC1_uc002ler.3_Silent_p.T644T|CXXC1_uc010doy.2_3'UTR	p.T640T	NM_014593	NP_055408	Q9P0U4	CXXC1_HUMAN			15	2653	-			640					B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Silent	SNP	ENST00000285106.6	37	c.1920G>A	CCDS11945.1																																																																																				0.642	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255927.2	NM_014593		8	58	0	0	0	0.006214	0	8	58				
BCL2	596	broad.mit.edu	37	18	60985347	60985347	+	Silent	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr18:60985347G>A	ENST00000398117.1	-	1	2014	c.553C>T	c.(553-555)Ctg>Ttg	p.L185L	BCL2_ENST00000333681.4_Silent_p.L185L|BCL2_ENST00000444484.1_Silent_p.L185L|BCL2_ENST00000589955.1_Silent_p.L185L	NM_000633.2	NP_000624.2	P10415	BCL2_HUMAN	B-cell CLL/lymphoma 2	185					actin filament organization (GO:0007015)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|axonogenesis (GO:0007409)|B cell homeostasis (GO:0001782)|B cell lineage commitment (GO:0002326)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|behavioral fear response (GO:0001662)|branching involved in ureteric bud morphogenesis (GO:0001658)|CD8-positive, alpha-beta T cell lineage commitment (GO:0043375)|cell aging (GO:0007569)|cell growth (GO:0016049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to organic substance (GO:0071310)|cochlear nucleus development (GO:0021747)|defense response to virus (GO:0051607)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|ear development (GO:0043583)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|female pregnancy (GO:0007565)|focal adhesion assembly (GO:0048041)|gland morphogenesis (GO:0022612)|glomerulus development (GO:0032835)|hair follicle morphogenesis (GO:0031069)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|melanin metabolic process (GO:0006582)|melanocyte differentiation (GO:0030318)|mesenchymal cell development (GO:0014031)|metanephros development (GO:0001656)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of autophagy (GO:0010507)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cellular pH reduction (GO:0032848)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of retinal cell programmed cell death (GO:0046671)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oocyte development (GO:0048599)|organ growth (GO:0035265)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pigment granule organization (GO:0048753)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell growth (GO:0030307)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron maturation (GO:0014042)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smooth muscle cell migration (GO:0014911)|post-embryonic development (GO:0009791)|protein dephosphorylation (GO:0006470)|protein polyubiquitination (GO:0000209)|reactive oxygen species metabolic process (GO:0072593)|regulation of calcium ion transport (GO:0051924)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glycoprotein biosynthetic process (GO:0010559)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|regulation of protein stability (GO:0031647)|regulation of transmembrane transporter activity (GO:0022898)|regulation of viral genome replication (GO:0045069)|release of cytochrome c from mitochondria (GO:0001836)|renal system process (GO:0003014)|response to acid chemical (GO:0001101)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to iron ion (GO:0010039)|response to ischemia (GO:0002931)|response to nicotine (GO:0035094)|response to radiation (GO:0009314)|response to toxic substance (GO:0009636)|response to UV-B (GO:0010224)|single organismal cell-cell adhesion (GO:0016337)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|channel inhibitor activity (GO:0016248)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(106)|kidney(1)|large_intestine(1)|lung(3)	113		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Ibuprofen(DB01050)|Paclitaxel(DB01229)|Rasagiline(DB01367)	CAGGTGTGCAGGTGCCGGTTC	0.612			T	IGH@	"""NHL, CLL"""																																		uc002lit.1		NA		Dom	yes		18	18q21.3	596	T	B-cell CLL/lymphoma 2			L	IGH@		NHL|CLL		0				central_nervous_system(1)	1						c.(553-555)CTG>TTG		B-cell lymphoma protein 2 alpha isoform	Docetaxel(DB01248)|Fludarabine(DB01073)|Melatonin(DB01065)|Paclitaxel(DB01229)|Rasagiline(DB01367)						104.0	95.0	98.0					18																	60985347		2203	4300	6503	SO:0001819	synonymous_variant	596				activation of pro-apoptotic gene products|anti-apoptosis|apoptosis in response to endoplasmic reticulum stress|B cell proliferation|B cell receptor signaling pathway|defense response to virus|female pregnancy|humoral immune response|induction of apoptosis by intracellular signals|negative regulation of cellular pH reduction|negative regulation of mitochondrial depolarization|negative regulation of neuron apoptosis|neuron apoptosis|positive regulation of B cell proliferation|positive regulation of cell growth|protein polyubiquitination|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|regulation of transmembrane transporter activity|release of cytochrome c from mitochondria|response to cytokine stimulus|response to DNA damage stimulus|response to drug|response to iron ion|response to nicotine|response to toxin	endoplasmic reticulum membrane|mitochondrial outer membrane|nuclear membrane|pore complex	BH3 domain binding|channel activity|protease binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|ubiquitin protein ligase binding	g.chr18:60985347G>A	M14745	CCDS11981.1, CCDS45882.1	18q21.3	2014-03-07			ENSG00000171791	ENSG00000171791		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	990	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 50"""	151430					Standard	XM_006722523		Approved	Bcl-2, PPP1R50	uc002lit.1	P10415	OTTHUMG00000132791	ENST00000398117.1:c.553C>T	18.37:g.60985347G>A						BCL2_uc002liu.1_Silent_p.L185L|BCL2_uc002liv.1_Silent_p.L185L	p.L185L	NM_000633	NP_000624	P10415	BCL2_HUMAN		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	2	1046	-		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)	185					C9JHD5|P10416|Q13842|Q16197	Silent	SNP	ENST00000398117.1	37	c.553C>T	CCDS11981.1																																																																																				0.612	BCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256199.1	NM_000633, NM_000657		9	36	0	0	0	0.013537	0	9	36				
SERPINB7	8710	broad.mit.edu	37	18	61463530	61463530	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr18:61463530G>A	ENST00000398019.2	+	5	692	c.367G>A	c.(367-369)Gat>Aat	p.D123N	SERPINB7_ENST00000540675.1_Missense_Mutation_p.D106N|SERPINB7_ENST00000336429.2_Missense_Mutation_p.D123N|SERPINB7_ENST00000546027.1_Missense_Mutation_p.D123N	NM_003784.3	NP_003775.1	O75635	SPB7_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 7	123					negative regulation of endopeptidase activity (GO:0010951)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	27		Esophageal squamous(42;0.129)				AAAATTATACGATGCCAAAGT	0.318																																							uc002ljl.2		NA																	0				lung(2)|central_nervous_system(1)	3						c.(367-369)GAT>AAT		serine (or cysteine) proteinase inhibitor, clade							81.0	80.0	81.0					18																	61463530		2203	4300	6503	SO:0001583	missense	8710				regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity	g.chr18:61463530G>A	AF027866	CCDS11988.1, CCDS58633.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166396	ENSG00000166396		"""Serine (or cysteine) peptidase inhibitors"""	13902	protein-coding gene	gene with protein product		603357	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7"""			24172014	Standard	NM_003784		Approved	MEGSIN	uc002ljl.4	O75635	OTTHUMG00000060591	ENST00000398019.2:c.367G>A	18.37:g.61463530G>A	ENSP00000381101:p.Asp123Asn					SERPINB7_uc002ljm.2_Missense_Mutation_p.D123N|SERPINB7_uc010xet.1_Missense_Mutation_p.D106N|SERPINB7_uc010dqg.2_Missense_Mutation_p.D123N	p.D123N	NM_001040147	NP_001035237	O75635	SPB7_HUMAN			5	463	+		Esophageal squamous(42;0.129)	123					B4DUW8|F5GZC0|Q1ED45|Q3KPG4	Missense_Mutation	SNP	ENST00000398019.2	37	c.367G>A	CCDS11988.1	.	.	.	.	.	.	.	.	.	.	G	0.333	-0.954711	0.02285	.	.	ENSG00000166396	ENST00000425392;ENST00000336429;ENST00000398019;ENST00000540675;ENST00000447428;ENST00000546027;ENST00000431370	D;T;T;T;D;T;D	0.87334	-2.24;2.82;2.82;2.82;-1.58;2.82;-2.24	5.56	3.04	0.35103	Serpin domain (3);	0.114142	0.39475	N	0.001343	T	0.60689	0.2288	N	0.01122	-1.005	0.23841	N	0.996694	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.52351	-0.8587	10	0.15499	T	0.54	.	5.5765	0.17227	0.7054:0.1439:0.1507:0.0	.	106;123	F5GZC0;O75635	.;SPB7_HUMAN	N	123;123;123;106;123;123;123	ENSP00000397301:D123N;ENSP00000337212:D123N;ENSP00000381101:D123N;ENSP00000444572:D106N;ENSP00000402362:D123N;ENSP00000444861:D123N;ENSP00000393947:D123N	ENSP00000337212:D123N	D	+	1	0	SERPINB7	59614510	0.000000	0.05858	0.963000	0.40424	0.061000	0.15899	-1.594000	0.02094	0.479000	0.27511	-0.300000	0.09419	GAT		0.318	SERPINB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134007.1	NM_003784		4	10	0	0	0	0.009096	0	4	10				
SALL3	27164	broad.mit.edu	37	18	76755179	76755179	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr18:76755179T>C	ENST00000537592.2	+	2	3188	c.3188T>C	c.(3187-3189)aTg>aCg	p.M1063T	SALL3_ENST00000575389.2_Missense_Mutation_p.M991T|SALL3_ENST00000536229.3_Missense_Mutation_p.M858T	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1063					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		ATGATCAAAATGGAAGTGAAC	0.632																																							uc002lmt.2		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(3187-3189)ATG>ACG		sal-like 3							62.0	61.0	62.0					18																	76755179		2203	4300	6503	SO:0001583	missense	27164				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:76755179T>C	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3188T>C	18.37:g.76755179T>C	ENSP00000441823:p.Met1063Thr					SALL3_uc010dra.2_Missense_Mutation_p.M598T	p.M1063T	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)	2	3188	+		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)	1063					Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	c.3188T>C	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.783955	0.00628	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.07908	3.15	5.1	-0.71	0.11234	.	0.237451	0.35235	N	0.003348	T	0.03434	0.0099	N	0.12961	0.28	0.42362	D	0.992414	B;B	0.15473	0.013;0.0	B;B	0.14578	0.011;0.0	T	0.47032	-0.9148	10	0.14252	T	0.57	-20.2187	4.9048	0.13793	0.1257:0.2296:0.0:0.6447	.	723;1063	F5GXY4;Q9BXA9	.;SALL3_HUMAN	T	1063;991;723	ENSP00000441823:M1063T	ENSP00000299466:M1063T	M	+	2	0	SALL3	74856167	1.000000	0.71417	0.982000	0.44146	0.082000	0.17680	4.005000	0.57075	-0.043000	0.13513	-0.441000	0.05720	ATG		0.632	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999		10	26	0	0	0	0.001855	0	10	26				
MUC16	94025	broad.mit.edu	37	19	9061942	9061942	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:9061942G>C	ENST00000397910.4	-	3	25707	c.25504C>G	c.(25504-25506)Cct>Gct	p.P8502A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8504	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTAGCCCCAGGAGAACCTGTC	0.488																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(25504-25506)CCT>GCT		mucin 16							193.0	176.0	181.0					19																	9061942		1957	4151	6108	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9061942G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.25504C>G	19.37:g.9061942G>C	ENSP00000381008:p.Pro8502Ala						p.P8502A	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	25708	-			8504			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.25504C>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.167	-0.390804	0.04932	.	.	ENSG00000181143	ENST00000397910	T	0.03094	4.05	2.78	-5.56	0.02529	.	.	.	.	.	T	0.02688	0.0081	L	0.29908	0.895	.	.	.	P	0.37573	0.6	B	0.36885	0.235	T	0.17137	-1.0379	8	0.87932	D	0	.	4.9403	0.13961	0.5788:0.0:0.1641:0.2571	.	8502	B5ME49	.	A	8502	ENSP00000381008:P8502A	ENSP00000381008:P8502A	P	-	1	0	MUC16	8922942	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.837000	0.04377	-2.353000	0.00615	-0.401000	0.06369	CCT		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		25	122	0	0	0	0.008361	0	25	122				
MUC16	94025	broad.mit.edu	37	19	9069683	9069683	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:9069683C>T	ENST00000397910.4	-	3	17966	c.17763G>A	c.(17761-17763)gtG>gtA	p.V5921V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5923	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTTTCTTCCACAGAGGGAG	0.498																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(17761-17763)GTG>GTA		mucin 16							111.0	104.0	106.0					19																	9069683		1961	4145	6106	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9069683C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.17763G>A	19.37:g.9069683C>T							p.V5921V	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	17967	-			5923			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.17763G>A	CCDS54212.1																																																																																				0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		12	23	0	0	0	0.013537	0	12	23				
ELOF1	84337	broad.mit.edu	37	19	11665067	11665067	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:11665067C>T	ENST00000252445.3	-	2	159	c.96G>A	c.(94-96)gaG>gaA	p.E32E	ELOF1_ENST00000591674.1_Silent_p.E39E|ELOF1_ENST00000586683.1_Silent_p.E32E|ELOF1_ENST00000589171.1_Silent_p.E32E|ELOF1_ENST00000590700.1_Silent_p.E32E|ELOF1_ENST00000591912.1_Silent_p.E32E|ELOF1_ENST00000586120.1_Silent_p.E32E|ELOF1_ENST00000587806.1_Silent_p.E53E	NM_032377.3	NP_115753.1	P60002	ELOF1_HUMAN	elongation factor 1 homolog (S. cerevisiae)	32					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(3)|lung(2)	5						CACAGGATTTCTCGTGGTTGC	0.577																																							uc002mse.1		NA																	0					0						c.(94-96)GAG>GAA		elongation factor 1 homolog (ELF1, S.							205.0	168.0	180.0					19																	11665067		2203	4300	6503	SO:0001819	synonymous_variant	84337				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr19:11665067C>T	AK001171	CCDS12264.1	19p13.2	2008-02-05	2006-02-13			ENSG00000130165			28691	protein-coding gene	gene with protein product			"""elongation factor 1 homolog (ELF1, S. cerevisiae)"""			12477932	Standard	NM_032377		Approved	MGC4549, ELF1	uc002mse.1	P60002		ENST00000252445.3:c.96G>A	19.37:g.11665067C>T						ELOF1_uc002msd.1_Silent_p.E53E	p.E32E	NM_032377	NP_115753	P60002	ELOF1_HUMAN			2	160	-			32					Q8R1J7|Q96II4	Silent	SNP	ENST00000252445.3	37	c.96G>A	CCDS12264.1																																																																																				0.577	ELOF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458868.1	NM_032377		20	66	0	0	0	0.003954	0	20	66				
ZSWIM4	65249	broad.mit.edu	37	19	13930173	13930173	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:13930173G>T	ENST00000254323.2	+	9	1765	c.1576G>T	c.(1576-1578)Ggt>Tgt	p.G526C	ZSWIM4_ENST00000440752.2_Missense_Mutation_p.G360C	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	526							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			TCCTGCAGGGGGTCCCTTCAG	0.637																																							uc002mxh.1		NA																	0				central_nervous_system(2)	2						c.(1576-1578)GGT>TGT		zinc finger, SWIM-type containing 4							64.0	43.0	51.0					19																	13930173		2203	4300	6503	SO:0001583	missense	65249						zinc ion binding	g.chr19:13930173G>T	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.1576G>T	19.37:g.13930173G>T	ENSP00000254323:p.Gly526Cys					ZSWIM4_uc010xng.1_Missense_Mutation_p.G449C	p.G526C	NM_023072	NP_075560	Q9H7M6	ZSWM4_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)		9	1765	+			526						Missense_Mutation	SNP	ENST00000254323.2	37	c.1576G>T	CCDS32924.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.726299	0.69074	.	.	ENSG00000132003	ENST00000254323;ENST00000440752	T;T	0.57907	0.38;0.37	3.87	2.83	0.33086	.	0.333597	0.24143	N	0.041145	T	0.65749	0.2721	M	0.64997	1.995	0.39003	D	0.959395	D;D	0.89917	0.995;1.0	P;D	0.85130	0.874;0.997	T	0.68187	-0.5475	10	0.87932	D	0	-36.4857	9.0155	0.36168	0.1117:0.0:0.8883:0.0	.	360;526	E7ERX2;Q9H7M6	.;ZSWM4_HUMAN	C	526;360	ENSP00000254323:G526C;ENSP00000405278:G360C	ENSP00000254323:G526C	G	+	1	0	ZSWIM4	13791173	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.415000	0.80131	0.861000	0.35504	0.485000	0.47835	GGT		0.637	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342		3	13	1	0	0.00024832	0.009096	0.000270754	3	13				
AKAP8	10270	broad.mit.edu	37	19	15483984	15483984	+	Missense_Mutation	SNP	C	C	T	rs144996992	byFrequency	TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:15483984C>T	ENST00000269701.2	-	5	599	c.539G>A	c.(538-540)cGg>cAg	p.R180Q		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	180					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						AAGGGAGCCCCGCTCCCGGGC	0.682																																					GBM(190;1671 2163 3274 27186 30476)	GBM(190;1671 2163 3274 27186 30476)	uc002nav.2		NA																	0				ovary(1)|breast(1)	2						c.(538-540)CGG>CAG		A-kinase anchor protein 8			GLN/ARG	1,4403		0,1,2201	19.0	24.0	22.0		539	-0.2	0.5	19	dbSNP_134	22	0,8588		0,0,4294	no	missense	AKAP8	NM_005858.3	43	0,1,6495	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	180/693	15483984	1,12991	2202	4294	6496	SO:0001583	missense	10270				signal transduction	nuclear matrix		g.chr19:15483984C>T	Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.539G>A	19.37:g.15483984C>T	ENSP00000269701:p.Arg180Gln					AKAP8_uc010dzy.2_5'UTR|AKAP8_uc010dzz.1_RNA|AKAP8_uc010xog.1_5'UTR	p.R180Q	NM_005858	NP_005849	O43823	AKAP8_HUMAN			5	600	-			180						Missense_Mutation	SNP	ENST00000269701.2	37	c.539G>A	CCDS12329.1	.	.	.	.	.	.	.	.	.	.	c	15.87	2.959504	0.53400	2.27E-4	0.0	ENSG00000105127	ENST00000269701	T	0.50813	0.73	4.82	-0.228	0.13098	.	0.160020	0.29692	N	0.011460	T	0.46444	0.1393	M	0.70275	2.135	0.32060	N	0.59582	D	0.67145	0.996	P	0.48368	0.575	T	0.56661	-0.7942	10	0.66056	D	0.02	-6.3166	5.8136	0.18479	0.0:0.5263:0.299:0.1747	.	180	O43823	AKAP8_HUMAN	Q	180	ENSP00000269701:R180Q	ENSP00000269701:R180Q	R	-	2	0	AKAP8	15344984	0.965000	0.33210	0.547000	0.28179	0.362000	0.29581	2.245000	0.43133	0.179000	0.19938	0.651000	0.88453	CGG		0.682	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461293.3	NM_005858		3	25	0	0	0	0.009096	0	3	25				
FAM129C	199786	broad.mit.edu	37	19	17644449	17644449	+	Silent	SNP	G	G	T	rs140293166	byFrequency	TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:17644449G>T	ENST00000335393.4	+	5	597	c.459G>T	c.(457-459)acG>acT	p.T153T	FAM129C_ENST00000601861.1_Silent_p.T122T|FAM129C_ENST00000449408.2_5'UTR|FAM129C_ENST00000600871.1_Silent_p.T99T|FAM129C_ENST00000300971.2_Silent_p.T153T|FAM129C_ENST00000599124.1_Silent_p.T122T|FAM129C_ENST00000332386.5_Silent_p.T153T|FAM129C_ENST00000595684.1_Silent_p.T153T|FAM129C_ENST00000599164.1_Silent_p.T122T|FAM129C_ENST00000597887.1_3'UTR|FAM129C_ENST00000352727.3_Silent_p.T153T	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	153										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						CAGGATACACGCTCCTGACTT	0.552																																							uc010xpr.1		NA																	0					0						c.(457-459)ACG>ACT		B-cell novel protein 1 isoform a							98.0	90.0	92.0					19																	17644449		2203	4300	6503	SO:0001819	synonymous_variant	199786							g.chr19:17644449G>T	AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.459G>T	19.37:g.17644449G>T						FAM129C_uc010xpq.1_Silent_p.T153T|FAM129C_uc010xps.1_Silent_p.T122T|FAM129C_uc010xpt.1_RNA	p.T153T	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN			5	597	+			153					B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Silent	SNP	ENST00000335393.4	37	c.459G>T	CCDS12362.1																																																																																				0.552	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	NM_173544		12	33	1	0	0.000422831	0.004007	0.000456762	12	33				
FAM129C	199786	broad.mit.edu	37	19	17650003	17650003	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:17650003G>T	ENST00000335393.4	+	7	871	c.733G>T	c.(733-735)Gcc>Tcc	p.A245S	FAM129C_ENST00000601861.1_Missense_Mutation_p.A214S|FAM129C_ENST00000449408.2_5'UTR|FAM129C_ENST00000600871.1_Missense_Mutation_p.A191S|FAM129C_ENST00000300971.2_Missense_Mutation_p.A245S|FAM129C_ENST00000599124.1_Missense_Mutation_p.A214S|FAM129C_ENST00000332386.5_Missense_Mutation_p.A245S|FAM129C_ENST00000595684.1_Missense_Mutation_p.A245S|FAM129C_ENST00000599164.1_Missense_Mutation_p.A214S|FAM129C_ENST00000352727.3_Missense_Mutation_p.A245S	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	245										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						CTTCCTGGACGCCGTCCGACT	0.697																																							uc010xpr.1		NA																	0					0						c.(733-735)GCC>TCC		B-cell novel protein 1 isoform a							14.0	14.0	14.0					19																	17650003		2191	4289	6480	SO:0001583	missense	199786							g.chr19:17650003G>T	AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.733G>T	19.37:g.17650003G>T	ENSP00000335040:p.Ala245Ser					FAM129C_uc010xpq.1_Missense_Mutation_p.A245S|FAM129C_uc002ngy.3_5'UTR|FAM129C_uc010xpu.1_5'UTR|FAM129C_uc002ngz.3_RNA|FAM129C_uc010eaw.2_5'UTR|FAM129C_uc002nhb.2_5'Flank	p.A245S	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN			7	871	+			245					B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	ENST00000335393.4	37	c.733G>T	CCDS12362.1	.	.	.	.	.	.	.	.	.	.	g	24.4	4.530906	0.85706	.	.	ENSG00000167483	ENST00000335393;ENST00000332386;ENST00000352727;ENST00000300971;ENST00000435646	T;T;T;T	0.50813	1.05;1.04;0.79;0.73	4.37	4.37	0.52481	.	0.124743	0.36134	N	0.002780	T	0.64371	0.2592	M	0.72118	2.19	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.65987	0.936;0.94	T	0.68961	-0.5271	10	0.87932	D	0	-25.9928	12.4055	0.55436	0.0:0.0:1.0:0.0	.	245;245	Q86XR2;Q86XR2-3	NIBL2_HUMAN;.	S	245;245;245;245;191	ENSP00000335040:A245S;ENSP00000333447:A245S;ENSP00000341067:A245S;ENSP00000300971:A245S	ENSP00000300971:A245S	A	+	1	0	FAM129C	17511003	0.934000	0.31675	0.982000	0.44146	0.991000	0.79684	2.457000	0.45005	2.004000	0.58718	0.486000	0.48141	GCC		0.697	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	NM_173544		5	6	1	0	3.59834e-05	0.001168	3.99815e-05	5	6				
NCAN	1463	broad.mit.edu	37	19	19349097	19349097	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:19349097C>A	ENST00000252575.6	+	11	3385	c.3286C>A	c.(3286-3288)Cag>Aag	p.Q1096K	NCAN_ENST00000538881.1_Missense_Mutation_p.Q547K	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	1096	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	GCATAAGTTCCAGGGCCACTG	0.657																																							uc002nlz.2		NA																	0				ovary(4)	4						c.(3286-3288)CAG>AAG		chondroitin sulfate proteoglycan 3 precursor							55.0	57.0	57.0					19																	19349097		2203	4300	6503	SO:0001583	missense	1463				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr19:19349097C>A	AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.3286C>A	19.37:g.19349097C>A	ENSP00000252575:p.Gln1096Lys					NCAN_uc010ecc.1_Missense_Mutation_p.Q660K|NCAN_uc002nma.2_5'Flank	p.Q1096K	NM_004386	NP_004377	O14594	NCAN_HUMAN	Epithelial(12;0.00544)		11	3385	+			1096			C-type lectin.		Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	37	c.3286C>A	CCDS12397.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.665649	0.88251	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	T;T	0.17213	2.29;2.29	4.75	4.75	0.60458	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.000000	0.37761	N	0.001960	T	0.36276	0.0961	L	0.58428	1.81	0.34272	D	0.681188	D;D	0.71674	0.998;0.989	D;P	0.66196	0.942;0.567	T	0.48091	-0.9065	10	0.54805	T	0.06	.	15.3064	0.73995	0.0:1.0:0.0:0.0	.	1110;1096	Q4LE67;O14594	.;NCAN_HUMAN	K	1110;1096;547	ENSP00000252575:Q1096K;ENSP00000442202:Q547K	ENSP00000252575:Q1096K	Q	+	1	0	NCAN	19210097	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.494000	0.81503	2.464000	0.83262	0.561000	0.74099	CAG		0.657	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386		29	45	1	0	5.52252e-06	0.010818	6.29603e-06	29	45				
TYROBP	7305	broad.mit.edu	37	19	36398370	36398370	+	Silent	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:36398370A>T	ENST00000262629.4	-	3	273	c.207T>A	c.(205-207)ccT>ccA	p.P69P	TYROBP_ENST00000585901.2_Silent_p.P69P|TYROBP_ENST00000544690.2_Silent_p.P58P|TYROBP_ENST00000589517.1_Silent_p.P69P|TYROBP_ENST00000424586.3_Silent_p.P58P	NM_003332.3|NM_198125.2	NP_003323.1|NP_937758.1	O43914	TYOBP_HUMAN	TYRO protein tyrosine kinase binding protein	69					axon guidance (GO:0007411)|cellular defense response (GO:0006968)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|regulation of immune response (GO:0050776)|regulation of osteoclast development (GO:2001204)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|receptor binding (GO:0005102)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|large_intestine(1)|lung(4)|skin(1)	8	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCGCCCCCGAGGGACCAGCC	0.662																																							uc002ocm.2		NA																	0					0						c.(205-207)CCT>CCA		TYRO protein tyrosine kinase binding protein							33.0	40.0	38.0					19																	36398370		2202	4297	6499	SO:0001819	synonymous_variant	7305				axon guidance|cell junction assembly|cellular defense response|intracellular signal transduction|regulation of immune response	integral to plasma membrane|intracellular	identical protein binding|receptor signaling protein activity	g.chr19:36398370A>T	AF019563	CCDS12482.1, CCDS46058.1, CCDS54255.1, CCDS59378.1	19q13.1	2014-09-17				ENSG00000011600			12449	protein-coding gene	gene with protein product	"""killer activating receptor associated protein"", ""DNAX-activation protein 12"""	604142		PLOSL		9490415, 10888890	Standard	NM_003332		Approved	DAP12, PLO-SL, KARAP	uc002ocm.3	O43914		ENST00000262629.4:c.207T>A	19.37:g.36398370A>T						TYROBP_uc002ocn.2_Silent_p.P69P	p.P69P	NM_003332	NP_003323	O43914	TYOBP_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		3	263	-	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		69			Cytoplasmic (Potential).		A8K2X0|F5H389|Q6FGA5|Q9UMT3	Silent	SNP	ENST00000262629.4	37	c.207T>A	CCDS12482.1																																																																																				0.662	TYROBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457397.1			25	86	0	0	0	0.007291	0	25	86				
PRX	57716	broad.mit.edu	37	19	40902612	40902612	+	Silent	SNP	C	C	G	rs202113722		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:40902612C>G	ENST00000324001.7	-	7	1917	c.1647G>C	c.(1645-1647)ccG>ccC	p.P549P	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	549	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P549P(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTGACACTTTCGGCAGCTGTA	0.577																																							uc002onr.2		NA																	1	Substitution - coding silent(1)	p.P549P(1)	ovary(1)	ovary(2)	2						c.(1645-1647)CCG>CCC		periaxin isoform 2							89.0	102.0	97.0					19																	40902612		2202	4297	6499	SO:0001819	synonymous_variant	57716				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding	g.chr19:40902612C>G	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1647G>C	19.37:g.40902612C>G						PRX_uc002onq.2_Silent_p.P410P|PRX_uc002ons.2_3'UTR	p.P549P	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		7	1916	-			549			55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].|18.		Q9BXL9|Q9HCF2	Silent	SNP	ENST00000324001.7	37	c.1647G>C	CCDS33028.1																																																																																				0.577	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956		4	124	0	0	0	0.000602	0	4	124				
PRX	57716	broad.mit.edu	37	19	40902620	40902620	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:40902620G>C	ENST00000324001.7	-	7	1909	c.1639C>G	c.(1639-1641)Cag>Gag	p.Q547E	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	547	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E545_P549delEVQLP(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TTCGGCAGCTGTACCTCTGGA	0.587																																							uc002onr.2		NA																	1	Deletion - In frame(1)		breast(1)	ovary(2)	2						c.(1639-1641)CAG>GAG		periaxin isoform 2							80.0	92.0	88.0					19																	40902620		2201	4297	6498	SO:0001583	missense	57716				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding	g.chr19:40902620G>C	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1639C>G	19.37:g.40902620G>C	ENSP00000326018:p.Gln547Glu					PRX_uc002onq.2_Missense_Mutation_p.Q408E|PRX_uc002ons.2_3'UTR	p.Q547E	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		7	1908	-			547			55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].|18.		Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	37	c.1639C>G	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	G	2.235	-0.375097	0.05034	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01821	4.62	4.14	3.07	0.35406	.	.	.	.	.	T	0.02342	0.0072	M	0.68317	2.08	0.09310	N	0.999999	B	0.14438	0.01	B	0.15484	0.013	T	0.48969	-0.8987	9	0.10111	T	0.7	-17.7457	6.247	0.20825	0.1018:0.3702:0.5279:0.0	.	547	Q9BXM0	PRAX_HUMAN	E	547	ENSP00000326018:Q547E	ENSP00000326018:Q547E	Q	-	1	0	PRX	45594460	0.000000	0.05858	0.759000	0.31340	0.312000	0.27988	0.006000	0.13152	0.905000	0.36596	0.591000	0.81541	CAG		0.587	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956		4	124	0	0	0	0.000602	0	4	124				
CEACAM5	1048	broad.mit.edu	37	19	42224083	42224083	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:42224083C>T	ENST00000221992.6	+	7	1841	c.1727C>T	c.(1726-1728)tCa>tTa	p.S576L	CEACAM5_ENST00000398599.4_Missense_Mutation_p.S575L|CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000405816.1_Missense_Mutation_p.S576L	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	576	Ig-like 6.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		ATCCAGAACTCAGTGAGTGCA	0.517																																							uc002ork.2		NA																	0				skin(2)	2						c.(1726-1728)TCA>TTA		carcinoembryonic antigen-related cell adhesion							205.0	188.0	194.0					19																	42224083		2203	4300	6503	SO:0001583	missense	1048					anchored to membrane|basolateral plasma membrane|integral to plasma membrane		g.chr19:42224083C>T	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1727C>T	19.37:g.42224083C>T	ENSP00000221992:p.Ser576Leu					CEACAM5_uc002orj.1_Missense_Mutation_p.S575L|CEACAM5_uc002orl.2_Missense_Mutation_p.S576L	p.S576L	NM_004363	NP_004354	P06731	CEAM5_HUMAN		OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)	7	1848	+			576			Ig-like 6.		H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	37	c.1727C>T	CCDS12584.1	.	.	.	.	.	.	.	.	.	.	C	9.052	0.992351	0.18966	.	.	ENSG00000105388	ENST00000221992;ENST00000405816;ENST00000378181	T;T	0.00784	5.7;5.7	2.6	2.6	0.31112	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00845	0.0028	N	0.25957	0.775	0.09310	N	1	B;B	0.23540	0.003;0.087	B;B	0.29077	0.019;0.098	T	0.47446	-0.9117	9	0.39692	T	0.17	.	8.8688	0.35303	0.0:1.0:0.0:0.0	.	576;576	P06731;Q53G30	CEAM5_HUMAN;.	L	576;576;294	ENSP00000221992:S576L;ENSP00000385072:S576L	ENSP00000221992:S576L	S	+	2	0	CEACAM5	46915923	0.000000	0.05858	0.011000	0.14972	0.012000	0.07955	-0.287000	0.08388	1.744000	0.51775	0.460000	0.39030	TCA		0.517	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363		11	140	0	0	0	0.003163	0	11	140				
PSG8	440533	broad.mit.edu	37	19	43262416	43262417	+	Missense_Mutation	DNP	GG	GG	AA	rs140447066		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:43262416_43262417GG>AA	ENST00000306511.4	-	3	543_544	c.446_447CC>TT	c.(445-447)cCC>cTT	p.P149L	PSG8_ENST00000406636.3_Missense_Mutation_p.P27L|PSG8_ENST00000404209.4_Missense_Mutation_p.P149L|PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000401467.2_Intron	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	149	Ig-like C2-type 1.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				TGGAGATGGAGGGCTTGGGAGT	0.52																																							uc002ouo.2		NA																	0					0						c.(445-447)CCC>CTT		pregnancy specific beta-1-glycoprotein 8 isoform																																				SO:0001583	missense	440533					extracellular region		g.chr19:43262416_43262417GG>AA	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.446_447delinsAA	19.37:g.43262416_43262417delinsAA	ENSP00000305005:p.Pro149Leu					PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_5'UTR|PSG8_uc002ouh.2_Missense_Mutation_p.P149L|PSG8_uc010ein.2_Missense_Mutation_p.P27L|PSG8_uc002ouj.3_Intron|PSG8_uc002ouk.3_5'UTR|PSG8_uc002oul.3_Missense_Mutation_p.P149L|PSG8_uc002oum.3_Intron|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Intron	p.P149L	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN			3	544_545	-		Prostate(69;0.00899)	149			Ig-like C2-type 1.		A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	DNP	ENST00000306511.4	37	c.446_447CC>TT	CCDS33037.1																																																																																				0.520	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1			50	69	0	0	0	0.004672	0	50	69				
ZNF229	7772	broad.mit.edu	37	19	44934284	44934284	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:44934284C>G	ENST00000588931.1	-	6	1105	c.672G>C	c.(670-672)tgG>tgC	p.W224C	ZNF229_ENST00000291187.4_Missense_Mutation_p.W218C|ZNF229_ENST00000591289.1_Intron|CTC-512J12.4_ENST00000588655.1_RNA	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W224*(1)		breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				GACAAGATATCCAGCAAAAGC	0.388																																							uc002oze.1		NA																	1	Substitution - Nonsense(1)		skin(1)	skin(2)|ovary(1)|pancreas(1)	4						c.(670-672)TGG>TGC		zinc finger protein 229							116.0	111.0	113.0					19																	44934284		1883	4101	5984	SO:0001583	missense	7772				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44934284C>G	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.672G>C	19.37:g.44934284C>G	ENSP00000466519:p.Trp224Cys					ZNF229_uc010ejk.1_5'UTR|ZNF229_uc010ejl.1_Missense_Mutation_p.W218C	p.W224C	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN			6	1106	-		Prostate(69;0.0352)	224					B2RWN3|Q59FV2|Q86WL9	Missense_Mutation	SNP	ENST00000588931.1	37	c.672G>C	CCDS42574.1	.	.	.	.	.	.	.	.	.	.	C	9.148	1.015633	0.19355	.	.	ENSG00000167383	ENST00000291187	.	.	.	2.67	1.47	0.22746	.	.	.	.	.	T	0.18467	0.0443	N	0.12182	0.205	0.22796	N	0.998721	B	0.24963	0.115	B	0.19666	0.026	T	0.14227	-1.0480	8	0.37606	T	0.19	.	6.7257	0.23355	0.0:0.7025:0.2975:0.0	.	224	Q9UJW7	ZN229_HUMAN	C	224	.	ENSP00000291187:W224C	W	-	3	0	ZNF229	49626124	0.002000	0.14202	0.081000	0.20488	0.080000	0.17528	0.327000	0.19663	1.495000	0.48549	0.609000	0.83330	TGG		0.388	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460833.1	NM_014518		35	24	0	0	0	0.00874	0	35	24				
FUT1	2523	broad.mit.edu	37	19	49253877	49253877	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:49253877C>A	ENST00000310160.3	-	4	1636	c.662G>T	c.(661-663)cGt>cTt	p.R221L	FUT1_ENST00000601931.1_5'Flank	NM_000148.3	NP_000139.1	P19526	FUT1_HUMAN	fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)	221					carbohydrate metabolic process (GO:0005975)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(3)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		ATAGTCCCCACGGCGCACGTG	0.687																																							uc002pkk.2		NA																	0				ovary(1)	1						c.(661-663)CGT>CTT		fucosyltransferase 1							71.0	70.0	70.0					19																	49253877		2203	4299	6502	SO:0001583	missense	2523				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to plasma membrane|membrane fraction	galactoside 2-alpha-L-fucosyltransferase activity	g.chr19:49253877C>A		CCDS12733.1	19q13.33	2014-07-19	2006-01-19		ENSG00000174951	ENSG00000174951	2.4.1.69	"""Blood group antigens"", ""Fucosyltransferases"""	4012	protein-coding gene	gene with protein product		211100	"""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, Bombay phenotype included)"", ""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase)"""	H, HSC			Standard	NM_000148		Approved		uc002pkk.3	P19526		ENST00000310160.3:c.662G>T	19.37:g.49253877C>A	ENSP00000312021:p.Arg221Leu						p.R221L	NM_000148	NP_000139	P19526	FUT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)	4	1637	-		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	221			Lumenal (Potential).		O14505|O14506|O14507	Missense_Mutation	SNP	ENST00000310160.3	37	c.662G>T	CCDS12733.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562311	0.86335	.	.	ENSG00000174951	ENST00000310160;ENST00000539428	D	0.98958	-5.27	4.43	4.43	0.53597	.	0.000000	0.49916	D	0.000129	D	0.99162	0.9710	M	0.88906	2.99	0.43480	D	0.995703	D	0.89917	1.0	D	0.77557	0.99	D	0.98991	1.0808	10	0.87932	D	0	-14.3572	14.9385	0.70975	0.0:1.0:0.0:0.0	.	221	P19526	FUT1_HUMAN	L	221;211	ENSP00000312021:R221L	ENSP00000312021:R221L	R	-	2	0	FUT1	53945689	0.981000	0.34729	0.982000	0.44146	0.897000	0.52465	4.017000	0.57167	2.479000	0.83701	0.563000	0.77884	CGT		0.687	FUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466194.1	NM_000148		26	41	1	0	1.06801e-11	0.009535	1.31159e-11	26	41				
SIGLEC11	114132	broad.mit.edu	37	19	50463829	50463829	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr19:50463829G>A	ENST00000447370.2	-	2	530	c.440C>T	c.(439-441)gCg>gTg	p.A147V	SIGLEC11_ENST00000426971.2_Missense_Mutation_p.A147V|CTC-326K19.6_ENST00000451973.1_5'Flank	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	147					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.A135V(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		TAGAAAGAACGCATTGCTCAG	0.562																																							uc010ybh.1		NA																	1	Substitution - Missense(1)		endometrium(1)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(439-441)GCG>GTG		sialic acid binding Ig-like lectin 11 isoform 1							43.0	61.0	56.0					19																	50463829		1923	4292	6215	SO:0001583	missense	114132				cell adhesion	integral to membrane	sugar binding	g.chr19:50463829G>A	AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.440C>T	19.37:g.50463829G>A	ENSP00000412361:p.Ala147Val					SIGLEC11_uc010ybi.1_Missense_Mutation_p.A147V	p.A147V	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)	2	531	-		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)	147			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000447370.2	37	c.440C>T	CCDS12790.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.654|0.654	-0.808546|-0.808546	0.02819|0.02819	.|.	.|.	ENSG00000161640|ENSG00000161640	ENST00000447370;ENST00000458019|ENST00000426971	T|.	0.44881|.	0.91|.	2.63|2.63	-5.25|-5.25	0.02781|0.02781	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);|.	4.208750|.	0.00397|.	N|.	0.000052|.	T|T	0.15176|0.15176	0.0366|0.0366	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B|.	0.27351|.	0.012;0.176|.	B;B|.	0.29942|.	0.025;0.109|.	T|T	0.03315|0.03315	-1.1049|-1.1049	10|5	0.26408|.	T|.	0.33|.	.|.	1.2851|1.2851	0.02049|0.02049	0.3576:0.1054:0.3555:0.1815|0.3576:0.1054:0.3555:0.1815	.|.	147;147|.	Q96RL6-2;Q96RL6|.	.;SIG11_HUMAN|.	V|C	147|137	ENSP00000412361:A147V|.	ENSP00000412361:A147V|.	A|R	-|-	2|1	0|0	SIGLEC11|SIGLEC11	55155641|55155641	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-2.702000|-2.702000	0.00823|0.00823	-4.389000|-4.389000	0.00052|0.00052	-1.227000|-1.227000	0.01581|0.01581	GCG|CGT		0.562	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884		8	38	0	0	0	0.004482	0	8	38				
GEN1	348654	broad.mit.edu	37	2	17962335	17962335	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:17962335C>T	ENST00000381254.2	+	14	2070	c.1856C>T	c.(1855-1857)tCa>tTa	p.S619L	GEN1_ENST00000317402.7_Missense_Mutation_p.S619L|SMC6_ENST00000402989.1_Intron	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	619					DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TCAGAGCTATCAGCCATCCCT	0.373								Homologous recombination																															uc002rct.2		NA																	0				breast(5)|kidney(1)|central_nervous_system(1)|skin(1)	8						c.(1855-1857)TCA>TTA	Homologous_recombination	Gen homolog 1, endonuclease							54.0	56.0	55.0					2																	17962335		2202	4300	6502	SO:0001583	missense	348654				DNA repair	nucleus	DNA binding|endonuclease activity|metal ion binding	g.chr2:17962335C>T	AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.1856C>T	2.37:g.17962335C>T	ENSP00000370653:p.Ser619Leu					SMC6_uc010exo.2_Intron|GEN1_uc010yjs.1_Missense_Mutation_p.S619L|GEN1_uc002rcu.2_Missense_Mutation_p.S619L	p.S619L	NM_182625	NP_872431	Q17RS7	GEN_HUMAN			14	1929	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)		619					Q17RS9|Q6ZN37	Missense_Mutation	SNP	ENST00000381254.2	37	c.1856C>T	CCDS1691.1	.	.	.	.	.	.	.	.	.	.	C	1.681	-0.506491	0.04231	.	.	ENSG00000178295	ENST00000317402;ENST00000381254;ENST00000536097	T;T	0.25912	1.77;1.77	2.58	1.68	0.24146	.	0.862864	0.09663	N	0.772148	T	0.17492	0.0420	L	0.34521	1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29792	-1.0000	10	0.62326	D	0.03	0.038	3.2434	0.06788	0.2073:0.5458:0.0:0.2468	.	619	Q17RS7	GEN_HUMAN	L	619;619;256	ENSP00000318977:S619L;ENSP00000370653:S619L	ENSP00000318977:S619L	S	+	2	0	GEN1	17825816	0.000000	0.05858	0.007000	0.13788	0.216000	0.24613	-0.095000	0.11077	0.408000	0.25621	0.563000	0.77884	TCA		0.373	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241661.2	NM_182625		9	26	0	0	0	0.010729	0	9	26				
NCOA1	8648	broad.mit.edu	37	2	24929670	24929670	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:24929670C>G	ENST00000406961.1	+	13	1983	c.1331C>G	c.(1330-1332)tCa>tGa	p.S444*	NCOA1_ENST00000395856.3_Nonsense_Mutation_p.S444*|NCOA1_ENST00000538539.1_Nonsense_Mutation_p.S444*|NCOA1_ENST00000348332.3_Nonsense_Mutation_p.S444*|NCOA1_ENST00000405141.1_Nonsense_Mutation_p.S444*|NCOA1_ENST00000288599.5_Nonsense_Mutation_p.S444*|NCOA1_ENST00000407230.1_Nonsense_Mutation_p.S293*			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	444	Interaction with STAT3.|Ser-rich.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCGGATGCTCACCCGGAAGT	0.458			T	PAX3	alveolar rhadomyosarcoma																																		uc002rfk.2		NA		Dom	yes		2	2p23	8648	T	nuclear receptor coactivator 1			M	PAX3		alveolar rhadomyosarcoma	PAX3/NCOA1(8)	0				soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11						c.(1330-1332)TCA>TGA		nuclear receptor coactivator 1 isoform 1							88.0	88.0	88.0					2																	24929670		2203	4300	6503	SO:0001587	stop_gained	8648							g.chr2:24929670C>G	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.1331C>G	2.37:g.24929670C>G	ENSP00000385216:p.Ser444*					NCOA1_uc010eye.2_Nonsense_Mutation_p.S444*|NCOA1_uc002rfi.2_Nonsense_Mutation_p.S293*|NCOA1_uc002rfj.2_Nonsense_Mutation_p.S444*|NCOA1_uc002rfl.2_Nonsense_Mutation_p.S444*	p.S444*	NM_003743	NP_003734	Q15788	NCOA1_HUMAN			11	1589	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		444			Interaction with STAT3.|Ser-rich.		O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Nonsense_Mutation	SNP	ENST00000406961.1	37	c.1331C>G	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	C	38	7.241328	0.98157	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	.	.	.	4.37	4.37	0.52481	.	0.188990	0.46758	D	0.000277	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	17.081	0.86598	0.0:1.0:0.0:0.0	.	.	.	.	X	444;444;293;444;444;444;444	.	ENSP00000288599:S444X	S	+	2	0	NCOA1	24783174	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.581000	0.67471	2.421000	0.82119	0.650000	0.86243	TCA		0.458	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223		12	99	0	0	0	0.003163	0	12	99				
CAD	790	broad.mit.edu	37	2	27457389	27457389	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:27457389G>A	ENST00000403525.1	+	22	3577	c.3433G>A	c.(3433-3435)Gac>Aac	p.D1145N	CAD_ENST00000264705.4_Missense_Mutation_p.D1208N			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCCCAGGATGACCAGCTGAA	0.557																																							uc002rji.2		NA																	0				ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10						c.(3622-3624)GAC>AAC		carbamoylphosphate synthetase 2/aspartate	L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)						204.0	176.0	186.0					2																	27457389		2203	4300	6503	SO:0001583	missense	790				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity	g.chr2:27457389G>A	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.3433G>A	2.37:g.27457389G>A	ENSP00000384510:p.Asp1145Asn					CAD_uc010eyw.2_Missense_Mutation_p.D1145N	p.D1208N	NM_004341	NP_004332	P27708	PYR1_HUMAN			23	3784	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1208			CPSase B.|ATP-grasp 2.|CPSase (Carbamoyl-phosphate synthase).		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37	c.3622G>A		.	.	.	.	.	.	.	.	.	.	G	11.28	1.591259	0.28357	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.97186	-4.28;-4.28	5.77	5.77	0.91146	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);	0.000000	0.85682	D	0.000000	D	0.89312	0.6679	N	0.01464	-0.85	0.80722	D	1	B;B	0.18863	0.012;0.031	B;B	0.21917	0.006;0.037	D	0.85677	0.1298	10	0.02654	T	1	0.8874	18.9103	0.92481	0.0:0.0:1.0:0.0	.	1145;1208	F8VPD4;P27708	.;PYR1_HUMAN	N	1208;1145	ENSP00000264705:D1208N;ENSP00000384510:D1145N	ENSP00000264705:D1208N	D	+	1	0	CAD	27310893	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	8.956000	0.93066	2.884000	0.98904	0.655000	0.94253	GAC		0.557	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1			4	159	0	0	0	0.001984	0	4	159				
FOSL2	2355	broad.mit.edu	37	2	28635264	28635264	+	Silent	SNP	C	C	T	rs141121352		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:28635264C>T	ENST00000264716.4	+	4	1793	c.930C>T	c.(928-930)agC>agT	p.S310S	FOSL2_ENST00000545753.1_Silent_p.S271S|FOSL2_ENST00000379619.1_Silent_p.S302S	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	310					cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					GCAGTAGCAGCGGGGACCAAT	0.622																																							uc002rma.2		NA																	0				ovary(2)|breast(1)	3						c.(928-930)AGC>AGT		FOS-like antigen 2		C		0,4406		0,0,2203	58.0	53.0	54.0		930	-6.8	0.9	2	dbSNP_134	54	1,8599		0,1,4299	no	coding-synonymous	FOSL2	NM_005253.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		310/327	28635264	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2355				cell death|regulation of transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:28635264C>T		CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.930C>T	2.37:g.28635264C>T						FOSL2_uc010ymi.1_Silent_p.S271S	p.S310S	NM_005253	NP_005244	P15408	FOSL2_HUMAN			4	1739	+	Acute lymphoblastic leukemia(172;0.155)		310					B2RD58|B3KP27|B4DYV4|Q6FG46	Silent	SNP	ENST00000264716.4	37	c.930C>T	CCDS1766.1																																																																																				0.622	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215116.2	NM_005253		3	75	0	0	0	0.009096	0	3	75				
GPR75	10936	broad.mit.edu	37	2	54081891	54081891	+	Start_Codon_SNP	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:54081891C>T	ENST00000394705.2	-	2	273	c.3G>A	c.(1-3)atG>atA	p.M1I	ASB3_ENST00000498475.2_Intron|ASB3_ENST00000406625.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron	NM_006794.3	NP_006785.1	O95800	GPR75_HUMAN	G protein-coupled receptor 75	1					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of neuron death (GO:1901214)	integral component of plasma membrane (GO:0005887)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CTGTTGAGTTCATTTTCGGAG	0.522																																							uc002rxo.3		NA																	0				ovary(1)|skin(1)	2						c.(1-3)ATG>ATA		G protein-coupled receptor 75							104.0	99.0	101.0					2																	54081891		2203	4300	6503	SO:0001582	initiator_codon_variant	10936					integral to plasma membrane	G-protein coupled receptor activity	g.chr2:54081891C>T	AF101472	CCDS1849.1	2p16	2012-08-21			ENSG00000119737	ENSG00000119737		"""GPCR / Class A : Orphans"""	4526	protein-coding gene	gene with protein product		606704				10381362	Standard	NM_006794		Approved	WI-31133	uc002rxo.3	O95800	OTTHUMG00000129280	ENST00000394705.2:c.3G>A	2.37:g.54081891C>T	ENSP00000378195:p.Met1Ile					ASB3_uc002rxi.3_Intron	p.M1I	NM_006794	NP_006785	O95800	GPR75_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		2	274	-			1			Extracellular (Potential).		B2RC02|Q6NWR2	Missense_Mutation	SNP	ENST00000394705.2	37	c.3G>A	CCDS1849.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.169247	0.57584	.	.	ENSG00000119737	ENST00000394705	T	0.23754	1.89	5.54	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.23330	0.0564	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.03773	-1.1005	9	0.87932	D	0	-15.5775	11.5297	0.50601	0.0:0.9155:0.0:0.0845	.	1	O95800	GPR75_HUMAN	I	1	ENSP00000378195:M1I	ENSP00000378195:M1I	M	-	3	0	GPR75	53935395	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	3.260000	0.51523	1.335000	0.45486	0.561000	0.74099	ATG		0.522	GPR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251403.2		Missense_Mutation	19	107	0	0	0	0.012319	0	19	107				
TMEM127	55654	broad.mit.edu	37	2	96934240	96934240	+	5'Flank	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:96934240G>A	ENST00000258439.3	-	0	0				TMEM127_ENST00000432959.1_5'Flank|CIAO1_ENST00000488633.1_Missense_Mutation_p.E179K	NM_001193304.2|NM_017849.3	NP_001180233.1|NP_060319.1	O75204	TM127_HUMAN	transmembrane protein 127						negative regulation of cell proliferation (GO:0008285)|negative regulation of TOR signaling (GO:0032007)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	5						GCTGTACCGGGAGGAAGAGGA	0.562																																							uc002svs.2		NA																	0					0						c.(535-537)GAG>AAG		WD repeat domain 39							134.0	123.0	127.0					2																	96934240		2203	4300	6503	SO:0001631	upstream_gene_variant	9391				chromosome segregation|iron-sulfur cluster assembly|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter	MMXD complex	protein binding	g.chr2:96934240G>A	AK000514	CCDS2018.1	2q11.2	2014-09-17			ENSG00000135956	ENSG00000135956			26038	protein-coding gene	gene with protein product		613403				10493829	Standard	NM_017849		Approved	FLJ20507, FLJ22257	uc002svr.3	O75204	OTTHUMG00000130454		2.37:g.96934240G>A	Exception_encountered					TMEM127_uc002svq.2_5'Flank|TMEM127_uc002svr.2_5'Flank	p.E179K	NM_004804	NP_004795	O76071	CIAO1_HUMAN			5	740	+			179			WD 4.		D3DXH0	Missense_Mutation	SNP	ENST00000258439.3	37	c.535G>A	CCDS2018.1	.	.	.	.	.	.	.	.	.	.	G	35	5.475712	0.96291	.	.	ENSG00000144021	ENST00000488633	T	0.65178	-0.14	5.62	5.62	0.85841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.62122	0.2402	N	0.16656	0.425	0.80722	D	1	D	0.62365	0.991	D	0.63488	0.915	T	0.55604	-0.8115	10	0.11182	T	0.66	-41.7804	17.154	0.86785	0.0:0.0:1.0:0.0	.	179	O76071	CIAO1_HUMAN	K	179	ENSP00000418287:E179K	ENSP00000418287:E179K	E	+	1	0	CIAO1	96297967	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.460000	0.97641	2.651000	0.90000	0.563000	0.77884	GAG		0.562	TMEM127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252845.3	NM_017849		5	89	0	0	0	0.00308	0	5	89				
IL36B	27177	broad.mit.edu	37	2	113788652	113788652	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:113788652C>A	ENST00000259213.4	-	3	201	c.94G>T	c.(94-96)Gct>Tct	p.A32S	IL36B_ENST00000327407.2_Missense_Mutation_p.A32S	NM_014438.3	NP_055253.2	Q9NZH7	IL36B_HUMAN	interleukin 36, beta	32					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)			kidney(1)|ovary(1)|pancreas(1)	3						CTAAGAGGAGCTGCTATTAAA	0.493																																							uc002tiq.1		NA																	0				ovary(1)	1						c.(94-96)GCT>TCT		interleukin 1 family, member 8 isoform 1							115.0	102.0	107.0					2																	113788652		2203	4300	6503	SO:0001583	missense	27177				immune response	extracellular space	cytokine activity|interleukin-1 receptor binding	g.chr2:113788652C>A	AF201833	CCDS2109.1, CCDS2110.1	2q14	2011-07-14	2011-06-06	2011-06-06	ENSG00000136696	ENSG00000136696		"""Interleukins and interleukin receptors"""	15564	protein-coding gene	gene with protein product		605508	"""interleukin 1 family, member 8 (eta)"""	IL1F8		10625660, 10512743, 16646978	Standard	NM_173178		Approved	FIL1, IL-1H2, IL-1F8, FILI-(ETA), IL1-ETA, IL1H2, MGC126880, MGC126882	uc002tiq.1	Q9NZH7	OTTHUMG00000131338	ENST00000259213.4:c.94G>T	2.37:g.113788652C>A	ENSP00000259213:p.Ala32Ser					IL1F8_uc002tir.1_Missense_Mutation_p.A32S	p.A32S	NM_014438	NP_055253	Q9NZH7	IL36B_HUMAN			3	198	-			32					Q3MIH0|Q53SR6|Q7RTZ7|Q9UHA5	Missense_Mutation	SNP	ENST00000259213.4	37	c.94G>T	CCDS2109.1	.	.	.	.	.	.	.	.	.	.	c	11.02	1.515192	0.27123	.	.	ENSG00000136696	ENST00000259213;ENST00000327407	T;T	0.18016	2.24;2.24	3.04	-0.119	0.13543	.	1.365360	0.05065	N	0.480517	T	0.11623	0.0283	L	0.34521	1.04	0.09310	N	1	B;P	0.41450	0.171;0.75	B;B	0.38755	0.059;0.281	T	0.20405	-1.0276	10	0.30078	T	0.28	.	2.1667	0.03839	0.2488:0.4298:0.0:0.3214	.	32;32	Q9NZH7-2;Q9NZH7	.;IL36B_HUMAN	S	32	ENSP00000259213:A32S;ENSP00000328420:A32S	ENSP00000259213:A32S	A	-	1	0	IL36B	113505123	0.517000	0.26226	0.158000	0.22627	0.161000	0.22273	-0.064000	0.11636	0.106000	0.17784	-0.441000	0.05720	GCT		0.493	IL36B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254110.1	NM_014438		15	39	1	0	6.49762e-13	0.006122	8.18046e-13	15	39				
WDR33	55339	broad.mit.edu	37	2	128479467	128479467	+	Silent	SNP	T	T	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:128479467T>C	ENST00000322313.4	-	15	1772	c.1614A>G	c.(1612-1614)caA>caG	p.Q538Q		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	538					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CAATTTCTGCTTGTGTTTTTT	0.393																																							uc002tpg.1		NA																	0					0						c.(1612-1614)CAA>CAG		WD repeat domain 33 isoform 1							254.0	225.0	235.0					2																	128479467		2203	4300	6503	SO:0001819	synonymous_variant	55339				postreplication repair|spermatogenesis	collagen|nucleus	protein binding	g.chr2:128479467T>C		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.1614A>G	2.37:g.128479467T>C							p.Q538Q	NM_018383	NP_060853	Q9C0J8	WDR33_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0695)	15	1797	-	Colorectal(110;0.1)		538					Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Silent	SNP	ENST00000322313.4	37	c.1614A>G	CCDS2150.1																																																																																				0.393	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383		23	42	0	0	0	0.014323	0	23	42				
TTN	7273	broad.mit.edu	37	2	179422610	179422610	+	Silent	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:179422610G>C	ENST00000591111.1	-	278	82772	c.82548C>G	c.(82546-82548)ctC>ctG	p.L27516L	TTN_ENST00000589042.1_Silent_p.L29157L|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.L26589L|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.L20284L|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.L20217L|TTN_ENST00000460472.2_Silent_p.L20092L			Q8WZ42	TITIN_HUMAN	titin	27516	Fibronectin type-III 100. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTCCCATTTGAGAGTCACAC	0.428																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(79765-79767)CTC>CTG		titin isoform N2-A							217.0	215.0	216.0					2																	179422610		1914	4124	6038	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179422610G>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.82548C>G	2.37:g.179422610G>C						uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L20284L|TTN_uc010zfi.1_Silent_p.L20217L|TTN_uc010zfj.1_Silent_p.L20092L	p.L26589L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		277	79991	-			27516					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.79767C>G																																																																																					0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		12	128	0	0	0	0.013537	0	12	128				
CCDC141	285025	broad.mit.edu	37	2	179736233	179736233	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:179736233G>A	ENST00000420890.2	-	14	2243	c.2126C>T	c.(2125-2127)tCt>tTt	p.S709F	CCDC141_ENST00000295723.5_Missense_Mutation_p.S134F	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	709										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			GTCAAGTGCAGACACAGGCAT	0.403																																							uc002unf.1		NA																	0				ovary(7)|pancreas(2)|skin(1)	10						c.(400-402)TCT>TTT		coiled-coil domain containing 141							141.0	142.0	142.0					2																	179736233		2203	4300	6503	SO:0001583	missense	285025						protein binding	g.chr2:179736233G>A	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2126C>T	2.37:g.179736233G>A	ENSP00000395995:p.Ser709Phe						p.S134F	NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)		4	458	-			134					H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37	c.401C>T		.	.	.	.	.	.	.	.	.	.	G	9.511	1.105637	0.20632	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758	T;T;T;T	0.46819	0.86;1.45;1.45;1.48	5.79	3.94	0.45596	.	0.234553	0.30177	N	0.010239	T	0.43897	0.1268	L	0.34521	1.04	0.28804	N	0.898616	P	0.44044	0.825	P	0.48063	0.565	T	0.37267	-0.9713	10	0.54805	T	0.06	-4.3963	10.4747	0.44657	0.0:0.1454:0.7034:0.1512	.	134	Q6ZP82	CC141_HUMAN	F	709;153;134;709	ENSP00000395995:S709F;ENSP00000344627:S153F;ENSP00000295723:S134F;ENSP00000390190:S709F	ENSP00000295723:S134F	S	-	2	0	CCDC141	179444478	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.834000	0.48167	0.735000	0.32537	-0.310000	0.09108	TCT		0.403	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648		6	77	0	0	0	0.001168	0	6	77				
ZNF804A	91752	broad.mit.edu	37	2	185803549	185803549	+	Silent	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:185803549A>T	ENST00000302277.6	+	4	4020	c.3426A>T	c.(3424-3426)tcA>tcT	p.S1142S		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1142							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CCAGAACCTCATTACCTCAGC	0.537																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(3424-3426)TCA>TCT		zinc finger protein 804A							162.0	154.0	157.0					2																	185803549		2203	4300	6503	SO:0001819	synonymous_variant	91752					intracellular	zinc ion binding	g.chr2:185803549A>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.3426A>T	2.37:g.185803549A>T							p.S1142S	NM_194250	NP_919226	Q7Z570	Z804A_HUMAN			4	4020	+			1142					A7E253|Q6ZN26	Silent	SNP	ENST00000302277.6	37	c.3426A>T	CCDS2291.1																																																																																				0.537	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		22	42	0	0	0	0.014323	0	22	42				
MARS2	92935	broad.mit.edu	37	2	198570892	198570892	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:198570892G>T	ENST00000282276.6	+	1	806	c.763G>T	c.(763-765)Gtg>Ttg	p.V255L	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	255					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	CGACCTGTCCGTGTCTCGCAG	0.602																																							uc002uuq.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(763-765)GTG>TTG		methionine-tRNA synthetase 2 precursor	L-Methionine(DB00134)						52.0	53.0	53.0					2																	198570892		2203	4300	6503	SO:0001583	missense	92935				methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity	g.chr2:198570892G>T	BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.763G>T	2.37:g.198570892G>T	ENSP00000282276:p.Val255Leu					uc002uup.2_Intron	p.V255L	NM_138395	NP_612404	Q96GW9	SYMM_HUMAN			1	806	+			255					A0AVC3|Q76E79|Q8IW62|Q8N7N4	Missense_Mutation	SNP	ENST00000282276.6	37	c.763G>T	CCDS33358.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743492	0.89663	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	T	0.48201	0.82	5.28	5.28	0.74379	Aminoacyl-tRNA synthetase, class I (M) (1);	0.119761	0.56097	D	0.000036	T	0.68622	0.3021	M	0.81179	2.53	0.80722	D	1	P	0.51351	0.944	P	0.61658	0.892	T	0.72137	-0.4381	10	0.72032	D	0.01	-17.5122	16.4558	0.84012	0.0:0.0:1.0:0.0	.	255	Q96GW9	SYMM_HUMAN	L	255;182	ENSP00000282276:V255L	ENSP00000282276:V255L	V	+	1	0	MARS2	198279137	1.000000	0.71417	0.812000	0.32479	0.972000	0.66771	7.685000	0.84117	2.738000	0.93877	0.655000	0.94253	GTG		0.602	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395		28	50	1	0	3.33393e-15	0.004878	4.27427e-15	28	50				
FZD7	8324	broad.mit.edu	37	2	202900672	202900672	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:202900672C>T	ENST00000286201.1	+	1	1363	c.1302C>T	c.(1300-1302)ttC>ttT	p.F434F	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	434					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						TCTACCTCTTCATAGGCACGT	0.612											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002uyw.1		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(1300-1302)TTC>TTT		frizzled 7 precursor							101.0	81.0	88.0					2																	202900672		2203	4300	6503	SO:0001819	synonymous_variant	8324				axonogenesis|brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|mesenchymal to epithelial transition|negative regulation of cell-substrate adhesion|negative regulation of ectodermal cell fate specification|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of phosphorylation|positive regulation of transcription, DNA-dependent|regulation of catenin import into nucleus|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr2:202900672C>T	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.1302C>T	2.37:g.202900672C>T			OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2133		p.F434F	NM_003507	NP_003498	O75084	FZD7_HUMAN			1	1363	+			434			Helical; Name=5; (Potential).		O94816|Q53S59|Q96B74	Silent	SNP	ENST00000286201.1	37	c.1302C>T	CCDS2351.1																																																																																				0.612	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507		4	40	0	0	0	0.000602	0	4	40				
TMEM169	92691	broad.mit.edu	37	2	216965204	216965204	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:216965204A>G	ENST00000295658.4	+	3	1040	c.833A>G	c.(832-834)aAt>aGt	p.N278S	TMEM169_ENST00000437356.2_Missense_Mutation_p.N278S|TMEM169_ENST00000406027.2_Missense_Mutation_p.N278S|TMEM169_ENST00000454545.1_Missense_Mutation_p.N278S	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	278						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAATCCGACAATATCTCAAGC	0.542																																							uc010zjr.1		NA																	0				ovary(1)	1						c.(832-834)AAT>AGT		transmembrane protein 169							99.0	100.0	100.0					2																	216965204		2203	4300	6503	SO:0001583	missense	92691					integral to membrane		g.chr2:216965204A>G	AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.833A>G	2.37:g.216965204A>G	ENSP00000295658:p.Asn278Ser					TMEM169_uc010zjs.1_Missense_Mutation_p.N278S|TMEM169_uc002vfw.2_Missense_Mutation_p.N278S|TMEM169_uc002vfv.3_Missense_Mutation_p.N278S	p.N278S	NM_001142310	NP_001135782	Q96HH4	TM169_HUMAN		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	4	1159	+		Renal(323;0.0651)	278			Extracellular (Potential).		B2R8W6	Missense_Mutation	SNP	ENST00000295658.4	37	c.833A>G	CCDS2401.1	.	.	.	.	.	.	.	.	.	.	A	10.86	1.470783	0.26423	.	.	ENSG00000163449	ENST00000454545;ENST00000437356;ENST00000295658;ENST00000406027	.	.	.	4.99	0.954	0.19595	.	0.046330	0.85682	D	0.000000	T	0.37544	0.1007	L	0.57536	1.79	0.31121	N	0.708853	B	0.15473	0.013	B	0.12156	0.007	T	0.30149	-0.9988	8	.	.	.	-11.4306	7.1072	0.25370	0.6494:0.2748:0.0758:0.0	.	278	Q96HH4	TM169_HUMAN	S	278	.	.	N	+	2	0	TMEM169	216673449	0.999000	0.42202	0.990000	0.47175	0.697000	0.40408	4.237000	0.58681	0.314000	0.23086	0.533000	0.62120	AAT		0.542	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256666.2	NM_138390		12	36	0	0	0	0.00245	0	12	36				
SMARCAL1	50485	broad.mit.edu	37	2	217281011	217281011	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:217281011G>A	ENST00000357276.4	+	4	1173	c.843G>A	c.(841-843)atG>atA	p.M281I	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.M281I	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	281	HARP 1. {ECO:0000255|PROSITE- ProRule:PRU00800}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		ACTTCAGCATGAATGACTATA	0.438									Schimke Immuno-Osseous Dysplasia																														uc002vgc.3		NA																	0				ovary(3)|breast(3)|skin(1)	7						c.(841-843)ATG>ATA		SWI/SNF-related matrix-associated							219.0	182.0	194.0					2																	217281011		2203	4300	6503	SO:0001583	missense	50485	Schimke_Immuno-Osseous_Dysplasia	Familial Cancer Database	SIOD	chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity	g.chr2:217281011G>A	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.843G>A	2.37:g.217281011G>A	ENSP00000349823:p.Met281Ile					SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.M281I|SMARCAL1_uc010fvg.2_Missense_Mutation_p.M281I	p.M281I	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)	4	1173	+		Renal(323;0.0458)	281			HARP 1.		A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	c.843G>A	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.596137	0.28445	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000427645;ENST00000392128;ENST00000412913	T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;0.71	5.14	4.18	0.49190	HepA-related (1);	0.167727	0.52532	D	0.000066	T	0.55273	0.1910	N	0.21373	0.66	0.28967	N	0.889471	B	0.31351	0.32	B	0.35182	0.197	T	0.54735	-0.8249	10	0.52906	T	0.07	-24.152	7.3924	0.26917	0.095:0.0:0.7339:0.1711	.	281	Q9NZC9	SMAL1_HUMAN	I	281;281;180;145;1	ENSP00000349823:M281I;ENSP00000350940:M281I;ENSP00000392997:M180I;ENSP00000375974:M145I;ENSP00000390248:M1I	ENSP00000349823:M281I	M	+	3	0	SMARCAL1	216989256	0.949000	0.32298	0.962000	0.40283	0.455000	0.32408	0.843000	0.27640	2.666000	0.90696	0.655000	0.94253	ATG		0.438	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2			8	95	0	0	0	0.008291	0	8	95				
D2HGDH	728294	broad.mit.edu	37	2	242690756	242690756	+	Missense_Mutation	SNP	G	G	A	rs372136379		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr2:242690756G>A	ENST00000321264.4	+	8	1302	c.1093G>A	c.(1093-1095)Ggc>Agc	p.G365S	D2HGDH_ENST00000403782.1_Missense_Mutation_p.G231S|D2HGDH_ENST00000486953.1_Intron	NM_152783.3	NP_689996.4	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase	365					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|response to cobalt ion (GO:0032025)|response to manganese ion (GO:0010042)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-2-hydroxyglutarate dehydrogenase activity (GO:0051990)|flavin adenine dinucleotide binding (GO:0050660)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(1)|endometrium(3)|lung(10)|skin(1)|urinary_tract(1)	16		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		GCTGGGCTCCGGCCTGGTGAC	0.622																																							uc002wce.1		NA																	0					0						c.(1093-1095)GGC>AGC		D-2-hydroxyglutarate dehydrogenase precursor		G	SER/GLY	0,4406		0,0,2203	48.0	46.0	46.0		1093	5.1	0.9	2		46	1,8591	1.2+/-3.3	0,1,4295	no	missense	D2HGDH	NM_152783.3	56	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	benign	365/522	242690756	1,12997	2203	4296	6499	SO:0001583	missense	728294				2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding	g.chr2:242690756G>A	AK091725	CCDS33426.1, CCDS74684.1	2p25.3	2010-05-11			ENSG00000180902	ENSG00000180902	1.1.99.-		28358	protein-coding gene	gene with protein product		609186				15070399, 15609246	Standard	NM_152783		Approved	MGC25181, D2HGD, FLJ42195	uc002wce.1	Q8N465	OTTHUMG00000151474	ENST00000321264.4:c.1093G>A	2.37:g.242690756G>A	ENSP00000315351:p.Gly365Ser					D2HGDH_uc010zpc.1_RNA|D2HGDH_uc010fzq.1_Missense_Mutation_p.G231S|D2HGDH_uc002wcg.1_Intron|D2HGDH_uc002wch.2_Intron|D2HGDH_uc002wci.2_Missense_Mutation_p.G64S	p.G365S	NM_152783	NP_689996	Q8N465	D2HDH_HUMAN		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)	8	1266	+		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)	365					B4E3L6|E7ENP2|Q6IQ24|Q8N5Q8	Missense_Mutation	SNP	ENST00000321264.4	37	c.1093G>A	CCDS33426.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.05|16.05	3.013925|3.013925	0.54468|0.54468	0.0|0.0	1.16E-4|1.16E-4	ENSG00000180902|ENSG00000180902	ENST00000321264;ENST00000403782;ENST00000454048|ENST00000432449	T;T;T|.	0.79454|.	-1.27;-1.27;-1.11|.	5.1|5.1	5.1|5.1	0.69264|0.69264	FAD-linked oxidase-like, C-terminal (1);FAD-linked oxidase, C-terminal (1);|.	0.144007|.	0.48286|.	D|.	0.000181|.	T|T	0.69744|0.69744	0.3145|0.3145	M|M	0.65320|0.65320	2|2	0.80722|0.80722	D|D	1|1	B|.	0.31989|.	0.35|.	B|.	0.41332|.	0.354|.	T|T	0.69000|0.69000	-0.5261|-0.5261	10|5	0.37606|.	T|.	0.19|.	-28.5373|-28.5373	12.9138|12.9138	0.58195|0.58195	0.0779:0.0:0.9221:0.0|0.0779:0.0:0.9221:0.0	.|.	365|.	Q8N465|.	D2HDH_HUMAN|.	S|Q	365;231;66|118	ENSP00000315351:G365S;ENSP00000384723:G231S;ENSP00000404596:G66S|.	ENSP00000315351:G365S|.	G|R	+|+	1|2	0|0	D2HGDH|D2HGDH	242339429|242339429	0.998000|0.998000	0.40836|0.40836	0.938000|0.938000	0.37757|0.37757	0.173000|0.173000	0.22820|0.22820	3.127000|3.127000	0.50484|0.50484	2.362000|2.362000	0.80069|0.80069	0.561000|0.561000	0.74099|0.74099	GGC|CGG		0.622	D2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322794.2	NM_152783		3	33	0	0	0	0.000602	0	3	33				
FASTKD5	60493	broad.mit.edu	37	20	3127632	3127632	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr20:3127632C>T	ENST00000380266.3	-	2	2406	c.2085G>A	c.(2083-2085)atG>atA	p.M695I	UBOX5_ENST00000217173.2_Intron|UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000348031.2_Intron	NM_021826.4	NP_068598.1	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	695					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(2)	19						CAGCCAGCTTCATTCTTGGGG	0.557																																							uc002whz.2		NA																	0					0						c.(2083-2085)ATG>ATA		FAST kinase domains 5							102.0	103.0	102.0					20																	3127632		2203	4300	6503	SO:0001583	missense	60493				apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity	g.chr20:3127632C>T	BC007413	CCDS13048.1	20p13	2006-07-07			ENSG00000215251	ENSG00000215251			25790	protein-coding gene	gene with protein product		614272				11347906	Standard	NM_021826		Approved	FLJ13149	uc002whz.4	Q7L8L6	OTTHUMG00000031727	ENST00000380266.3:c.2085G>A	20.37:g.3127632C>T	ENSP00000369618:p.Met695Ile					uc002whv.1_Intron|UBOX5_uc002whw.2_Intron|UBOX5_uc002whx.2_Intron|UBOX5_uc002why.1_Intron	p.M695I	NM_021826	NP_068598	Q7L8L6	FAKD5_HUMAN			2	2396	-			695					Q96JN3|Q9H5D1|Q9H8Y3	Missense_Mutation	SNP	ENST00000380266.3	37	c.2085G>A	CCDS13048.1	.	.	.	.	.	.	.	.	.	.	C	0.520	-0.862431	0.02610	.	.	ENSG00000215251	ENST00000380266	T	0.13420	2.59	5.84	1.09	0.20402	.	0.899782	0.09362	N	0.812678	T	0.07369	0.0186	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38585	-0.9654	10	0.35671	T	0.21	.	9.4694	0.38833	0.0:0.6468:0.1034:0.2499	.	695	Q7L8L6	FAKD5_HUMAN	I	695	ENSP00000369618:M695I	ENSP00000369618:M695I	M	-	3	0	FASTKD5	3075632	0.028000	0.19301	0.266000	0.24541	0.054000	0.15201	0.202000	0.17295	0.358000	0.24211	0.491000	0.48974	ATG		0.557	FASTKD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077701.2	NM_021826		6	73	0	0	0	0.00308	0	6	73				
ATRN	8455	broad.mit.edu	37	20	3571954	3571954	+	Splice_Site	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr20:3571954G>T	ENST00000262919.5	+	19	3390		c.e19+1		ATRN_ENST00000446916.2_Splice_Site	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin						cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						AAATGTCAGCGTAAGTCAAAT	0.463																																							uc002wim.2		NA																	0				ovary(1)|breast(1)	2						c.e19+1		attractin isoform 1							162.0	149.0	154.0					20																	3571954		2203	4300	6503	SO:0001630	splice_region_variant	8455				inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding	g.chr20:3571954G>T	AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.3322+1G>T	20.37:g.3571954G>T						ATRN_uc002wil.2_Splice_Site_p.P1108_splice	p.P1108_splice	NM_139321	NP_647537	O75882	ATRN_HUMAN			19	3412	+								A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Splice_Site	SNP	ENST00000262919.5	37	c.3322_splice	CCDS13053.1	.	.	.	.	.	.	.	.	.	.	G	32	5.141461	0.94560	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5012	0.95095	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATRN	3519954	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.785000	0.99042	2.692000	0.91855	0.650000	0.86243	.		0.463	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321	Intron	15	85	1	0	1.33834e-09	0.007413	1.59326e-09	15	85				
HSPA12B	116835	broad.mit.edu	37	20	3730746	3730746	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr20:3730746C>T	ENST00000254963.2	+	11	1318	c.1173C>T	c.(1171-1173)ttC>ttT	p.F391F	HSPA12B_ENST00000542646.1_Silent_p.F225F	NM_001197327.1|NM_052970.4	NP_001184256.1|NP_443202.3	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	391							ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	14						CCATCGCCTTCGAGGCTCGCA	0.627																																							uc002wjd.2		NA																	0					0						c.(1171-1173)TTC>TTT		heat shock 70kD protein 12B							21.0	20.0	20.0					20																	3730746		2202	4297	6499	SO:0001819	synonymous_variant	116835						ATP binding	g.chr20:3730746C>T	AK056712	CCDS13061.1	20p13	2011-09-02	2003-04-10	2003-04-10	ENSG00000132622	ENSG00000132622		"""Heat shock proteins / HSP70"""	16193	protein-coding gene	gene with protein product		610702	"""chromosome 20 open reading frame 60"""	C20orf60		12552099	Standard	NM_052970		Approved	dJ1009E24.2	uc002wjd.3	Q96MM6	OTTHUMG00000031755	ENST00000254963.2:c.1173C>T	20.37:g.3730746C>T						HSPA12B_uc010zqi.1_Silent_p.F390F|HSPA12B_uc002wje.2_Silent_p.F304F|HSPA12B_uc010zqj.1_Silent_p.F225F	p.F391F	NM_052970	NP_443202	Q96MM6	HS12B_HUMAN			11	1276	+			391					D3DVX7|Q2TAK3|Q9BR52	Silent	SNP	ENST00000254963.2	37	c.1173C>T	CCDS13061.1																																																																																				0.627	HSPA12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077756.2	NM_052970		3	12	0	0	0	0.001168	0	3	12				
CRLS1	54675	broad.mit.edu	37	20	5990502	5990502	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr20:5990502G>C	ENST00000378863.4	+	2	545	c.388G>C	c.(388-390)Gaa>Caa	p.E130Q	CRLS1_ENST00000378868.4_Missense_Mutation_p.E31Q|CRLS1_ENST00000452938.1_Missense_Mutation_p.E130Q	NM_019095.4	NP_061968.1	Q9UJA2	CRLS1_HUMAN	cardiolipin synthase 1	130					cardiolipin biosynthetic process (GO:0032049)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			lung(3)|ovary(1)	4						TTTGATTATTGAAGAAGATTT	0.393																																							uc002wmn.3		NA																	0					0						c.(388-390)GAA>CAA		cardiolipin synthase 1 isoform 1							77.0	77.0	77.0					20																	5990502		2203	4300	6503	SO:0001583	missense	54675				phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphotransferase activity, for other substituted phosphate groups	g.chr20:5990502G>C	AF241784	CCDS13096.1, CCDS46578.1	20p13-p12.3	2006-04-04	2006-04-04	2006-04-04	ENSG00000088766	ENSG00000088766			16148	protein-coding gene	gene with protein product	"""GCD10 homolog (S. cerevisiae)"""	608188	"""chromosome 20 open reading frame 155"""	C20orf155		16547353	Standard	NM_019095		Approved	dJ967N21.6, CLS1, GCD10	uc002wmn.4	Q9UJA2	OTTHUMG00000031823	ENST00000378863.4:c.388G>C	20.37:g.5990502G>C	ENSP00000368140:p.Glu130Gln					CRLS1_uc010gbq.2_RNA|CRLS1_uc010gbr.2_Missense_Mutation_p.E31Q|CRLS1_uc010gbs.1_Missense_Mutation_p.E19Q	p.E130Q	NM_019095	NP_061968	Q9UJA2	CRLS1_HUMAN			2	542	+			130					D3DW09|E9PAT4|Q27RP0|Q69YQ5	Missense_Mutation	SNP	ENST00000378863.4	37	c.388G>C	CCDS13096.1	.	.	.	.	.	.	.	.	.	.	G	5.350	0.249916	0.10130	.	.	ENSG00000088766	ENST00000378863;ENST00000452938;ENST00000378868	T;T;T	0.41400	1.0;1.0;1.0	5.8	4.86	0.63082	.	0.202374	0.51477	D	0.000096	T	0.21718	0.0523	N	0.03891	-0.335	0.42793	D	0.993908	B;B;B	0.18310	0.027;0.001;0.027	B;B;B	0.28385	0.089;0.003;0.055	T	0.08513	-1.0718	10	0.10902	T	0.67	-20.4566	13.539	0.61662	0.0756:0.0:0.9244:0.0	.	130;31;130	Q6NTG3;Q9UJA2-2;Q9UJA2	.;.;CRLS1_HUMAN	Q	130;130;31	ENSP00000368140:E130Q;ENSP00000416770:E130Q;ENSP00000368145:E31Q	ENSP00000368140:E130Q	E	+	1	0	CRLS1	5938502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.519000	0.73768	1.447000	0.47661	0.650000	0.86243	GAA		0.393	CRLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077902.2	NM_019095		2	29	0	0	0	0.004672	0	2	29				
LAMP5	24141	broad.mit.edu	37	20	9496746	9496746	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr20:9496746C>A	ENST00000246070.2	+	3	829	c.337C>A	c.(337-339)Cgc>Agc	p.R113S	LAMP5_ENST00000427562.2_Intron|RP5-1119D9.4_ENST00000443469.1_RNA	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	113						cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)											CTGGGTGGATCGCGCATATGC	0.622																																							uc002wni.1		NA																	0				upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						c.(337-339)CGC>AGC		chromosome 20 open reading frame 103 precursor							44.0	44.0	44.0					20																	9496746		2203	4300	6503	SO:0001583	missense	24141					integral to membrane		g.chr20:9496746C>A	AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.337C>A	20.37:g.9496746C>A	ENSP00000246070:p.Arg113Ser					C20orf103_uc010zrc.1_Intron	p.R113S	NM_012261	NP_036393	Q9UJQ1	CT103_HUMAN	COAD - Colon adenocarcinoma(9;0.194)		3	566	+			113			Extracellular (Potential).		B4DHZ7|B7Z9Z9	Missense_Mutation	SNP	ENST00000246070.2	37	c.337C>A	CCDS13106.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.195642	0.38806	.	.	ENSG00000125869	ENST00000246070	T	0.30448	1.53	6.01	2.69	0.31865	.	0.411471	0.26442	N	0.024356	T	0.17662	0.0424	N	0.19112	0.55	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.06092	-1.0846	9	.	.	.	-5.471	10.5563	0.45118	0.396:0.5074:0.0966:0.0	.	113	Q9UJQ1	CT103_HUMAN	S	113	ENSP00000246070:R113S	.	R	+	1	0	C20orf103	9444746	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	2.290000	0.43531	0.804000	0.34136	0.655000	0.94253	CGC		0.622	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077946.2	NM_012261		7	17	1	0	3.09899e-07	0.004482	3.59154e-07	7	17				
PAK7	57144	broad.mit.edu	37	20	9546591	9546591	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr20:9546591C>T	ENST00000378429.3	-	6	1977	c.1431G>A	c.(1429-1431)gtG>gtA	p.V477V	PAK7_ENST00000353224.5_Silent_p.V477V|PAK7_ENST00000378423.1_Silent_p.V477V	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	477	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			CCATTTTCTTCACTGCAACTT	0.458																																							uc002wnl.2		NA																	0				lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23						c.(1429-1431)GTG>GTA		p21-activated kinase 7							283.0	259.0	267.0					20																	9546591		2203	4300	6503	SO:0001819	synonymous_variant	57144						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr20:9546591C>T	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1431G>A	20.37:g.9546591C>T						PAK7_uc002wnk.2_Silent_p.V477V|PAK7_uc002wnj.2_Silent_p.V477V|PAK7_uc010gby.1_Silent_p.V477V	p.V477V	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	COAD - Colon adenocarcinoma(9;0.194)		6	1976	-			477			Protein kinase.		A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Silent	SNP	ENST00000378429.3	37	c.1431G>A	CCDS13107.1																																																																																				0.458	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1			11	117	0	0	0	0.001855	0	11	117				
XRN2	22803	broad.mit.edu	37	20	21327175	21327175	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr20:21327175G>A	ENST00000377191.3	+	17	1747	c.1652G>A	c.(1651-1653)aGa>aAa	p.R551K	XRN2_ENST00000430571.2_Missense_Mutation_p.R475K|XRN2_ENST00000539513.1_Missense_Mutation_p.R497K	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	551					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						TGGGTTCTTAGATATTATTAC	0.323																																							uc002wsf.1		NA																	0				skin(1)	1						c.(1651-1653)AGA>AAA		5'-3' exoribonuclease 2							142.0	149.0	147.0					20																	21327175		2203	4300	6503	SO:0001583	missense	22803				cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding	g.chr20:21327175G>A	AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.1652G>A	20.37:g.21327175G>A	ENSP00000366396:p.Arg551Lys					XRN2_uc002wsg.1_Missense_Mutation_p.R475K|XRN2_uc010zsk.1_Missense_Mutation_p.R497K	p.R551K	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN			17	1747	+			551					Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	ENST00000377191.3	37	c.1652G>A	CCDS13144.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.274003	0.40194	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.73789	-0.78;-0.78;-0.78	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.68787	0.3039	L	0.37466	1.105	0.80722	D	1	B	0.27679	0.185	B	0.28011	0.085	T	0.62115	-0.6922	10	0.25751	T	0.34	-11.4667	20.3495	0.98807	0.0:0.0:1.0:0.0	.	551	Q9H0D6	XRN2_HUMAN	K	551;475;497	ENSP00000366396:R551K;ENSP00000413548:R475K;ENSP00000441113:R497K	ENSP00000366396:R551K	R	+	2	0	XRN2	21275175	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.444000	0.97578	2.814000	0.96858	0.591000	0.81541	AGA		0.323	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078273.2	NM_012255		15	60	0	0	0	0.007413	0	15	60				
SDC4	6385	broad.mit.edu	37	20	43959123	43959123	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr20:43959123C>T	ENST00000372733.3	-	4	367	c.328G>A	c.(328-330)Gag>Aag	p.E110K	SDC4_ENST00000537976.1_Missense_Mutation_p.E38K	NM_002999.3	NP_002990.2	P31431	SDC4_HUMAN	syndecan 4	110					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stress fiber assembly (GO:0051496)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|costamere (GO:0043034)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)	p.L106fs*35(1)	SDC4/ROS1(7)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)	5		Myeloproliferative disorder(115;0.0122)				GGGATAACCTCATTCTCCTCT	0.532			T	ROS1	NSCLC																																		uc002xnu.2		NA		Dom	yes		20	20q12	6385		syndecan 4			E					1	Deletion - Frameshift(1)		breast(1)		0						c.(328-330)GAG>AAG		syndecan 4 precursor							126.0	103.0	111.0					20																	43959123		2203	4300	6503	SO:0001583	missense	6385					extracellular region|integral to plasma membrane	cytoskeletal protein binding|thrombospondin receptor activity	g.chr20:43959123C>T	X67016, D13292	CCDS13350.1	20q12	2010-03-25	2007-02-15		ENSG00000124145	ENSG00000124145		"""Proteoglycans / Cell Surface : Syndecans"""	10661	protein-coding gene	gene with protein product	"""syndecan proteoglycan 4"""	600017	"""syndecan 4 (amphiglycan, ryudocan)"""			7916598, 1500433	Standard	NM_002999		Approved	SYND4, amphiglycan, ryudocan	uc002xnu.3	P31431	OTTHUMG00000033083	ENST00000372733.3:c.328G>A	20.37:g.43959123C>T	ENSP00000361818:p.Glu110Lys					SDC4_uc010zws.1_Missense_Mutation_p.E38K	p.E110K	NM_002999	NP_002990	P31431	SDC4_HUMAN			4	368	-		Myeloproliferative disorder(115;0.0122)	110			Extracellular (Potential).		O00773|Q16833|Q53FN9|Q6FGN3	Missense_Mutation	SNP	ENST00000372733.3	37	c.328G>A	CCDS13350.1	.	.	.	.	.	.	.	.	.	.	C	32	5.177538	0.94846	.	.	ENSG00000124145	ENST00000372733;ENST00000537976	T	0.35048	1.33	5.8	5.8	0.92144	.	0.507172	0.22435	N	0.060084	T	0.61677	0.2366	M	0.79258	2.445	0.49130	D	0.999753	D	0.89917	1.0	D	0.85130	0.997	T	0.56141	-0.8028	10	0.28530	T	0.3	-34.978	17.2064	0.86920	0.0:1.0:0.0:0.0	.	110	P31431	SDC4_HUMAN	K	110;38	ENSP00000361818:E110K	ENSP00000361818:E110K	E	-	1	0	SDC4	43392537	1.000000	0.71417	0.991000	0.47740	0.849000	0.48306	6.018000	0.70811	2.739000	0.93911	0.561000	0.74099	GAG		0.532	SDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080515.1	NM_002999		12	25	0	0	0	0.001855	0	12	25				
SLC12A5	57468	broad.mit.edu	37	20	44671916	44671916	+	Silent	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr20:44671916C>A	ENST00000454036.2	+	9	1309	c.1260C>A	c.(1258-1260)acC>acA	p.T420T	SLC12A5_ENST00000243964.3_Silent_p.T397T	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	420					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GTGATATGACCTCCTACTTCA	0.567																																							uc010zxl.1		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						c.(1258-1260)ACC>ACA		solute carrier family 12 (potassium-chloride	Bumetanide(DB00887)|Potassium Chloride(DB00761)						297.0	251.0	266.0					20																	44671916		2203	4300	6503	SO:0001819	synonymous_variant	57468				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity	g.chr20:44671916C>A	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.1260C>A	20.37:g.44671916C>A						SLC12A5_uc010zxm.1_Intron|SLC12A5_uc002xrb.2_Silent_p.T397T	p.T420T	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN			9	1336	+		Myeloproliferative disorder(115;0.0122)	420			Helical; (Potential).		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	37	c.1260C>A	CCDS46610.1																																																																																				0.567	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1			105	206	1	0	1.15969e-64	0.01441	1.57322e-64	105	206				
CXADR	1525	broad.mit.edu	37	21	18919367	18919367	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr21:18919367C>T	ENST00000284878.7	+	2	814	c.66C>T	c.(64-66)atC>atT	p.I22I	CXADR_ENST00000306618.10_Silent_p.I22I|CXADR_ENST00000356275.6_Silent_p.I22I|CXADR_ENST00000400169.1_Silent_p.I22I|CXADR_ENST00000400165.1_Silent_p.I22I|CXADR_ENST00000400166.1_Silent_p.I22I	NM_001338.4	NP_001329.1	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	22	Ig-like C2-type 1.				actin cytoskeleton reorganization (GO:0031532)|AV node cell to bundle of His cell communication (GO:0086067)|blood coagulation (GO:0007596)|cardiac muscle fiber development (GO:0048739)|cell-cell junction organization (GO:0045216)|defense response to virus (GO:0051607)|epithelial structure maintenance (GO:0010669)|gamma-delta T cell activation (GO:0046629)|germ cell migration (GO:0008354)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|homotypic cell-cell adhesion (GO:0034109)|leukocyte migration (GO:0050900)|mitochondrion organization (GO:0007005)|neutrophil chemotaxis (GO:0030593)|regulation of immune response (GO:0050776)|transepithelial transport (GO:0070633)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|adherens junction (GO:0005912)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|filopodium (GO:0030175)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|cell adhesion molecule binding (GO:0050839)|connexin binding (GO:0071253)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|virus receptor activity (GO:0001618)			endometrium(2)|large_intestine(5)|lung(1)|ovary(1)|prostate(2)	11				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		GTTTGAGTATCACTACTCCTG	0.478																																							uc002yki.2		NA																	0				ovary(1)	1						c.(64-66)ATC>ATT		coxsackie virus and adenovirus receptor							86.0	81.0	83.0					21																	18919367		2203	4300	6503	SO:0001819	synonymous_variant	1525				blood coagulation|cell adhesion|interspecies interaction between organisms|leukocyte migration|regulation of immune response	adherens junction|basolateral plasma membrane|extracellular region|integral to plasma membrane|nucleus|tight junction	receptor activity	g.chr21:18919367C>T	Y07593	CCDS33519.1, CCDS56204.1, CCDS56205.1, CCDS56206.1, CCDS56207.1	21q21.1	2013-01-29			ENSG00000154639	ENSG00000154639		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2559	protein-coding gene	gene with protein product		602621				9036860, 9096397	Standard	NM_001338		Approved	CAR	uc002yki.3	P78310	OTTHUMG00000074508	ENST00000284878.7:c.66C>T	21.37:g.18919367C>T						CXADR_uc002ykh.1_Silent_p.I22I|CXADR_uc010gld.1_Silent_p.I22I|CXADR_uc010gle.1_Silent_p.I22I|CXADR_uc002ykj.1_5'UTR	p.I22I	NM_001338	NP_001329	P78310	CXAR_HUMAN		Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)	2	184	+			22			Extracellular (Potential).|Ig-like C2-type 1.		B2R8V8|B7WPI3|D3YHP0|O00694|Q8WWT6|Q8WWT7|Q8WWT8|Q9UKV4	Silent	SNP	ENST00000284878.7	37	c.66C>T	CCDS33519.1																																																																																				0.478	CXADR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000158209.1			6	74	0	0	0	0.001984	0	6	74				
RIPPLY3	53820	broad.mit.edu	37	21	38380471	38380471	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr21:38380471G>A	ENST00000329553.2	+	2	329	c.119G>A	c.(118-120)cGa>cAa	p.R40Q	RIPPLY3_ENST00000485272.1_3'UTR	NM_018962.2	NP_061835.1	P57055	DSCR6_HUMAN	ripply transcriptional repressor 3	40					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pharyngeal system development (GO:0060037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											GCGCCGTGGCGACCTTGGATC	0.577																																						Colon(134;194 1731 2725 51652 51982)	uc002yvv.2		NA																	0				breast(1)	1						c.(118-120)CGA>CAA		Down syndrome critical region protein 6							51.0	50.0	50.0					21																	38380471		2203	4300	6503	SO:0001583	missense	53820					nucleus		g.chr21:38380471G>A	AB037158	CCDS13648.1	21q22.2	2013-07-23	2013-07-23	2013-06-04	ENSG00000183145	ENSG00000183145			3047	protein-coding gene	gene with protein product		609892	"""Down syndrome critical region gene 6"", ""ripply3 homolog (zebrafish)"""	DSCR6		10814524, 22354841	Standard	NM_018962		Approved			P57055	OTTHUMG00000086639	ENST00000329553.2:c.119G>A	21.37:g.38380471G>A	ENSP00000331734:p.Arg40Gln					DSCR6_uc011aec.1_5'UTR|DSCR6_uc010gnd.2_5'UTR	p.R40Q	NM_018962	NP_061835	P57055	DSCR6_HUMAN			2	329	+		Myeloproliferative disorder(46;0.0632)	40			WRPW motif.			Missense_Mutation	SNP	ENST00000329553.2	37	c.119G>A	CCDS13648.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214403	0.58452	.	.	ENSG00000183145	ENST00000329553	.	.	.	4.6	4.6	0.57074	.	0.000000	0.64402	D	0.000004	T	0.79644	0.4481	M	0.82193	2.58	0.44142	D	0.996939	D	0.89917	1.0	D	0.87578	0.998	T	0.82663	-0.0346	9	0.87932	D	0	-18.2775	13.6581	0.62349	0.0:0.0:1.0:0.0	.	40	P57055	DSCR6_HUMAN	Q	40	.	ENSP00000331734:R40Q	R	+	2	0	DSCR6	37302341	1.000000	0.71417	1.000000	0.80357	0.048000	0.14542	4.211000	0.58507	2.513000	0.84729	0.561000	0.74099	CGA		0.577	RIPPLY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194703.1			5	41	0	0	0	0.001168	0	5	41				
UMODL1	89766	broad.mit.edu	37	21	43529807	43529807	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr21:43529807A>T	ENST00000408910.2	+	10	1655	c.1655A>T	c.(1654-1656)gAg>gTg	p.E552V	C21orf128_ENST00000329015.2_5'Flank|UMODL1_ENST00000400424.2_Missense_Mutation_p.E480V|UMODL1_ENST00000408989.2_Missense_Mutation_p.E552V|UMODL1_ENST00000400427.1_Missense_Mutation_p.E480V	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	552	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CGGGCCTGTGAGGGTACGTGT	0.677																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	uc002zaf.1		NA																	0				ovary(2)|skin(1)	3						c.(1654-1656)GAG>GTG		uromodulin-like 1 isoform 1 precursor							26.0	32.0	30.0					21																	43529807		1966	4122	6088	SO:0001583	missense	89766					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity	g.chr21:43529807A>T		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1655A>T	21.37:g.43529807A>T	ENSP00000386147:p.Glu552Val					UMODL1_uc002zad.1_Missense_Mutation_p.E480V|UMODL1_uc002zae.1_Missense_Mutation_p.E480V|UMODL1_uc002zag.1_Missense_Mutation_p.E552V|C21orf128_uc002zak.2_5'Flank	p.E552V	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN			10	1655	+			552			EGF-like 2; calcium-binding (Potential).|Extracellular (Potential).		C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	c.1655A>T	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	A	8.496	0.863227	0.17250	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.74315	-0.82;-0.82;-0.83;-0.82	3.23	0.817	0.18773	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.355194	0.19514	N	0.112442	T	0.59155	0.2173	N	0.20610	0.595	0.09310	N	0.999998	P;B	0.40638	0.725;0.413	P;B	0.45794	0.493;0.254	T	0.50448	-0.8827	10	0.42905	T	0.14	-5.6022	3.8232	0.08843	0.5572:0.2256:0.0:0.2173	.	552;552	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	V	480;480;552;552	ENSP00000383279:E480V;ENSP00000383276:E480V;ENSP00000386126:E552V;ENSP00000386147:E552V	ENSP00000383276:E480V	E	+	2	0	UMODL1	42402876	0.258000	0.24033	0.072000	0.20136	0.026000	0.11368	0.676000	0.25247	0.163000	0.19507	0.533000	0.62120	GAG		0.677	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2			15	23	0	0	0	0.007413	0	15	23				
U2AF1	7307	broad.mit.edu	37	21	44524456	44524456	+	Missense_Mutation	SNP	G	G	A	rs371769427		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr21:44524456G>A	ENST00000291552.4	-	2	193	c.101C>T	c.(100-102)tCt>tTt	p.S34F	U2AF1_ENST00000398137.1_5'UTR|U2AF1_ENST00000459639.1_5'UTR|U2AF1_ENST00000486519.1_5'UTR|U2AF1_ENST00000380276.2_Missense_Mutation_p.S34F	NM_006758.2	NP_006749.1	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxiliary factor 1	34					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S34F(45)|p.S34Y(12)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(111)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	126						GTGCAACCGAGAGCACCTGTC	0.358			Mis		"""CLL, MDS"""																																		uc002zda.1		NA		Dom	yes		21	21q22.3	7307		U2 small nuclear RNA auxiliary factor 1			L					57	Substitution - Missense(57)		haematopoietic_and_lymphoid_tissue(43)|lung(12)|endometrium(2)		0						c.(100-102)TCT>TTT		U2 small nuclear RNA auxillary factor 1 isoform		G	PHE/SER,PHE/SER,	1,4405		0,1,2202	67.0	64.0	65.0		101,101,	5.5	1.0	21		65	0,8600		0,0,4300	no	missense,missense,utr-5	U2AF1	NM_001025203.1,NM_006758.2,NM_001025204.1	155,155,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,	34/241,34/241,	44524456	1,13005	2203	4300	6503	SO:0001583	missense	7307				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	Cajal body|catalytic step 2 spliceosome|nuclear speck	nucleotide binding|RNA binding|zinc ion binding	g.chr21:44524456G>A	BC001177	CCDS13694.1, CCDS33574.1, CCDS42948.1	21q22.3	2014-09-17	2006-04-11		ENSG00000160201	ENSG00000160201		"""RNA binding motif (RRM) containing"""	12453	protein-coding gene	gene with protein product		191317	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein"", ""U2(RNU2) small nuclear RNA auxiliary factor 1"""	U2AFBP		8660980, 7956352	Standard	NM_006758		Approved	U2AF35, RNU2AF1, RN	uc002zdb.1	Q01081	OTTHUMG00000086836	ENST00000291552.4:c.101C>T	21.37:g.44524456G>A	ENSP00000291552:p.Ser34Phe					U2AF1_uc002zcy.1_5'UTR|U2AF1_uc002zcz.1_5'UTR|U2AF1_uc002zdb.1_Missense_Mutation_p.S34F|U2AF1_uc010gpi.1_Missense_Mutation_p.S34F|U2AF1_uc002zdc.1_Missense_Mutation_p.S34F	p.S34F	NM_001025203	NP_001020374	Q01081	U2AF1_HUMAN			2	185	-			34			C3H1-type 1.		Q701P4|Q71RF1	Missense_Mutation	SNP	ENST00000291552.4	37	c.101C>T	CCDS13694.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025187	0.93518	2.27E-4	0.0	ENSG00000160201	ENST00000380276;ENST00000291552	T;T	0.46063	0.88;0.88	5.47	5.47	0.80525	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.77239	0.4101	H	0.96430	3.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.997	D	0.84864	0.0821	10	0.87932	D	0	-15.7954	19.3169	0.94218	0.0:0.0:1.0:0.0	.	34;34;34	Q69YM7;Q01081;Q701P4	.;U2AF1_HUMAN;.	F	34	ENSP00000369629:S34F;ENSP00000291552:S34F	ENSP00000291552:S34F	S	-	2	0	U2AF1	43397525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.864000	0.92294	2.560000	0.86352	0.563000	0.77884	TCT		0.358	U2AF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195541.1	NM_006758		7	29	0	0	0	0.001984	0	7	29				
CRYAA	1409	broad.mit.edu	37	21	44589361	44589361	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr21:44589361C>T	ENST00000291554.2	+	1	244	c.152C>T	c.(151-153)tCc>tTc	p.S51F	CRYAA_ENST00000398132.1_5'Flank|CRYAA_ENST00000398133.1_5'Flank|CRYAA_ENST00000482775.1_3'UTR	NM_000394.2	NP_000385.1	P02489	CRYAA_HUMAN	crystallin, alpha A	51					negative regulation of apoptotic process (GO:0043066)|negative regulation of intracellular transport (GO:0032387)|protein homooligomerization (GO:0051260)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural constituent of eye lens (GO:0005212)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						TACCGCCAGTCCCTCTTCCGC	0.632																																							uc002zdd.1		NA																	0				breast(1)|central_nervous_system(1)	2						c.(151-153)TCC>TTC		crystallin, alpha A							138.0	128.0	131.0					21																	44589361		2203	4300	6503	SO:0001583	missense	1409				anti-apoptosis|negative regulation of intracellular transport|protein homooligomerization|response to heat|visual perception	cytoplasm|nucleus	structural constituent of eye lens|unfolded protein binding	g.chr21:44589361C>T		CCDS13695.1	21q22.3	2011-09-05			ENSG00000160202	ENSG00000160202		"""Heat shock proteins / HSPB"""	2388	protein-coding gene	gene with protein product		123580		CRYA1			Standard	XM_005261093		Approved	HSPB4	uc002zdd.1	P02489	OTTHUMG00000086842	ENST00000291554.2:c.152C>T	21.37:g.44589361C>T	ENSP00000291554:p.Ser51Phe						p.S51F	NM_000394	NP_000385	P02489	CRYAA_HUMAN			1	221	+			51					Q53X53	Missense_Mutation	SNP	ENST00000291554.2	37	c.152C>T	CCDS13695.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392223	0.83011	.	.	ENSG00000160202	ENST00000291554	D	0.84873	-1.91	4.88	4.88	0.63580	Alpha-crystallin, N-terminal (1);HSP20-like chaperone (1);	0.000000	0.85682	D	0.000000	D	0.90259	0.6954	M	0.85542	2.76	0.80722	D	1	B	0.32939	0.391	P	0.48921	0.595	D	0.87048	0.2145	10	0.10111	T	0.7	-38.1633	16.1827	0.81921	0.0:1.0:0.0:0.0	.	51	P02489	CRYAA_HUMAN	F	51	ENSP00000291554:S51F	ENSP00000291554:S51F	S	+	2	0	CRYAA	43462430	0.984000	0.35163	1.000000	0.80357	0.997000	0.91878	2.383000	0.44354	2.256000	0.74724	0.609000	0.83330	TCC		0.632	CRYAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195562.1			9	177	0	0	0	0.001855	0	9	177				
PCNT	5116	broad.mit.edu	37	21	47754527	47754527	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr21:47754527A>G	ENST00000359568.5	+	3	591	c.484A>G	c.(484-486)Agt>Ggt	p.S162G	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	162					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GTTCACAGTCAGTGACCACCC	0.552																																							uc002zji.3		NA																	0				ovary(4)|breast(2)|pancreas(2)	8						c.(484-486)AGT>GGT		pericentrin							206.0	129.0	155.0					21																	47754527		2203	4300	6503	SO:0001583	missense	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47754527A>G	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.484A>G	21.37:g.47754527A>G	ENSP00000352572:p.Ser162Gly					PCNT_uc002zjj.2_Missense_Mutation_p.S44G|PCNT_uc010gqk.1_RNA	p.S162G	NM_006031	NP_006022	O95613	PCNT_HUMAN			3	591	+	Breast(49;0.112)		162					O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	c.484A>G	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	a	0.030	-1.341863	0.01277	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.01705	4.68	0.235	0.235	0.15431	.	.	.	.	.	T	0.02767	0.0083	L	0.36672	1.1	0.09310	N	1	P;P	0.46395	0.877;0.805	P;P	0.51866	0.682;0.483	T	0.50215	-0.8854	8	0.25751	T	0.34	.	.	.	.	.	44;162	O95613-2;O95613	.;PCNT_HUMAN	G	162;149	ENSP00000352572:S162G	ENSP00000338675:S149G	S	+	1	0	PCNT	46578955	0.036000	0.19791	0.005000	0.12908	0.005000	0.04900	1.077000	0.30741	0.263000	0.21812	0.260000	0.18958	AGT		0.552	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		3	95	0	0	0	0.000602	0	3	95				
GNAZ	2781	broad.mit.edu	37	22	23438057	23438057	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr22:23438057G>T	ENST00000248996.4	+	2	841	c.175G>T	c.(175-177)Ggc>Tgc	p.G59C	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	59					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)	p.G59C(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		CATCCACAGCGGCGGCTTCAA	0.602																																							uc002zwu.1		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)|skin(1)	2						c.(175-177)GGC>TGC		guanine nucleotide binding protein, alpha z							137.0	141.0	140.0					22																	23438057		2203	4300	6503	SO:0001583	missense	2781					endoplasmic reticulum|heterotrimeric G-protein complex|nuclear envelope	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|metabotropic serotonin receptor binding|receptor signaling protein activity	g.chr22:23438057G>T		CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.175G>T	22.37:g.23438057G>T	ENSP00000248996:p.Gly59Cys					RTDR1_uc002zwt.2_Intron	p.G59C	NM_002073	NP_002064	P19086	GNAZ_HUMAN		READ - Rectum adenocarcinoma(21;0.166)	2	712	+	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)		59					B2R6C1|Q4QRJ6	Missense_Mutation	SNP	ENST00000248996.4	37	c.175G>T	CCDS13804.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.176615	0.38413	.	.	ENSG00000128266	ENST00000248996;ENST00000456059	D	0.89196	-2.48	4.95	2.87	0.33458	G protein alpha subunit, helical insertion (1);	0.000000	0.85682	D	0.000000	D	0.84759	0.5543	L	0.56280	1.765	0.58432	D	0.999995	P	0.48834	0.916	B	0.40602	0.334	D	0.83462	0.0054	10	0.72032	D	0.01	.	10.4464	0.44497	0.1583:0.0:0.8417:0.0	.	59	P19086	GNAZ_HUMAN	C	59;7	ENSP00000248996:G59C	ENSP00000248996:G59C	G	+	1	0	GNAZ	21768057	1.000000	0.71417	0.068000	0.19968	0.098000	0.18820	9.570000	0.98174	0.618000	0.30179	-0.136000	0.14681	GGC		0.602	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319073.1	NM_002073		15	124	1	0	7.07596e-05	0.006122	7.81257e-05	15	124				
AP1B1	162	broad.mit.edu	37	22	29726395	29726395	+	Missense_Mutation	SNP	C	C	T	rs142354304	byFrequency	TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr22:29726395C>T	ENST00000405198.1	-	20	2769	c.2738G>A	c.(2737-2739)cGg>cAg	p.R913Q	AP1B1_ENST00000357586.2_Missense_Mutation_p.R913Q|AP1B1_ENST00000402502.1_Missense_Mutation_p.R906Q|AP1B1_ENST00000472057.1_5'Flank|SNORD125_ENST00000459538.1_RNA|AP1B1_ENST00000432560.2_Missense_Mutation_p.R906Q|AP1B1_ENST00000356015.2_Missense_Mutation_p.R906Q|AP1B1_ENST00000415447.1_Missense_Mutation_p.R906Q|AP1B1_ENST00000317368.7_Missense_Mutation_p.R886Q			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	913					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CGGCTGGATCCGCAGCTCCGC	0.667													C|||	6	0.00119808	0.0008	0.0	5008	,	,		14727	0.0		0.005	False		,,,				2504	0.0						uc003afj.2		NA																	0				ovary(1)|skin(1)	2						c.(2737-2739)CGG>CAG		adaptor-related protein complex 1 beta 1 subunit		C	GLN/ARG,GLN/ARG,GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	48.0	47.0	47.0		2738,2657,2717	4.4	1.0	22	dbSNP_134	47	16,8584	11.9+/-42.8	0,16,4284	yes	missense,missense,missense	AP1B1	NM_001127.3,NM_001166019.1,NM_145730.2	43,43,43	0,18,6485	TT,TC,CC		0.186,0.0454,0.1384	possibly-damaging,possibly-damaging,possibly-damaging	913/950,886/920,906/940	29726395	18,12988	2203	4300	6503	SO:0001583	missense	162				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity	g.chr22:29726395C>T	L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.2738G>A	22.37:g.29726395C>T	ENSP00000384194:p.Arg913Gln					AP1B1_uc003afi.2_Missense_Mutation_p.R906Q|AP1B1_uc003afk.2_Missense_Mutation_p.R906Q|AP1B1_uc003afl.2_Missense_Mutation_p.R886Q|AP1B1_uc003afh.2_Missense_Mutation_p.R110Q|AP1B1_uc011ako.1_Missense_Mutation_p.R466Q	p.R913Q	NM_001127	NP_001118	Q10567	AP1B1_HUMAN			21	2922	-			913					C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	ENST00000405198.1	37	c.2738G>A	CCDS13855.1	3	0.0013736263736263737	1	0.0020325203252032522	0	0.0	0	0.0	2	0.002638522427440633	C	14.09	2.432838	0.43224	4.54E-4	0.00186	ENSG00000100280	ENST00000357586;ENST00000356015;ENST00000432560;ENST00000405198;ENST00000317368;ENST00000402502;ENST00000415447	T;T;T;T;T;T;T	0.22539	1.96;1.96;1.96;1.96;1.95;1.96;1.96	5.41	4.39	0.52855	Coatomer/calthrin adaptor appendage, C-terminal subdomain (1);Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.050472	0.85682	D	0.000000	T	0.30479	0.0766	L	0.47716	1.5	0.54753	D	0.999984	P;P;P;D;P;D	0.54601	0.914;0.561;0.742;0.96;0.742;0.967	B;B;B;B;B;P	0.53401	0.165;0.09;0.09;0.294;0.131;0.725	T	0.02398	-1.1165	10	0.48119	T	0.1	-20.267	13.7543	0.62926	0.0:0.9251:0.0:0.0749	.	466;886;906;913;906;110	B4DS79;F8WDL0;Q10567-2;Q10567;Q10567-3;Q7Z3M8	.;.;.;AP1B1_HUMAN;.;.	Q	913;906;906;913;886;906;906	ENSP00000350199:R913Q;ENSP00000348297:R906Q;ENSP00000400065:R906Q;ENSP00000384194:R913Q;ENSP00000319361:R886Q;ENSP00000386071:R906Q;ENSP00000387612:R906Q	ENSP00000319361:R886Q	R	-	2	0	AP1B1	28056395	1.000000	0.71417	0.990000	0.47175	0.144000	0.21451	6.061000	0.71148	1.291000	0.44653	-0.251000	0.11542	CGG		0.667	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127		5	36	0	0	0	0.001168	0	5	36				
SLC5A4	6527	broad.mit.edu	37	22	32647853	32647853	+	Silent	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr22:32647853G>T	ENST00000266086.4	-	3	227	c.216C>A	c.(214-216)gcC>gcA	p.A72A	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	72					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CAAAGAGAGAGGCGCCCATCT	0.502																																							uc003ami.2		NA																	0					0						c.(214-216)GCC>GCA		solute carrier family 5 (low affinity glucose							85.0	85.0	85.0					22																	32647853		2203	4300	6503	SO:0001819	synonymous_variant	6527				carbohydrate transport|sodium ion transport	integral to membrane	symporter activity	g.chr22:32647853G>T	U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.216C>A	22.37:g.32647853G>T							p.A72A	NM_014227	NP_055042	Q9NY91	SC5A4_HUMAN			3	218	-			72			Helical; (Potential).		O15279	Silent	SNP	ENST00000266086.4	37	c.216C>A	CCDS13903.1																																																																																				0.502	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315724.1	NM_014227		27	21	1	0	1.06801e-11	0.009535	1.31159e-11	27	21				
LARGE	9215	broad.mit.edu	37	22	33960945	33960945	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr22:33960945C>A	ENST00000354992.2	-	7	1247	c.676G>T	c.(676-678)Gtc>Ttc	p.V226F	LARGE_ENST00000452586.2_Missense_Mutation_p.V25F|LARGE_ENST00000437602.2_Missense_Mutation_p.V226F|LARGE_ENST00000397394.2_Missense_Mutation_p.V226F|LARGE_ENST00000337431.2_Missense_Mutation_p.V226F|LARGE_ENST00000402320.1_Missense_Mutation_p.V226F	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	226					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				TTGGTCAGGACAAGCTTCATC	0.483																																					Colon(70;397 1175 4573 19089 45288)	Colon(70;397 1175 4573 19089 45288)	uc003and.3		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(676-678)GTC>TTC		like-glycosyltransferase							113.0	103.0	106.0					22																	33960945		2203	4300	6503	SO:0001583	missense	9215				glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity	g.chr22:33960945C>A	AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.676G>T	22.37:g.33960945C>A	ENSP00000347088:p.Val226Phe					LARGE_uc011amd.1_Missense_Mutation_p.V25F|LARGE_uc003ane.3_Missense_Mutation_p.V226F|LARGE_uc010gwp.2_Missense_Mutation_p.V226F|LARGE_uc011ame.1_Missense_Mutation_p.V158F|LARGE_uc011amf.1_Missense_Mutation_p.V226F|LARGE_uc010gwq.1_RNA	p.V226F	NM_004737	NP_004728	O95461	LARGE_HUMAN			7	1255	-		Lung NSC(1;0.219)	226			Lumenal (Potential).		B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	ENST00000354992.2	37	c.676G>T	CCDS13912.1	.	.	.	.	.	.	.	.	.	.	C	31	5.093298	0.94149	.	.	ENSG00000133424	ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000452586;ENST00000437602;ENST00000421768	T;T;T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18;2.18;2.18	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.28830	0.0715	L	0.33710	1.025	0.80722	D	1	P;B;P;B	0.47034	0.542;0.111;0.889;0.372	B;B;P;B	0.51135	0.388;0.067;0.66;0.309	T	0.00335	-1.1808	10	0.23302	T	0.38	-0.102	20.4581	0.99154	0.0:1.0:0.0:0.0	.	226;25;226;226	B7Z2I9;E9PH73;O95461-2;O95461	.;.;.;LARGE_HUMAN	F	226;226;226;226;25;226;25	ENSP00000347088:V226F;ENSP00000336636:V226F;ENSP00000380549:V226F;ENSP00000385223:V226F;ENSP00000407917:V25F;ENSP00000388544:V226F;ENSP00000403841:V25F	ENSP00000336636:V226F	V	-	1	0	LARGE	32290945	1.000000	0.71417	0.985000	0.45067	0.976000	0.68499	5.691000	0.68249	2.835000	0.97688	0.650000	0.86243	GTC		0.483	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320515.2	NM_133642		22	42	1	0	1.87028e-06	0.012319	2.14623e-06	22	42				
C3orf20	84077	broad.mit.edu	37	3	14768449	14768449	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:14768449G>C	ENST00000253697.3	+	11	2060	c.1608G>C	c.(1606-1608)aaG>aaC	p.K536N	C3orf20_ENST00000435614.1_Missense_Mutation_p.K414N|C3orf20_ENST00000412910.1_Missense_Mutation_p.K414N	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	536						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						AGGTGTATAAGATGAGCCGAG	0.537																																							uc003byy.2		NA																	0				ovary(3)|skin(1)	4						c.(1606-1608)AAG>AAC		hypothetical protein LOC84077							114.0	102.0	106.0					3																	14768449		2203	4300	6503	SO:0001583	missense	84077					cytoplasm|integral to membrane		g.chr3:14768449G>C	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.1608G>C	3.37:g.14768449G>C	ENSP00000253697:p.Lys536Asn					C3orf20_uc003byz.2_Missense_Mutation_p.K414N|C3orf20_uc003bza.2_Missense_Mutation_p.K414N|C3orf20_uc003bzb.1_Missense_Mutation_p.K37N	p.K536N	NM_032137	NP_115513	Q8ND61	CC020_HUMAN			11	2012	+			536					Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	c.1608G>C	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793726	0.50102	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.18338	2.22;2.22;2.22	5.05	5.05	0.67936	.	0.126120	0.36234	N	0.002717	T	0.37433	0.1003	M	0.68317	2.08	0.22719	N	0.998814	D;D	0.67145	0.996;0.996	P;D	0.65323	0.801;0.934	T	0.12941	-1.0528	10	0.72032	D	0.01	-21.8559	13.7528	0.62917	0.0:0.0:1.0:0.0	.	414;536	Q8ND61-2;Q8ND61	.;CC020_HUMAN	N	536;414;414	ENSP00000253697:K536N;ENSP00000402933:K414N;ENSP00000396081:K414N	ENSP00000253697:K536N	K	+	3	2	C3orf20	14743453	1.000000	0.71417	0.077000	0.20336	0.299000	0.27559	2.073000	0.41519	2.632000	0.89209	0.491000	0.48974	AAG		0.537	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137		5	45	0	0	0	0.000602	0	5	45				
TRIM71	131405	broad.mit.edu	37	3	32932777	32932777	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:32932777G>A	ENST00000383763.5	+	4	2144	c.2081G>A	c.(2080-2082)gGa>gAa	p.G694E		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	694					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGTGAGAAAGGAACCAAGAAT	0.537																																							uc003cff.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(2080-2082)GGA>GAA		tripartite motif-containing 71							52.0	58.0	56.0					3																	32932777		2097	4211	6308	SO:0001583	missense	131405				multicellular organismal development	cytoplasm	zinc ion binding	g.chr3:32932777G>A		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.2081G>A	3.37:g.32932777G>A	ENSP00000373272:p.Gly694Glu						p.G694E	NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN			4	2144	+			694			NHL 3.			Missense_Mutation	SNP	ENST00000383763.5	37	c.2081G>A	CCDS43060.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.974605	0.74360	.	.	ENSG00000206557	ENST00000383763	D	0.91577	-2.87	5.74	5.74	0.90152	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.96744	0.8937	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97371	0.9976	10	0.87932	D	0	-5.353	18.4614	0.90739	0.0:0.0:1.0:0.0	.	694	Q2Q1W2	LIN41_HUMAN	E	694	ENSP00000373272:G694E	ENSP00000373272:G694E	G	+	2	0	TRIM71	32907781	1.000000	0.71417	0.925000	0.36789	0.990000	0.78478	9.866000	0.99616	2.713000	0.92767	0.655000	0.94253	GGA		0.537	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111		4	20	0	0	0	0.000602	0	4	20				
SCN5A	6331	broad.mit.edu	37	3	38595897	38595897	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:38595897C>T	ENST00000333535.4	-	27	4835	c.4686G>A	c.(4684-4686)aaG>aaA	p.K1562K	SCN5A_ENST00000450102.2_Silent_p.K1508K|SCN5A_ENST00000423572.2_Silent_p.K1561K|SCN5A_ENST00000451551.2_Silent_p.K1508K|SCN5A_ENST00000443581.1_Silent_p.K1561K|SCN5A_ENST00000464652.1_5'UTR|SCN5A_ENST00000425664.1_Silent_p.K1544K|SCN5A_ENST00000414099.2_Silent_p.K1544K|SCN5A_ENST00000449557.2_Silent_p.K1508K|SCN5A_ENST00000455624.2_Silent_p.K1561K|SCN5A_ENST00000413689.1_Silent_p.K1562K			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1562					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GCAGGTTGATCTTGGCCAAGA	0.478																																							uc003cio.2		NA																	0				ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9						c.(4684-4686)AAG>AAA		voltage-gated sodium channel type V alpha	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)						172.0	184.0	180.0					3																	38595897		2107	4259	6366	SO:0001819	synonymous_variant	6331				blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity	g.chr3:38595897C>T	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.4686G>A	3.37:g.38595897C>T						SCN5A_uc003cin.2_Silent_p.K1561K|SCN5A_uc003cil.3_Silent_p.K1562K|SCN5A_uc010hhi.2_Silent_p.K1544K|SCN5A_uc010hhk.2_Silent_p.K1561K|SCN5A_uc011ayr.1_Silent_p.K1508K	p.K1562K	NM_198056	NP_932173	Q14524	SCN5A_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	27	4880	-	Medulloblastoma(35;0.163)		1562			Helical; Name=S2 of repeat IV; (Potential).		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	ENST00000333535.4	37	c.4686G>A	CCDS46796.1																																																																																				0.478	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056		9	86	0	0	0	0.010729	0	9	86				
LZTFL1	54585	broad.mit.edu	37	3	45868857	45868857	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:45868857C>G	ENST00000296135.6	-	9	1046	c.872G>C	c.(871-873)aGa>aCa	p.R291T	LZTFL1_ENST00000536047.1_Missense_Mutation_p.R274T|LZTFL1_ENST00000539217.1_Intron	NM_001276378.1|NM_020347.2	NP_001263307.1|NP_065080.1	Q9NQ48	LZTL1_HUMAN	leucine zipper transcription factor-like 1	291	Interaction with BSS9.				establishment of protein localization to organelle (GO:0072594)	BBSome (GO:0034464)|cytoplasm (GO:0005737)	identical protein binding (GO:0042802)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	8				BRCA - Breast invasive adenocarcinoma(193;0.00867)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		CTGTGCCAGTCTTTTCCTCAG	0.403																																							uc003cox.1		NA																	0					0						c.(871-873)AGA>ACA		leucine zipper transcription factor-like 1							292.0	266.0	275.0					3																	45868857		2202	4300	6502	SO:0001583	missense	54585							g.chr3:45868857C>G	AJ297351	CCDS2731.1, CCDS63608.1, CCDS63609.1	3p21.3	2014-01-28			ENSG00000163818	ENSG00000163818			6741	protein-coding gene	gene with protein product		606568				11352561, 22510444	Standard	NM_020347		Approved	BBS17	uc003cox.2	Q9NQ48	OTTHUMG00000133452	ENST00000296135.6:c.872G>C	3.37:g.45868857C>G	ENSP00000296135:p.Arg291Thr					LZTFL1_uc003coy.1_Missense_Mutation_p.R274T|LZTFL1_uc011bak.1_Intron	p.R291T	NM_020347	NP_065080	Q9NQ48	LZTL1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00867)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)	9	1010	-			291			Potential.		B3KSI9|B4E0K7|Q8TC61|Q9NQ56	Missense_Mutation	SNP	ENST00000296135.6	37	c.872G>C	CCDS2731.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.24|17.24	3.339894|3.339894	0.60963|0.60963	.|.	.|.	ENSG00000163818|ENSG00000163818	ENST00000440576|ENST00000296135;ENST00000536047	T|T;T	0.24908|0.25579	1.83|1.79;1.79	5.49|5.49	3.52|3.52	0.40303|0.40303	.|.	.|0.139348	.|0.64402	.|D	.|0.000006	T|T	0.33089|0.33089	0.0851|0.0851	M|M	0.77616|0.77616	2.38|2.38	0.80722|0.80722	D|D	1|1	.|B	.|0.29037	.|0.231	.|B	.|0.34873	.|0.191	T|T	0.12785|0.12785	-1.0534|-1.0534	7|10	0.40728|0.72032	T|D	0.16|0.01	-8.1043|-8.1043	9.9666|9.9666	0.41727|0.41727	0.0:0.7669:0.0:0.2331|0.0:0.7669:0.0:0.2331	.|.	.|291	.|Q9NQ48	.|LZTL1_HUMAN	N|T	226|291;274	ENSP00000416083:K226N|ENSP00000296135:R291T;ENSP00000439522:R274T	ENSP00000416083:K226N|ENSP00000296135:R291T	K|R	-|-	3|2	2|0	LZTFL1|LZTFL1	45843861|45843861	0.999000|0.999000	0.42202|0.42202	0.997000|0.997000	0.53966|0.53966	0.813000|0.813000	0.45954|0.45954	0.853000|0.853000	0.27777|0.27777	0.565000|0.565000	0.29255|0.29255	0.563000|0.563000	0.77884|0.77884	AAG|AGA		0.403	LZTFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257326.3	NM_020347		5	45	0	0	0	0.000602	0	5	45				
MAP4	4134	broad.mit.edu	37	3	47958144	47958144	+	Silent	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:47958144A>G	ENST00000360240.6	-	7	1691	c.1173T>C	c.(1171-1173)gcT>gcC	p.A391A	MAP4_ENST00000395734.3_Silent_p.A391A|MAP4_ENST00000383737.4_Intron|MAP4_ENST00000426837.2_Silent_p.A408A	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	391	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.A391A(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	CCTTGGAAGGAGCCAAGTCCA	0.443																																							uc003csb.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(1171-1173)GCT>GCC		microtubule-associated protein 4 isoform 1							148.0	145.0	146.0					3																	47958144		2203	4300	6503	SO:0001819	synonymous_variant	4134				negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr3:47958144A>G		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1173T>C	3.37:g.47958144A>G						MAP4_uc003csc.3_Silent_p.A391A|MAP4_uc011bbf.1_Silent_p.A368A|MAP4_uc003csf.3_Silent_p.A408A	p.A391A	NM_002375	NP_002366	P27816	MAP4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	7	1699	-			391			17 X 14 AA tandem repeats.|26 residues 2.		Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Silent	SNP	ENST00000360240.6	37	c.1173T>C	CCDS33750.1																																																																																				0.443	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375		3	85	0	0	0	0.004672	0	3	85				
MAP4	4134	broad.mit.edu	37	3	47958147	47958147	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:47958147C>T	ENST00000360240.6	-	7	1688	c.1170G>A	c.(1168-1170)ttG>ttA	p.L390L	MAP4_ENST00000395734.3_Silent_p.L390L|MAP4_ENST00000383737.4_Intron|MAP4_ENST00000426837.2_Silent_p.L407L	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	390	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.L390L(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TGGAAGGAGCCAAGTCCATTT	0.448																																							uc003csb.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(1168-1170)TTG>TTA		microtubule-associated protein 4 isoform 1							148.0	146.0	146.0					3																	47958147		2203	4300	6503	SO:0001819	synonymous_variant	4134				negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr3:47958147C>T		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1170G>A	3.37:g.47958147C>T						MAP4_uc003csc.3_Silent_p.L390L|MAP4_uc011bbf.1_Silent_p.L367L|MAP4_uc003csf.3_Silent_p.L407L	p.L390L	NM_002375	NP_002366	P27816	MAP4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	7	1696	-			390			17 X 14 AA tandem repeats.|26 residues 2.		Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Silent	SNP	ENST00000360240.6	37	c.1170G>A	CCDS33750.1																																																																																				0.448	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375		3	86	0	0	0	0.004672	0	3	86				
RHOA	387	broad.mit.edu	37	3	49395018	49395018	+	IGR	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:49395018C>T	ENST00000418115.1	-	0	2031				GPX1_ENST00000496791.1_5'Flank|GPX1_ENST00000419783.1_Missense_Mutation_p.D139N|GPX1_ENST00000419349.1_3'UTR	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GCGGTGGCGTCGTCGCTGGGA	0.632																																							uc011bcl.1		NA																	0				large_intestine(1)	1						c.(415-417)GAC>AAC		glutathione peroxidase 1 isoform 1	Glutathione(DB00143)						43.0	50.0	48.0					3																	49395018		2070	4181	6251	SO:0001628	intergenic_variant	2876				anti-apoptosis|cell redox homeostasis|glutathione metabolic process|heart contraction|hydrogen peroxide catabolic process|negative regulation of caspase activity|purine base metabolic process|purine nucleotide catabolic process|regulation of gene expression, epigenetic|regulation of mammary gland epithelial cell proliferation|regulation of proteasomal protein catabolic process|release of cytochrome c from mitochondria|response to selenium ion|UV protection	cytosol|mitochondrion	endopeptidase inhibitor activity|glutathione peroxidase activity|SH3 domain binding	g.chr3:49395018C>T	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395018C>T						GPX1_uc011bcm.1_3'UTR	p.D139N	NM_000581	NP_000572	P07203	GPX1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	3	495	-			139					P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	37	c.415G>A	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.780852	0.90195	.	.	ENSG00000233276	ENST00000419783	T	0.03860	3.78	5.18	5.18	0.71444	Thioredoxin-like fold (2);	0.110322	0.64402	D	0.000016	T	0.08802	0.0218	L	0.61387	1.9	0.80722	D	1	B	0.31817	0.341	B	0.31547	0.132	T	0.08086	-1.0739	10	0.45353	T	0.12	.	17.2747	0.87112	0.0:1.0:0.0:0.0	.	139	P07203	GPX1_HUMAN	N	139	ENSP00000407375:D139N	ENSP00000407375:D139N	D	-	1	0	GPX1	49370022	1.000000	0.71417	0.992000	0.48379	0.853000	0.48598	4.889000	0.63171	2.414000	0.81942	0.561000	0.74099	GAC		0.632	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664		11	22	0	0	0	0.003163	0	11	22				
NPRL2	10641	broad.mit.edu	37	3	50385968	50385968	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:50385968G>C	ENST00000232501.3	-	7	1148	c.710C>G	c.(709-711)tCc>tGc	p.S237C	NPRL2_ENST00000493465.1_5'UTR|ZMYND10-AS1_ENST00000440013.1_RNA|CYB561D2_ENST00000424512.1_5'Flank|CYB561D2_ENST00000232508.5_5'Flank|CYB561D2_ENST00000425346.1_5'Flank|ZMYND10_ENST00000231749.3_5'Flank|CYB561D2_ENST00000418577.1_5'Flank|XXcos-LUCA11.5_ENST00000606589.1_5'Flank|ZMYND10_ENST00000360165.3_5'Flank	NM_006545.4	NP_006536.3	Q8WTW4	NPRL2_HUMAN	nitrogen permease regulator-like 2 (S. cerevisiae)	237					negative regulation of kinase activity (GO:0033673)|protein phosphorylation (GO:0006468)		GTPase activator activity (GO:0005096)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	11						CTGGAGGATGGACACCAGTGT	0.582																																							uc003daj.1		NA																	0				lung(1)	1						c.(709-711)TCC>TGC		tumor suppressor candidate 4							139.0	125.0	130.0					3																	50385968		2203	4300	6503	SO:0001583	missense	10641				negative regulation of kinase activity		protein binding|protein kinase activity	g.chr3:50385968G>C	AF040708	CCDS2826.1	3p21.3	2010-03-30	2010-03-30	2010-03-30	ENSG00000114388	ENSG00000114388			24969	protein-coding gene	gene with protein product		607072	"""tumor suppressor candidate 4"""	TUSC4		11085536	Standard	NM_006545		Approved	NPR2L, NPR2	uc003daj.1	Q8WTW4	OTTHUMG00000156864	ENST00000232501.3:c.710C>G	3.37:g.50385968G>C	ENSP00000232501:p.Ser237Cys					ZMYND10_uc003dag.1_5'Flank|ZMYND10_uc010hll.1_5'Flank|ZMYND10_uc003dah.1_5'Flank|ZMYND10_uc010hlm.1_5'Flank|NPRL2_uc003dai.1_Missense_Mutation_p.S117C|CYB561D2_uc003dak.2_5'Flank|CYB561D2_uc003dal.2_5'Flank|CYB561D2_uc003dam.2_5'Flank	p.S237C	NM_006545	NP_006536	Q8WTW4	NPRL2_HUMAN			7	1113	-			237					A8K831|Q6FGS2|Q9Y249|Q9Y497	Missense_Mutation	SNP	ENST00000232501.3	37	c.710C>G	CCDS2826.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.092378	0.76756	.	.	ENSG00000114388	ENST00000232501	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.77552	0.4147	M	0.65975	2.015	0.80722	D	1	D	0.71674	0.998	D	0.64144	0.922	T	0.79249	-0.1881	9	0.72032	D	0.01	-6.4707	19.4133	0.94685	0.0:0.0:1.0:0.0	.	237	Q8WTW4	NPRL2_HUMAN	C	237	.	ENSP00000232501:S237C	S	-	2	0	NPRL2	50360972	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.327000	0.79147	2.579000	0.87056	0.561000	0.74099	TCC		0.582	NPRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346299.1	NM_006545		6	59	0	0	0	0.004482	0	6	59				
PCNP	57092	broad.mit.edu	37	3	101311480	101311480	+	Silent	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:101311480A>G	ENST00000265260.3	+	5	541	c.420A>G	c.(418-420)ccA>ccG	p.P140P	PCNP_ENST00000486406.1_3'UTR|PCNP_ENST00000296024.5_Missense_Mutation_p.N122D|PCNP_ENST00000469941.1_Silent_p.P17P	NM_020357.1	NP_065090.1	Q8WW12	PCNP_HUMAN	PEST proteolytic signal containing nuclear protein	140					cell cycle (GO:0007049)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)				large_intestine(1)|lung(1)	2						GGGATACACCAACATCAGCTG	0.338																																							uc003dva.2		NA																	0					0						c.(418-420)CCA>CCG		PEST proteolytic signal containing nuclear							71.0	74.0	73.0					3																	101311480		2203	4300	6503	SO:0001819	synonymous_variant	57092				cell cycle|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	nucleus	protein binding	g.chr3:101311480A>G		CCDS2942.1	3q12.3	2006-03-09			ENSG00000081154	ENSG00000081154			30023	protein-coding gene	gene with protein product		615210				12176013	Standard	NM_020357		Approved		uc003dva.3	Q8WW12	OTTHUMG00000159108	ENST00000265260.3:c.420A>G	3.37:g.101311480A>G						PCNP_uc003dvb.2_RNA|PCNP_uc003dvc.2_RNA|PCNP_uc003dvd.2_Missense_Mutation_p.N122D	p.P140P	NM_020357	NP_065090	Q8WW12	PCNP_HUMAN			5	438	+			140					B2RBE7|D3DN52|Q53GF3|Q6AI44|Q96CU3|Q9NS81	Silent	SNP	ENST00000265260.3	37	c.420A>G	CCDS2942.1	.	.	.	.	.	.	.	.	.	.	A	13.04	2.119464	0.37436	.	.	ENSG00000081154	ENST00000296024	.	.	.	5.05	3.9	0.45041	.	.	.	.	.	T	0.38719	0.1051	.	.	.	0.25209	N	0.989991	B	0.15930	0.015	B	0.14578	0.011	T	0.33701	-0.9858	7	0.87932	D	0	.	10.1797	0.42961	0.9213:0.0:0.0787:0.0	.	122	Q8WW12-2	.	D	122	.	ENSP00000296024:N122D	N	+	1	0	PCNP	102794170	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.172000	0.58243	1.895000	0.54865	0.477000	0.44152	AAC		0.338	PCNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353338.2	NM_020357		13	29	0	0	0	0.00499	0	13	29				
CCDC54	84692	broad.mit.edu	37	3	107096474	107096474	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:107096474A>T	ENST00000261058.1	+	1	287	c.40A>T	c.(40-42)Agg>Tgg	p.R14W		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	14										NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						AGCTGCTGCTAGGCAGATGTG	0.408																																							uc003dwi.1		NA																	0					0						c.(40-42)AGG>TGG		coiled-coil domain containing 54							106.0	106.0	106.0					3																	107096474		2203	4300	6503	SO:0001583	missense	84692							g.chr3:107096474A>T	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.40A>T	3.37:g.107096474A>T	ENSP00000261058:p.Arg14Trp						p.R14W	NM_032600	NP_115989	Q8NEL0	CCD54_HUMAN			1	287	+			14					Q96A43	Missense_Mutation	SNP	ENST00000261058.1	37	c.40A>T	CCDS2949.1	.	.	.	.	.	.	.	.	.	.	A	11.07	1.531393	0.27387	.	.	ENSG00000138483	ENST00000261058	T	0.46063	0.88	5.55	1.71	0.24356	.	0.641662	0.13449	N	0.387067	T	0.20129	0.0484	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17349	-1.0372	10	0.62326	D	0.03	-0.1253	4.0742	0.09895	0.2684:0.0:0.5694:0.1621	.	14	Q8NEL0	CCD54_HUMAN	W	14	ENSP00000261058:R14W	ENSP00000261058:R14W	R	+	1	2	CCDC54	108579164	0.985000	0.35326	0.074000	0.20217	0.021000	0.10359	0.976000	0.29462	0.028000	0.15324	-0.462000	0.05337	AGG		0.408	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353651.1	NM_032600		14	54	0	0	0	0.004007	0	14	54				
PLXND1	23129	broad.mit.edu	37	3	129290552	129290552	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:129290552G>C	ENST00000324093.4	-	16	3391	c.3213C>G	c.(3211-3213)atC>atG	p.I1071M	PLXND1_ENST00000393239.1_Missense_Mutation_p.I1071M	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1071	IPT/TIG 3.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						TGATGGCCGTGATGACCGGGT	0.667																																					Ovarian(97;366 1484 3738 22084 39045)	Ovarian(97;366 1484 3738 22084 39045)	uc003emx.2		NA																	0				large_intestine(1)	1						c.(3211-3213)ATC>ATG		plexin D1 precursor							61.0	64.0	63.0					3																	129290552		2203	4299	6502	SO:0001583	missense	23129				axon guidance	integral to membrane|intracellular|plasma membrane		g.chr3:129290552G>C	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3213C>G	3.37:g.129290552G>C	ENSP00000317128:p.Ile1071Met						p.I1071M	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN			16	3313	-			1071			Extracellular (Potential).|IPT/TIG 3.		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	c.3213C>G	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.264181	0.59431	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.71341	-0.56;-0.56	4.67	3.79	0.43588	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.182283	0.39615	N	0.001301	T	0.79323	0.4426	M	0.74389	2.26	0.51767	D	0.999936	D	0.63880	0.993	D	0.64877	0.93	T	0.80551	-0.1332	10	0.87932	D	0	.	7.3123	0.26481	0.0912:0.0:0.6925:0.2163	.	1071	Q9Y4D7	PLXD1_HUMAN	M	1071	ENSP00000317128:I1071M;ENSP00000376931:I1071M	ENSP00000317128:I1071M	I	-	3	3	PLXND1	130773242	1.000000	0.71417	0.998000	0.56505	0.624000	0.37722	2.240000	0.43088	2.166000	0.68216	0.561000	0.74099	ATC		0.667	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103		4	84	0	0	0	0.00308	0	4	84				
PLXND1	23129	broad.mit.edu	37	3	129291746	129291746	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:129291746G>C	ENST00000324093.4	-	14	3054	c.2876C>G	c.(2875-2877)tCa>tGa	p.S959*	PLXND1_ENST00000393239.1_Nonsense_Mutation_p.S959*	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	959	IPT/TIG 1.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						CACCACACCTGAGAGTGGTCC	0.682																																					Ovarian(97;366 1484 3738 22084 39045)	Ovarian(97;366 1484 3738 22084 39045)	uc003emx.2		NA																	0				large_intestine(1)	1						c.(2875-2877)TCA>TGA		plexin D1 precursor							64.0	53.0	57.0					3																	129291746		2202	4300	6502	SO:0001587	stop_gained	23129				axon guidance	integral to membrane|intracellular|plasma membrane		g.chr3:129291746G>C	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.2876C>G	3.37:g.129291746G>C	ENSP00000317128:p.Ser959*						p.S959*	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN			14	2976	-			959			IPT/TIG 1.|Extracellular (Potential).		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Nonsense_Mutation	SNP	ENST00000324093.4	37	c.2876C>G	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	G	40	8.196810	0.98701	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	.	.	.	5.1	5.1	0.69264	.	0.495444	0.18954	N	0.126611	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	16.7144	0.85394	0.0:0.0:1.0:0.0	.	.	.	.	X	959	.	ENSP00000317128:S959X	S	-	2	0	PLXND1	130774436	1.000000	0.71417	0.792000	0.32020	0.005000	0.04900	6.994000	0.76251	2.364000	0.80123	0.655000	0.94253	TCA		0.682	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103		4	32	0	0	0	0.001168	0	4	32				
TF	7018	broad.mit.edu	37	3	133467266	133467266	+	Silent	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:133467266G>T	ENST00000402696.3	+	2	539	c.54G>T	c.(52-54)ctG>ctT	p.L18L	TF_ENST00000264998.3_Intron|TF_ENST00000475382.1_3'UTR|TFP1_ENST00000460564.1_RNA	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	18					blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)			NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	GGCTGTGTCTGGCTGTCCCTG	0.572																																							uc003epu.1		NA																	0				ovary(1)|skin(1)	2						c.(52-54)CTG>CTT		transferrin precursor	Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)						125.0	111.0	116.0					3																	133467266		2203	4300	6503	SO:0001819	synonymous_variant	7018				cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding	g.chr3:133467266G>T		CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.54G>T	3.37:g.133467266G>T						TF_uc011bls.1_Silent_p.L18L|TF_uc011blt.1_Intron|TF_uc003epw.1_Silent_p.L18L|TF_uc010htv.1_RNA|TF_uc003epv.1_Silent_p.L18L	p.L18L	NM_001063	NP_001054	P02787	TRFE_HUMAN			7	1782	+			18					O43890|Q1HBA5|Q9NQB8|Q9UHV0	Silent	SNP	ENST00000402696.3	37	c.54G>T	CCDS3080.1																																																																																				0.572	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317775.1	NM_001063		16	22	1	0	5.03518e-11	0.007413	6.09797e-11	16	22				
NME9	347736	broad.mit.edu	37	3	138023810	138023810	+	Silent	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:138023810G>T	ENST00000333911.3	-	9	723	c.696C>A	c.(694-696)ctC>ctA	p.L232L	NME9_ENST00000317876.4_Silent_p.L171L|NME9_ENST00000536478.1_Silent_p.L171L|NME9_ENST00000484930.1_Silent_p.L169L|NME9_ENST00000383180.2_Silent_p.L171L|NME9_ENST00000341790.5_Silent_p.L169L			Q86XW9	TXND6_HUMAN	NME/NM23 family member 9	232	NDK.				cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										CAGTCCTGGTGAGGATCAGGA	0.597																																							uc003esg.2		NA																	0				breast(3)|ovary(1)|pancreas(1)	5						c.(694-696)CTC>CTA		thioredoxin domain containing 6							188.0	161.0	170.0					3																	138023810		2203	4300	6503	SO:0001819	synonymous_variant	347736				cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	cytoplasm|cytoskeleton	ATP binding|nucleoside diphosphate kinase activity	g.chr3:138023810G>T	AF196568	CCDS3099.1	3q22.3	2012-05-18	2012-05-18	2011-08-24	ENSG00000181322	ENSG00000181322			21343	protein-coding gene	gene with protein product			"""thioredoxin domain containing 6"", ""NME gene family member 9"", ""NME family member 9"""	TXNDC6		12569107, 19852809	Standard	NM_178130		Approved	TXL-2, NM23-H9	uc003ese.1	Q86XW9	OTTHUMG00000159823	ENST00000333911.3:c.696C>A	3.37:g.138023810G>T						TXNDC6_uc003esd.1_Intron|TXNDC6_uc010huf.1_Silent_p.L147L|TXNDC6_uc003ese.1_Silent_p.L171L	p.L232L	NM_178130	NP_835231	Q86XW9	TXND6_HUMAN			9	724	-			232			NDK.		Q7Z4A8|Q8N1V7	Silent	SNP	ENST00000333911.3	37	c.696C>A																																																																																					0.597	NME9-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357583.1	NM_178130		12	141	1	0	4.36969e-10	0.001855	5.23764e-10	12	141				
XRN1	54464	broad.mit.edu	37	3	142083991	142083991	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:142083991C>T	ENST00000264951.4	-	29	3409	c.3292G>A	c.(3292-3294)Gat>Aat	p.D1098N	XRN1_ENST00000392981.2_Missense_Mutation_p.D1098N	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1098					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						GCATCCCGATCAGGAATGACT	0.348																																							uc003eus.2		NA																	0				ovary(3)	3						c.(3292-3294)GAT>AAT		5'-3' exoribonuclease 1 isoform a							68.0	65.0	66.0					3																	142083991		2203	4300	6503	SO:0001583	missense	54464				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding	g.chr3:142083991C>T	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.3292G>A	3.37:g.142083991C>T	ENSP00000264951:p.Asp1098Asn					XRN1_uc010huu.2_Missense_Mutation_p.D564N|XRN1_uc003eut.2_Missense_Mutation_p.D1098N|XRN1_uc003euu.2_Missense_Mutation_p.D1098N	p.D1098N	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN			29	3359	-			1098					Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	c.3292G>A	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	C	33	5.205674	0.95033	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.34275	1.37;1.37	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.65585	0.2705	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.986	T	0.71728	-0.4505	10	0.62326	D	0.03	-16.8815	18.4179	0.90576	0.0:1.0:0.0:0.0	.	1098;1098	Q8IZH2-2;Q8IZH2	.;XRN1_HUMAN	N	1098	ENSP00000264951:D1098N;ENSP00000376707:D1098N	ENSP00000264951:D1098N	D	-	1	0	XRN1	143566681	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.948000	0.75965	2.428000	0.82296	0.650000	0.86243	GAT		0.348	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001		4	34	0	0	0	0.000602	0	4	34				
B3GALNT1	8706	broad.mit.edu	37	3	160804158	160804158	+	Silent	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:160804158A>G	ENST00000392781.2	-	8	1132	c.385T>C	c.(385-387)Ttg>Ctg	p.L129L	B3GALNT1_ENST00000320474.4_Silent_p.L129L|B3GALNT1_ENST00000488170.1_Silent_p.L129L|B3GALNT1_ENST00000392780.1_Silent_p.L129L|B3GALNT1_ENST00000417187.1_Intron|B3GALNT1_ENST00000473285.1_Silent_p.L129L|B3GALNT1_ENST00000392779.2_Silent_p.L129L	NM_001038628.1	NP_001033717.1	O75752	B3GL1_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)	129					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	galactosylgalactosylglucosylceramide beta-D-acetylgalactosaminyltransferase activity (GO:0047273)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(72;4.41e-05)|Lung(72;4.61e-05)			GACAATGCCAACATTTTGTCT	0.383																																							uc003fdv.2		NA																	0				skin(1)	1						c.(385-387)TTG>CTG		UDP-Gal:betaGlcNAc beta							111.0	107.0	108.0					3																	160804158		2203	4300	6503	SO:0001819	synonymous_variant	8706				protein glycosylation	Golgi membrane|integral to membrane	galactosylgalactosylglucosylceramide beta-D-acetylgalactosaminyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity	g.chr3:160804158A>G	Y15062	CCDS3193.1	3q25	2014-07-18	2006-06-14	2006-05-09	ENSG00000169255	ENSG00000169255	2.4.1.79	"""Blood group antigens"", ""Beta 3-glycosyltransferases"""	918	protein-coding gene	gene with protein product	"""globoside synthase"", ""P antigen synthase"""	603094	"""UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 3 (Globoside blood group)"", ""UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 (Globoside blood group)"""	B3GALT3		9582303, 10993897	Standard	XM_005247861		Approved	beta3Gal-T3, galT3, P1, GLOB	uc003fdv.3	O75752	OTTHUMG00000159064	ENST00000392781.2:c.385T>C	3.37:g.160804158A>G						B3GALNT1_uc003fdw.2_Silent_p.L129L|B3GALNT1_uc003fdx.2_Silent_p.L129L|B3GALNT1_uc003fdy.2_Silent_p.L129L|B3GALNT1_uc003fdz.2_Silent_p.L129L|B3GALNT1_uc003fea.2_Silent_p.L129L|B3GALNT1_uc011bpa.1_Intron	p.L129L	NM_033169	NP_149359	O75752	B3GL1_HUMAN	LUSC - Lung squamous cell carcinoma(72;4.41e-05)|Lung(72;4.61e-05)		5	804	-			129			Lumenal (Potential).		D3DNM4|Q3Y531|Q6IAI5|Q8NFM8|Q8NFM9|Q9HA06	Silent	SNP	ENST00000392781.2	37	c.385T>C	CCDS3193.1																																																																																				0.383	B3GALNT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353125.1	NM_033167		6	56	0	0	0	0.001984	0	6	56				
MYNN	55892	broad.mit.edu	37	3	169501310	169501310	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:169501310C>T	ENST00000349841.5	+	6	2108	c.1445C>T	c.(1444-1446)tCc>tTc	p.S482F	MYNN_ENST00000356716.4_Missense_Mutation_p.S482F|MYNN_ENST00000392733.1_Missense_Mutation_p.S482F|MYNN_ENST00000544106.1_Missense_Mutation_p.S482F	NM_018657.4	NP_061127.1	Q9NPC7	MYNN_HUMAN	myoneurin	482					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			AGTTTTATTTCCTCAGGAGAG	0.328																																							uc003fft.2		NA																	0				skin(1)	1						c.(1444-1446)TCC>TTC		myoneurin							131.0	148.0	143.0					3																	169501310		2203	4300	6503	SO:0001583	missense	55892					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:169501310C>T	AF148848	CCDS3207.1, CCDS54671.1	3q26.31	2013-01-09			ENSG00000085274	ENSG00000085274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	14955	protein-coding gene	gene with protein product		606042				10873615	Standard	NM_001185118		Approved	SBBIZ1, ZBTB31, ZNF902	uc010hwo.3	Q9NPC7		ENST00000349841.5:c.1445C>T	3.37:g.169501310C>T	ENSP00000326240:p.Ser482Phe					MYNN_uc011bpm.1_Missense_Mutation_p.S368F|MYNN_uc003ffu.2_Missense_Mutation_p.S482F|MYNN_uc003ffv.2_Missense_Mutation_p.S209F|MYNN_uc010hwo.2_Missense_Mutation_p.S482F|MYNN_uc003ffw.1_RNA	p.S482F	NM_018657	NP_061127	Q9NPC7	MYNN_HUMAN	Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)		6	1874	+	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		482			C2H2-type 7.		B2R6C9|Q6QHA6|Q6QHA7|Q6R3G1|Q6R3G2|Q6R4A0|Q7Z716|Q7Z717|Q86Z11|Q86Z12|Q9NS01|Q9UIW8	Missense_Mutation	SNP	ENST00000349841.5	37	c.1445C>T	CCDS3207.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.567420	0.86439	.	.	ENSG00000085274	ENST00000356716;ENST00000349841;ENST00000392733;ENST00000544106	T;T;T;T	0.36878	3.88;3.88;1.23;1.23	5.06	5.06	0.68205	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000002	T	0.55641	0.1933	L	0.53561	1.675	0.53688	D	0.999974	B;D	0.71674	0.013;0.998	B;D	0.67382	0.006;0.951	T	0.55976	-0.8055	10	0.51188	T	0.08	.	18.4119	0.90554	0.0:1.0:0.0:0.0	.	482;482	Q9NPC7-2;Q9NPC7	.;MYNN_HUMAN	F	482	ENSP00000349150:S482F;ENSP00000326240:S482F;ENSP00000376492:S482F;ENSP00000440637:S482F	ENSP00000326240:S482F	S	+	2	0	MYNN	170984004	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.326000	0.72905	2.349000	0.79799	0.484000	0.47621	TCC		0.328	MYNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467801.1	NM_018657		22	68	0	0	0	0.00632	0	22	68				
PSMD2	5708	broad.mit.edu	37	3	184024551	184024551	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:184024551C>T	ENST00000310118.4	+	16	2521	c.1963C>T	c.(1963-1965)Ctg>Ttg	p.L655L	PSMD2_ENST00000435761.1_Silent_p.L496L|EIF2B5_ENST00000444495.1_Intron|PSMD2_ENST00000439383.1_Silent_p.L525L	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	655					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	AGTGGCTGTTCTGGGGATTGC	0.443																																					Colon(24;313 636 6917 9932 15554)	Colon(24;313 636 6917 9932 15554)	uc003fnn.1		NA																	0					0						c.(1963-1965)CTG>TTG		proteasome 26S non-ATPase subunit 2	Bortezomib(DB00188)						164.0	164.0	164.0					3																	184024551		2203	4300	6503	SO:0001819	synonymous_variant	5708				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding	g.chr3:184024551C>T	AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.1963C>T	3.37:g.184024551C>T						PSMD2_uc011brj.1_Silent_p.L496L|PSMD2_uc011brk.1_Silent_p.L525L	p.L655L	NM_002808	NP_002799	Q13200	PSMD2_HUMAN	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		16	1996	+	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		655					B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Silent	SNP	ENST00000310118.4	37	c.1963C>T	CCDS3258.1																																																																																				0.443	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345843.1	NM_002808		36	82	0	0	0	0.009718	0	36	82				
CHRD	8646	broad.mit.edu	37	3	184100663	184100663	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:184100663G>C	ENST00000204604.1	+	9	1248	c.1002G>C	c.(1000-1002)ttG>ttC	p.L334F	CHRD_ENST00000348986.3_Missense_Mutation_p.L334F|CHRD_ENST00000545352.1_5'UTR|EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000450923.1_Missense_Mutation_p.L334F	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	334	CHRD 2. {ECO:0000255|PROSITE- ProRule:PRU00230}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGGTTCCCTTGAGGCTCCAGA	0.577																																							uc003fov.2		NA																	0				skin(2)|ovary(1)	3						c.(1000-1002)TTG>TTC		chordin precursor							61.0	60.0	60.0					3																	184100663		2203	4300	6503	SO:0001583	missense	8646				BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding	g.chr3:184100663G>C	AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1002G>C	3.37:g.184100663G>C	ENSP00000204604:p.Leu334Phe					CHRD_uc003fow.2_Intron|CHRD_uc003fox.2_Missense_Mutation_p.L334F|CHRD_uc003foy.2_Intron|CHRD_uc010hyc.2_5'UTR|CHRD_uc011brr.1_5'UTR	p.L334F	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		9	1248	+	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		334			CHRD 2.		O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	37	c.1002G>C	CCDS3266.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.80|15.80	2.940523|2.940523	0.52972|0.52972	.|.	.|.	ENSG00000090539|ENSG00000090539	ENST00000342610|ENST00000204604;ENST00000450923;ENST00000348986	.|T;T;T	.|0.45668	.|0.89;0.89;0.89	4.79|4.79	1.82|1.82	0.25136|0.25136	.|CHRD (3);	.|0.300335	.|0.31221	.|N	.|0.008039	T|T	0.47173|0.47173	0.1431|0.1431	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	.|P;D	.|0.56968	.|0.593;0.978	.|P;P	.|0.62491	.|0.644;0.903	T|T	0.42932|0.42932	-0.9422|-0.9422	6|10	0.87932|0.87932	D|D	0|0	-1.1311|-1.1311	4.9064|4.9064	0.13800|0.13800	0.2536:0.0:0.5981:0.1484|0.2536:0.0:0.5981:0.1484	.|.	.|334;334	.|E7ESX1;Q9H2X0	.|.;CHRD_HUMAN	Q|F	22|334	.|ENSP00000204604:L334F;ENSP00000408972:L334F;ENSP00000334036:L334F	ENSP00000339396:E22Q|ENSP00000204604:L334F	E|L	+|+	1|3	0|2	CHRD|CHRD	185583357|185583357	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.985000|0.985000	0.73830|0.73830	1.766000|1.766000	0.38491|0.38491	0.557000|0.557000	0.29117|0.29117	0.563000|0.563000	0.77884|0.77884	GAG|TTG		0.577	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741		4	10	0	0	0	0.009096	0	4	10				
ST6GAL1	6480	broad.mit.edu	37	3	186793407	186793407	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr3:186793407C>G	ENST00000169298.3	+	8	1711	c.1037C>G	c.(1036-1038)tCc>tGc	p.S346C	ST6GAL1_ENST00000448044.1_Missense_Mutation_p.S346C|ST6GAL1_ENST00000457772.2_Missense_Mutation_p.S115C	NM_173216.2	NP_775323.1	P15907	SIAT1_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 1	346					cellular protein metabolic process (GO:0044267)|humoral immune response (GO:0006959)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)|sialyltransferase activity (GO:0008373)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		TTCCTCCCATCCAAGCGCAAG	0.522																																							uc003frb.2		NA																	0				central_nervous_system(1)	1						c.(1036-1038)TCC>TGC		ST6 beta-galactosamide							148.0	120.0	129.0					3																	186793407		2203	4300	6503	SO:0001583	missense	6480				humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	g.chr3:186793407C>G	X62822	CCDS3285.1, CCDS46973.1	3q27-q28	2013-02-26	2003-01-14	2005-02-07	ENSG00000073849	ENSG00000073849	2.4.99.1		10860	protein-coding gene	gene with protein product	"""ST6Gal I"""	109675	"""sialyltransferase 1 (beta-galactoside alpha-2,6-sialytransferase)"""	SIAT1		2408023	Standard	NM_003032		Approved		uc003frd.3	P15907	OTTHUMG00000156500	ENST00000169298.3:c.1037C>G	3.37:g.186793407C>G	ENSP00000169298:p.Ser346Cys					ST6GAL1_uc003frc.2_Missense_Mutation_p.S115C|ST6GAL1_uc003frd.2_Missense_Mutation_p.S346C	p.S346C	NM_173216	NP_775323	P15907	SIAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)	8	1469	+	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		346			Lumenal (Potential).		A8KA14|B2R513|D3DNV3	Missense_Mutation	SNP	ENST00000169298.3	37	c.1037C>G	CCDS3285.1	.	.	.	.	.	.	.	.	.	.	C	31	5.064031	0.93898	.	.	ENSG00000073849	ENST00000169298;ENST00000457772;ENST00000448044;ENST00000442023	T;T;T	0.33865	1.39;1.39;1.39	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.70029	0.3177	M	0.93062	3.375	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75955	-0.3135	10	0.62326	D	0.03	-13.0445	17.8009	0.88586	0.0:1.0:0.0:0.0	.	346	P15907	SIAT1_HUMAN	C	346;115;346;115	ENSP00000169298:S346C;ENSP00000412221:S115C;ENSP00000389337:S346C	ENSP00000169298:S346C	S	+	2	0	ST6GAL1	188276101	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.762000	0.85270	2.884000	0.98904	0.655000	0.94253	TCC		0.522	ST6GAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344399.1	NM_173216		13	41	0	0	0	0.003163	0	13	41				
ZNF718	255403	broad.mit.edu	37	4	154780	154780	+	lincRNA	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr4:154780G>T	ENST00000510175.1	+	0	215							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		ATACCAAAAGGACATGAGAAA	0.338																																							uc003fzt.3		NA																	0					0						c.(304-306)GGA>GTA		zinc finger protein 718							49.0	50.0	50.0					4																	154780		2023	4208	6231			255403				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:154780G>T	AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.154780G>T						ZNF595_uc003fzu.1_Intron|ZNF718_uc010iaz.2_RNA|ZNF718_uc003fzw.3_5'UTR	p.G102V	NM_001039127	NP_001034216	Q3SXZ3	ZN718_HUMAN		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)	8	438	+		all_cancers(4;0.0738)|all_epithelial(65;0.139)	102					Q3SXZ4|Q3SXZ5	Missense_Mutation	SNP	ENST00000510175.1	37	c.305G>T																																																																																					0.338	ZNF718-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000357865.3	NM_001039127		5	20	1	0	2.0095e-06	0.001984	2.29844e-06	5	20				
LGI2	55203	broad.mit.edu	37	4	25005381	25005381	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr4:25005381G>A	ENST00000382114.4	-	8	1515	c.1330C>T	c.(1330-1332)Cgg>Tgg	p.R444W		NM_018176.3	NP_060646.2	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	444			R -> Q (in dbSNP:rs2232026).			extracellular region (GO:0005576)		p.R444R(1)|p.R444M(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(2)	33		Breast(46;0.173)				CTCATGACCCGGGAGTCCCCG	0.522																																							uc003grf.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(1)|kidney(1)		0						c.(1330-1332)CGG>TGG		leucine-rich repeat LGI family, member 2							154.0	166.0	162.0					4																	25005381		2203	4300	6503	SO:0001583	missense	55203					extracellular region		g.chr4:25005381G>A	AJ487516	CCDS3431.1	4p15.31	2008-07-28			ENSG00000153012	ENSG00000153012			18710	protein-coding gene	gene with protein product		608301				12023020, 16014869	Standard	NM_018176		Approved	KIAA1916, FLJ10675	uc003grf.2	Q8N0V4	OTTHUMG00000097749	ENST00000382114.4:c.1330C>T	4.37:g.25005381G>A	ENSP00000371548:p.Arg444Trp						p.R444W	NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN			8	1429	-		Breast(46;0.173)	444			EAR 5.		Q3MIN2|Q8NDW6|Q96PX2|Q9NVK4	Missense_Mutation	SNP	ENST00000382114.4	37	c.1330C>T	CCDS3431.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558547	0.65538	.	.	ENSG00000153012	ENST00000382114;ENST00000282970	T	0.80653	-1.4	5.77	0.792	0.18625	.	0.047581	0.85682	D	0.000000	D	0.82995	0.5158	L	0.34521	1.04	0.42936	D	0.99433	D	0.76494	0.999	D	0.70227	0.968	T	0.82610	-0.0372	10	0.62326	D	0.03	-28.113	15.527	0.75919	0.0:0.0:0.576:0.424	.	444	Q8N0V4	LGI2_HUMAN	W	444;92	ENSP00000371548:R444W	ENSP00000282970:R92W	R	-	1	2	LGI2	24614479	1.000000	0.71417	0.954000	0.39281	0.993000	0.82548	2.396000	0.44468	-0.078000	0.12730	-0.474000	0.04947	CGG		0.522	LGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214978.1			27	231	0	0	0	0.007291	0	27	231				
GABRG1	2565	broad.mit.edu	37	4	46067491	46067491	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr4:46067491C>G	ENST00000295452.4	-	4	599	c.432G>C	c.(430-432)tgG>tgC	p.W144C		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	144					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGTCAGGAATCCAAATTTTTC	0.358																																							uc003gxb.2		NA																	0				ovary(2)	2						c.(430-432)TGG>TGC		gamma-aminobutyric acid A receptor, gamma 1							83.0	84.0	83.0					4																	46067491		2203	4300	6503	SO:0001583	missense	2565				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr4:46067491C>G	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.432G>C	4.37:g.46067491C>G	ENSP00000295452:p.Trp144Cys						p.W144C	NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN		Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	4	584	-			144			Extracellular (Probable).		Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	37	c.432G>C	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.137743	0.77775	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	D	0.98684	-5.07	5.08	5.08	0.68730	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.99399	0.9788	H	0.95745	3.715	0.80722	D	1	D	0.67145	0.996	D	0.70487	0.969	D	0.98574	1.0647	10	0.72032	D	0.01	.	17.8218	0.88652	0.0:1.0:0.0:0.0	.	144	Q8N1C3	GBRG1_HUMAN	C	144	ENSP00000295452:W144C	ENSP00000295452:W144C	W	-	3	0	GABRG1	45762248	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.759000	0.85235	2.513000	0.84729	0.508000	0.49915	TGG		0.358	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536		10	17	0	0	0	0.006214	0	10	17				
CORIN	10699	broad.mit.edu	37	4	47765548	47765548	+	Silent	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr4:47765548C>A	ENST00000273857.4	-	4	464	c.465G>T	c.(463-465)acG>acT	p.T155T	CORIN_ENST00000504584.1_Silent_p.T155T|CORIN_ENST00000502252.1_Silent_p.T88T|CORIN_ENST00000508498.1_Silent_p.T16T|CORIN_ENST00000505909.1_Silent_p.T155T	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	155	FZ 1. {ECO:0000255|PROSITE- ProRule:PRU00090}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						GAGGTGTCAGCGTGGCGTGGT	0.468																																							uc003gxm.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(463-465)ACG>ACT		corin							146.0	138.0	141.0					4																	47765548		2203	4300	6503	SO:0001819	synonymous_variant	10699				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity	g.chr4:47765548C>A	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.465G>T	4.37:g.47765548C>A						CORIN_uc011bzf.1_Silent_p.T16T|CORIN_uc011bzg.1_Silent_p.T88T|CORIN_uc011bzh.1_Silent_p.T155T|CORIN_uc011bzi.1_Silent_p.T155T|CORIN_uc003gxn.3_Silent_p.T155T	p.T155T	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN			4	558	-			155			Extracellular (Potential).|FZ 1.		B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Silent	SNP	ENST00000273857.4	37	c.465G>T	CCDS3477.1																																																																																				0.468	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2			19	89	1	0	1.96895e-08	0.00278	2.29711e-08	19	89				
PDGFRA	5156	broad.mit.edu	37	4	55161414	55161414	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr4:55161414A>G	ENST00000257290.5	+	23	3576	c.3245A>G	c.(3244-3246)gAc>gGc	p.D1082G	FIP1L1_ENST00000507166.1_Missense_Mutation_p.D842G	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	1082	Ser-rich.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	GACTCTTCAGACCTGGTGGAA	0.512			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)	Pancreas(151;208 1913 7310 23853 37092)	uc003han.3		NA		Dom	yes		4	4q11-q13	5156	Mis|O|T	"""platelet-derived growth factor, alpha-receptor"""			"""L, M, O"""	FIP1L1		GIST|idiopathic hypereosinophilic syndrome		0				soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674						c.(3244-3246)GAC>GGC		platelet-derived growth factor receptor alpha	Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)						150.0	137.0	141.0					4																	55161414		2203	4300	6503	SO:0001583	missense	5156	Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity	g.chr4:55161414A>G	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.3245A>G	4.37:g.55161414A>G	ENSP00000257290:p.Asp1082Gly	TSP Lung(21;0.16)				PDGFRA_uc003haa.2_Missense_Mutation_p.D842G	p.D1082G	NM_006206	NP_006197	P16234	PGFRA_HUMAN	GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		23	3576	+	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		1082			Ser-rich.|Cytoplasmic (Potential).		B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	c.3245A>G	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.475992	0.84640	.	.	ENSG00000145216;ENSG00000134853	ENST00000507166;ENST00000257290	T;T	0.79247	-1.25;-1.1	5.84	5.84	0.93424	.	0.000000	0.33670	U	0.004674	T	0.79335	0.4428	L	0.51422	1.61	0.80722	D	1	P	0.52316	0.952	P	0.49477	0.612	T	0.79560	-0.1753	10	0.44086	T	0.13	.	16.2225	0.82267	1.0:0.0:0.0:0.0	.	1082	P16234	PGFRA_HUMAN	G	842;1082	ENSP00000423325:D842G;ENSP00000257290:D1082G	ENSP00000423325:D842G	D	+	2	0	FIP1L1;PDGFRA	54856171	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	8.962000	0.93254	2.235000	0.73313	0.379000	0.24179	GAC		0.512	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206		12	95	0	0	0	0.00245	0	12	95				
EPHA5	2044	broad.mit.edu	37	4	66509083	66509083	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr4:66509083C>G	ENST00000273854.3	-	2	844	c.244G>C	c.(244-246)Ggg>Cgg	p.G82R	EPHA5_ENST00000432638.2_Missense_Mutation_p.G82R|EPHA5_ENST00000354839.4_Missense_Mutation_p.G82R|EPHA5_ENST00000511294.1_Missense_Mutation_p.G82R	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	82	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						AAACTTACCCCATTTTTTGGA	0.343										TSP Lung(17;0.13)																													uc003hcy.2		NA																	0				lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(244-246)GGG>CGG		ephrin receptor EphA5 isoform a precursor							53.0	54.0	54.0					4																	66509083		2202	4299	6501	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66509083C>G	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.244G>C	4.37:g.66509083C>G	ENSP00000273854:p.Gly82Arg	TSP Lung(17;0.13)				EPHA5_uc003hcx.2_Missense_Mutation_p.G13R|EPHA5_uc003hcz.2_Missense_Mutation_p.G82R|EPHA5_uc011cah.1_Missense_Mutation_p.G82R|EPHA5_uc011cai.1_Missense_Mutation_p.G82R|EPHA5_uc003hda.2_Missense_Mutation_p.G82R	p.G82R	NM_004439	NP_004430	P54756	EPHA5_HUMAN			2	437	-			82			Extracellular (Potential).		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.244G>C	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572066	0.86542	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.04234	3.67;3.67;3.67;3.67	5.51	5.51	0.81932	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000013	T	0.31451	0.0797	M	0.91972	3.26	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.995;0.999;0.991;1.0	T	0.22487	-1.0215	10	0.87932	D	0	.	19.7788	0.96409	0.0:1.0:0.0:0.0	.	82;82;82;82	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	R	82	ENSP00000273854:G82R;ENSP00000389208:G82R;ENSP00000346899:G82R;ENSP00000427638:G82R	ENSP00000273854:G82R	G	-	1	0	EPHA5	66191678	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.151000	0.71806	2.749000	0.94314	0.460000	0.39030	GGG		0.343	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		6	20	0	0	0	0.004482	0	6	20				
SEC24D	9871	broad.mit.edu	37	4	119665242	119665242	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr4:119665242C>T	ENST00000280551.6	-	15	2134	c.1896G>A	c.(1894-1896)gtG>gtA	p.V632V	SEC24D_ENST00000379735.5_Silent_p.V633V|SEC24D_ENST00000419654.2_Silent_p.V188V|SEC24D_ENST00000511481.1_Silent_p.V263V|SEC24D_ENST00000505134.1_5'UTR|SEC24D_ENST00000429811.2_Silent_p.V188V			O94855	SC24D_HUMAN	SEC24 family member D	632					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						GGAAGAGTGTCACAGAGCAGC	0.473																																							uc003ici.3		NA																	0					0						c.(1894-1896)GTG>GTA		Sec24-related protein D							67.0	60.0	62.0					4																	119665242		2203	4300	6503	SO:0001819	synonymous_variant	9871				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding	g.chr4:119665242C>T	AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1896G>A	4.37:g.119665242C>T						SEC24D_uc003ich.3_RNA|SEC24D_uc003icj.3_Silent_p.V633V|SEC24D_uc003icl.2_RNA	p.V632V	NM_014822	NP_055637	O94855	SC24D_HUMAN			15	2168	-			632					Q8IYI7	Silent	SNP	ENST00000280551.6	37	c.1896G>A	CCDS3710.1																																																																																				0.473	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4			3	50	0	0	0	0.009096	0	3	50				
NEK1	4750	broad.mit.edu	37	4	170477147	170477147	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr4:170477147G>A	ENST00000439128.2	-	16	2006	c.1366C>T	c.(1366-1368)Caa>Taa	p.Q456*	NEK1_ENST00000510533.1_Nonsense_Mutation_p.Q456*|NEK1_ENST00000511633.1_Nonsense_Mutation_p.Q456*|NEK1_ENST00000512193.1_Nonsense_Mutation_p.Q431*|NEK1_ENST00000507142.1_Nonsense_Mutation_p.Q456*	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	456					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		TCTGCTCTTTGTTGCTGCATT	0.418																																							uc003isb.1		NA																	0				lung(3)|ovary(2)|large_intestine(1)	6						c.(1366-1368)CAA>TAA		NIMA-related kinase 1							157.0	137.0	143.0					4																	170477147		1852	4108	5960	SO:0001587	stop_gained	4750				cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr4:170477147G>A	AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.1366C>T	4.37:g.170477147G>A	ENSP00000408020:p.Gln456*					NEK1_uc003isc.1_Nonsense_Mutation_p.Q456*|NEK1_uc003isd.1_Nonsense_Mutation_p.Q456*|NEK1_uc003ise.1_Nonsense_Mutation_p.Q456*|NEK1_uc003isf.1_Nonsense_Mutation_p.Q431*|NEK1_uc003isg.1_Nonsense_Mutation_p.Q377*	p.Q456*	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)	16	1858	-		Prostate(90;0.00601)|Renal(120;0.0183)	456					G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Nonsense_Mutation	SNP	ENST00000439128.2	37	c.1366C>T	CCDS47162.1	.	.	.	.	.	.	.	.	.	.	G	41	9.058325	0.99051	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	.	.	.	5.66	5.66	0.87406	.	0.409867	0.23581	N	0.046649	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	19.3573	0.94420	0.0:0.0:1.0:0.0	.	.	.	.	X	456;456;456;456;431	.	ENSP00000408020:Q456X	Q	-	1	0	NEK1	170713722	1.000000	0.71417	0.949000	0.38748	0.595000	0.36748	6.524000	0.73791	2.681000	0.91329	0.585000	0.79938	CAA		0.418	NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3			3	13	0	0	0	0.004672	0	3	13				
IRX2	153572	broad.mit.edu	37	5	2747711	2747711	+	Silent	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:2747711G>A	ENST00000382611.6	-	4	1631	c.1383C>T	c.(1381-1383)acC>acT	p.T461T	IRX2_ENST00000302057.5_Silent_p.T461T|IRX2_ENST00000502957.1_5'Flank	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	461					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		CGCCAACCACGGTGCAGCCCT	0.652																																							uc003jda.2		NA																	0				skin(1)	1						c.(1381-1383)ACC>ACT		iroquois homeobox 2							46.0	43.0	44.0					5																	2747711		2203	4300	6503	SO:0001819	synonymous_variant	153572					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:2747711G>A	AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.1383C>T	5.37:g.2747711G>A						IRX2_uc003jdb.2_Silent_p.T461T	p.T461T	NM_001134222	NP_001127694	Q9BZI1	IRX2_HUMAN		GBM - Glioblastoma multiforme(108;0.204)	4	1625	-			461					Q68A19|Q7Z2I7	Silent	SNP	ENST00000382611.6	37	c.1383C>T	CCDS3868.1																																																																																				0.652	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206749.2			3	91	0	0	0	0.004672	0	3	91				
ADAMTS16	170690	broad.mit.edu	37	5	5239860	5239860	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:5239860C>G	ENST00000274181.7	+	16	2483	c.2345C>G	c.(2344-2346)tCt>tGt	p.S782C		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	782	Spacer.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						ATGAACGTCTCTACCTCCTAC	0.493																																							uc003jdl.2		NA																	0				ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						c.(2344-2346)TCT>TGT		ADAM metallopeptidase with thrombospondin type 1							142.0	135.0	137.0					5																	5239860		1900	4122	6022	SO:0001583	missense	170690				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:5239860C>G	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2345C>G	5.37:g.5239860C>G	ENSP00000274181:p.Ser782Cys					ADAMTS16_uc003jdk.1_Missense_Mutation_p.S782C	p.S782C	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN			16	2483	+			782			Spacer.		C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	c.2345C>G	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255970	0.80135	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.57595	0.39	5.56	5.56	0.83823	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	T	0.80602	0.4654	M	0.93328	3.405	0.80722	D	1	D;D	0.89917	1.0;0.984	D;P	0.91635	0.999;0.903	D	0.85502	0.1192	10	0.87932	D	0	.	18.2879	0.90120	0.0:1.0:0.0:0.0	.	782;782	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	C	782	ENSP00000274181:S782C	ENSP00000274181:S782C	S	+	2	0	ADAMTS16	5292860	1.000000	0.71417	0.806000	0.32338	0.850000	0.48378	7.110000	0.77069	2.615000	0.88500	0.655000	0.94253	TCT		0.493	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		6	103	0	0	0	0.004482	0	6	103				
FASTKD3	79072	broad.mit.edu	37	5	7863072	7863072	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:7863072A>T	ENST00000264669.5	-	4	1699	c.1563T>A	c.(1561-1563)ttT>ttA	p.F521L	MTRR_ENST00000502509.1_Intron|FASTKD3_ENST00000513658.1_5'UTR	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	521					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						ATGGGGTAAGAAATGACTTCA	0.353																																							uc003jeb.2		NA																	0				ovary(2)|breast(1)|pancreas(1)	4						c.(1561-1563)TTT>TTA		FAST kinase domains 3							136.0	149.0	145.0					5																	7863072		2203	4300	6503	SO:0001583	missense	79072				apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity	g.chr5:7863072A>T	AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.1563T>A	5.37:g.7863072A>T	ENSP00000264669:p.Phe521Leu					FASTKD3_uc011cmp.1_Missense_Mutation_p.F223L|FASTKD3_uc003jec.2_RNA	p.F521L	NM_024091	NP_076996	Q14CZ7	FAKD3_HUMAN			4	1700	-			521					Q9BVD3	Missense_Mutation	SNP	ENST00000264669.5	37	c.1563T>A	CCDS3873.1	.	.	.	.	.	.	.	.	.	.	A	15.13	2.742130	0.49151	.	.	ENSG00000124279	ENST00000264669	T	0.42131	0.98	5.65	-4.33	0.03677	FAST kinase-like protein, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.49695	0.1572	M	0.68952	2.095	0.42281	D	0.992094	D	0.89917	1.0	D	0.85130	0.997	T	0.57458	-0.7808	10	0.13853	T	0.58	-31.4968	8.9224	0.35619	0.4327:0.1173:0.4501:0.0	.	521	Q14CZ7	FAKD3_HUMAN	L	521	ENSP00000264669:F521L	ENSP00000264669:F521L	F	-	3	2	FASTKD3	7916072	0.980000	0.34600	0.001000	0.08648	0.259000	0.26198	0.261000	0.18442	-0.944000	0.03686	0.533000	0.62120	TTT		0.353	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1	NM_024091		12	196	0	0	0	0.004007	0	12	196				
DNAH5	1767	broad.mit.edu	37	5	13809157	13809157	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:13809157C>A	ENST00000265104.4	-	46	7852	c.7748G>T	c.(7747-7749)gGc>gTc	p.G2583V		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2583	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCATACCTTGCCCTGTTTAGC	0.373									Kartagener syndrome																														uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(7747-7749)GGC>GTC		dynein, axonemal, heavy chain 5							119.0	116.0	117.0					5																	13809157		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13809157C>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.7748G>T	5.37:g.13809157C>A	ENSP00000265104:p.Gly2583Val						p.G2583V	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN			46	7790	-	Lung NSC(4;0.00476)		2583			AAA 3 (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.7748G>T	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	14.56	2.570723	0.45798	.	.	ENSG00000039139	ENST00000265104	T	0.36520	1.25	5.91	5.91	0.95273	ATPase, AAA+ type, core (1);	0.049020	0.85682	D	0.000000	T	0.64505	0.2604	H	0.94698	3.57	0.80722	D	1	B	0.33299	0.407	P	0.45610	0.487	T	0.65030	-0.6267	10	0.27785	T	0.31	.	20.3053	0.98627	0.0:1.0:0.0:0.0	.	2583	Q8TE73	DYH5_HUMAN	V	2583	ENSP00000265104:G2583V	ENSP00000265104:G2583V	G	-	2	0	DNAH5	13862157	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.065000	0.71176	2.808000	0.96608	0.655000	0.94253	GGC		0.373	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		11	85	1	0	0.000978159	0.010729	0.00104059	11	85				
PRDM9	56979	broad.mit.edu	37	5	23527693	23527693	+	Silent	SNP	T	T	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:23527693T>C	ENST00000296682.3	+	11	2678	c.2496T>C	c.(2494-2496)taT>taC	p.Y832Y		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	832					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.Y832Y(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGAAGCCCTATGTCTGCAGGG	0.587										HNSCC(3;0.000094)																													uc003jgo.2		NA																	1	Substitution - coding silent(1)		endometrium(1)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(2494-2496)TAT>TAC		PR domain containing 9							48.0	60.0	56.0					5																	23527693		2166	4285	6451	SO:0001819	synonymous_variant	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23527693T>C	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2496T>C	5.37:g.23527693T>C		HNSCC(3;0.000094)					p.Y832Y	NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN			11	2678	+			832			C2H2-type 13.		B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	c.2496T>C	CCDS43307.1																																																																																				0.587	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		7	178	0	0	0	0.004482	0	7	178				
CDH9	1007	broad.mit.edu	37	5	26906068	26906068	+	Splice_Site	SNP	T	T	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:26906068T>A	ENST00000231021.4	-	5	983	c.811A>T	c.(811-813)Agt>Tgt	p.S271C		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	271	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CATTTCTTACTCTGGGGAAAT	0.433																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	0				ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(811-813)AGT>TGT		cadherin 9, type 2 preproprotein							166.0	161.0	163.0					5																	26906068		2203	4300	6503	SO:0001630	splice_region_variant	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26906068T>A	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.811+1A>T	5.37:g.26906068T>A						CDH9_uc010iug.2_Missense_Mutation_p.S271C	p.S271C	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN			5	980	-			271			Cadherin 3.|Extracellular (Potential).		Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.811A>T	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	T	18.12	3.553379	0.65425	.	.	ENSG00000113100	ENST00000231021	T	0.40756	1.02	5.6	4.41	0.53225	Cadherin (3);Cadherin-like (1);	0.262999	0.47455	D	0.000223	T	0.62527	0.2435	H	0.95187	3.635	0.51482	D	0.999927	P	0.40066	0.701	P	0.45558	0.485	T	0.70506	-0.4853	9	.	.	.	.	12.1226	0.53900	0.0:0.0:0.1434:0.8566	.	271	Q9ULB4	CADH9_HUMAN	C	271	ENSP00000231021:S271C	.	S	-	1	0	CDH9	26941825	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	4.217000	0.58547	1.035000	0.39972	0.528000	0.53228	AGT		0.433	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	Missense_Mutation	42	144	0	0	0	0.01441	0	42	144				
MROH2B	133558	broad.mit.edu	37	5	41004595	41004595	+	Silent	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:41004595G>T	ENST00000399564.4	-	37	4497	c.4047C>A	c.(4045-4047)atC>atA	p.I1349I	MROH2B_ENST00000506092.2_Silent_p.I904I	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1349																	GGCCTCTGATGATAGATTCTA	0.423																																							uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(4045-4047)ATC>ATA		HEAT repeat family member 7B2							98.0	89.0	92.0					5																	41004595		1847	4105	5952	SO:0001819	synonymous_variant	133558						binding	g.chr5:41004595G>T		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.4047C>A	5.37:g.41004595G>T						HEATR7B2_uc003jmi.3_Silent_p.I904I	p.I1349I	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN			37	4537	-			1349					Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	c.4047C>A	CCDS47202.1																																																																																				0.423	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		21	13	1	0	2.27731e-05	0.012319	2.55467e-05	21	13				
C6	729	broad.mit.edu	37	5	41176734	41176734	+	Silent	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:41176734G>C	ENST00000263413.3	-	8	1275	c.1011C>G	c.(1009-1011)gtC>gtG	p.V337V	C6_ENST00000475349.1_5'UTR|C6_ENST00000337836.5_Silent_p.V337V	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	337	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTTTCAAAAAGACATCAGAAA	0.383																																							uc003jmk.2		NA																	0				ovary(3)|central_nervous_system(2)|skin(2)	7						c.(1009-1011)GTC>GTG		complement component 6 precursor							129.0	127.0	128.0					5																	41176734		2203	4300	6503	SO:0001819	synonymous_variant	729				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding	g.chr5:41176734G>C	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1011C>G	5.37:g.41176734G>C						C6_uc003jml.1_Silent_p.V337V	p.V337V	NM_000065	NP_000056	P13671	CO6_HUMAN			8	1221	-		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)	337			MACPF.			Silent	SNP	ENST00000263413.3	37	c.1011C>G	CCDS3936.1																																																																																				0.383	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1			6	66	0	0	0	0.00308	0	6	66				
MEF2C	4208	broad.mit.edu	37	5	88018598	88018598	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:88018598C>A	ENST00000437473.2	-	11	1662	c.1245G>T	c.(1243-1245)gaG>gaT	p.E415D	MEF2C_ENST00000514015.1_Missense_Mutation_p.E383D|MEF2C_ENST00000510942.1_Missense_Mutation_p.E407D|MEF2C_ENST00000504921.2_Missense_Mutation_p.E415D|MEF2C_ENST00000539796.1_Missense_Mutation_p.E359D|CTC-467M3.1_ENST00000510274.1_RNA|MEF2C_ENST00000514028.1_Missense_Mutation_p.E415D|MEF2C_ENST00000424173.2_Missense_Mutation_p.E405D|MEF2C_ENST00000340208.5_Missense_Mutation_p.E425D|MEF2C_ENST00000508569.1_Missense_Mutation_p.E375D|MEF2C_ENST00000506554.1_Missense_Mutation_p.R391M	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	415					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		ATCTCCCCGCCTCGTGGCGCG	0.562										HNSCC(66;0.2)																													uc003kjj.2		NA																	0				lung(3)|breast(2)|ovary(1)|large_intestine(1)	7						c.(1243-1245)GAG>GAT		myocyte enhancer factor 2C isoform 1							114.0	121.0	119.0					5																	88018598		2022	4190	6212	SO:0001583	missense	4208				apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr5:88018598C>A	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.1245G>T	5.37:g.88018598C>A	ENSP00000396219:p.Glu415Asp	HNSCC(66;0.2)				MEF2C_uc003kji.2_Missense_Mutation_p.E407D|MEF2C_uc003kjk.2_Missense_Mutation_p.E415D|MEF2C_uc003kjm.2_Missense_Mutation_p.E405D|MEF2C_uc003kjl.2_Missense_Mutation_p.E425D	p.E415D	NM_002397	NP_002388	Q06413	MEF2C_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)	11	1918	-		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)	415					C9JMZ0|D7F7N5|F8W7V7	Missense_Mutation	SNP	ENST00000437473.2	37	c.1245G>T	CCDS47245.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.48|10.48	1.360640|1.360640	0.24598|0.24598	.|.	.|.	ENSG00000081189|ENSG00000081189	ENST00000340208;ENST00000424173;ENST00000504921;ENST00000514028;ENST00000437473;ENST00000510942;ENST00000508569;ENST00000514015;ENST00000539796|ENST00000506554	T;T;T;T;T;T;T;T;T|T	0.66099|0.66280	0.16;0.18;0.18;0.19;0.19;0.18;-0.19;-0.13;0.59|-0.2	5.69|5.69	4.81|4.81	0.61882|0.61882	.|.	0.474372|.	0.26297|.	N|.	0.025187|.	T|T	0.46852|0.46852	0.1414|0.1414	N|N	0.02296|0.02296	-0.605|-0.605	0.42761|0.42761	D|D	0.993802|0.993802	B;B;B;B|.	0.19817|.	0.001;0.039;0.001;0.0|.	B;B;B;B|.	0.16289|.	0.003;0.015;0.001;0.001|.	T|T	0.61695|0.61695	-0.7010|-0.7010	10|7	0.26408|0.72032	T|D	0.33|0.01	-3.0532|-3.0532	16.5707|16.5707	0.84612|0.84612	0.0:0.8693:0.1307:0.0|0.0:0.8693:0.1307:0.0	.|.	405;425;415;407|.	C9JMZ0;F8W7V7;Q06413;Q06413-2|.	.;.;MEF2C_HUMAN;.|.	D|M	425;405;415;415;415;407;375;383;359|391	ENSP00000340874:E425D;ENSP00000389610:E405D;ENSP00000421925:E415D;ENSP00000426665:E415D;ENSP00000396219:E415D;ENSP00000422390:E407D;ENSP00000423597:E375D;ENSP00000424606:E383D;ENSP00000441153:E359D|ENSP00000425636:R391M	ENSP00000340874:E425D|ENSP00000425636:R391M	E|R	-|-	3|2	2|0	MEF2C|MEF2C	88054354|88054354	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.898000|4.898000	0.63238|0.63238	1.499000|1.499000	0.48617|0.48617	0.655000|0.655000	0.94253|0.94253	GAG|AGG		0.562	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	NM_002397		14	40	1	0	3.45872e-05	0.004007	3.85526e-05	14	40				
POLR3G	10622	broad.mit.edu	37	5	89781433	89781433	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:89781433G>A	ENST00000399107.1	+	2	249	c.49G>A	c.(49-51)Gag>Aag	p.E17K	POLR3G_ENST00000514483.1_Missense_Mutation_p.E17K|POLR3G_ENST00000504930.1_Missense_Mutation_p.E17K	NM_006467.2	NP_006458.2	O15318	RPC7_HUMAN	polymerase (RNA) III (DNA directed) polypeptide G (32kD)	17					cell proliferation (GO:0008283)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	DNA-directed RNA polymerase activity (GO:0003899)			cervix(1)|endometrium(1)|kidney(2)|lung(4)|prostate(1)	9		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;2.74e-31)|Epithelial(54;8.2e-26)|all cancers(79;3.86e-22)		CTTTAATATTGAGGCTGTTGG	0.398																																							uc003kjq.2		NA																	0					0						c.(49-51)GAG>AAG		polymerase (RNA) III (DNA directed) polypeptide							129.0	116.0	120.0					5																	89781433		1859	4096	5955	SO:0001583	missense	10622				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA-directed RNA polymerase activity	g.chr5:89781433G>A	U93868	CCDS43337.1	5q14.3	2014-06-05			ENSG00000113356	ENSG00000113356		"""RNA polymerase subunits"""	30075	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006467		Approved	RPC32, RPC7	uc003kjq.3	O15318	OTTHUMG00000162809	ENST00000399107.1:c.49G>A	5.37:g.89781433G>A	ENSP00000382058:p.Glu17Lys					POLR3G_uc011cuc.1_Missense_Mutation_p.E17K	p.E17K	NM_006467	NP_006458	O15318	RPC7_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.74e-31)|Epithelial(54;8.2e-26)|all cancers(79;3.86e-22)	2	249	+		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)	17					A8MTH0	Missense_Mutation	SNP	ENST00000399107.1	37	c.49G>A	CCDS43337.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.679535	0.88542	.	.	ENSG00000113356	ENST00000512239;ENST00000505345;ENST00000503373;ENST00000503973;ENST00000399107;ENST00000504930;ENST00000514483	.	.	.	5.41	5.41	0.78517	.	0.093898	0.64402	D	0.000001	T	0.80154	0.4571	M	0.88640	2.97	0.49798	D	0.999821	D	0.67145	0.996	D	0.63381	0.914	D	0.83518	0.0084	9	0.72032	D	0.01	-34.1046	13.8199	0.63313	0.0:0.1535:0.8465:0.0	.	17	O15318	RPC7_HUMAN	K	17	.	ENSP00000382058:E17K	E	+	1	0	POLR3G	89817189	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.748000	0.62148	2.697000	0.92050	0.563000	0.77884	GAG		0.398	POLR3G-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370462.1	NM_006467		3	60	0	0	0	0.009096	0	3	60				
PCDHA7	56141	broad.mit.edu	37	5	140216127	140216127	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:140216127C>T	ENST00000525929.1	+	1	2159	c.2159C>T	c.(2158-2160)gCg>gTg	p.A720V	PCDHA7_ENST00000378125.3_Missense_Mutation_p.A720V|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	720					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTACACGGCGTTGCGGTGC	0.617																																					NSCLC(160;258 2013 5070 22440 28951)	NSCLC(160;258 2013 5070 22440 28951)	uc003lhq.2		NA																	0				ovary(2)|skin(2)	4						c.(2158-2160)GCG>GTG		protocadherin alpha 7 isoform 1 precursor							101.0	85.0	90.0					5																	140216127		2203	4300	6503	SO:0001583	missense	56141				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140216127C>T	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2159C>T	5.37:g.140216127C>T	ENSP00000436426:p.Ala720Val					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.A720V	p.A720V	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2159	+			720			Cytoplasmic (Potential).		O75282	Missense_Mutation	SNP	ENST00000525929.1	37	c.2159C>T	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183837	0.38609	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.16597	2.33;2.33	3.57	2.69	0.31865	.	0.289408	0.17547	U	0.170301	T	0.18635	0.0447	M	0.70842	2.15	0.25125	N	0.990613	B;B	0.24258	0.1;0.061	B;B	0.20577	0.03;0.021	T	0.14924	-1.0455	10	0.52906	T	0.07	.	7.5321	0.27689	0.0:0.7964:0.0:0.2036	.	720;720	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	V	720	ENSP00000436426:A720V;ENSP00000367365:A720V	ENSP00000367365:A720V	A	+	2	0	PCDHA7	140196311	0.000000	0.05858	0.948000	0.38648	0.598000	0.36846	-0.222000	0.09190	0.819000	0.34492	0.462000	0.41574	GCG		0.617	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910		28	45	0	0	0	0.009535	0	28	45				
PCDHA12	56137	broad.mit.edu	37	5	140256768	140256768	+	Missense_Mutation	SNP	G	G	A	rs201399892	byFrequency	TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:140256768G>A	ENST00000398631.2	+	1	1711	c.1711G>A	c.(1711-1713)Ggc>Agc	p.G571S	PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	571					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACTCCGGCTGGCAGCGCAGG	0.697													.|||	14	0.00279553	0.0106	0.0	5008	,	,		17897	0.0		0.0	False		,,,				2504	0.0				Pancreas(113;759 1672 13322 24104 50104)	Pancreas(113;759 1672 13322 24104 50104)	uc003lic.2		NA																	0					0						c.(1711-1713)GGC>AGC		protocadherin alpha 12 isoform 1 precursor		G	,,,SER/GLY,,,,,,,,,,,,SER/GLY	34,4372	38.4+/-70.7	0,34,2169	169.0	167.0	168.0		,,,1711,,,,,,,,,,,,1711	-0.6	0.0	5		168	0,8598		0,0,4299	yes	intron,intron,intron,missense,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,missense	PCDHA9,PCDHA12,PCDHA11,PCDHA10,PCDHA8,PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018901.2,NM_018902.3,NM_018903.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_018911.2,NM_031411.1,NM_031849.1,NM_031857.1,NM_031860.1,NM_031864.1	,,,56,,,,,,,,,,,,56	0,34,6468	AA,AG,GG		0.0,0.7717,0.2615	,,,,,,,,,,,,,,,	,,,571/942,,,,,,,,,,,,571/793	140256768	34,12970	2203	4299	6502	SO:0001583	missense	56137				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140256768G>A	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1711G>A	5.37:g.140256768G>A	ENSP00000381628:p.Gly571Ser					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Missense_Mutation_p.G571S	p.G571S	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1838	+			571			Extracellular (Potential).		O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	37	c.1711G>A	CCDS47285.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	0.006	-2.112686	0.00353	0.007717	0.0	ENSG00000251664	ENST00000398631	T	0.48836	0.8	3.63	-0.58	0.11717	Cadherin-like (1);	.	.	.	.	T	0.16599	0.0399	N	0.14661	0.345	0.09310	N	1	B;B	0.20671	0.02;0.047	B;B	0.18871	0.02;0.023	T	0.21999	-1.0229	9	0.11485	T	0.65	.	4.7151	0.12891	0.3763:0.1507:0.4731:0.0	.	571;571	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	S	571	ENSP00000381628:G571S	ENSP00000381628:G571S	G	+	1	0	PCDHA12	140236952	0.138000	0.22547	0.029000	0.17559	0.113000	0.19764	1.342000	0.33919	-0.216000	0.10048	0.561000	0.74099	GGC		0.697	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903		19	76	0	0	0	0.00333	0	19	76				
PCDHGA6	56109	broad.mit.edu	37	5	140754648	140754648	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:140754648T>A	ENST00000517434.1	+	1	998	c.998T>A	c.(997-999)gTc>gAc	p.V333D	PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	333	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGCGAAAGTCTTAATAACT	0.433																																							uc003ljy.1		NA																	0				breast(1)	1						c.(997-999)GTC>GAC		protocadherin gamma subfamily A, 6 isoform 1							154.0	160.0	158.0					5																	140754648		1899	4110	6009	SO:0001583	missense	56109				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140754648T>A	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.998T>A	5.37:g.140754648T>A	ENSP00000429601:p.Val333Asp					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.V333D	p.V333D	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	998	+			333			Cadherin 3.|Extracellular (Potential).		A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	37	c.998T>A	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	17.62	3.433720	0.62955	.	.	ENSG00000253731	ENST00000517434	T	0.61980	0.06	5.25	4.09	0.47781	Cadherin (5);Cadherin-like (1);	0.377762	0.14397	U	0.322152	D	0.85792	0.5779	H	0.98005	4.125	0.43000	D	0.994512	D;D	0.89917	1.0;0.998	D;D	0.77557	0.99;0.988	D	0.87646	0.2525	10	0.87932	D	0	.	10.959	0.47374	0.0:0.0739:0.0:0.9261	.	333;333	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	D	333	ENSP00000429601:V333D	ENSP00000429601:V333D	V	+	2	0	PCDHGA6	140734832	0.466000	0.25823	0.973000	0.42090	0.958000	0.62258	3.362000	0.52314	1.126000	0.42016	0.533000	0.62120	GTC		0.433	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919		48	103	0	0	0	0.01441	0	48	103				
PCDHGA12	26025	broad.mit.edu	37	5	140812657	140812657	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:140812657C>G	ENST00000252085.3	+	1	2473	c.2331C>G	c.(2329-2331)gaC>gaG	p.D777E	PCDHGA7_ENST00000518325.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	777					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTATGCAGACATGCTCGTCA	0.522																																							uc003lkt.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(2329-2331)GAC>GAG		protocadherin gamma subfamily A, 12 isoform 1							109.0	113.0	111.0					5																	140812657		2203	4300	6503	SO:0001583	missense	26025				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140812657C>G	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.2331C>G	5.37:g.140812657C>G	ENSP00000252085:p.Asp777Glu					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Missense_Mutation_p.D777E	p.D777E	NM_003735	NP_003726	O60330	PCDGC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2500	+			777			Cytoplasmic (Potential).		O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	37	c.2331C>G	CCDS4260.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.491396	0.64074	.	.	ENSG00000253159	ENST00000252085	T	0.47177	0.85	5.23	4.35	0.52113	.	.	.	.	.	T	0.67031	0.2850	M	0.81341	2.54	0.25234	N	0.989806	D;D	0.58620	0.983;0.97	P;P	0.61533	0.89;0.78	T	0.59337	-0.7473	9	0.59425	D	0.04	.	13.5596	0.61782	0.0:0.9246:0.0:0.0754	.	777;777	O60330-2;O60330	.;PCDGC_HUMAN	E	777	ENSP00000252085:D777E	ENSP00000252085:D777E	D	+	3	2	PCDHGA12	140792841	0.996000	0.38824	0.947000	0.38551	0.323000	0.28346	0.860000	0.27871	2.588000	0.87417	0.655000	0.94253	GAC		0.522	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735		11	127	0	0	0	0.013537	0	11	127				
PDGFRB	5159	broad.mit.edu	37	5	149513572	149513572	+	Splice_Site	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:149513572C>A	ENST00000261799.4	-	5	1101		c.e5-1			NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide						adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATGGATGACACTGGTAGAGAG	0.542			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																		uc003lro.2		NA		Dom	yes		5	5q31-q32	5159	T	"""platelet-derived growth factor receptor, beta polypeptide"""			L	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP		MPD|AML|CMML|CML		0				central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17						c.e5-1		platelet-derived growth factor receptor beta	Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)						130.0	112.0	118.0					5																	149513572		2203	4300	6503	SO:0001630	splice_region_variant	5159				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity	g.chr5:149513572C>A	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.632-1G>T	5.37:g.149513572C>A						PDGFRB_uc010jhd.2_Splice_Site_p.V50_splice|PDGFRB_uc011dcg.1_Splice_Site_p.V211_splice	p.V211_splice	NM_002609	NP_002600	P09619	PGFRB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		5	1101	-		all_hematologic(541;0.224)						B5A957|Q8N5L4	Splice_Site	SNP	ENST00000261799.4	37	c.632_splice	CCDS4303.1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.267959	0.23136	.	.	ENSG00000113721	ENST00000261799	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0211	0.64555	0.0:0.928:0.0:0.072	.	.	.	.	.	-1	.	.	.	-	.	.	PDGFRB	149493765	1.000000	0.71417	1.000000	0.80357	0.191000	0.23601	3.845000	0.55880	2.698000	0.92095	0.563000	0.77884	.		0.542	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609	Intron	13	74	1	0	3.45872e-05	0.004007	3.85526e-05	13	74				
FAM71B	153745	broad.mit.edu	37	5	156589685	156589685	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:156589685C>A	ENST00000302938.4	-	2	1686	c.1591G>T	c.(1591-1593)Gcc>Tcc	p.A531S		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	531						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATCTTACTGGCTTTCTTTTGT	0.473																																							uc003lwn.2		NA																	0				ovary(4)|pancreas(1)|skin(1)	6						c.(1591-1593)GCC>TCC		family with sequence similarity 71, member B							116.0	119.0	118.0					5																	156589685		2203	4300	6503	SO:0001583	missense	153745					nucleus		g.chr5:156589685C>A		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1591G>T	5.37:g.156589685C>A	ENSP00000305596:p.Ala531Ser						p.A531S	NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		2	1691	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	531					Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	c.1591G>T	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	C	9.852	1.193999	0.22037	.	.	ENSG00000170613	ENST00000302938	T	0.18960	2.18	3.87	-4.63	0.03359	.	0.581163	0.14481	N	0.316966	T	0.03871	0.0109	N	0.00729	-1.24	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31586	-0.9938	10	0.26408	T	0.33	-1.7985	2.8683	0.05609	0.5539:0.2272:0.1056:0.1133	.	531	Q8TC56	FA71B_HUMAN	S	531	ENSP00000305596:A531S	ENSP00000305596:A531S	A	-	1	0	FAM71B	156522263	0.914000	0.31030	0.068000	0.19968	0.439000	0.31926	-0.377000	0.07456	-0.965000	0.03591	-0.150000	0.13652	GCC		0.473	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		3	21	1	0	0.004672	0.004672	0.00485223	3	21				
ITK	3702	broad.mit.edu	37	5	156670710	156670710	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:156670710G>T	ENST00000422843.3	+	12	1290	c.1138G>T	c.(1138-1140)Ggc>Tgc	p.G380C	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	380	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	GGTGCATCTGGGCTACTGGCT	0.498			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)	Esophageal Squamous(70;1378 1469 8785 19883)	uc003lwo.1		NA		Dom	yes		5	5q31-q32	3702	T	IL2-inducible T-cell kinase			L	SYK		peripheral T-cell lymphoma		0				lung(12)|ovary(8)|skin(4)|stomach(1)|central_nervous_system(1)	26						c.(1138-1140)GGC>TGC		IL2-inducible T-cell kinase							174.0	172.0	173.0					5																	156670710		2203	4300	6503	SO:0001583	missense	3702				cellular defense response|intracellular signal transduction|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr5:156670710G>T	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1138G>T	5.37:g.156670710G>T	ENSP00000398655:p.Gly380Cys						p.G380C	NM_005546	NP_005537	Q08881	ITK_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		12	1220	+	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	380			Protein kinase.		B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	c.1138G>T	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029813	0.93575	.	.	ENSG00000113263	ENST00000422843	D	0.86694	-2.16	5.79	5.79	0.91817	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93575	0.7949	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.93856	0.7149	10	0.87932	D	0	.	18.2068	0.89857	0.0:0.0:1.0:0.0	.	380	Q08881	ITK_HUMAN	C	380	ENSP00000398655:G380C	ENSP00000398655:G380C	G	+	1	0	ITK	156603288	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	9.676000	0.98643	2.735000	0.93741	0.655000	0.94253	GGC		0.498	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2			17	68	1	0	1.22574e-08	0.014323	1.43481e-08	17	68				
CYFIP2	26999	broad.mit.edu	37	5	156712415	156712415	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:156712415A>C	ENST00000521420.1	+	2	135	c.44A>C	c.(43-45)gAc>gCc	p.D15A	CYFIP2_ENST00000318218.6_Missense_Mutation_p.D15A|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000522463.1_Missense_Mutation_p.D15A|CYFIP2_ENST00000347377.6_Missense_Mutation_p.D15A|CYFIP2_ENST00000377576.3_Missense_Mutation_p.D15A|CYFIP2_ENST00000541131.1_Missense_Mutation_p.D15A					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCAACGTGGACCTGCTTGAA	0.542																																							uc003lwq.2		NA																	0					0						c.(43-45)GAC>GCC		cytoplasmic FMR1 interacting protein 2							48.0	54.0	52.0					5																	156712415		2168	4276	6444	SO:0001583	missense	26999				apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding	g.chr5:156712415A>C	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.44A>C	5.37:g.156712415A>C	ENSP00000430904:p.Asp15Ala					CYFIP2_uc011ddn.1_Missense_Mutation_p.D15A|CYFIP2_uc011ddo.1_Missense_Mutation_p.D15A|CYFIP2_uc003lwr.2_Missense_Mutation_p.D15A|CYFIP2_uc003lws.2_Missense_Mutation_p.D15A|CYFIP2_uc003lwp.2_5'UTR	p.D15A	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		2	182	+	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	15						Missense_Mutation	SNP	ENST00000521420.1	37	c.44A>C		.	.	.	.	.	.	.	.	.	.	A	28.5	4.927241	0.92389	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131	T;T;T;T;T;T	0.41758	0.99;2.13;2.13;0.99;0.99;1.81	5.61	5.61	0.85477	.	0.041485	0.85682	D	0.000000	T	0.60274	0.2256	M	0.70595	2.14	0.80722	D	1	P;B;B;P;D	0.54601	0.909;0.41;0.068;0.498;0.967	P;B;B;B;P	0.59424	0.857;0.064;0.009;0.23;0.857	T	0.60026	-0.7343	10	0.40728	T	0.16	-42.2612	16.1025	0.81194	1.0:0.0:0.0:0.0	.	15;15;15;15;15	E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;CYFP2_HUMAN	A	15	ENSP00000325817:D15A;ENSP00000428009:D15A;ENSP00000430904:D15A;ENSP00000313567:D15A;ENSP00000366799:D15A;ENSP00000444645:D15A	ENSP00000325817:D15A	D	+	2	0	CYFIP2	156644993	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.794000	0.91867	2.254000	0.74563	0.533000	0.62120	GAC		0.542	CYFIP2-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000373710.1	NM_001037332		4	10	0	0	0	0.001168	0	4	10				
UNC5A	90249	broad.mit.edu	37	5	176300975	176300975	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr5:176300975C>G	ENST00000329542.4	+	7	1167	c.893C>G	c.(892-894)tCt>tGt	p.S298C	UNC5A_ENST00000261961.3_Missense_Mutation_p.S258C	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	298					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAGCTGCTTCTGGCCCTGAG	0.627																																							uc003mey.2		NA																	0				skin(1)	1						c.(892-894)TCT>TGT		netrin receptor Unc5h1 precursor							75.0	65.0	69.0					5																	176300975		2203	4300	6503	SO:0001583	missense	90249				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane		g.chr5:176300975C>G	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.893C>G	5.37:g.176300975C>G	ENSP00000332737:p.Ser298Cys					UNC5A_uc010jkg.1_Missense_Mutation_p.S258C	p.S298C	NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		7	1085	+	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	298			Extracellular (Potential).		B2RXE6|Q8TF26|Q96GP4	Missense_Mutation	SNP	ENST00000329542.4	37	c.893C>G	CCDS34299.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.27|16.27	3.076743|3.076743	0.55753|0.55753	.|.	.|.	ENSG00000113763|ENSG00000113763	ENST00000509580|ENST00000329542;ENST00000261961	.|T;T	.|0.53640	.|0.61;0.94	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	.|0.857734	.|0.10486	.|N	.|0.669033	T|T	0.62865|0.62865	0.2463|0.2463	M|M	0.62088|0.62088	1.915|1.915	0.09310|0.09310	N|N	0.999998|0.999998	.|D;D	.|0.58620	.|0.964;0.983	.|P;P	.|0.58013	.|0.831;0.682	T|T	0.54814|0.54814	-0.8237|-0.8237	5|10	.|0.51188	.|T	.|0.08	-30.3802|-30.3802	13.9831|13.9831	0.64317|0.64317	0.0:0.7212:0.2788:0.0|0.0:0.7212:0.2788:0.0	.|.	.|258;298	.|Q6ZN44-3;Q6ZN44	.|.;UNC5A_HUMAN	L|C	319|298;258	.|ENSP00000332737:S298C;ENSP00000261961:S258C	.|ENSP00000261961:S258C	F|S	+|+	3|2	2|0	UNC5A|UNC5A	176233581|176233581	0.017000|0.017000	0.18338|0.18338	0.774000|0.774000	0.31636|0.31636	0.883000|0.883000	0.51084|0.51084	2.482000|2.482000	0.45224|0.45224	2.485000|2.485000	0.83878|0.83878	0.491000|0.491000	0.48974|0.48974	TTC|TCT		0.627	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300		8	46	0	0	0	0.010729	0	8	46				
DSP	1832	broad.mit.edu	37	6	7568679	7568679	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:7568679G>A	ENST00000379802.3	+	11	1617	c.1276G>A	c.(1276-1278)Gag>Aag	p.E426K	DSP_ENST00000418664.2_Missense_Mutation_p.E426K	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	426	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GAAAGAACGAGAGAAAATCCT	0.383																																							uc003mxp.1		NA																	0				central_nervous_system(6)|ovary(2)|skin(1)	9						c.(1276-1278)GAG>AAG		desmoplakin isoform I							104.0	101.0	102.0					6																	7568679		2203	4300	6503	SO:0001583	missense	1832				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton	g.chr6:7568679G>A	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.1276G>A	6.37:g.7568679G>A	ENSP00000369129:p.Glu426Lys					DSP_uc003mxq.1_Missense_Mutation_p.E426K	p.E426K	NM_004415	NP_004406	P15924	DESP_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	11	1555	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	426			Globular 1.|Spectrin 1.|Interacts with plakophilin 1 and junction plakoglobin.		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	c.1276G>A	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	G	36	5.683951	0.96774	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	D;D	0.96830	-4.14;-4.14	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000006	D	0.97093	0.9050	L	0.49571	1.57	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.74023	0.982;0.982	D	0.95749	0.8790	10	0.36615	T	0.2	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	473;426	Q4LE79;P15924	.;DESP_HUMAN	K	426;426;231	ENSP00000369129:E426K;ENSP00000396591:E426K	ENSP00000369129:E426K	E	+	1	0	DSP	7513678	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.869000	0.99810	2.788000	0.95919	0.650000	0.86243	GAG		0.383	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		3	46	0	0	0	0.004672	0	3	46				
SYCP2L	221711	broad.mit.edu	37	6	10902949	10902949	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:10902949G>A	ENST00000283141.6	+	7	802	c.506G>A	c.(505-507)gGa>gAa	p.G169E	RP11-637O19.3_ENST00000480294.1_3'UTR|SYCP2L_ENST00000543878.1_Missense_Mutation_p.G10E	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	169						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			CTTAGCTTAGGATTCCTGGTG	0.358																																							uc003mzo.2		NA																	0				ovary(1)|skin(1)	2						c.(505-507)GGA>GAA		synaptonemal complex protein 2-like							112.0	104.0	106.0					6																	10902949		1848	4086	5934	SO:0001583	missense	221711					nucleus		g.chr6:10902949G>A	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.506G>A	6.37:g.10902949G>A	ENSP00000283141:p.Gly169Glu					SYCP2L_uc011din.1_Missense_Mutation_p.G10E|SYCP2L_uc010jow.2_5'UTR	p.G169E	NM_001040274	NP_001035364	Q5T4T6	SYC2L_HUMAN	Epithelial(50;0.239)		7	802	+	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	169					A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	ENST00000283141.6	37	c.506G>A	CCDS43423.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266668	0.80358	.	.	ENSG00000153157	ENST00000543878;ENST00000283141	T;T	0.55588	0.51;1.9	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000001	T	0.70902	0.3277	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73845	-0.3854	10	0.87932	D	0	-19.2878	19.3485	0.94374	0.0:0.0:1.0:0.0	.	10;169	B4DFB8;Q5T4T6	.;SYC2L_HUMAN	E	10;169	ENSP00000440676:G10E;ENSP00000283141:G169E	ENSP00000283141:G169E	G	+	2	0	SYCP2L	11010935	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	4.630000	0.61297	2.673000	0.90976	0.650000	0.86243	GGA		0.358	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3	NM_194299		11	19	0	0	0	0.013537	0	11	19				
JARID2	3720	broad.mit.edu	37	6	15511564	15511564	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:15511564G>A	ENST00000341776.2	+	13	3128	c.2884G>A	c.(2884-2886)Gat>Aat	p.D962N	JARID2_ENST00000397311.3_Missense_Mutation_p.D790N	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	962	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				CAAGCTGGAAGATGTGGTCCA	0.567																																							uc003nbj.2		NA																	0				ovary(2)|lung(1)|pancreas(1)	4						c.(2884-2886)GAT>AAT		jumonji, AT rich interactive domain 2 protein							125.0	107.0	113.0					6																	15511564		2203	4300	6503	SO:0001583	missense	3720				central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding	g.chr6:15511564G>A	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.2884G>A	6.37:g.15511564G>A	ENSP00000341280:p.Asp962Asn					JARID2_uc011div.1_Missense_Mutation_p.D790N	p.D962N	NM_004973	NP_004964	Q92833	JARD2_HUMAN			13	3128	+	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)	962			JmjC.		A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	c.2884G>A	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.824102	0.50739	.	.	ENSG00000008083	ENST00000341776;ENST00000397311	T;T	0.71934	-0.61;-0.61	5.09	5.09	0.68999	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.213333	0.50627	D	0.000115	T	0.41811	0.1175	N	0.17248	0.465	0.40049	D	0.975753	P	0.39717	0.684	B	0.41036	0.346	T	0.46233	-0.9206	10	0.33141	T	0.24	-12.3668	9.6259	0.39750	0.1574:0.0:0.8426:0.0	.	962	Q92833	JARD2_HUMAN	N	962;790	ENSP00000341280:D962N;ENSP00000380478:D790N	ENSP00000341280:D962N	D	+	1	0	JARID2	15619543	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	5.214000	0.65236	2.516000	0.84829	0.650000	0.86243	GAT		0.567	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973		12	95	0	0	0	0.006122	0	12	95				
TRIM31	11074	broad.mit.edu	37	6	30078327	30078327	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:30078327C>T	ENST00000376734.3	-	4	767	c.642G>A	c.(640-642)ggG>ggA	p.G214G	TRIM31_ENST00000485864.1_5'UTR|TRIM31-AS1_ENST00000440874.1_RNA|TRIM31_ENST00000540829.1_Silent_p.G214G	NM_007028.3	NP_008959.3	Q9BZY9	TRI31_HUMAN	tripartite motif containing 31	214					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral release from host cell (GO:1902186)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(2)	15						CATAGTGTTTCCCCGCTTCCG	0.512																																							uc003npg.1		NA																	0				lung(1)	1						c.(640-642)GGG>GGA		tripartite motif protein 31							198.0	178.0	185.0					6																	30078327		2203	4300	6503	SO:0001819	synonymous_variant	11074					mitochondrion	ligase activity|zinc ion binding	g.chr6:30078327C>T	AF230386	CCDS34374.1	6p21.3	2013-01-09	2011-01-25		ENSG00000204616	ENSG00000204616		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16289	protein-coding gene	gene with protein product		609316	"""tripartite motif-containing 31"""			11331580	Standard	XM_006714977		Approved	RNF, HCGI, C6orf13, HCG1	uc003npg.1	Q9BZY9	OTTHUMG00000031064	ENST00000376734.3:c.642G>A	6.37:g.30078327C>T						TRIM31_uc003npi.3_RNA	p.G214G	NM_007028	NP_008959	Q9BZY9	TRI31_HUMAN			4	752	-			214					A6NLX6|A9R9Q4|Q53H52|Q5RI37|Q5SRJ7|Q5SRJ8|Q5SS28|Q96AK4|Q96AP8|Q99579|Q9BZY8	Silent	SNP	ENST00000376734.3	37	c.642G>A	CCDS34374.1																																																																																				0.512	TRIM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076081.2			10	112	0	0	0	0.001855	0	10	112				
EHMT2	10919	broad.mit.edu	37	6	31855433	31855433	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:31855433C>T	ENST00000375537.4	-	15	1938	c.1932G>A	c.(1930-1932)cgG>cgA	p.R644R	EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375528.4_Silent_p.R667R|EHMT2_ENST00000375530.4_Silent_p.R610R|EHMT2_ENST00000395728.3_Silent_p.R701R	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	644					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						GGAGCTTCTTCCGCCTGCCAA	0.612																																							uc003nxz.1		NA																	0				ovary(1)	1						c.(1930-1932)CGG>CGA		euchromatic histone-lysine N-methyltransferase 2							103.0	91.0	95.0					6																	31855433		1511	2709	4220	SO:0001819	synonymous_variant	10919				DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding	g.chr6:31855433C>T	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.1932G>A	6.37:g.31855433C>T						EHMT2_uc003nxv.1_5'Flank|EHMT2_uc003nxw.1_5'Flank|EHMT2_uc003nxx.1_5'Flank|EHMT2_uc003nxy.1_Silent_p.R435R|EHMT2_uc011don.1_Silent_p.R667R|EHMT2_uc003nya.1_Silent_p.R610R	p.R644R	NM_006709	NP_006700	Q96KQ7	EHMT2_HUMAN			15	1942	-			644					B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Silent	SNP	ENST00000375537.4	37	c.1932G>A	CCDS4725.1																																																																																				0.612	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709		5	80	0	0	0	0.001168	0	5	80				
TDRD6	221400	broad.mit.edu	37	6	46659781	46659781	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:46659781A>T	ENST00000316081.6	+	1	3916	c.3916A>T	c.(3916-3918)Aaa>Taa	p.K1306*	TDRD6_ENST00000544460.1_Nonsense_Mutation_p.K1306*	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1306					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GCCTGGATTTAAAACAACTGT	0.323																																							uc003oyj.2		NA																	0				breast(3)|ovary(2)|skin(1)	6						c.(3916-3918)AAA>TAA		tudor domain containing 6							43.0	48.0	46.0					6																	46659781		2203	4298	6501	SO:0001587	stop_gained	221400				cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding	g.chr6:46659781A>T	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.3916A>T	6.37:g.46659781A>T	ENSP00000346065:p.Lys1306*					TDRD6_uc010jze.2_Nonsense_Mutation_p.K1300*	p.K1306*	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	Lung(136;0.192)		1	3916	+			1306					B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Nonsense_Mutation	SNP	ENST00000316081.6	37	c.3916A>T	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	A	42	9.302139	0.99130	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	.	.	.	5.95	5.95	0.96441	.	0.093915	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.7594	16.4159	0.83738	1.0:0.0:0.0:0.0	.	.	.	.	X	1306	.	ENSP00000346065:K1306X	K	+	1	0	TDRD6	46767740	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.082000	0.57635	2.279000	0.76181	0.533000	0.62120	AAA		0.323	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443		8	10	0	0	0	0.006214	0	8	10				
GPR115	221393	broad.mit.edu	37	6	47675035	47675035	+	Silent	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:47675035C>A	ENST00000283303.2	+	2	312	c.54C>A	c.(52-54)tcC>tcA	p.S18S	GPR115_ENST00000371220.1_Intron|GPR115_ENST00000327753.3_Silent_p.S18S	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	18					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						TCTTTCTGTCCACAGAATGTT	0.423																																					GBM(22;431 510 9010 26644 32828)	GBM(22;431 510 9010 26644 32828)	uc003oza.1		NA																	0				ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						c.(52-54)TCC>TCA		G-protein coupled receptor 115 precursor							179.0	162.0	168.0					6																	47675035		2203	4300	6503	SO:0001819	synonymous_variant	221393				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:47675035C>A	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.54C>A	6.37:g.47675035C>A						GPR115_uc003oyz.1_Intron|GPR115_uc003ozb.1_Silent_p.S16S	p.S18S	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN			2	312	+			18					B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Silent	SNP	ENST00000283303.2	37	c.54C>A	CCDS4922.2																																																																																				0.423	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838		13	47	1	0	4.35082e-09	0.010504	5.16199e-09	13	47				
COL9A1	1297	broad.mit.edu	37	6	70993463	70993463	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:70993463G>T	ENST00000357250.6	-	6	915	c.757C>A	c.(757-759)Cat>Aat	p.H253N	COL9A1_ENST00000370496.3_Missense_Mutation_p.H253N|COL9A1_ENST00000370499.4_5'Flank|COL9A1_ENST00000320755.7_5'Flank	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	253	Nonhelical region (NC4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GGCAGCTCATGGCAAGTTTCT	0.522																																							uc003pfg.3		NA																	0				ovary(4)	4						c.(757-759)CAT>AAT		alpha 1 type IX collagen isoform 1 precursor							123.0	98.0	107.0					6																	70993463		2203	4300	6503	SO:0001583	missense	1297				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding	g.chr6:70993463G>T		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.757C>A	6.37:g.70993463G>T	ENSP00000349790:p.His253Asn					COL9A1_uc003pff.3_5'Flank	p.H253N	NM_001851	NP_001842	P20849	CO9A1_HUMAN			6	916	-			253			Nonhelical region (NC4).	Zinc.	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	c.757C>A	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	G	7.733	0.699673	0.15106	.	.	ENSG00000112280	ENST00000357250;ENST00000370496	D;D	0.90844	-2.41;-2.74	5.56	4.68	0.58851	Concanavalin A-like lectin/glucanase (1);	0.220355	0.38492	N	0.001677	T	0.59128	0.2171	N	0.04508	-0.205	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.58103	-0.7695	10	0.07030	T	0.85	.	8.9415	0.35733	0.0:0.1528:0.5689:0.2783	.	253	P20849	CO9A1_HUMAN	N	253	ENSP00000349790:H253N;ENSP00000359527:H253N	ENSP00000349790:H253N	H	-	1	0	COL9A1	71050184	0.995000	0.38212	0.986000	0.45419	0.894000	0.52154	1.738000	0.38207	1.345000	0.45676	0.655000	0.94253	CAT		0.522	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			5	15	1	0	0.00198382	0.001984	0.00209137	5	15				
SH3BGRL2	83699	broad.mit.edu	37	6	80383466	80383466	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:80383466C>A	ENST00000369838.4	+	2	360	c.181C>A	c.(181-183)Cag>Aag	p.Q61K		NM_031469.2	NP_113657.1	Q9UJC5	SH3L2_HUMAN	SH3 domain binding glutamate-rich protein like 2	61						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				large_intestine(2)|lung(3)	5		all_cancers(76;0.00188)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.174)		BRCA - Breast invasive adenocarcinoma(397;0.0278)		GAAACCCACTCAGGGCAACCC	0.458																																							uc003piz.1		NA																	0					0						c.(181-183)CAG>AAG		SH3 domain binding glutamic acid-rich protein							124.0	132.0	129.0					6																	80383466		2203	4300	6503	SO:0001583	missense	83699					nucleus	SH3 domain binding	g.chr6:80383466C>A	AJ297972	CCDS4991.1	6q14.1	2014-02-19	2014-02-19		ENSG00000198478	ENSG00000198478			15567	protein-coding gene	gene with protein product		615678	"""SH3 domain binding glutamic acid-rich protein like 2"""			12095696	Standard	NM_031469		Approved		uc003piz.1	Q9UJC5	OTTHUMG00000015081	ENST00000369838.4:c.181C>A	6.37:g.80383466C>A	ENSP00000358853:p.Gln61Lys						p.Q61K	NM_031469	NP_113657	Q9UJC5	SH3L2_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0278)	2	360	+		all_cancers(76;0.00188)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.174)	61			SH3-binding (Potential).		A8MQU2|Q2VPC2|Q5VV96|Q6NSK8|Q6P9E8|Q7Z734|Q8IWD3|Q9BPY5	Missense_Mutation	SNP	ENST00000369838.4	37	c.181C>A	CCDS4991.1	.	.	.	.	.	.	.	.	.	.	C	1.608	-0.524665	0.04141	.	.	ENSG00000198478	ENST00000369838	T	0.75589	-0.95	5.75	5.75	0.90469	Thioredoxin-like fold (2);	0.100273	0.64402	D	0.000002	T	0.40886	0.1135	N	0.11724	0.165	0.41096	D	0.985632	B	0.14805	0.011	B	0.22152	0.038	T	0.48969	-0.8987	10	0.05721	T	0.95	-25.0623	18.9446	0.92616	0.0:1.0:0.0:0.0	.	61	Q9UJC5	SH3L2_HUMAN	K	61	ENSP00000358853:Q61K	ENSP00000358853:Q61K	Q	+	1	0	SH3BGRL2	80440185	1.000000	0.71417	0.983000	0.44433	0.124000	0.20399	4.648000	0.61425	2.708000	0.92522	0.650000	0.86243	CAG		0.458	SH3BGRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041309.1			7	68	1	0	0.00307968	0.00308	0.00321758	7	68				
GPRC6A	222545	broad.mit.edu	37	6	117113821	117113821	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:117113821C>G	ENST00000310357.3	-	6	2286	c.2265G>C	c.(2263-2265)atG>atC	p.M755I	GPRC6A_ENST00000368549.3_Missense_Mutation_p.M684I|GPRC6A_ENST00000530250.1_Missense_Mutation_p.M580I	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	755					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		TGTAGCCCAGCATGGTGCCAA	0.448																																							uc003pxj.1		NA																	0				ovary(4)|skin(2)	6						c.(2263-2265)ATG>ATC		G protein-coupled receptor, family C, group 6,							58.0	58.0	58.0					6																	117113821		2203	4300	6503	SO:0001583	missense	222545				response to amino acid stimulus		G-protein coupled receptor activity	g.chr6:117113821C>G	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.2265G>C	6.37:g.117113821C>G	ENSP00000309493:p.Met755Ile					GPRC6A_uc003pxk.1_Missense_Mutation_p.M580I|GPRC6A_uc003pxl.1_Missense_Mutation_p.M684I	p.M755I	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)	6	2287	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	755			Helical; Name=5; (Potential).		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	c.2265G>C	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	C	17.23	3.336783	0.60963	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.86956	-2.19;-2.19;-2.19	4.37	4.37	0.52481	GPCR, family 3, C-terminal (2);	0.000000	0.64402	D	0.000003	D	0.88314	0.6403	L	0.37507	1.11	0.47094	D	0.999313	P;D;D	0.89917	0.494;0.999;1.0	P;D;D	0.97110	0.479;0.996;1.0	D	0.88652	0.3183	10	0.46703	T	0.11	.	17.0959	0.86635	0.0:1.0:0.0:0.0	.	684;580;755	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	I	755;684;580	ENSP00000309493:M755I;ENSP00000357537:M684I;ENSP00000433465:M580I	ENSP00000309493:M755I	M	-	3	0	GPRC6A	117220514	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.165000	0.42396	2.270000	0.75569	0.591000	0.81541	ATG		0.448	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			9	20	0	0	0	0.013537	0	9	20				
PLEKHG1	57480	broad.mit.edu	37	6	151130291	151130291	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:151130291C>T	ENST00000358517.2	+	8	1174	c.963C>T	c.(961-963)taC>taT	p.Y321Y	PLEKHG1_ENST00000367328.1_Silent_p.Y321Y			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	321	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		TGACCAGCTACGGGGAACTGG	0.557																																							uc003qny.1		NA																	0				ovary(2)	2						c.(961-963)TAC>TAT		pleckstrin homology domain containing, family G							87.0	81.0	83.0					6																	151130291		2203	4300	6503	SO:0001819	synonymous_variant	57480				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr6:151130291C>T	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.963C>T	6.37:g.151130291C>T						PLEKHG1_uc011eel.1_Silent_p.Y361Y|PLEKHG1_uc011eem.1_Silent_p.Y380Y|PLEKHG1_uc003qnz.2_Silent_p.Y321Y	p.Y321Y	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)	9	1275	+			321			PH.		Q5T1F2	Silent	SNP	ENST00000358517.2	37	c.963C>T	CCDS34552.1																																																																																				0.557	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1			9	49	0	0	0	0.006214	0	9	49				
SNX9	51429	broad.mit.edu	37	6	158358492	158358492	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:158358492G>A	ENST00000392185.3	+	15	1641	c.1470G>A	c.(1468-1470)atG>atA	p.M490I		NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	490	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		ATTTCCTGATGGAATGTAATC	0.383																																							uc003qqv.1		NA																	0					0						c.(1468-1470)ATG>ATA		sorting nexin 9							156.0	149.0	152.0					6																	158358492		2203	4300	6503	SO:0001583	missense	51429				cell communication|intracellular protein transport|lipid tube assembly|positive regulation of GTPase activity|positive regulation of protein oligomerization|receptor-mediated endocytosis	clathrin-coated vesicle|cytoplasmic vesicle membrane|extrinsic to internal side of plasma membrane|ruffle|trans-Golgi network	1-phosphatidylinositol binding|protein homodimerization activity|ubiquitin protein ligase binding	g.chr6:158358492G>A	AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.1470G>A	6.37:g.158358492G>A	ENSP00000376024:p.Met490Ile						p.M490I	NM_016224	NP_057308	Q9Y5X1	SNX9_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)	15	1643	+		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)	490			BAR.		Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Missense_Mutation	SNP	ENST00000392185.3	37	c.1470G>A	CCDS5253.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.771286	0.90108	.	.	ENSG00000130340	ENST00000539592;ENST00000392185;ENST00000252631	T	0.36157	1.27	5.39	5.39	0.77823	Sorting nexin protein, WASP-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.38188	0.1031	L	0.49640	1.575	0.80722	D	1	P	0.51351	0.944	P	0.53809	0.735	T	0.02238	-1.1190	10	0.31617	T	0.26	-17.7104	19.1129	0.93326	0.0:0.0:1.0:0.0	.	490	Q9Y5X1	SNX9_HUMAN	I	490;490;290	ENSP00000376024:M490I	ENSP00000252631:M290I	M	+	3	0	SNX9	158278480	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	9.243000	0.95416	2.673000	0.90976	0.563000	0.77884	ATG		0.383	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042856.1			9	99	0	0	0	0.010729	0	9	99				
CCR6	1235	broad.mit.edu	37	6	167549755	167549755	+	Missense_Mutation	SNP	G	G	T	rs145768514		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:167549755G>T	ENST00000341935.5	+	3	589	c.37G>T	c.(37-39)Gac>Tac	p.D13Y	CCR6_ENST00000400926.2_Missense_Mutation_p.D13Y|CCR6_ENST00000349984.4_Missense_Mutation_p.D13Y|RP11-517H2.6_ENST00000609590.1_RNA	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	13					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		CGATGTTTTCGACTCCAGTGA	0.413																																							uc003qvl.2		NA																	0				ovary(1)	1						c.(37-39)GAC>TAC		chemokine (C-C motif) receptor 6							147.0	146.0	147.0					6																	167549755		2203	4300	6503	SO:0001583	missense	1235				cellular defense response|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|humoral immune response	integral to plasma membrane	C-C chemokine receptor activity	g.chr6:167549755G>T	U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.37G>T	6.37:g.167549755G>T	ENSP00000343952:p.Asp13Tyr					CCR6_uc010kkm.2_Missense_Mutation_p.D13Y|CCR6_uc003qvn.3_Missense_Mutation_p.D13Y|CCR6_uc003qvm.3_Missense_Mutation_p.D13Y	p.D13Y	NM_031409	NP_113597	P51684	CCR6_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)	13	2513	+		Breast(66;1.53e-05)|Ovarian(120;0.0606)	13			Extracellular (Potential).		E1P5C6|P78553|Q92846	Missense_Mutation	SNP	ENST00000341935.5	37	c.37G>T	CCDS5298.1	.	.	.	.	.	.	.	.	.	.	G	7.245	0.602116	0.13939	.	.	ENSG00000112486	ENST00000400926;ENST00000341935;ENST00000349984	T;T;T	0.67345	-0.26;-0.26;-0.26	4.42	-6.43	0.01926	.	302.783000	0.00357	U	0.000032	T	0.23054	0.0557	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.05386	-1.0888	10	0.17369	T	0.5	.	11.9182	0.52778	0.0:0.0946:0.1843:0.7211	.	13	P51684	CCR6_HUMAN	Y	13	ENSP00000383715:D13Y;ENSP00000343952:D13Y;ENSP00000339393:D13Y	ENSP00000343952:D13Y	D	+	1	0	CCR6	167469745	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.284000	0.08422	-1.178000	0.02741	-1.581000	0.00855	GAC		0.413	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043118.1			39	49	1	0	9.84934e-19	0.010771	1.30086e-18	39	49				
THBS2	7058	broad.mit.edu	37	6	169620303	169620303	+	Silent	SNP	G	G	A	rs184062464	byFrequency	TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr6:169620303G>A	ENST00000366787.3	-	22	3750	c.3501C>T	c.(3499-3501)taC>taT	p.Y1167Y	XXyac-YX65C7_A.2_ENST00000444188.1_RNA|THBS2_ENST00000488355.1_5'UTR	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	1167	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CTCTGCATTCGTACTTGAGGT	0.512													G|||	2	0.000399361	0.0	0.0014	5008	,	,		18998	0.001		0.0	False		,,,				2504	0.0				Esophageal Squamous(91;219 1934 18562 44706)	Esophageal Squamous(91;219 1934 18562 44706)	uc003qwt.2		NA																	0				ovary(5)	5						c.(3499-3501)TAC>TAT		thrombospondin 2 precursor							154.0	149.0	151.0					6																	169620303		2203	4300	6503	SO:0001819	synonymous_variant	7058				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity	g.chr6:169620303G>A		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.3501C>T	6.37:g.169620303G>A							p.Y1167Y	NM_003247	NP_003238	P35442	TSP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)	22	3749	-		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)	1167			TSP C-terminal.		A6H8N1|A7E232|Q5RI52	Silent	SNP	ENST00000366787.3	37	c.3501C>T	CCDS34574.1																																																																																				0.512	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		59	58	0	0	0	0.01441	0	59	58				
AGR3	155465	broad.mit.edu	37	7	16900125	16900125	+	Splice_Site	SNP	T	T	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:16900125T>A	ENST00000310398.2	-	7	520	c.450A>T	c.(448-450)ctA>ctT	p.L150L	AGR3_ENST00000402239.3_Silent_p.L150L	NM_176813.3	NP_789783.1	Q8TD06	AGR3_HUMAN	anterior gradient 3	150						extracellular region (GO:0005576)	dystroglycan binding (GO:0002162)			central_nervous_system(1)|kidney(8)|lung(2)|skin(1)|stomach(1)	13	Lung NSC(10;0.0376)|all_lung(11;0.0721)|all_epithelial(12;0.202)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		AATACTTACATAGGGGTAAAT	0.423																																							uc003sts.2		NA																	0					0						c.(448-450)CTA>CTT		breast cancer membrane protein 11 precursor							137.0	136.0	136.0					7																	16900125		2203	4300	6503	SO:0001630	splice_region_variant	155465					extracellular region		g.chr7:16900125T>A	AY069977	CCDS5365.1	7p21.1	2013-07-31	2013-07-31		ENSG00000173467	ENSG00000173467		"""Protein disulfide isomerases"""	24167	protein-coding gene	gene with protein product	"""breast cancer membrane protein 11"", ""protein disulfide isomerase family A, member 18"""	609482	"""anterior gradient 3 homolog (Xenopus laevis)"""			12592373, 12477722	Standard	NM_176813		Approved	HAG3, hAG-3, BCMP11, PDIA18	uc003sts.3	Q8TD06	OTTHUMG00000128411	ENST00000310398.2:c.451+1A>T	7.37:g.16900125T>A							p.L150L	NM_176813	NP_789783	Q8TD06	AGR3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.184)	7	523	-	Lung NSC(10;0.0376)|all_lung(11;0.0721)|all_epithelial(12;0.202)		150					A4D120	Silent	SNP	ENST00000310398.2	37	c.450A>T	CCDS5365.1																																																																																				0.423	AGR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250191.2	NM_176813	Silent	17	51	0	0	0	0.012319	0	17	51				
AHR	196	broad.mit.edu	37	7	17369593	17369593	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:17369593G>C	ENST00000242057.4	+	5	1111	c.468G>C	c.(466-468)caG>caC	p.Q156H		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	156	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	TCATACATCAGAGTGTATATG	0.348																																							uc011jxz.1		NA																	0				urinary_tract(1)|kidney(1)|pancreas(1)	3						c.(466-468)CAG>CAC		aryl hydrocarbon receptor precursor							75.0	76.0	76.0					7																	17369593		2203	4300	6503	SO:0001583	missense	196				apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding	g.chr7:17369593G>C	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.468G>C	7.37:g.17369593G>C	ENSP00000242057:p.Gln156His					AHR_uc003stt.3_RNA	p.Q156H	NM_001621	NP_001612	P35869	AHR_HUMAN			5	1081	+	Lung NSC(10;0.0392)|all_lung(11;0.0754)		156			PAS 1.		A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	c.468G>C	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.130960	0.77549	.	.	ENSG00000106546	ENST00000242057	T	0.17854	2.25	5.92	5.03	0.67393	PAS (2);PAS fold (1);	0.000000	0.85682	D	0.000000	T	0.38612	0.1047	M	0.80028	2.48	0.80722	D	1	P	0.46395	0.877	P	0.58577	0.841	T	0.10451	-1.0629	10	0.62326	D	0.03	.	11.502	0.50444	0.1373:0.0:0.8627:0.0	.	156	P35869	AHR_HUMAN	H	156	ENSP00000242057:Q156H	ENSP00000242057:Q156H	Q	+	3	2	AHR	17336118	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.625000	0.54238	2.795000	0.96236	0.655000	0.94253	CAG		0.348	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621		4	13	0	0	0	0.009096	0	4	13				
TBX20	57057	broad.mit.edu	37	7	35289601	35289601	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:35289601A>T	ENST00000408931.3	-	2	868	c.342T>A	c.(340-342)caT>caA	p.H114Q		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	114					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						TGCCCAGCTCATGGAATTTGT	0.582																																							uc011kas.1		NA																	0				central_nervous_system(1)	1						c.(340-342)CAT>CAA		T-box transcription factor TBX20							72.0	65.0	67.0					7																	35289601		2203	4300	6503	SO:0001583	missense	57057					nucleus	DNA binding	g.chr7:35289601A>T	AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.342T>A	7.37:g.35289601A>T	ENSP00000386170:p.His114Gln						p.H114Q	NM_001077653	NP_001071121	Q9UMR3	TBX20_HUMAN			2	353	-			114			T-box.		A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	ENST00000408931.3	37	c.342T>A	CCDS43568.1	.	.	.	.	.	.	.	.	.	.	A	17.80	3.479197	0.63849	.	.	ENSG00000164532	ENST00000408931	D	0.90676	-2.71	5.59	-0.646	0.11472	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.044953	0.85682	D	0.000000	D	0.93278	0.7858	M	0.75615	2.305	0.80722	D	1	D	0.71674	0.998	D	0.64321	0.924	D	0.91794	0.5446	10	0.87932	D	0	.	12.808	0.57624	0.6635:0.0:0.3365:0.0	.	114	Q9UMR3	TBX20_HUMAN	Q	114	ENSP00000386170:H114Q	ENSP00000386170:H114Q	H	-	3	2	TBX20	35256126	0.612000	0.27000	0.980000	0.43619	0.992000	0.81027	-0.110000	0.10824	-0.468000	0.06922	-0.242000	0.12053	CAT		0.582	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417		16	63	0	0	0	0.010504	0	16	63				
KIAA0895	23366	broad.mit.edu	37	7	36396957	36396957	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:36396957G>A	ENST00000297063.6	-	3	471	c.421C>T	c.(421-423)Cct>Tct	p.P141S	KIAA0895_ENST00000415803.2_Missense_Mutation_p.P128S|KIAA0895_ENST00000436884.1_5'UTR|KIAA0895_ENST00000480192.1_Intron|KIAA0895_ENST00000440378.1_Missense_Mutation_p.P90S|KIAA0895_ENST00000317020.6_Missense_Mutation_p.P90S|KIAA0895_ENST00000453212.1_Intron|KIAA0895_ENST00000338533.5_Missense_Mutation_p.P128S	NM_001100425.1	NP_001093895.1	Q8NCT3	K0895_HUMAN	KIAA0895	141										breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						GAAGTGTTAGGAGATTTGCTG	0.463																																							uc003tfd.2		NA																	0					0						c.(421-423)CCT>TCT		hypothetical protein LOC23366 isoform 1							112.0	98.0	102.0					7																	36396957		1903	4118	6021	SO:0001583	missense	23366							g.chr7:36396957G>A	BC028678	CCDS43570.1, CCDS47573.1, CCDS56482.1, CCDS56483.1, CCDS56484.1, CCDS75583.1	7p14.2	2008-11-27			ENSG00000164542	ENSG00000164542			22206	protein-coding gene	gene with protein product							Standard	NM_015314		Approved		uc003tfd.2	Q8NCT3	OTTHUMG00000154939	ENST00000297063.6:c.421C>T	7.37:g.36396957G>A	ENSP00000297063:p.Pro141Ser					KIAA0895_uc003tfc.2_Missense_Mutation_p.P128S|KIAA0895_uc011kaw.1_5'UTR|KIAA0895_uc003tfb.2_Missense_Mutation_p.P90S|KIAA0895_uc011kax.1_Missense_Mutation_p.P90S|KIAA0895_uc003tfe.2_Missense_Mutation_p.P128S|KIAA0895_uc011kay.1_Missense_Mutation_p.P90S	p.P141S	NM_001100425	NP_001093895	Q8NCT3	K0895_HUMAN			3	472	-			141					B4DF35|B7ZLT4|B9EGB9|O94969|Q0VGC1|Q7Z4L2	Missense_Mutation	SNP	ENST00000297063.6	37	c.421C>T	CCDS43570.1	.	.	.	.	.	.	.	.	.	.	G	2.124	-0.400653	0.04865	.	.	ENSG00000164542	ENST00000297063;ENST00000338533;ENST00000317020;ENST00000440378;ENST00000415803	.	.	.	5.98	4.18	0.49190	.	0.416798	0.30003	N	0.010651	T	0.21227	0.0511	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B;B	0.26744	0.158;0.021;0.019;0.006;0.008;0.008	B;B;B;B;B;B	0.20184	0.028;0.007;0.012;0.009;0.013;0.007	T	0.17258	-1.0375	9	0.44086	T	0.13	2.6052	2.6937	0.05128	0.1409:0.1124:0.4695:0.2772	.	90;90;128;141;128;90	B4DGN6;B7ZLT4;Q8NCT3-4;Q8NCT3;Q8NCT3-2;Q8NCT3-3	.;.;.;K0895_HUMAN;.;.	S	141;128;90;90;128	.	ENSP00000297063:P141S	P	-	1	0	KIAA0895	36363482	0.052000	0.20516	0.994000	0.49952	0.045000	0.14185	0.314000	0.19432	0.862000	0.35528	-0.257000	0.10917	CCT		0.463	KIAA0895-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337717.1	NM_015314		13	14	0	0	0	0.00245	0	13	14				
VWC2	375567	broad.mit.edu	37	7	49815691	49815692	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:49815691_49815692CC>AA	ENST00000340652.4	+	2	1216_1217	c.660_661CC>AA	c.(658-663)ttCCgg>ttAAgg	p.F220L		NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	220	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						ACTGCGAGTTCCGGGGCAAGAC	0.629																																							uc003tot.1		NA																	0					0						c.(658-663)TTCCGG>TTAAGG		von Willebrand factor C domain containing 2																																				SO:0001583	missense	375567				negative regulation of BMP signaling pathway|positive regulation of neuron differentiation	basement membrane|extracellular space		g.chr7:49815691_49815692CC>AA	AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	Exception_encountered	7.37:g.49815691_49815692delinsAA	ENSP00000341819:p.Phe220Leu						p.F220L	NM_198570	NP_940972	Q2TAL6	VWC2_HUMAN			2	1216_1217	+			220			VWFC 2.		Q6UXE2	Missense_Mutation	DNP	ENST00000340652.4	37	c.660_661CC>AA	CCDS5508.1																																																																																				0.629	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251375.2	NM_198570		3	7	0	0	0	0.004672	0	3	7				
ZNF479	90827	broad.mit.edu	37	7	57187809	57187809	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:57187809T>G	ENST00000331162.4	-	5	1583	c.1313A>C	c.(1312-1314)aAa>aCa	p.K438T		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TTCTTCACATTTGTAGGGTCT	0.453																																							uc010kzo.2		NA																	0				ovary(3)|skin(1)	4						c.(1312-1314)AAA>ACA		zinc finger protein 479							15.0	13.0	14.0					7																	57187809		1651	3694	5345	SO:0001583	missense	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57187809T>G	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1313A>C	7.37:g.57187809T>G	ENSP00000333776:p.Lys438Thr						p.K438T	NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		5	1584	-			438			C2H2-type 10.			Missense_Mutation	SNP	ENST00000331162.4	37	c.1313A>C	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	N	0.007	-1.944203	0.00479	.	.	ENSG00000185177	ENST00000331162	T	0.58060	0.36	0.955	-1.91	0.07641	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32133	0.0819	N	0.20574	0.59	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10497	-1.0627	9	0.59425	D	0.04	.	4.2411	0.10648	0.1773:0.0:0.4807:0.342	.	438	Q96JC4	ZN479_HUMAN	T	438	ENSP00000333776:K438T	ENSP00000333776:K438T	K	-	2	0	ZNF479	57191751	0.000000	0.05858	0.013000	0.15412	0.012000	0.07955	-1.673000	0.01951	-4.325000	0.00056	-4.471000	0.00005	AAA		0.453	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		4	64	0	0	0	0.000602	0	4	64				
RFC2	5982	broad.mit.edu	37	7	73663380	73663380	+	Silent	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:73663380G>C	ENST00000055077.3	-	4	354	c.294C>G	c.(292-294)ctC>ctG	p.L98L	RFC2_ENST00000352131.3_Silent_p.L98L	NM_181471.1	NP_852136.1	P35250	RFC2_HUMAN	replication factor C (activator 1) 2, 40kDa	98					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)	8						TGGCATCTTTGAGTGCTGGGC	0.527																																							uc003uaj.2		NA																	0				liver(1)|central_nervous_system(1)	2						c.(292-294)CTC>CTG		replication factor C 2 isoform 1							88.0	95.0	93.0					7																	73663380		2203	4300	6503	SO:0001819	synonymous_variant	5982				cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding	g.chr7:73663380G>C		CCDS5567.1, CCDS5568.1, CCDS75618.1	7q11.23	2010-04-21	2002-08-29		ENSG00000049541	ENSG00000049541		"""ATPases / AAA-type"""	9970	protein-coding gene	gene with protein product	"""activator 1"""	600404	"""replication factor C (activator 1) 2 (40kD)"""			1313560, 7774928	Standard	NM_181471		Approved	A1, RFC40	uc003uaj.3	P35250	OTTHUMG00000023239	ENST00000055077.3:c.294C>G	7.37:g.73663380G>C						RFC2_uc011kfa.1_RNA|RFC2_uc003uak.2_Silent_p.L98L|RFC2_uc010lbp.2_Silent_p.L61L|RFC2_uc003ual.2_5'UTR	p.L98L	NM_181471	NP_852136	P35250	RFC2_HUMAN			4	319	-			98					B5BU07|D3DXG3|P32846|Q9BU93	Silent	SNP	ENST00000055077.3	37	c.294C>G	CCDS5568.1																																																																																				0.527	RFC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252459.2	NM_181471		3	70	0	0	0	0.004672	0	3	70				
ANKIB1	54467	broad.mit.edu	37	7	92027106	92027106	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:92027106T>A	ENST00000265742.3	+	19	2841	c.2465T>A	c.(2464-2466)gTg>gAg	p.V822E		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	822							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCTATGAGTGTGCTGCACAGC	0.527																																							uc003ulw.2		NA																	0				lung(1)	1						c.(2464-2466)GTG>GAG		ankyrin repeat and IBR domain containing 1							178.0	185.0	183.0					7																	92027106		2001	4188	6189	SO:0001583	missense	54467						protein binding|zinc ion binding	g.chr7:92027106T>A	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.2465T>A	7.37:g.92027106T>A	ENSP00000265742:p.Val822Glu					ANKIB1_uc010lew.1_Missense_Mutation_p.V91E	p.V822E	NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		19	2841	+	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		822					Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	ENST00000265742.3	37	c.2465T>A	CCDS47639.1	.	.	.	.	.	.	.	.	.	.	T	16.58	3.162610	0.57368	.	.	ENSG00000001629	ENST00000265742	T	0.10860	2.83	5.87	4.74	0.60224	.	0.349077	0.30185	N	0.010208	T	0.09642	0.0237	N	0.24115	0.695	0.31624	N	0.649961	P;B	0.41188	0.741;0.039	B;B	0.41988	0.372;0.014	T	0.03630	-1.1018	10	0.72032	D	0.01	.	11.1041	0.48193	0.0:0.0738:0.0:0.9262	.	174;822	Q4VBX8;Q9P2G1	.;AKIB1_HUMAN	E	822	ENSP00000265742:V822E	ENSP00000265742:V822E	V	+	2	0	ANKIB1	91865042	1.000000	0.71417	0.587000	0.28692	0.823000	0.46562	3.086000	0.50159	1.173000	0.42796	0.533000	0.62120	GTG		0.527	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1			3	149	0	0	0	0.004672	0	3	149				
MUC17	140453	broad.mit.edu	37	7	100682585	100682585	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:100682585G>A	ENST00000306151.4	+	3	7952	c.7888G>A	c.(7888-7890)Gaa>Aaa	p.E2630K		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2630	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACTCCTAGTGAAGTAAGTAC	0.458																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(7888-7890)GAA>AAA		mucin 17 precursor							238.0	241.0	240.0					7																	100682585		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100682585G>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7888G>A	7.37:g.100682585G>A	ENSP00000302716:p.Glu2630Lys					MUC17_uc010lho.1_RNA	p.E2630K	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	7941	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2630			Extracellular (Potential).|59 X approximate tandem repeats.|42.|Ser-rich.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.7888G>A	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	8.526	0.869841	0.17322	.	.	ENSG00000169876	ENST00000306151	T	0.02050	4.48	0.522	0.522	0.17053	.	.	.	.	.	T	0.02047	0.0064	N	0.14661	0.345	0.09310	N	1	P	0.46578	0.88	P	0.50270	0.636	T	0.42361	-0.9456	9	0.08837	T	0.75	.	6.9491	0.24536	1.0E-4:0.0:0.9999:0.0	.	2630	Q685J3	MUC17_HUMAN	K	2630	ENSP00000302716:E2630K	ENSP00000302716:E2630K	E	+	1	0	MUC17	100469305	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.812000	0.04496	0.562000	0.29204	0.134000	0.15878	GAA		0.458	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		24	196	0	0	0	0.00632	0	24	196				
MUC17	140453	broad.mit.edu	37	7	100684763	100684763	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:100684763G>A	ENST00000306151.4	+	3	10130	c.10066G>A	c.(10066-10068)Gag>Aag	p.E3356K		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3356	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GGTCAGTTCTGAGGCTAGCAC	0.483																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(10066-10068)GAG>AAG		mucin 17 precursor							296.0	308.0	304.0					7																	100684763		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100684763G>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.10066G>A	7.37:g.100684763G>A	ENSP00000302716:p.Glu3356Lys					MUC17_uc010lho.1_RNA	p.E3356K	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	10119	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3356			Extracellular (Potential).|54.|59 X approximate tandem repeats.|Ser-rich.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.10066G>A	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	g	8.677	0.904280	0.17760	.	.	ENSG00000169876	ENST00000306151	T	0.01933	4.55	1.44	0.315	0.15852	.	.	.	.	.	T	0.03520	0.0101	N	0.24115	0.695	0.09310	N	1	D	0.58268	0.982	D	0.67548	0.952	T	0.38200	-0.9672	9	0.09338	T	0.73	.	6.2653	0.20924	0.0:0.0:0.6772:0.3228	.	3356	Q685J3	MUC17_HUMAN	K	3356	ENSP00000302716:E3356K	ENSP00000302716:E3356K	E	+	1	0	MUC17	100471483	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.387000	0.20718	-0.111000	0.12001	0.196000	0.17591	GAG		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		13	315	0	0	0	0.00245	0	13	315				
HYAL4	23553	broad.mit.edu	37	7	123516999	123516999	+	Silent	SNP	C	C	T	rs201879421		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:123516999C>T	ENST00000223026.4	+	5	1874	c.1236C>T	c.(1234-1236)gaC>gaT	p.D412D	HYAL4_ENST00000476325.1_Silent_p.D412D	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	412					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						CCTCTGAGGACGGGGAGTTTA	0.478													C|||	1	0.000199681	0.0	0.0	5008	,	,		19741	0.001		0.0	False		,,,				2504	0.0						uc003vlc.2		NA																	0				skin(1)	1						c.(1234-1236)GAC>GAT		hyaluronoglucosaminidase 4							127.0	123.0	124.0					7																	123516999		2203	4300	6503	SO:0001819	synonymous_variant	23553				fusion of sperm to egg plasma membrane|glycosaminoglycan catabolic process	integral to membrane	hyalurononglucosaminidase activity	g.chr7:123516999C>T	AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.1236C>T	7.37:g.123516999C>T						HYAL4_uc011knz.1_3'UTR	p.D412D	NM_012269	NP_036401	Q2M3T9	HYAL4_HUMAN			5	1874	+			412			Extracellular (Potential).		D0VXG1|Q9UL99|Q9Y6T9	Silent	SNP	ENST00000223026.4	37	c.1236C>T	CCDS5789.1																																																																																				0.478	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348545.1	NM_012269		5	46	0	0	0	0.000602	0	5	46				
GRM8	2918	broad.mit.edu	37	7	126410032	126410032	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:126410032G>A	ENST00000339582.2	-	7	2052	c.1244C>T	c.(1243-1245)gCc>gTc	p.A415V	GRM8_ENST00000444921.2_Missense_Mutation_p.A415V|GRM8_ENST00000405249.1_Missense_Mutation_p.A415V|GRM8_ENST00000358373.3_Missense_Mutation_p.A415V|GRM8_ENST00000480995.1_5'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	415					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				ATTGTGCAGGGCGTAAGCCAT	0.438										HNSCC(24;0.065)																													uc003vlr.2		NA																	0				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23						c.(1243-1245)GCC>GTC		glutamate receptor, metabotropic 8 isoform a	L-Glutamic Acid(DB00142)						129.0	113.0	118.0					7																	126410032		2203	4300	6503	SO:0001583	missense	2918				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane		g.chr7:126410032G>A		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1244C>T	7.37:g.126410032G>A	ENSP00000344173:p.Ala415Val	HNSCC(24;0.065)				GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.A415V|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_Missense_Mutation_p.A136V	p.A415V	NM_000845	NP_000836	O00222	GRM8_HUMAN			6	1555	-		Prostate(267;0.186)	415			Extracellular (Potential).		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	37	c.1244C>T	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688671	0.68271	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249	D;D;D;D	0.94828	-3.53;-3.53;-3.53;-3.53	5.88	5.88	0.94601	Extracellular ligand-binding receptor (1);	0.055575	0.64402	D	0.000001	D	0.98343	0.9450	H	0.96333	3.805	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.87578	0.991;0.99;0.998	D	0.99091	1.0840	10	0.87932	D	0	.	19.2147	0.93772	0.0:0.0:1.0:0.0	.	415;415;415	O00222-3;O00222-2;O00222	.;.;GRM8_HUMAN	V	415	ENSP00000344173:A415V;ENSP00000409790:A415V;ENSP00000351142:A415V;ENSP00000385731:A415V	ENSP00000344173:A415V	A	-	2	0	GRM8	126197268	1.000000	0.71417	0.951000	0.38953	0.025000	0.11179	9.864000	0.99589	2.769000	0.95229	0.655000	0.94253	GCC		0.438	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			6	40	0	0	0	0.001168	0	6	40				
AKR1B10	57016	broad.mit.edu	37	7	134216764	134216764	+	Silent	SNP	A	A	G	rs202083279		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:134216764A>G	ENST00000359579.4	+	3	659	c.339A>G	c.(337-339)ccA>ccG	p.P113P	AKR1B10_ENST00000475559.1_3'UTR	NM_020299.4	NP_064695.3	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10 (aldose reductase)	113					cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aldo-keto reductase (NADP) activity (GO:0004033)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(9)|skin(5)	20						TTCACTGGCCACAGGGATTCA	0.507																																							uc003vrr.2		NA																	0				skin(5)	5						c.(337-339)CCA>CCG		aldo-keto reductase family 1, member B10							147.0	144.0	145.0					7																	134216764		2203	4300	6503	SO:0001819	synonymous_variant	57016				cellular aldehyde metabolic process|digestion|steroid metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|protein binding	g.chr7:134216764A>G	AF052577	CCDS5832.1	7q33	2010-04-08			ENSG00000198074	ENSG00000198074		"""Aldo-keto reductases"""	382	protein-coding gene	gene with protein product	"""aldose reductase-like 1"", ""aldo-keto reductase family 1, member B11 (aldose reductase-like)"", ""aldose reductase-like peptide"", ""aldose reductase-related protein"", ""small intestine reductase"""	604707		AKR1B11		9765596, 9565553	Standard	NM_020299		Approved	AKR1B12, ARL-1, HIS, ARL1, HSI, ALDRLn	uc003vrr.3	O60218	OTTHUMG00000155356	ENST00000359579.4:c.339A>G	7.37:g.134216764A>G							p.P113P	NM_020299	NP_064695	O60218	AK1BA_HUMAN			3	659	+			113					A4D1P1|O75890|Q6FHF3|Q8IWZ1	Silent	SNP	ENST00000359579.4	37	c.339A>G	CCDS5832.1																																																																																				0.507	AKR1B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339615.1	NM_020299		5	78	0	0	0	0.001168	0	5	78				
DGKI	9162	broad.mit.edu	37	7	137172408	137172408	+	Missense_Mutation	SNP	C	C	A	rs148779791		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:137172408C>A	ENST00000288490.5	-	23	2330	c.2330G>T	c.(2329-2331)cGt>cTt	p.R777L	DGKI_ENST00000446122.1_Missense_Mutation_p.R759L|DGKI_ENST00000424189.2_Missense_Mutation_p.R780L|DGKI_ENST00000453654.2_Missense_Mutation_p.R477L	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	777					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						ACAGTCTCCACGCACAACTAG	0.368																																							uc003vtt.2		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(2329-2331)CGT>CTT		diacylglycerol kinase, iota							146.0	151.0	149.0					7																	137172408		2203	4300	6503	SO:0001583	missense	9162				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chr7:137172408C>A	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2330G>T	7.37:g.137172408C>A	ENSP00000288490:p.Arg777Leu					DGKI_uc003vtu.2_Missense_Mutation_p.R477L	p.R777L	NM_004717	NP_004708	O75912	DGKI_HUMAN			23	2331	-			777					A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	c.2330G>T	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095199	0.76870	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.35236	1.89;1.32;1.53	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.39860	0.1094	L	0.51422	1.61	0.80722	D	1	P;P	0.47034	0.582;0.889	B;B	0.42087	0.155;0.375	T	0.27905	-1.0060	10	0.62326	D	0.03	.	19.0482	0.93030	0.0:1.0:0.0:0.0	.	477;777	E9PFX6;O75912	.;DGKI_HUMAN	L	477;725;780;777;759	ENSP00000392161:R477L;ENSP00000288490:R777L;ENSP00000399131:R759L	ENSP00000288490:R777L	R	-	2	0	DGKI	136822948	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.102000	0.64572	2.808000	0.96608	0.650000	0.86243	CGT		0.368	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717		39	109	1	0	1.83081e-24	0.01441	2.45511e-24	39	109				
EPHA1	2041	broad.mit.edu	37	7	143096797	143096797	+	Missense_Mutation	SNP	C	C	A	rs201209720	byFrequency	TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:143096797C>A	ENST00000275815.3	-	4	868	c.782G>T	c.(781-783)cGg>cTg	p.R261L		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	261	Cys-rich.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				ACAGTGGCACCGTCCTACAGG	0.657																																							uc003wcz.2		NA																	0				ovary(3)|lung(1)|breast(1)	5						c.(781-783)CGG>CTG		ephrin receptor EphA1 precursor							40.0	44.0	43.0					7																	143096797		2203	4300	6503	SO:0001583	missense	2041					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:143096797C>A	M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.782G>T	7.37:g.143096797C>A	ENSP00000275815:p.Arg261Leu						p.R261L	NM_005232	NP_005223	P21709	EPHA1_HUMAN			4	869	-	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)	261			Extracellular (Potential).|Cys-rich.		A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	ENST00000275815.3	37	c.782G>T	CCDS5884.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313498	0.40996	.	.	ENSG00000146904	ENST00000275815	D	0.97279	-4.32	5.22	-0.967	0.10316	Tyrosine-protein kinase, receptor class V, conserved site (1);Growth factor, receptor (1);	0.651298	0.14092	N	0.341931	D	0.94624	0.8267	M	0.68317	2.08	0.09310	N	1	B	0.32203	0.36	B	0.25987	0.065	D	0.87897	0.2688	10	0.72032	D	0.01	.	11.1324	0.48354	0.0:0.4279:0.0:0.5721	.	261	P21709	EPHA1_HUMAN	L	261	ENSP00000275815:R261L	ENSP00000275815:R261L	R	-	2	0	EPHA1	142806919	0.000000	0.05858	0.043000	0.18650	0.926000	0.56050	-0.666000	0.05280	-0.408000	0.07565	0.655000	0.94253	CGG		0.657	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1			16	52	1	0	3.57192e-18	0.006122	4.6999e-18	16	52				
TAS2R41	259287	broad.mit.edu	37	7	143175698	143175698	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:143175698C>G	ENST00000408916.1	+	1	733	c.733C>G	c.(733-735)Ctg>Gtg	p.L245V	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	245					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					TCTTTATGCTCTGTCCTTTCT	0.502																																							uc003wdc.1		NA																	0				pancreas(1)|skin(1)	2						c.(733-735)CTG>GTG		taste receptor, type 2, member 41							111.0	115.0	114.0					7																	143175698		2051	4210	6261	SO:0001583	missense	259287				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr7:143175698C>G	AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.733C>G	7.37:g.143175698C>G	ENSP00000386201:p.Leu245Val					uc003wda.2_Intron	p.L245V	NM_176883	NP_795364	P59536	T2R41_HUMAN			1	733	+	Melanoma(164;0.15)		245			Helical; Name=6; (Potential).		P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Missense_Mutation	SNP	ENST00000408916.1	37	c.733C>G	CCDS43663.1	.	.	.	.	.	.	.	.	.	.	C	1.915	-0.449736	0.04572	.	.	ENSG00000221855	ENST00000408916	T	0.38077	1.16	6.0	0.862	0.19056	.	0.868416	0.09335	N	0.816328	T	0.25680	0.0625	L	0.38531	1.155	0.09310	N	1	P	0.36733	0.567	B	0.37387	0.248	T	0.20075	-1.0286	10	0.20519	T	0.43	.	6.0546	0.19804	0.2703:0.5516:0.1067:0.0715	.	245	P59536	T2R41_HUMAN	V	245	ENSP00000386201:L245V	ENSP00000386201:L245V	L	+	1	2	TAS2R41	142885820	0.000000	0.05858	0.008000	0.14137	0.019000	0.09904	-0.387000	0.07361	0.071000	0.16664	0.655000	0.94253	CTG		0.502	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342149.1			6	57	0	0	0	0.00308	0	6	57				
ZNF862	643641	broad.mit.edu	37	7	149557595	149557595	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:149557595A>G	ENST00000223210.4	+	7	1591	c.1346A>G	c.(1345-1347)gAa>gGa	p.E449G	RP4-751H13.7_ENST00000608963.1_RNA	NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						ATTTGTGAGGAAGGAGATGGA	0.567																																							uc010lpn.2		NA																	0				skin(1)	1						c.(1345-1347)GAA>GGA		zinc finger protein 862							110.0	120.0	117.0					7																	149557595		2073	4212	6285	SO:0001583	missense	643641				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|nucleic acid binding|protein dimerization activity	g.chr7:149557595A>G	AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.1346A>G	7.37:g.149557595A>G	ENSP00000223210:p.Glu449Gly					ZNF862_uc003wgm.2_RNA	p.E449G	NM_001099220	NP_001092690	O60290	ZN862_HUMAN			7	1538	+			449					A0AUL8	Missense_Mutation	SNP	ENST00000223210.4	37	c.1346A>G	CCDS47741.1	.	.	.	.	.	.	.	.	.	.	A	14.92	2.680112	0.47886	.	.	ENSG00000106479	ENST00000223210	T	0.01234	5.13	5.19	2.72	0.32119	.	0.346769	0.24606	N	0.037095	T	0.02455	0.0075	M	0.65975	2.015	0.09310	N	1	P	0.52577	0.954	P	0.45310	0.476	T	0.43702	-0.9375	10	0.51188	T	0.08	-29.7212	5.7731	0.18263	0.6548:0.1765:0.0:0.1687	.	449	O60290	ZN862_HUMAN	G	449	ENSP00000223210:E449G	ENSP00000223210:E449G	E	+	2	0	ZNF862	149188528	0.004000	0.15560	0.003000	0.11579	0.026000	0.11368	1.414000	0.34736	0.277000	0.22141	-0.333000	0.08304	GAA		0.567	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350165.1	NM_001099220		26	59	0	0	0	0.007291	0	26	59				
KCNH2	3757	broad.mit.edu	37	7	150643967	150643967	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:150643967G>C	ENST00000262186.5	-	14	3729	c.3328C>G	c.(3328-3330)Cag>Gag	p.Q1110E	KCNH2_ENST00000392968.2_Missense_Mutation_p.Q1014E|KCNH2_ENST00000330883.4_Missense_Mutation_p.Q770E	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	1110					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GAGCTTACCTGAGAAAGCGAG	0.642																																					GBM(137;110 1844 13671 20123 45161)	GBM(137;110 1844 13671 20123 45161)	uc003wic.2		NA																	0				skin(3)|ovary(1)	4						c.(3328-3330)CAG>GAG		voltage-gated potassium channel, subfamily H,	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)						63.0	54.0	57.0					7																	150643967		2203	4300	6503	SO:0001583	missense	3757				blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity	g.chr7:150643967G>C	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.3328C>G	7.37:g.150643967G>C	ENSP00000262186:p.Gln1110Glu					KCNH2_uc003wib.2_Missense_Mutation_p.Q770E|KCNH2_uc011kux.1_Missense_Mutation_p.Q1014E	p.Q1110E	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	14	3341	-	all_neural(206;0.219)		1110			Cytoplasmic (Potential).		A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	c.3328C>G	CCDS5910.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.10|13.10	2.137259|2.137259	0.37728|0.37728	.|.	.|.	ENSG00000055118|ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186|ENST00000350328	D;D;D|.	0.98617|.	-4.75;-4.82;-5.03|.	4.89|4.89	4.89|4.89	0.63831|0.63831	.|.	0.317543|.	0.27956|.	N|.	0.017165|.	T|.	0.56804|.	0.2010|.	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	P;P;P|.	0.51933|.	0.915;0.915;0.949|.	B;B;B|.	0.44224|.	0.258;0.258;0.444|.	T|.	0.55444|.	-0.8140|.	10|.	0.05620|0.36615	T|T	0.96|0.2	.|.	15.9235|15.9235	0.79592|0.79592	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1014;1110;770|.	C4PFH9;Q12809;Q12809-2|.	.;KCNH2_HUMAN;.|.	E|X	770;1014;1110|386	ENSP00000328531:Q770E;ENSP00000376695:Q1014E;ENSP00000262186:Q1110E|.	ENSP00000262186:Q1110E|ENSP00000309393:S386X	Q|S	-|-	1|2	0|0	KCNH2|KCNH2	150274900|150274900	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.764000|0.764000	0.43329|0.43329	4.957000|4.957000	0.63652|0.63652	2.426000|2.426000	0.82243|0.82243	0.484000|0.484000	0.47621|0.47621	CAG|TCA		0.642	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238		7	64	0	0	0	0.00308	0	7	64				
RP1L1	94137	broad.mit.edu	37	8	10470721	10470721	+	Missense_Mutation	SNP	G	G	A	rs201669521		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:10470721G>A	ENST00000382483.3	-	4	1110	c.887C>T	c.(886-888)aCg>aTg	p.T296M		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	296					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTGAGCTGGCGTGTCCTGAGG	0.657																																							uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(886-888)ACG>ATG		retinitis pigmentosa 1-like 1		G	MET/THR	2,3944		0,2,1971	64.0	71.0	69.0		887	-3.1	0.0	8		69	0,8298		0,0,4149	yes	missense	RP1L1	NM_178857.5	81	0,2,6120	AA,AG,GG		0.0,0.0507,0.0163	possibly-damaging	296/2401	10470721	2,12242	1973	4149	6122	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10470721G>A	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.887C>T	8.37:g.10470721G>A	ENSP00000371923:p.Thr296Met						p.T296M	NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	1116	-			296					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.887C>T	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.313943	0.40996	5.07E-4	0.0	ENSG00000183638	ENST00000382483	T	0.04317	3.65	5.12	-3.14	0.05250	.	1.027830	0.07817	N	0.959233	T	0.02083	0.0065	N	0.14661	0.345	0.09310	N	1	P	0.39551	0.678	B	0.28991	0.097	T	0.47799	-0.9089	10	0.23891	T	0.37	-0.0121	5.7441	0.18110	0.54:0.0:0.2421:0.2179	.	296	A6NKC6	.	M	296	ENSP00000371923:T296M	ENSP00000371923:T296M	T	-	2	0	RP1L1	10508131	0.001000	0.12720	0.007000	0.13788	0.647000	0.38526	-0.234000	0.09028	-0.269000	0.09298	0.591000	0.81541	ACG		0.657	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			14	45	0	0	0	0.00245	0	14	45				
HOOK3	84376	broad.mit.edu	37	8	42841831	42841831	+	Silent	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:42841831G>A	ENST00000307602.4	+	15	1625	c.1425G>A	c.(1423-1425)aaG>aaA	p.K475K		NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	475					cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			ATGAGAATAAGATGTTAAAGC	0.343			T	RET	papillary thyroid																																		uc003xpr.2		NA		Dom	yes		8	8p11.21	84376	T	hook homolog 3			E	RET		papillary thyroid		0				ovary(1)|breast(1)	2						c.(1423-1425)AAG>AAA		golgi-associated microtubule-binding protein							97.0	101.0	100.0					8																	42841831		2203	4300	6503	SO:0001819	synonymous_variant	84376				cytoplasmic microtubule organization|early endosome to late endosome transport|endosome organization|endosome to lysosome transport|Golgi localization|interkinetic nuclear migration|lysosome organization|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome|protein transport	cis-Golgi network|FHF complex|microtubule|pericentriolar material	identical protein binding|microtubule binding	g.chr8:42841831G>A	AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.1425G>A	8.37:g.42841831G>A						HOOK3_uc010lxq.1_Silent_p.K475K	p.K475K	NM_032410	NP_115786	Q86VS8	HOOK3_HUMAN	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)		15	1667	+	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	475			Potential.		D3DSY8|Q8NBH0|Q9BY13	Silent	SNP	ENST00000307602.4	37	c.1425G>A	CCDS6139.1																																																																																				0.343	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383172.2	NM_032410		4	34	0	0	0	0.000602	0	4	34				
SNAI2	6591	broad.mit.edu	37	8	49832849	49832849	+	Silent	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:49832849G>A	ENST00000396822.1	-	3	588	c.231C>T	c.(229-231)tcC>tcT	p.S77S	SNAI2_ENST00000020945.1_Silent_p.S77S			O43623	SNAI2_HUMAN	snail family zinc finger 2	77					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				AGGAGTATCCGGAAAGAGGAG	0.567																																							uc003xqp.2		NA																	0				ovary(2)	2						c.(229-231)TCC>TCT		snail 2							97.0	101.0	100.0					8																	49832849		2203	4300	6503	SO:0001819	synonymous_variant	6591				canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:49832849G>A	U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.231C>T	8.37:g.49832849G>A							p.S77S	NM_003068	NP_003059	O43623	SNAI2_HUMAN			2	395	-		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)	77					B2R6P6|Q53FC1	Silent	SNP	ENST00000396822.1	37	c.231C>T	CCDS6146.1																																																																																				0.567	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313873.2	NM_003068		6	66	0	0	0	0.001168	0	6	66				
PXDNL	137902	broad.mit.edu	37	8	52320897	52320897	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:52320897C>A	ENST00000356297.4	-	17	3387	c.3287G>T	c.(3286-3288)gGg>gTg	p.G1096V	PXDNL_ENST00000543296.1_Missense_Mutation_p.G1096V	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1096					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CGGGTCTATCCCACCTTCCTT	0.547																																							uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(3286-3288)GGG>GTG		peroxidasin homolog-like precursor							54.0	57.0	56.0					8																	52320897		1874	4101	5975	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52320897C>A		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3287G>T	8.37:g.52320897C>A	ENSP00000348645:p.Gly1096Val					PXDNL_uc003xqt.3_RNA	p.G1096V	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN			17	3388	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	1096					B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.3287G>T	CCDS47855.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.07|12.07	1.826116|1.826116	0.32237|0.32237	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000356297;ENST00000543296|ENST00000522933	T;T|.	0.76839|.	-1.05;-1.05|.	3.82|3.82	2.88|2.88	0.33553|0.33553	.|.	0.117488|0.117488	0.37857|0.37857	N|N	0.001920|0.001920	T|.	0.74816|.	0.3766|.	M|M	0.86097|0.86097	2.795|2.795	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|.	0.75814|.	-0.3185|.	10|.	0.87932|0.72032	D|D	0|0.01	.|.	9.9032|9.9032	0.41359|0.41359	0.2058:0.7942:0.0:0.0|0.2058:0.7942:0.0:0.0	.|.	1096|.	A1KZ92|.	PXDNL_HUMAN|.	V|X	1096|215	ENSP00000348645:G1096V;ENSP00000444865:G1096V|.	ENSP00000348645:G1096V|ENSP00000428114:G215X	G|G	-|-	2|1	0|0	PXDNL|PXDNL	52483450|52483450	0.982000|0.982000	0.34865|0.34865	0.009000|0.009000	0.14445|0.14445	0.007000|0.007000	0.05969|0.05969	3.975000|3.975000	0.56859|0.56859	0.502000|0.502000	0.28037|0.28037	0.655000|0.655000	0.94253|0.94253	GGG|GGA		0.547	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		11	30	1	0	1.41608e-15	0.001855	1.82216e-15	11	30				
CLVS1	157807	broad.mit.edu	37	8	62371093	62371093	+	Silent	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:62371093G>T	ENST00000519846.1	+	6	1441	c.969G>T	c.(967-969)ctG>ctT	p.L323L	CLVS1_ENST00000518592.1_Silent_p.L44L|CLVS1_ENST00000325897.4_Silent_p.L323L			Q8IUQ0	CLVS1_HUMAN	clavesin 1	323					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						CACCCAAGCTGATGAAAAGGT	0.433																																							uc003xuh.2		NA																	0				skin(4)|ovary(1)	5						c.(967-969)CTG>CTT		retinaldehyde binding protein 1-like 1							39.0	33.0	35.0					8																	62371093		2203	4300	6503	SO:0001819	synonymous_variant	157807				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity	g.chr8:62371093G>T	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.969G>T	8.37:g.62371093G>T						CLVS1_uc003xui.2_RNA|CLVS1_uc010lyp.2_Intron	p.L323L	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN			5	1293	+			323					B2R7M5|C8UZT3|Q8NB32	Silent	SNP	ENST00000519846.1	37	c.969G>T	CCDS6176.1																																																																																				0.433	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	NM_173519		5	8	1	0	1.26484e-09	0.00308	1.51091e-09	5	8				
DCAF4L2	138009	broad.mit.edu	37	8	88885555	88885555	+	Silent	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:88885555C>A	ENST00000319675.3	-	1	741	c.645G>T	c.(643-645)acG>acT	p.T215T		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	215								p.T215T(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GCTGGTGTCCCGTCACCACGT	0.542																																							uc003ydz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(643-645)ACG>ACT		WD repeat domain 21C							180.0	161.0	167.0					8																	88885555		2203	4300	6503	SO:0001819	synonymous_variant	138009							g.chr8:88885555C>A	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.645G>T	8.37:g.88885555C>A							p.T215T	NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN			1	742	-			215						Silent	SNP	ENST00000319675.3	37	c.645G>T	CCDS6245.1																																																																																				0.542	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		24	130	1	0	2.48779e-11	0.005443	3.0339e-11	24	130				
RBM12B	389677	broad.mit.edu	37	8	94746552	94746552	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:94746552T>G	ENST00000399300.2	-	3	2300	c.2087A>C	c.(2086-2088)gAg>gCg	p.E696A	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000520961.1_Intron|RBM12B_ENST00000517700.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	696							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			GAAGTCATCCTCGGGTGGTCG	0.627																																							uc003yfz.2		NA																	0					0						c.(2086-2088)GAG>GCG		RNA binding motif protein 12B							96.0	102.0	100.0					8																	94746552		1869	4074	5943	SO:0001583	missense	389677						nucleotide binding|RNA binding	g.chr8:94746552T>G		CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2087A>C	8.37:g.94746552T>G	ENSP00000382239:p.Glu696Ala						p.E696A	NM_203390	NP_976324	Q8IXT5	RB12B_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.0168)		3	2280	-	Breast(36;4.14e-07)		696					A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	c.2087A>C	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.319092	0.81469	.	.	ENSG00000183808	ENST00000399300	T	0.07567	3.18	4.01	4.01	0.46588	.	.	.	.	.	T	0.05410	0.0143	N	0.19112	0.55	0.80722	D	1	B	0.33694	0.421	B	0.22386	0.039	T	0.40887	-0.9539	9	0.56958	D	0.05	-2.2781	11.5277	0.50591	0.0:0.0:0.0:1.0	.	696	Q8IXT5	RB12B_HUMAN	A	696	ENSP00000382239:E696A	ENSP00000382239:E696A	E	-	2	0	RBM12B	94815728	0.350000	0.24878	0.040000	0.18447	0.514000	0.34195	1.430000	0.34914	2.041000	0.60428	0.528000	0.53228	GAG		0.627	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		47	141	0	0	0	0.01441	0	47	141				
TMEM67	91147	broad.mit.edu	37	8	94807657	94807657	+	Silent	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:94807657G>T	ENST00000453321.3	+	17	1753	c.1695G>T	c.(1693-1695)gtG>gtT	p.V565V	TMEM67_ENST00000409623.3_Silent_p.V484V	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	565					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			AATTCTTGGTGTACTATGCTG	0.343																																							uc011lgk.1		NA																	0				ovary(2)	2						c.(1693-1695)GTG>GTT		meckelin isoform 1							223.0	218.0	220.0					8																	94807657		2203	4300	6503	SO:0001819	synonymous_variant	91147				cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding	g.chr8:94807657G>T	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.1695G>T	8.37:g.94807657G>T						TMEM67_uc010maw.2_Silent_p.V271V|TMEM67_uc003yga.3_Silent_p.V484V|TMEM67_uc011lgl.1_5'UTR	p.V565V	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00896)		17	1766	+	Breast(36;4.14e-07)		565					B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Silent	SNP	ENST00000453321.3	37	c.1695G>T	CCDS6258.2	.	.	.	.	.	.	.	.	.	.	G	9.361	1.068029	0.20067	.	.	ENSG00000164953	ENST00000520680	D	0.96491	-4.03	5.56	-0.739	0.11120	.	0.477230	0.21599	N	0.071965	D	0.89136	0.6629	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.76599	-0.2900	7	0.09338	T	0.73	-0.5229	2.4693	0.04560	0.3754:0.1044:0.4044:0.1158	.	.	.	.	L	214	ENSP00000428785:V214L	ENSP00000428785:V214L	V	+	1	0	TMEM67	94876833	0.947000	0.32204	0.955000	0.39395	0.984000	0.73092	-0.002000	0.12924	-0.378000	0.07918	0.650000	0.86243	GTA		0.343	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704		27	67	1	0	2.09667e-21	0.003755	2.79024e-21	27	67				
MTERF3	51001	broad.mit.edu	37	8	97270789	97270789	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:97270789G>A	ENST00000287025.3	-	2	228	c.130C>T	c.(130-132)Cag>Tag	p.Q44*	MTERFD1_ENST00000522822.1_5'Flank|MTERFD1_ENST00000524341.1_5'Flank|MTERFD1_ENST00000523821.1_Nonsense_Mutation_p.Q44*	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		44					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					ATCTGAGGCTGAGCAGAAAAG	0.423																																							uc003yhs.1		NA																	0				ovary(1)	1						c.(130-132)CAG>TAG		MTERF domain containing 1 precursor							154.0	151.0	152.0					8																	97270789		2203	4300	6503	SO:0001587	stop_gained	51001				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion	transcription regulatory region DNA binding	g.chr8:97270789G>A																												ENST00000287025.3:c.130C>T	8.37:g.97270789G>A	ENSP00000287025:p.Gln44*					MTERFD1_uc003yhr.1_5'Flank|MTERFD1_uc010mbd.1_Nonsense_Mutation_p.Q44*	p.Q44*	NM_015942	NP_057026	Q96E29	MTER1_HUMAN			2	208	-	Breast(36;5.16e-05)		44					B3KMG6|G3V130|Q9Y301	Nonsense_Mutation	SNP	ENST00000287025.3	37	c.130C>T	CCDS6270.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040327	0.75732	.	.	ENSG00000156469	ENST00000523821;ENST00000287025;ENST00000517720	.	.	.	5.78	1.97	0.26223	.	1.014830	0.07864	N	0.966872	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-7.235	1.838	0.03143	0.2234:0.1393:0.4935:0.1439	.	.	.	.	X	44	.	ENSP00000287025:Q44X	Q	-	1	0	MTERFD1	97339965	0.008000	0.16893	0.022000	0.16811	0.991000	0.79684	1.276000	0.33156	0.083000	0.17047	-0.181000	0.13052	CAG		0.423	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379876.1			8	93	0	0	0	0.004482	0	8	93				
KLHL38	340359	broad.mit.edu	37	8	124663831	124663831	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:124663831C>A	ENST00000325995.7	-	1	1359	c.1336G>T	c.(1336-1338)Gtg>Ttg	p.V446L	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	446										breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						ATAAGGCGCACAGGGTTCTGC	0.547																																							uc003yqs.1		NA																	0					0						c.(1336-1338)GTG>TTG		kelch-like 38							145.0	143.0	144.0					8																	124663831		2041	4206	6247	SO:0001583	missense	340359							g.chr8:124663831C>A		CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.1336G>T	8.37:g.124663831C>A	ENSP00000321475:p.Val446Leu						p.V446L	NM_001081675	NP_001075144	Q2WGJ6	KLH38_HUMAN			1	1360	-			446			Kelch 4.		A0PK12	Missense_Mutation	SNP	ENST00000325995.7	37	c.1336G>T	CCDS43766.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.985731	0.53934	.	.	ENSG00000175946	ENST00000325995	T	0.62364	0.03	5.48	5.48	0.80851	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.53769	0.1817	L	0.40543	1.245	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.51317	-0.8721	10	0.10377	T	0.69	.	19.3576	0.94421	0.0:1.0:0.0:0.0	.	446	Q2WGJ6	KLH38_HUMAN	L	446	ENSP00000321475:V446L	ENSP00000321475:V446L	V	-	1	0	KLHL38	124733012	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.770000	0.85390	2.571000	0.86741	0.561000	0.74099	GTG		0.547	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381288.1			36	59	1	0	3.4345e-17	0.011902	4.46868e-17	36	59				
NDUFB9	4715	broad.mit.edu	37	8	125562071	125562071	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:125562071G>A	ENST00000276689.3	+	4	562	c.478G>A	c.(478-480)Gaa>Aaa	p.E160K	NDUFB9_ENST00000517367.1_Missense_Mutation_p.E149K|NDUFB9_ENST00000522532.1_Intron|NDUFB9_ENST00000517830.1_3'UTR	NM_001278646.1|NM_005005.2	NP_001265575.1|NP_004996.1	Q9Y6M9	NDUB9_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa	160					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TGCCCGAAAGGAAGGTGATTT	0.522																																							uc003yrg.3		NA																	0				ovary(1)|skin(1)	2						c.(478-480)GAA>AAA		NADH dehydrogenase (ubiquinone) 1 beta	NADH(DB00157)						72.0	64.0	67.0					8																	125562071		2203	4300	6503	SO:0001583	missense	4715				mitochondrial electron transport, NADH to ubiquinone|sensory perception of sound|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity	g.chr8:125562071G>A	AF044956	CCDS6352.1	8q24.13	2011-07-04	2002-08-29		ENSG00000147684	ENSG00000147684		"""LYR motif containing"", ""Mitochondrial respiratory chain complex / Complex I"""	7704	protein-coding gene	gene with protein product	"""complex I B22 subunit"""	601445	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9 (22kD, B22)"""			8661098	Standard	NM_005005		Approved	B22, UQOR22, LYRM3	uc003yrg.4	Q9Y6M9	OTTHUMG00000165054	ENST00000276689.3:c.478G>A	8.37:g.125562071G>A	ENSP00000276689:p.Glu160Lys					NDUFB9_uc011lim.1_Intron	p.E160K	NM_005005	NP_004996	Q9Y6M9	NDUB9_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		4	563	+	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		160					B2R8M6|Q9UQE8	Missense_Mutation	SNP	ENST00000276689.3	37	c.478G>A	CCDS6352.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885301	0.51908	.	.	ENSG00000147684	ENST00000276689;ENST00000517367	T;T	0.72615	-0.67;-0.66	4.79	1.72	0.24424	.	0.179769	0.47852	D	0.000216	T	0.66973	0.2844	M	0.63428	1.95	0.45747	D	0.998646	B	0.09022	0.002	B	0.08055	0.003	T	0.61802	-0.6988	10	0.37606	T	0.19	-1.1947	15.863	0.79040	0.0:0.5428:0.4572:0.0	.	160	Q9Y6M9	NDUB9_HUMAN	K	160;149	ENSP00000276689:E160K;ENSP00000430322:E149K	ENSP00000276689:E160K	E	+	1	0	NDUFB9	125631252	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	2.872000	0.48467	0.114000	0.18032	0.313000	0.20887	GAA		0.522	NDUFB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381606.1	NM_005005		7	47	0	0	0	0.004482	0	7	47				
MTSS1	9788	broad.mit.edu	37	8	125565305	125565305	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:125565305C>T	ENST00000518547.1	-	14	2669	c.2196G>A	c.(2194-2196)ctG>ctA	p.L732L	MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000325064.5_Silent_p.L736L|MTSS1_ENST00000378017.3_Silent_p.L707L|MTSS1_ENST00000354184.4_Silent_p.L450L|MTSS1_ENST00000395508.2_Silent_p.L506L|MTSS1_ENST00000431961.2_Silent_p.L450L|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000524090.1_Silent_p.L622L	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	732	WH2. {ECO:0000255|PROSITE- ProRule:PRU00406}.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GGATGGCGTTCAGCATGTCTT	0.562																																					Esophageal Squamous(160;622 1893 3862 8546 12509)	Esophageal Squamous(160;622 1893 3862 8546 12509)	uc003yrk.2		NA																	0				ovary(1)	1						c.(2194-2196)CTG>CTA		metastasis suppressor 1							206.0	202.0	203.0					8																	125565305		2203	4300	6503	SO:0001819	synonymous_variant	9788				actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding	g.chr8:125565305C>T	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.2196G>A	8.37:g.125565305C>T						NDUFB9_uc011lim.1_Intron|MTSS1_uc003yrh.2_Silent_p.L381L|MTSS1_uc011lin.1_Silent_p.L506L|MTSS1_uc011lio.1_Silent_p.L622L|MTSS1_uc003yri.2_Silent_p.L450L|MTSS1_uc003yrj.2_Silent_p.L707L|MTSS1_uc003yrl.2_Silent_p.L736L	p.L732L	NM_014751	NP_055566	O43312	MTSS1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		14	2730	-	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		732			WH2.		J3KNK6|Q8TCA2|Q96RX2	Silent	SNP	ENST00000518547.1	37	c.2196G>A	CCDS6353.1	.	.	.	.	.	.	.	.	.	.	C	8.334	0.827105	0.16749	.	.	ENSG00000170873	ENST00000519168	.	.	.	6.14	4.24	0.50183	.	.	.	.	.	T	0.72930	0.3522	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73820	-0.3862	4	.	.	.	-18.3496	17.3814	0.87406	0.0:0.6604:0.3396:0.0	.	.	.	.	K	520	.	.	E	-	1	0	MTSS1	125634486	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.698000	0.37794	1.608000	0.50180	0.650000	0.86243	GAA		0.562	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751		11	149	0	0	0	0.001855	0	11	149				
MTSS1	9788	broad.mit.edu	37	8	125565318	125565318	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:125565318C>T	ENST00000518547.1	-	14	2656	c.2183G>A	c.(2182-2184)gGa>gAa	p.G728E	MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000325064.5_Missense_Mutation_p.G732E|MTSS1_ENST00000378017.3_Missense_Mutation_p.G703E|MTSS1_ENST00000354184.4_Missense_Mutation_p.G446E|MTSS1_ENST00000395508.2_Missense_Mutation_p.G502E|MTSS1_ENST00000431961.2_Missense_Mutation_p.G446E|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000524090.1_Missense_Mutation_p.G618E	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	728	WH2. {ECO:0000255|PROSITE- ProRule:PRU00406}.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CATGTCTTCTCCTTGTGGAGT	0.557																																					Esophageal Squamous(160;622 1893 3862 8546 12509)	Esophageal Squamous(160;622 1893 3862 8546 12509)	uc003yrk.2		NA																	0				ovary(1)	1						c.(2182-2184)GGA>GAA		metastasis suppressor 1							217.0	214.0	215.0					8																	125565318		2203	4300	6503	SO:0001583	missense	9788				actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding	g.chr8:125565318C>T	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.2183G>A	8.37:g.125565318C>T	ENSP00000429064:p.Gly728Glu					NDUFB9_uc011lim.1_Intron|MTSS1_uc003yrh.2_Missense_Mutation_p.G377E|MTSS1_uc011lin.1_Missense_Mutation_p.G502E|MTSS1_uc011lio.1_Missense_Mutation_p.G618E|MTSS1_uc003yri.2_Missense_Mutation_p.G446E|MTSS1_uc003yrj.2_Missense_Mutation_p.G703E|MTSS1_uc003yrl.2_Missense_Mutation_p.G732E	p.G728E	NM_014751	NP_055566	O43312	MTSS1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		14	2717	-	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		728			WH2.		J3KNK6|Q8TCA2|Q96RX2	Missense_Mutation	SNP	ENST00000518547.1	37	c.2183G>A	CCDS6353.1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.332985	0.60853	.	.	ENSG00000170873	ENST00000378017;ENST00000518547;ENST00000354184;ENST00000395508;ENST00000325064;ENST00000431961;ENST00000524090	T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89	6.14	6.14	0.99180	Actin-binding WH2 (2);	0.115504	0.64402	D	0.000014	T	0.67458	0.2895	M	0.72118	2.19	0.58432	D	0.999996	P;P;P;D;B;P;D	0.89917	0.733;0.807;0.549;0.996;0.433;0.521;1.0	B;P;B;P;B;B;D	0.85130	0.376;0.531;0.245;0.873;0.207;0.158;0.997	T	0.66744	-0.5846	10	0.87932	D	0	-15.0824	20.8597	0.99761	0.0:1.0:0.0:0.0	.	618;502;703;728;703;446;377	E7EWW5;B7Z3B6;A5YM41;O43312;O43312-4;O43312-2;Q6ZTG0	.;.;.;MTSS1_HUMAN;.;.;.	E	703;728;446;502;732;446;618	ENSP00000367256:G703E;ENSP00000429064:G728E;ENSP00000346119:G446E;ENSP00000378884:G502E;ENSP00000322804:G732E;ENSP00000393606:G446E;ENSP00000428319:G618E	ENSP00000322804:G732E	G	-	2	0	MTSS1	125634499	0.909000	0.30893	0.998000	0.56505	0.552000	0.35366	2.028000	0.41088	2.937000	0.99478	0.650000	0.86243	GGA		0.557	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751		11	168	0	0	0	0.013537	0	11	168				
ASAP1	50807	broad.mit.edu	37	8	131072883	131072883	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:131072883T>C	ENST00000518721.1	-	28	3361	c.3134A>G	c.(3133-3135)aAc>aGc	p.N1045S	ASAP1_ENST00000357668.1_Missense_Mutation_p.N1045S	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	1045					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						CGTGAGGTCGTTGGAGTCTTC	0.537																																							uc003yta.1		NA																	0				ovary(4)	4						c.(3133-3135)AAC>AGC		development and differentiation enhancing factor							237.0	226.0	230.0					8																	131072883		2203	4300	6503	SO:0001583	missense	50807				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding	g.chr8:131072883T>C	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.3134A>G	8.37:g.131072883T>C	ENSP00000429900:p.Asn1045Ser					ASAP1_uc003ysz.1_Missense_Mutation_p.N856S|ASAP1_uc011liw.1_Missense_Mutation_p.N1038S	p.N1045S	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN			27	3162	-			1045					B2RNV3	Missense_Mutation	SNP	ENST00000518721.1	37	c.3134A>G	CCDS6362.1	.	.	.	.	.	.	.	.	.	.	T	11.49	1.652871	0.29336	.	.	ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721	T;T	0.05786	3.39;3.39	5.66	-0.816	0.10839	Src homology-3 domain (1);	1.181470	0.05859	N	0.622593	T	0.16685	0.0401	L	0.53249	1.67	0.36131	D	0.846154	D;D;D	0.71674	0.997;0.997;0.998	D;D;D	0.76071	0.97;0.97;0.987	T	0.41610	-0.9499	10	0.33141	T	0.24	.	5.9098	0.19020	0.0:0.2748:0.1272:0.598	.	1045;1045;1048	B2RNV3;Q9ULH1;Q9ULH1-2	.;ASAP1_HUMAN;.	S	1048;1045;1045	ENSP00000350297:N1045S;ENSP00000429900:N1045S	ENSP00000344591:N1048S	N	-	2	0	ASAP1	131142065	0.044000	0.20184	0.002000	0.10522	0.742000	0.42306	0.265000	0.18515	-0.372000	0.07992	-0.313000	0.08912	AAC		0.537	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482		42	73	0	0	0	0.011902	0	42	73				
ASAP1	50807	broad.mit.edu	37	8	131130783	131130783	+	Silent	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:131130783G>C	ENST00000518721.1	-	19	1973	c.1746C>G	c.(1744-1746)gtC>gtG	p.V582V	ASAP1_ENST00000357668.1_Silent_p.V582V	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	582					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						CTTCTGCATAGACTTGAATTA	0.398																																							uc003yta.1		NA																	0				ovary(4)	4						c.(1744-1746)GTC>GTG		development and differentiation enhancing factor							123.0	112.0	115.0					8																	131130783		2203	4300	6503	SO:0001819	synonymous_variant	50807				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding	g.chr8:131130783G>C	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.1746C>G	8.37:g.131130783G>C						ASAP1_uc003ysz.1_Silent_p.V393V|ASAP1_uc011liw.1_Silent_p.V575V	p.V582V	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN			18	1774	-			582					B2RNV3	Silent	SNP	ENST00000518721.1	37	c.1746C>G	CCDS6362.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.284940	0.23392	.	.	ENSG00000153317	ENST00000524124	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	T	0.75451	0.3851	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72530	-0.4265	4	.	.	.	.	19.1654	0.93555	0.0:0.0:1.0:0.0	.	.	.	.	V	403	.	.	L	-	1	2	ASAP1	131199965	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.173000	0.65010	2.778000	0.95560	0.655000	0.94253	CTA		0.398	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482		34	37	0	0	0	0.009718	0	34	37				
CYP11B1	1584	broad.mit.edu	37	8	143960993	143960993	+	Silent	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr8:143960993G>A	ENST00000292427.4	-	1	269	c.237C>T	c.(235-237)ttC>ttT	p.F79F	CYP11B1_ENST00000377675.3_Silent_p.F79F|CYP11B1_ENST00000517471.1_Silent_p.F79F	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	79					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	GGCTTTACCTGAAAATGGGCC	0.627									Familial Hyperaldosteronism type I																														uc003yxi.2		NA																	0				ovary(3)	3						c.(235-237)TTC>TTT		cytochrome P450, family 11, subfamily B,	Mitotane(DB00648)						77.0	74.0	75.0					8																	143960993		2203	4300	6503	SO:0001819	synonymous_variant	1584	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143960993G>A	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.237C>T	8.37:g.143960993G>A						CYP11B1_uc003yxj.2_Silent_p.F79F|CYP11B1_uc010mey.2_Silent_p.F79F	p.F79F	NM_000497	NP_000488	P15538	C11B1_HUMAN			1	244	-	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		79					Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Silent	SNP	ENST00000292427.4	37	c.237C>T	CCDS6392.1																																																																																				0.627	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2			3	69	0	0	0	0.004672	0	3	69				
JAK2	3717	broad.mit.edu	37	9	5044417	5044417	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:5044417G>T	ENST00000381652.3	+	5	859	c.365G>T	c.(364-366)cGt>cTt	p.R122L	JAK2_ENST00000544510.1_5'UTR|JAK2_ENST00000539801.1_Missense_Mutation_p.R122L	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	122	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TACTTTCCTCGTTGGTATTGC	0.393		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																														uc010mhm.2		1		Dom	yes		9	9p24	3717	T|Mis|O	Janus kinase 2			L	ETV6|PCM1|BCR		ALL|AML|MPD| CML	PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	0				haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641						c.(364-366)CGT>CTT		Janus kinase 2							145.0	137.0	140.0					9																	5044417		2203	4300	6503	SO:0001583	missense	3717	Polycythemia_Vera_Familial	Familial Cancer Database		actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding	g.chr9:5044417G>T		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.365G>T	9.37:g.5044417G>T	ENSP00000371067:p.Arg122Leu					JAK2_uc003ziw.2_Missense_Mutation_p.R122L	p.R122L	NM_004972	NP_004963	O60674	JAK2_HUMAN		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	4	478	+	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)	122			Interaction with cytokine/interferon/growth hormone receptors (By similarity).|FERM.		O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	37	c.365G>T	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.496610	0.44352	.	.	ENSG00000096968	ENST00000539801;ENST00000381652	T;T	0.38722	1.12;1.12	5.35	4.14	0.48551	Band 4.1 domain (1);FERM domain (1);	0.199460	0.53938	D	0.000058	T	0.24547	0.0595	N	0.08118	0	0.80722	D	1	B	0.17268	0.021	B	0.19148	0.024	T	0.05801	-1.0863	10	0.87932	D	0	-4.8228	11.2314	0.48914	0.9268:0.0:0.0732:0.0	.	122	O60674	JAK2_HUMAN	L	122	ENSP00000440387:R122L;ENSP00000371067:R122L	ENSP00000371067:R122L	R	+	2	0	JAK2	5034417	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	5.729000	0.68538	0.952000	0.37798	-0.290000	0.09829	CGT		0.393	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1			15	40	1	0	4.14922e-12	0.004007	5.14974e-12	15	40				
PTPRD	5789	broad.mit.edu	37	9	8341727	8341727	+	Missense_Mutation	SNP	C	C	G	rs369304072		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:8341727C>G	ENST00000381196.4	-	37	5456	c.4913G>C	c.(4912-4914)gGa>gCa	p.G1638A	PTPRD_ENST00000486161.1_Missense_Mutation_p.G1231A|PTPRD_ENST00000537002.1_Missense_Mutation_p.G1228A|PTPRD_ENST00000397611.3_Missense_Mutation_p.G1228A|PTPRD_ENST00000360074.4_Missense_Mutation_p.G1625A|PTPRD_ENST00000397606.3_Missense_Mutation_p.G1231A|PTPRD_ENST00000397617.3_Missense_Mutation_p.G1231A|PTPRD_ENST00000540109.1_Missense_Mutation_p.G1638A|PTPRD_ENST00000355233.5_Missense_Mutation_p.G1232A|PTPRD_ENST00000356435.5_Missense_Mutation_p.G1638A|PTPRD_ENST00000358503.5_Missense_Mutation_p.G1616A	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1638					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GACATTCTCTCCCGTTTCTAT	0.433										TSP Lung(15;0.13)																													uc003zkk.2		NA																	0				lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(4912-4914)GGA>GCA		protein tyrosine phosphatase, receptor type, D							305.0	282.0	289.0					9																	8341727		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8341727C>G	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.4913G>C	9.37:g.8341727C>G	ENSP00000370593:p.Gly1638Ala	TSP Lung(15;0.13)				PTPRD_uc003zkp.2_Missense_Mutation_p.G1232A|PTPRD_uc003zkq.2_Missense_Mutation_p.G1231A|PTPRD_uc003zkr.2_Missense_Mutation_p.G1222A|PTPRD_uc003zks.2_Missense_Mutation_p.G1231A|PTPRD_uc003zkl.2_Missense_Mutation_p.G1629A|PTPRD_uc003zkm.2_Missense_Mutation_p.G1625A|PTPRD_uc003zkn.2_Missense_Mutation_p.G1227A|PTPRD_uc003zko.2_Missense_Mutation_p.G1228A	p.G1638A	NM_002839	NP_002830	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	39	5624	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	1638			Cytoplasmic (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.4913G>C	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	18.40	3.615943	0.66672	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.10005	2.92;2.92;2.92;2.92;2.92;2.92;2.92;2.92;2.92;2.92;2.92	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.41971	0.1182	M	0.87456	2.885	0.80722	D	1	B;B;B;B;B;B;P;D;P	0.76494	0.214;0.214;0.214;0.214;0.131;0.32;0.806;0.999;0.706	B;B;B;B;B;B;P;D;B	0.75020	0.012;0.012;0.012;0.012;0.105;0.028;0.522;0.985;0.218	T	0.24621	-1.0155	9	.	.	.	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	1231;1222;1231;1232;1228;1228;1625;1638;1638	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	A	1638;1638;1625;1616;1232;1231;1228;1228;1109;1638;1231;1231	ENSP00000370593:G1638A;ENSP00000348812:G1638A;ENSP00000353187:G1625A;ENSP00000351293:G1616A;ENSP00000347373:G1232A;ENSP00000380741:G1231A;ENSP00000380735:G1228A;ENSP00000440515:G1228A;ENSP00000438164:G1638A;ENSP00000417093:G1231A;ENSP00000380731:G1231A	.	G	-	2	0	PTPRD	8331727	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.050000	0.71063	2.885000	0.99019	0.655000	0.94253	GGA		0.433	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			31	94	0	0	0	0.00623	0	31	94				
MPDZ	8777	broad.mit.edu	37	9	13109986	13109986	+	Silent	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:13109986C>A	ENST00000319217.7	-	45	6154	c.5907G>T	c.(5905-5907)ggG>ggT	p.G1969G	MPDZ_ENST00000536827.1_Silent_p.G1907G|MPDZ_ENST00000381015.4_Silent_p.G1969G|MPDZ_ENST00000538841.1_Silent_p.G828G|MPDZ_ENST00000546205.1_Silent_p.G1983G|MPDZ_ENST00000541718.1_Silent_p.G1940G|MPDZ_ENST00000447879.1_Silent_p.G1936G|MPDZ_ENST00000541093.1_Silent_p.G203G|MPDZ_ENST00000381022.2_Silent_p.G1940G	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1969					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TTGACGTCAGCCCAGTGAAAG	0.458																																							uc010mhy.2		NA																	0				ovary(5)|central_nervous_system(1)	6						c.(5818-5820)GGG>GGT		multiple PDZ domain protein							74.0	74.0	74.0					9																	13109986		1983	4166	6149	SO:0001819	synonymous_variant	8777				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding	g.chr9:13109986C>A	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.5907G>T	9.37:g.13109986C>A						MPDZ_uc003zkx.3_Silent_p.G164G|MPDZ_uc003zky.3_Silent_p.G503G|MPDZ_uc010mib.2_Silent_p.G674G|MPDZ_uc010mhx.2_Silent_p.G791G|MPDZ_uc011lmm.1_Silent_p.G828G|MPDZ_uc003zkz.3_Silent_p.G662G|MPDZ_uc010mhz.2_Silent_p.G1936G|MPDZ_uc011lmn.1_Silent_p.G1907G|MPDZ_uc003zlb.3_Silent_p.G1940G	p.G1940G	NM_003829	NP_003820	O75970	MPDZ_HUMAN		GBM - Glioblastoma multiforme(50;2.03e-06)	43	5871	-			1969					A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Silent	SNP	ENST00000319217.7	37	c.5820G>T																																																																																					0.458	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		5	13	1	0	0.000602214	0.000602	0.000642607	5	13				
ADAMTSL1	92949	broad.mit.edu	37	9	18777150	18777150	+	Silent	SNP	A	A	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:18777150A>C	ENST00000380548.4	+	19	3262	c.2923A>C	c.(2923-2925)Aga>Cga	p.R975R		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	975						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CTTGAGCCCGAGAAGTGAGGA	0.647																																							uc003zne.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5						c.(2923-2925)AGA>CGA		ADAMTS-like 1 isoform 4 precursor							29.0	34.0	33.0					9																	18777150		1881	4092	5973	SO:0001819	synonymous_variant	92949					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr9:18777150A>C	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2923A>C	9.37:g.18777150A>C							p.R975R	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN		GBM - Glioblastoma multiforme(50;1.29e-17)	19	3050	+			975					A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	ENST00000380548.4	37	c.2923A>C	CCDS47954.1																																																																																				0.647	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			5	40	0	0	0	0.000602	0	5	40				
FAM154A	158297	broad.mit.edu	37	9	18929019	18929019	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:18929019C>T	ENST00000380534.4	-	4	735	c.456G>A	c.(454-456)gaG>gaA	p.E152E	FAM154A_ENST00000542071.1_5'UTR|FAM154A_ENST00000380530.1_3'UTR	NM_153707.2	NP_714918.2	Q8IYX7	F154A_HUMAN	family with sequence similarity 154, member A	152										breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|skin(1)	26				GBM - Glioblastoma multiforme(50;6.53e-16)		GACGAAGTGGCTCTCGCCTTG	0.423																																							uc003zni.1		NA																	0				pancreas(1)	1						c.(454-456)GAG>GAA		hypothetical protein LOC158297							112.0	102.0	105.0					9																	18929019		2203	4300	6503	SO:0001819	synonymous_variant	158297							g.chr9:18929019C>T	BC033489	CCDS6487.1, CCDS75819.1, CCDS75820.1	9p22.1	2012-03-23	2008-02-21	2008-02-21	ENSG00000155875	ENSG00000155875			28566	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 138"""	C9orf138		12477932	Standard	NM_153707		Approved	MGC35182	uc003zni.2	Q8IYX7	OTTHUMG00000019609	ENST00000380534.4:c.456G>A	9.37:g.18929019C>T						FAM154A_uc010mip.1_5'UTR	p.E152E	NM_153707	NP_714918	Q8IYX7	F154A_HUMAN		GBM - Glioblastoma multiforme(50;6.53e-16)	4	734	-			152					Q5VY58	Silent	SNP	ENST00000380534.4	37	c.456G>A	CCDS6487.1																																																																																				0.423	FAM154A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051811.1	NM_153707		7	42	0	0	0	0.006214	0	7	42				
HAUS6	54801	broad.mit.edu	37	9	19050308	19050308	+	IGR	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:19050308C>T	ENST00000380502.3	-	0	6536				RRAGA_ENST00000380527.1_Silent_p.Y217Y	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6						centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTTCCCACTACCAGTGCAAAG	0.478																																							uc003znj.2		NA																	0					0						c.(649-651)TAC>TAT		Ras-related GTP binding A							129.0	121.0	124.0					9																	19050308		2203	4300	6503	SO:0001628	intergenic_variant	10670				apoptosis|cellular protein localization|cellular response to amino acid stimulus|positive regulation of cytolysis|positive regulation of TOR signaling cascade|virus-host interaction	Golgi apparatus|lysosome|nucleus	GTP binding|phosphoprotein binding|protein heterodimerization activity|protein homodimerization activity	g.chr9:19050308C>T	AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622		9.37:g.19050308C>T							p.Y217Y	NM_006570	NP_006561	Q7L523	RRAGA_HUMAN			1	937	+			217					B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Silent	SNP	ENST00000380502.3	37	c.651C>T	CCDS6489.1																																																																																				0.478	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645		8	76	0	0	0	0.010729	0	8	76				
AQP7	364	broad.mit.edu	37	9	33385097	33385097	+	3'UTR	SNP	G	G	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:33385097G>A	ENST00000537089.1	-	0	1335				AQP7_ENST00000377425.4_3'UTR			O14520	AQP7_HUMAN	aquaporin 7						excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GGTGAGGGGAGAGATCGTGGG	0.557																																							uc003zst.2		NA																	0					0						c.(934-936)TCT>TTT		aquaporin 7							146.0	148.0	147.0					9																	33385097		2203	4300	6503	SO:0001624	3_prime_UTR_variant	364				excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity	g.chr9:33385097G>A	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.*519C>T	9.37:g.33385097G>A						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_3'UTR	p.S312F	NM_001170	NP_001161	O14520	AQP7_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)	8	1107	-			312			Cytoplasmic (Potential).		Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37	c.935C>T		.	.	.	.	.	.	.	.	.	.	g	12.72	2.022322	0.35701	.	.	ENSG00000165269	ENST00000379507;ENST00000297988	D;D	0.87029	-2.2;-2.2	3.6	3.6	0.41247	.	.	.	.	.	T	0.81866	0.4913	L	0.29908	0.895	0.33776	D	0.623641	P	0.46277	0.875	P	0.44732	0.459	D	0.86696	0.1926	9	0.87932	D	0	-4.5984	10.6111	0.45423	0.0:0.0:1.0:0.0	.	312	O14520	AQP7_HUMAN	F	311;312	ENSP00000368821:S311F;ENSP00000297988:S312F	ENSP00000297988:S312F	S	-	2	0	AQP7	33375097	0.116000	0.22171	0.006000	0.13384	0.006000	0.05464	4.207000	0.58480	1.849000	0.53698	0.550000	0.68814	TCT		0.557	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170		16	244	0	0	0	0.010504	0	16	244				
NPR2	4882	broad.mit.edu	37	9	35799660	35799660	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:35799660C>T	ENST00000342694.2	+	3	1174	c.919C>T	c.(919-921)Cag>Tag	p.Q307*		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	307					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	TCCTGAGTATCAGGAATTCCA	0.507																																							uc003zyd.2		NA																	0				ovary(2)|stomach(1)	3						c.(919-921)CAG>TAG		natriuretic peptide receptor B precursor	Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)						132.0	131.0	131.0					9																	35799660		2203	4300	6503	SO:0001587	stop_gained	4882				intracellular signal transduction|ossification|receptor guanylyl cyclase signaling pathway|regulation of blood pressure	integral to membrane|plasma membrane	GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|protein kinase activity|transmembrane receptor activity	g.chr9:35799660C>T	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.919C>T	9.37:g.35799660C>T	ENSP00000341083:p.Gln307*					NPR2_uc010mlb.2_Nonsense_Mutation_p.Q307*	p.Q307*	NM_003995	NP_003986	P20594	ANPRB_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		3	919	+	all_epithelial(49;0.161)		307			Extracellular (Potential).		B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Nonsense_Mutation	SNP	ENST00000342694.2	37	c.919C>T	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	C	38	6.700328	0.97772	.	.	ENSG00000159899	ENST00000342694	.	.	.	5.69	4.78	0.61160	.	0.000000	0.41396	D	0.000897	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	13.4561	0.61199	0.1566:0.8434:0.0:0.0	.	.	.	.	X	307	.	ENSP00000341083:Q307X	Q	+	1	0	NPR2	35789660	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.386000	0.34419	1.393000	0.46605	0.655000	0.94253	CAG		0.507	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1			13	61	0	0	0	0.004007	0	13	61				
SPATA31D1	389763	broad.mit.edu	37	9	84608347	84608347	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:84608347C>A	ENST00000344803.2	+	4	3009	c.2962C>A	c.(2962-2964)Cct>Act	p.P988T		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	988					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCGTCCTCACCCTGTCTCCTC	0.498																																							uc004amn.2		NA																	0					0						c.(2962-2964)CCT>ACT		hypothetical protein LOC389763							139.0	141.0	140.0					9																	84608347		1958	4151	6109	SO:0001583	missense	389763					integral to membrane		g.chr9:84608347C>A		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2962C>A	9.37:g.84608347C>A	ENSP00000341988:p.Pro988Thr						p.P988T	NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN			4	3009	+			988						Missense_Mutation	SNP	ENST00000344803.2	37	c.2962C>A	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	C	8.755	0.922230	0.17982	.	.	ENSG00000214929	ENST00000344803	T	0.04809	3.55	2.45	1.52	0.23074	.	.	.	.	.	T	0.06508	0.0167	N	0.14661	0.345	0.09310	N	1	D	0.60160	0.987	P	0.62014	0.897	T	0.40608	-0.9554	9	0.38643	T	0.18	.	5.011	0.14312	0.0:0.8236:0.0:0.1764	.	988	Q6ZQQ2	F75D1_HUMAN	T	988	ENSP00000341988:P988T	ENSP00000341988:P988T	P	+	1	0	FAM75D1	83798167	0.038000	0.19896	0.002000	0.10522	0.008000	0.06430	0.124000	0.15728	0.619000	0.30197	0.556000	0.70494	CCT		0.498	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		34	100	1	0	2.42023e-17	0.003271	3.16075e-17	34	100				
ERCC6L2	375748	broad.mit.edu	37	9	98685569	98685569	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:98685569C>G	ENST00000288985.7	+	9	1779	c.1474C>G	c.(1474-1476)Cag>Gag	p.Q492E	ERCC6L2_ENST00000437817.1_Missense_Mutation_p.Q303E|ERCC6L2_ENST00000466840.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	492					DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										GATATGTGATCAGGTATTTTC	0.343																																							uc004avt.3		NA																	0					0						c.(1474-1476)CAG>GAG		RAD26L hypothetical protein							126.0	124.0	125.0					9																	98685569		2203	4300	6503	SO:0001583	missense	375748				DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding	g.chr9:98685569C>G	BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.1474C>G	9.37:g.98685569C>G	ENSP00000288985:p.Gln492Glu					C9orf102_uc010mrx.1_RNA|C9orf102_uc011lum.1_Missense_Mutation_p.Q194E|C9orf102_uc010mry.1_Missense_Mutation_p.Q194E|C9orf102_uc010mrz.2_Missense_Mutation_p.Q303E|C9orf102_uc004avu.2_Translation_Start_Site	p.Q492E	NM_001010895	NP_001010895	Q5T890	RAD26_HUMAN			9	1862	+		Acute lymphoblastic leukemia(62;0.0559)	492					A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	ENST00000288985.7	37	c.1474C>G	CCDS35072.1	.	.	.	.	.	.	.	.	.	.	C	5.608	0.296865	0.10622	.	.	ENSG00000182150	ENST00000405401;ENST00000288985;ENST00000437817	D;D	0.89552	-2.5;-2.53	4.59	4.59	0.56863	.	0.128116	0.33691	N	0.004641	T	0.70833	0.3269	N	0.02539	-0.55	0.58432	D	0.999997	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.68606	-0.5364	10	0.02654	T	1	-6.2836	14.4092	0.67103	0.0:0.722:0.278:0.0	.	303;174;492	Q5T890-2;F2Z2R4;Q5T890	.;.;RAD26_HUMAN	E	174;492;303	ENSP00000288985:Q492E;ENSP00000416286:Q303E	ENSP00000288985:Q492E	Q	+	1	0	C9orf102	97725390	0.989000	0.36119	1.000000	0.80357	0.989000	0.77384	0.839000	0.27586	2.543000	0.85770	0.655000	0.94253	CAG		0.343	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053247.2	NM_001010895		4	57	0	0	0	0.001168	0	4	57				
ASTN2	23245	broad.mit.edu	37	9	119738458	119738458	+	Silent	SNP	G	G	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:119738458G>T	ENST00000313400.4	-	9	1786	c.1686C>A	c.(1684-1686)ccC>ccA	p.P562P	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Silent_p.P562P|ASTN2_ENST00000361209.2_Silent_p.P511P			O75129	ASTN2_HUMAN	astrotactin 2	562					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GTGTCGTGTAGGGCCAAGGTC	0.493																																							uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(1684-1686)CCC>CCA		astrotactin 2 isoform c							84.0	76.0	79.0					9																	119738458		2203	4300	6503	SO:0001819	synonymous_variant	23245					integral to membrane		g.chr9:119738458G>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1686C>A	9.37:g.119738458G>T						ASTN2_uc004bjr.1_Silent_p.P562P|ASTN2_uc004bjt.1_Silent_p.P511P	p.P562P	NM_198187	NP_937830	O75129	ASTN2_HUMAN			9	1787	-			562			Extracellular (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Silent	SNP	ENST00000313400.4	37	c.1686C>A																																																																																					0.493	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		3	19	1	0	0.004672	0.004672	0.00485223	3	19				
ASTN2	23245	broad.mit.edu	37	9	119770395	119770395	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:119770395C>T	ENST00000313400.4	-	7	1667	c.1567G>A	c.(1567-1569)Gag>Aag	p.E523K	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.E523K|ASTN2_ENST00000361209.2_Missense_Mutation_p.E472K			O75129	ASTN2_HUMAN	astrotactin 2	523	EGF-like 1.				negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CAGAGCTGCTCACAGGCATCT	0.577																																							uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(1567-1569)GAG>AAG		astrotactin 2 isoform c							78.0	73.0	75.0					9																	119770395		2203	4300	6503	SO:0001583	missense	23245					integral to membrane		g.chr9:119770395C>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1567G>A	9.37:g.119770395C>T	ENSP00000314038:p.Glu523Lys					ASTN2_uc004bjr.1_Missense_Mutation_p.E523K|ASTN2_uc004bjt.1_Missense_Mutation_p.E472K	p.E523K	NM_198187	NP_937830	O75129	ASTN2_HUMAN			7	1668	-			523			Extracellular (Potential).|EGF-like 1.		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.1567G>A		.	.	.	.	.	.	.	.	.	.	C	26.7	4.764033	0.89932	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.21031	2.16;2.16;2.03;2.24	5.67	5.67	0.87782	.	0.151757	0.47852	D	0.000219	T	0.39091	0.1065	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	0.999;0.997;1.0	D;D;D	0.91635	0.995;0.98;0.999	T	0.02251	-1.1188	9	.	.	.	-28.8465	19.7848	0.96432	0.0:1.0:0.0:0.0	.	472;523;523	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	K	523;523;250;472	ENSP00000314038:E523K;ENSP00000363108:E523K;ENSP00000363098:E250K;ENSP00000354504:E472K	.	E	-	1	0	ASTN2	118810216	1.000000	0.71417	0.996000	0.52242	0.974000	0.67602	7.684000	0.84104	2.673000	0.90976	0.655000	0.94253	GAG		0.577	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		4	54	0	0	0	0.001168	0	4	54				
OR1Q1	158131	broad.mit.edu	37	9	125377476	125377476	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:125377476C>A	ENST00000297913.2	+	1	529	c.460C>A	c.(460-462)Ctt>Att	p.L154I	RP11-64P14.7_ENST00000431442.1_RNA	NM_012364.1	NP_036496.1	Q15612	OR1Q1_HUMAN	olfactory receptor, family 1, subfamily Q, member 1	154					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	17						TCTCTCCCACCTTCATGCCAT	0.478																																							uc011lyy.1		NA																	0				ovary(1)	1						c.(460-462)CTT>ATT		olfactory receptor, family 1, subfamily Q,							203.0	172.0	183.0					9																	125377476		2203	4300	6503	SO:0001583	missense	158131				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125377476C>A		CCDS35125.1	9q33.2	2013-09-20			ENSG00000165202	ENSG00000165202		"""GPCR / Class A : Olfactory receptors"""	8223	protein-coding gene	gene with protein product				OR1Q2, OR1Q3			Standard	NM_012364		Approved	OST226, OR9-A, HSTPCR106, OST226OR9-A, TPCR106	uc011lyy.2	Q15612	OTTHUMG00000020615	ENST00000297913.2:c.460C>A	9.37:g.125377476C>A	ENSP00000297913:p.Leu154Ile						p.L154I	NM_012364	NP_036496	Q15612	OR1Q1_HUMAN			1	460	+			154			Helical; Name=4; (Potential).		Q6IFN4|Q8NGR7|Q96R82	Missense_Mutation	SNP	ENST00000297913.2	37	c.460C>A	CCDS35125.1	.	.	.	.	.	.	.	.	.	.	C	10.41	1.343686	0.24339	.	.	ENSG00000165202	ENST00000297913	T	0.00216	8.53	5.58	2.62	0.31277	GPCR, rhodopsin-like superfamily (1);	0.165053	0.29165	N	0.012951	T	0.00178	0.0005	L	0.57130	1.785	0.09310	N	1	B	0.32526	0.374	B	0.30716	0.119	T	0.29671	-1.0004	10	0.54805	T	0.06	-6.153	5.5613	0.17146	0.0:0.5032:0.3491:0.1477	.	154	Q15612	OR1Q1_HUMAN	I	154	ENSP00000297913:L154I	ENSP00000297913:L154I	L	+	1	0	OR1Q1	124417297	0.000000	0.05858	0.957000	0.39632	0.122000	0.20287	-0.519000	0.06260	1.574000	0.49760	0.655000	0.94253	CTT		0.478	OR1Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053946.1			24	68	1	0	9.22233e-05	0.004656	0.000101185	24	68				
SETX	23064	broad.mit.edu	37	9	135211746	135211746	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:135211746C>A	ENST00000224140.5	-	6	837	c.655G>T	c.(655-657)Ggt>Tgt	p.G219C	SETX_ENST00000372169.2_Missense_Mutation_p.G219C|SETX_ENST00000393220.1_Missense_Mutation_p.G219C	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	219					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		ATCAGTTTACCCTTCTCTAGG	0.338																																							uc004cbk.2		NA																	0				ovary(2)|skin(1)	3						c.(655-657)GGT>TGT		senataxin							87.0	83.0	84.0					9																	135211746		2203	4300	6503	SO:0001583	missense	23064				cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity	g.chr9:135211746C>A	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.655G>T	9.37:g.135211746C>A	ENSP00000224140:p.Gly219Cys						p.G219C	NM_015046	NP_055861	Q7Z333	SETX_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)	6	838	-		Myeloproliferative disorder(178;0.204)	219					A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	c.655G>T	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592591	0.86953	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	T;T;T	0.73469	-0.75;-0.75;-0.75	6.04	6.04	0.98038	.	0.126851	0.52532	D	0.000072	T	0.81336	0.4801	L	0.29908	0.895	0.50039	D	0.999841	D	0.89917	1.0	D	0.97110	1.0	T	0.82315	-0.0518	10	0.87932	D	0	.	19.5772	0.95449	0.0:1.0:0.0:0.0	.	219	Q7Z333	SETX_HUMAN	C	219	ENSP00000224140:G219C;ENSP00000361242:G219C;ENSP00000376913:G219C	ENSP00000224140:G219C	G	-	1	0	SETX	134201567	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.465000	0.66725	2.876000	0.98609	0.650000	0.86243	GGT		0.338	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046		10	26	1	0	9.31168e-06	0.001855	1.05472e-05	10	26				
QSOX2	169714	broad.mit.edu	37	9	139107068	139107068	+	Missense_Mutation	SNP	G	G	C	rs145333884		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:139107068G>C	ENST00000358701.5	-	10	1329	c.1292C>G	c.(1291-1293)tCt>tGt	p.S431C		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	431	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		TTTCCAGAGAGAACACGGGTA	0.488																																							uc010nbi.2		NA																	0				ovary(1)	1						c.(1291-1293)TCT>TGT		quiescin Q6 sulfhydryl oxidase 2 precursor							114.0	95.0	102.0					9																	139107068		2203	4300	6503	SO:0001583	missense	169714				cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity	g.chr9:139107068G>C	AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.1292C>G	9.37:g.139107068G>C	ENSP00000351536:p.Ser431Cys						p.S431C	NM_181701	NP_859052	Q6ZRP7	QSOX2_HUMAN		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)	10	1330	-		Myeloproliferative disorder(178;0.0511)	431			ERV/ALR sulfhydryl oxidase.		A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	ENST00000358701.5	37	c.1292C>G	CCDS35178.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.21|17.21	3.332550|3.332550	0.60853|0.60853	.|.	.|.	ENSG00000165661|ENSG00000165661	ENST00000455222|ENST00000358701;ENST00000389471	.|T	.|0.52057	.|0.68	4.78|4.78	3.88|3.88	0.44766|0.44766	.|Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);	.|0.120260	.|0.56097	.|D	.|0.000024	T|T	0.75788|0.75788	0.3897|0.3897	H|H	0.94385|0.94385	3.53|3.53	0.52099|0.52099	D|D	0.999942|0.999942	.|D	.|0.89917	.|1.0	.|D	.|0.79784	.|0.993	T|T	0.82494|0.82494	-0.0429|-0.0429	5|10	.|0.66056	.|D	.|0.02	-11.8939|-11.8939	13.7952|13.7952	0.63166|0.63166	0.0:0.1654:0.8346:0.0|0.0:0.1654:0.8346:0.0	.|.	.|431	.|Q6ZRP7	.|QSOX2_HUMAN	L|C	198|431;230	.|ENSP00000351536:S431C	.|ENSP00000351536:S431C	F|S	-|-	3|2	2|0	QSOX2|QSOX2	138246889|138246889	0.775000|0.775000	0.28604|0.28604	0.364000|0.364000	0.25888|0.25888	0.973000|0.973000	0.67179|0.67179	3.566000|3.566000	0.53805|0.53805	0.977000|0.977000	0.38444|0.38444	0.650000|0.650000	0.86243|0.86243	TTC|TCT		0.488	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701		4	27	0	0	0	0.009096	0	4	27				
CACNA1B	774	broad.mit.edu	37	9	140811715	140811715	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr9:140811715C>G	ENST00000371372.1	+	6	943	c.798C>G	c.(796-798)ttC>ttG	p.F266L	CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000371357.1_Missense_Mutation_p.F266L|CACNA1B_ENST00000371355.4_Missense_Mutation_p.F266L|CACNA1B_ENST00000277551.2_Missense_Mutation_p.F266L|CACNA1B_ENST00000371363.1_Missense_Mutation_p.F266L	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	266					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGGTGACTTCCCCTGTGGCA	0.587																																							uc004cog.2		NA																	0				breast(3)|large_intestine(2)|ovary(1)	6						c.(796-798)TTC>TTG		calcium channel, voltage-dependent, N type,	Amlodipine(DB00381)|Gabapentin(DB00996)						82.0	91.0	88.0					9																	140811715		2038	4205	6243	SO:0001583	missense	774				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity	g.chr9:140811715C>G	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.798C>G	9.37:g.140811715C>G	ENSP00000360423:p.Phe266Leu						p.F266L	NM_000718	NP_000709	Q00975	CAC1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	6	943	+	all_cancers(76;0.166)		266			I.|Extracellular (Potential).		B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	c.798C>G	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.306807	0.40795	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.96265	-3.95;-3.96;-3.94;-3.94;-3.94	4.86	-1.05	0.10036	.	0.210181	0.42172	D	0.000749	D	0.89118	0.6624	L	0.28014	0.82	0.80722	D	1	P	0.34462	0.454	B	0.31016	0.123	T	0.80779	-0.1230	10	0.11794	T	0.64	.	9.7344	0.40379	0.0:0.3651:0.0:0.6349	.	266	B1AQK6	.	L	266	ENSP00000360423:F266L;ENSP00000277551:F266L;ENSP00000360414:F266L;ENSP00000360408:F266L;ENSP00000360406:F266L	ENSP00000277551:F266L	F	+	3	2	CACNA1B	139931536	0.658000	0.27402	0.995000	0.50966	0.890000	0.51754	-0.214000	0.09292	-0.044000	0.13491	0.655000	0.94253	TTC		0.587	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718		9	33	0	0	0	0.004482	0	9	33				
IL3RA	3563	broad.mit.edu	37	X	1471302	1471302	+	Silent	SNP	C	C	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chrX:1471302C>G	ENST00000331035.4	+	6	868	c.519C>G	c.(517-519)ctC>ctG	p.L173L	IL3RA_ENST00000381469.2_Silent_p.L95L	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	173					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)			lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TCTCTCGACTCTCCAGCGGTT	0.542																																							uc004cps.2		NA																	0				skin(2)|lung(1)	3						c.(517-519)CTC>CTG		interleukin 3 receptor, alpha precursor	Sargramostim(DB00020)						316.0	307.0	310.0					X																	1471302		2203	4296	6499	SO:0001819	synonymous_variant	3563					integral to membrane|plasma membrane	interleukin-3 receptor activity	g.chrX:1471302C>G	M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.519C>G	X.37:g.1471302C>G						IL3RA_uc011mhd.1_Silent_p.L95L	p.L173L	NM_002183	NP_002174	P26951	IL3RA_HUMAN			6	868	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	173			Extracellular (Potential).		A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Silent	SNP	ENST00000331035.4	37	c.519C>G	CCDS14113.1																																																																																				0.542	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055600.3			3	113	0	0	0	0.004672	0	3	113				
CTPS2	56474	broad.mit.edu	37	X	16717203	16717203	+	Silent	SNP	G	G	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chrX:16717203G>C	ENST00000443824.1	-	3	923	c.180C>G	c.(178-180)gtC>gtG	p.V60V	CTPS2_ENST00000380241.3_Silent_p.V60V|CTPS2_ENST00000359276.4_Silent_p.V60V	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	60					'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					CATCATTTAAGACGAAGACTT	0.313																																							uc004cxk.2		NA																	0				ovary(1)	1						c.(178-180)GTC>GTG		cytidine triphosphate synthase II							79.0	83.0	81.0					X																	16717203		2202	4300	6502	SO:0001819	synonymous_variant	56474				glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine nucleotide biosynthetic process	cytosol	ATP binding|CTP synthase activity	g.chrX:16717203G>C	AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.180C>G	X.37:g.16717203G>C						CTPS2_uc004cxl.2_Silent_p.V60V|CTPS2_uc004cxm.2_Silent_p.V60V	p.V60V	NM_001144002	NP_001137474	Q9NRF8	PYRG2_HUMAN			3	924	-	Hepatocellular(33;0.0997)		60					B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Silent	SNP	ENST00000443824.1	37	c.180C>G	CCDS14175.1																																																																																				0.313	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055906.1	NM_019857		22	16	0	0	0	0.00278	0	22	16				
RBM10	8241	broad.mit.edu	37	X	47039904	47039904	+	Splice_Site	SNP	A	A	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chrX:47039904A>T	ENST00000377604.3	+	12	1989	c.1247A>T	c.(1246-1248)cAg>cTg	p.Q416L	RBM10_ENST00000478410.1_3'UTR|RBM10_ENST00000345781.6_Splice_Site_p.Q339L|RBM10_ENST00000329236.7_Splice_Site_p.Q338L	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	416					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						GCCATCTCACAGGTACTCAGA	0.602																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	0				ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.(1246-1248)CAG>CTG		RNA binding motif protein 10 isoform 1							40.0	33.0	35.0					X																	47039904		2203	4300	6503	SO:0001630	splice_region_variant	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47039904A>T	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.1248+1A>T	X.37:g.47039904A>T						RBM10_uc004dhg.2_Missense_Mutation_p.Q338L|RBM10_uc004dhh.2_Missense_Mutation_p.Q415L|RBM10_uc010nhq.2_Missense_Mutation_p.Q339L|RBM10_uc004dhi.2_Missense_Mutation_p.Q481L	p.Q416L	NM_005676	NP_005667	P98175	RBM10_HUMAN			12	1626	+			416					C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	37	c.1247A>T	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	A	18.45	3.626714	0.66901	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	T;T;T	0.20738	2.71;2.05;2.3	3.05	3.05	0.35203	.	0.263574	0.30630	N	0.009202	T	0.35189	0.0923	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D	0.89917	0.996;1.0;1.0;0.981;1.0	D;D;D;D;D	0.91635	0.99;0.996;0.999;0.969;0.996	T	0.21314	-1.0249	10	0.12103	T	0.63	-15.6554	8.8419	0.35146	1.0:0.0:0.0:0.0	.	339;481;415;338;416	P98175-3;Q7Z3D7;P98175-2;P98175-4;P98175	.;.;.;.;RBM10_HUMAN	L	416;338;339	ENSP00000366829:Q416L;ENSP00000328848:Q338L;ENSP00000329659:Q339L	ENSP00000328848:Q338L	Q	+	2	0	RBM10	46924848	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.789000	0.91839	1.434000	0.47414	0.483000	0.47432	CAG		0.602	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	Missense_Mutation	5	8	0	0	0	0.000602	0	5	8				
ARAF	369	broad.mit.edu	37	X	47426121	47426122	+	Missense_Mutation	DNP	CC	CC	GT			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chrX:47426121_47426122CC>GT	ENST00000377045.4	+	7	835_836	c.641_642CC>GT	c.(640-642)tCC>tGT	p.S214C	ARAF_ENST00000290277.6_Intron	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	214					cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.S214F(1)		biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	CGCTCCACGTCCACTCCCAACG	0.663																																							uc011mlq.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|lung(2)|ovary(1)|skin(1)	7						c.(640-642)TCC>TGT		v-raf murine sarcoma 3611 viral oncogene	Adenosine triphosphate(DB00171)																																			SO:0001583	missense	369				intracellular signal transduction|negative regulation of apoptosis|positive regulation of peptidyl-serine phosphorylation		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity	g.chrX:47426121_47426122CC>GT	X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	Exception_encountered	X.37:g.47426121_47426122delinsGT	ENSP00000366244:p.Ser214Cys					ARAF_uc011mln.1_Intron|ARAF_uc011mlo.1_Missense_Mutation_p.S80C|ARAF_uc011mlp.1_Missense_Mutation_p.S214C|ARAF_uc004dic.1_5'UTR	p.S214C	NM_001654	NP_001645	P10398	ARAF_HUMAN			7	774_775	+			214					P07557|Q5H9B2|Q5H9B3	Missense_Mutation	DNP	ENST00000377045.4	37	c.641_642CC>GT	CCDS35232.1																																																																																				0.663	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056418.1			6	5	0	0	0	0.004672	0	6	5				
USP51	158880	broad.mit.edu	37	X	55513511	55513511	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chrX:55513511A>G	ENST00000500968.3	-	2	1944	c.1862T>C	c.(1861-1863)aTg>aCg	p.M621T	USP51_ENST00000586165.1_5'UTR	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	621	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						AAACGGAGTCATGTCCAGCTC	0.443																																							uc004dun.1		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(1861-1863)ATG>ACG		ubiquitin specific protease 51							74.0	65.0	68.0					X																	55513511		2203	4300	6503	SO:0001583	missense	158880				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding	g.chrX:55513511A>G	BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.1862T>C	X.37:g.55513511A>G	ENSP00000423333:p.Met621Thr					USP51_uc011moo.1_Missense_Mutation_p.M325T	p.M621T	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN			2	1941	-			621					Q8IWJ8	Missense_Mutation	SNP	ENST00000500968.3	37	c.1862T>C	CCDS14370.1	.	.	.	.	.	.	.	.	.	.	.	12.80	2.047397	0.36085	.	.	ENSG00000247746	ENST00000500968	T	0.03152	4.03	2.96	2.96	0.34315	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	U	0.000000	T	0.21674	0.0522	H	0.95679	3.705	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.00817	-1.1554	10	0.87932	D	0	.	5.5973	0.17334	0.7177:0.2823:0.0:0.0	.	621	Q70EK9	UBP51_HUMAN	T	621	ENSP00000423333:M621T	ENSP00000423333:M621T	M	-	2	0	USP51	55530236	0.991000	0.36638	1.000000	0.80357	0.986000	0.74619	1.726000	0.38085	1.416000	0.47057	0.371000	0.22339	ATG		0.443	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056871.2	NM_201286		8	8	0	0	0	0.008291	0	8	8				
ACRC	93953	broad.mit.edu	37	X	70823918	70823918	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chrX:70823918C>T	ENST00000373695.1	+	7	1328	c.791C>T	c.(790-792)gCt>gTt	p.A264V	ACRC_ENST00000373696.3_Missense_Mutation_p.A264V			Q96QF7	ACRC_HUMAN	acidic repeat containing	264	Asp/Ser-rich.					nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					GATTCGGAAGCTCCCGACGAC	0.557																																							uc004eae.2		NA																	0				ovary(3)	3						c.(790-792)GCT>GTT		ACRC protein							23.0	24.0	24.0					X																	70823918		2143	4156	6299	SO:0001583	missense	93953					nucleus		g.chrX:70823918C>T	AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.791C>T	X.37:g.70823918C>T	ENSP00000362799:p.Ala264Val					BCYRN1_uc011mpt.1_Intron	p.A264V	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN			8	1292	+	Renal(35;0.156)		264			Asp/Ser-rich.		B9EG62	Missense_Mutation	SNP	ENST00000373695.1	37	c.791C>T	CCDS35326.1	.	.	.	.	.	.	.	.	.	.	c	3.203	-0.163335	0.06502	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.33654	1.4;1.4	0.14	0.14	0.14804	.	.	.	.	.	T	0.13500	0.0327	N	0.03608	-0.345	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.22906	-1.0203	9	0.30078	T	0.28	.	3.6887	0.08338	2.0E-4:0.509:0.4907:1.0E-4	.	264	Q96QF7	ACRC_HUMAN	V	264	ENSP00000362800:A264V;ENSP00000362799:A264V	ENSP00000362799:A264V	A	+	2	0	ACRC	70740643	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-5.140000	0.00147	0.168000	0.19655	0.169000	0.16792	GCT		0.557	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081856.1			4	51	0	0	0	0.000602	0	4	51				
KLHL4	56062	broad.mit.edu	37	X	86888884	86888884	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chrX:86888884C>A	ENST00000373119.4	+	8	1830	c.1685C>A	c.(1684-1686)aCa>aAa	p.T562K	KLHL4_ENST00000373114.4_Missense_Mutation_p.T562K	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	562						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						CCTAGAAGCACAGTTGGTGTT	0.433																																							uc004efb.2		NA																	0				ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(1684-1686)ACA>AAA		kelch-like 4 isoform 1							156.0	124.0	135.0					X																	86888884		2203	4300	6503	SO:0001583	missense	56062					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding	g.chrX:86888884C>A	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1685C>A	X.37:g.86888884C>A	ENSP00000362211:p.Thr562Lys					KLHL4_uc004efa.2_Missense_Mutation_p.T562K	p.T562K	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN			8	1867	+			562			Kelch 3.		B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	c.1685C>A	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498938	0.85069	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.77358	-1.09;-1.09	4.72	4.72	0.59763	Galactose oxidase, beta-propeller (1);	0.109434	0.64402	D	0.000009	D	0.84552	0.5497	L	0.52011	1.625	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.83275	0.996;0.962	D	0.84739	0.0750	10	0.45353	T	0.12	.	15.7654	0.78123	0.0:1.0:0.0:0.0	.	562;562	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	K	562	ENSP00000362211:T562K;ENSP00000362206:T562K	ENSP00000362206:T562K	T	+	2	0	KLHL4	86775540	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.156000	0.77453	2.174000	0.68829	0.506000	0.49869	ACA		0.433	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1			9	15	1	0	0.000442599	0.006214	0.000476645	9	15				
CPXCR1	53336	broad.mit.edu	37	X	88008985	88008985	+	Missense_Mutation	SNP	C	C	A	rs187641480		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chrX:88008985C>A	ENST00000276127.4	+	3	829	c.570C>A	c.(568-570)caC>caA	p.H190Q	CPXCR1_ENST00000373111.1_Missense_Mutation_p.H190Q	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	190							metal ion binding (GO:0046872)			NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						TCACCCATCACGAGAGAGCCA	0.428																																							uc004efd.3		NA																	0				ovary(3)	3						c.(568-570)CAC>CAA		CPX chromosome region, candidate 1							68.0	54.0	59.0					X																	88008985		2203	4300	6503	SO:0001583	missense	53336					intracellular	zinc ion binding	g.chrX:88008985C>A	AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.570C>A	X.37:g.88008985C>A	ENSP00000276127:p.His190Gln					CPXCR1_uc004efc.3_Missense_Mutation_p.H190Q	p.H190Q	NM_033048	NP_149037	Q8N123	CPXCR_HUMAN			3	829	+			190					B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	37	c.570C>A	CCDS14458.1	.	.	.	.	.	.	.	.	.	.	C	3.052	-0.195077	0.06259	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.40476	1.03;1.03	3.06	-5.49	0.02584	.	2.278320	0.02697	N	0.111341	T	0.19046	0.0457	N	0.14661	0.345	0.09310	N	1	B	0.22146	0.065	B	0.12156	0.007	T	0.05484	-1.0882	9	.	.	.	13.0951	0.305	0.00279	0.3122:0.2822:0.1877:0.218	.	190	Q8N123	CPXCR_HUMAN	Q	190	ENSP00000276127:H190Q;ENSP00000362203:H190Q	.	H	+	3	2	CPXCR1	87895641	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.651000	0.01989	-1.096000	0.03046	-0.458000	0.05436	CAC		0.428	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048		12	4	1	0	4.7546e-09	0.004007	5.622e-09	12	4				
GLUD2	2747	broad.mit.edu	37	X	120182249	120182249	+	Silent	SNP	T	T	C			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chrX:120182249T>C	ENST00000328078.1	+	1	788	c.711T>C	c.(709-711)gcT>gcC	p.A237A		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	237					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						CCTGGATTGCTGATACCTATG	0.517																																							uc004eto.2		NA																	0				pancreas(1)	1						c.(709-711)GCT>GCC		glutamate dehydrogenase 2 precursor	L-Glutamic Acid(DB00142)|NADH(DB00157)						178.0	134.0	149.0					X																	120182249		2203	4300	6503	SO:0001819	synonymous_variant	2747				glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding	g.chrX:120182249T>C	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.711T>C	X.37:g.120182249T>C							p.A237A	NM_012084	NP_036216	P49448	DHE4_HUMAN			1	788	+			237					B2R8G0|Q9UDQ4	Silent	SNP	ENST00000328078.1	37	c.711T>C	CCDS14603.1																																																																																				0.517	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084		26	23	0	0	0	0.003271	0	26	23				
MAGEC1	9947	broad.mit.edu	37	X	140996370	140996370	+	Silent	SNP	C	C	T			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chrX:140996370C>T	ENST00000285879.4	+	4	3466	c.3180C>T	c.(3178-3180)ccC>ccT	p.P1060P	MAGEC1_ENST00000406005.2_Silent_p.P127P	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1060	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GGGAGGTGCCCAACTCTTCTC	0.512										HNSCC(15;0.026)																													uc004fbt.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(3178-3180)CCC>CCT		melanoma antigen family C, 1							114.0	108.0	110.0					X																	140996370		2203	4300	6503	SO:0001819	synonymous_variant	9947						protein binding	g.chrX:140996370C>T	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3180C>T	X.37:g.140996370C>T		HNSCC(15;0.026)				MAGEC1_uc010nsl.1_Silent_p.P127P	p.P1060P	NM_005462	NP_005453	O60732	MAGC1_HUMAN			4	3466	+	Acute lymphoblastic leukemia(192;6.56e-05)		1060			MAGE.		A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	c.3180C>T	CCDS35417.1																																																																																				0.512	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		4	51	0	0	0	0.000602	0	4	51				
GABRQ	55879	broad.mit.edu	37	X	151821220	151821220	+	Missense_Mutation	SNP	C	C	A	rs77796656		TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chrX:151821220C>A	ENST00000370306.2	+	9	1395	c.1375C>A	c.(1375-1377)Cag>Aag	p.Q459K		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	459					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CACCTCAGAGCAGGCCCGGCA	0.592																																							uc004ffp.1		NA																	0				ovary(2)|pancreas(1)	3						c.(1375-1377)CAG>AAG		gamma-aminobutyric acid (GABA) receptor, theta							106.0	97.0	100.0					X																	151821220		2203	4300	6503	SO:0001583	missense	55879					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity	g.chrX:151821220C>A	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1375C>A	X.37:g.151821220C>A	ENSP00000359329:p.Gln459Lys						p.Q459K	NM_018558	NP_061028	Q9UN88	GBRT_HUMAN			9	1395	+	Acute lymphoblastic leukemia(192;6.56e-05)		459					A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	c.1375C>A	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.974833	0.53720	.	.	ENSG00000147402	ENST00000370306	T	0.80123	-1.34	4.59	3.72	0.42706	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.389730	0.04763	N	0.426658	D	0.84042	0.5385	L	0.48642	1.525	0.09310	N	1	D	0.55605	0.972	P	0.54759	0.76	T	0.68704	-0.5338	10	0.87932	D	0	.	9.4585	0.38769	0.0:0.7904:0.2096:0.0	.	459	Q9UN88	GBRT_HUMAN	K	459	ENSP00000359329:Q459K	ENSP00000359329:Q459K	Q	+	1	0	GABRQ	151571876	0.974000	0.33945	0.039000	0.18376	0.853000	0.48598	3.018000	0.49625	1.244000	0.43870	0.600000	0.82982	CAG		0.592	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558		12	46	1	0	2.61681e-11	0.00245	3.18016e-11	12	46				
MTMR10	54893	broad.mit.edu	37	15	31253222	31253224	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	CCT	CCT	-	-	CCT	CCT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr15:31253222_31253224delCCT	ENST00000435680.1	-	7	715_717	c.618_620delAGG	c.(616-621)ggaggt>ggt	p.206_207GG>G	MTMR10_ENST00000563714.1_In_Frame_Del_p.124_125GG>G|MTMR10_ENST00000425768.1_In_Frame_Del_p.E176del|MTMR10_ENST00000314404.8_5'UTR	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	206	Poly-Gly.						phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		AGCTCCATTAcctcctcctcctc	0.463																																							uc001zfh.1		NA																	0				ovary(1)	1						c.(616-621)GGAGGT>GGT		myotubularin related protein 10				52,8,3566		0,0,52,1,6,1754						-1.4	0.0			51	178,14,7612		1,0,176,1,12,3712	no	codingComplex	MTMR10	NM_017762.2		1,0,228,2,18,5466	A1A1,A1A2,A1R,A2A2,A2R,RR		2.4603,1.6547,2.2047				230,22,11178				SO:0001651	inframe_deletion	54893						phosphatase activity	g.chr15:31253222_31253224delCCT	AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.618_620delAGG	15.37:g.31253231_31253233delCCT	ENSP00000402537:p.Gly207del					MTMR10_uc010azx.1_5'UTR|MTMR10_uc001zfi.1_5'UTR|MTMR10_uc001zfj.2_In_Frame_Del_p.124_125GG>G|MTMR10_uc001zfk.2_5'UTR|MTMR10_uc010ubl.1_RNA	p.206_207GG>G	NM_017762	NP_060232	Q9NXD2	MTMRA_HUMAN		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)	7	716_718	-		all_lung(180;2.81e-11)	206_207			Poly-Gly.		Q6P4Q6	In_Frame_Del	DEL	ENST00000435680.1	37	c.618_620delAGG	CCDS45204.1																																																																																				0.463	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430747.1	NM_017762		4	4	NA	NA	NA	NA	NA	4	4	---	---	---	---
CPLX3	594855	broad.mit.edu	37	15	75122558	75122560	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	GAG	GAG	-	-	GAG	GAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr15:75122558_75122560delGAG	ENST00000395018.4	+	3	497_499	c.340_342delGAG	c.(340-342)gagdel	p.E118del	RP11-414J4.2_ENST00000564823.1_RNA	NM_001030005.2	NP_001025176.1	Q8WVH0	CPLX3_HUMAN	complexin 3	118					insulin secretion (GO:0030073)|regulation of neurotransmitter secretion (GO:0046928)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)	neurotransmitter transporter activity (GO:0005326)			large_intestine(2)|lung(2)	4						GGAGGACACAGAGGAGGAGGAGG	0.616																																							uc002ayu.1		NA																	0					0						c.(340-342)GAGdel		complexin 3 precursor				22,4242		10,2,2120						-5.3	1.0			72	52,8202		23,6,4098	no	coding	CPLX3	NM_001030005.2		33,8,6218	A1A1,A1R,RR		0.63,0.5159,0.5911				74,12444				SO:0001651	inframe_deletion	594855					cell junction|synapse	syntaxin binding	g.chr15:75122558_75122560delGAG	BC018026	CCDS32294.1	15q24.1	2005-08-09			ENSG00000213578	ENSG00000213578			27652	protein-coding gene	gene with protein product		609585				15911881	Standard	NM_001030005		Approved	CPX-III	uc002ayu.1	Q8WVH0	OTTHUMG00000142816	ENST00000395018.4:c.340_342delGAG	15.37:g.75122567_75122569delGAG	ENSP00000378464:p.Glu118del						p.E118del	NM_001030005	NP_001025176	Q8WVH0	CPLX3_HUMAN			3	434_436	+			118					D3DW66|Q8TEM6|Q9H818	In_Frame_Del	DEL	ENST00000395018.4	37	c.340_342delGAG	CCDS32294.1																																																																																				0.616	CPLX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286402.2	NM_001030005		7	85	NA	NA	NA	NA	NA	7	85	---	---	---	---
SLC26A11	284129	broad.mit.edu	37	17	78201649	78201651	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	TGC	TGC	-	-	TGC	TGC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr17:78201649_78201651delTGC	ENST00000361193.3	+	7	906_908	c.626_628delTGC	c.(625-630)atgctg>atg	p.L213del	SLC26A11_ENST00000546047.2_In_Frame_Del_p.L213del|SLC26A11_ENST00000411502.3_In_Frame_Del_p.L213del|SLC26A11_ENST00000572725.1_In_Frame_Del_p.L213del	NM_001166347.1|NM_173626.3	NP_001159819.1|NP_775897.3			solute carrier family 26 (anion exchanger), member 11											central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	28	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CTGGTCTGCATGCTGCTGCTGCT	0.675																																							uc002jyb.1		NA																	0					0						c.(625-630)ATGCTG>ATG		solute carrier family 26, member 11																																				SO:0001651	inframe_deletion	284129					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|plasma membrane	anion:anion antiporter activity|secondary active sulfate transmembrane transporter activity	g.chr17:78201649_78201651delTGC		CCDS11771.2	17q25	2013-07-18	2013-07-18		ENSG00000181045	ENSG00000181045		"""Solute carriers"""	14471	protein-coding gene	gene with protein product		610117	"""solute carrier family 26, member 11"""				Standard	NM_001166347		Approved		uc010dhv.2	Q86WA9	OTTHUMG00000133419	ENST00000361193.3:c.626_628delTGC	17.37:g.78201658_78201660delTGC	ENSP00000355384:p.Leu213del					SLC26A11_uc002jyc.1_In_Frame_Del_p.L213del|SLC26A11_uc002jyd.1_In_Frame_Del_p.L213del|SLC26A11_uc010dhv.1_In_Frame_Del_p.L213del	p.L213del	NM_173626	NP_775897	Q86WA9	S2611_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)		7	895_897	+	all_neural(118;0.0538)		213			Helical; (Potential).			In_Frame_Del	DEL	ENST00000361193.3	37	c.626_628delTGC	CCDS11771.2																																																																																				0.675	SLC26A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257281.1			8	197	NA	NA	NA	NA	NA	8	197	---	---	---	---
PIEZO2	63895	broad.mit.edu	37	18	10681669	10681669	+	Frame_Shift_Del	DEL	A	A	-			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr18:10681669delA	ENST00000503781.3	-	47	7428	c.7429delT	c.(7429-7431)tctfs	p.S2477fs	PIEZO2_ENST00000580640.1_Frame_Shift_Del_p.S2502fs|PIEZO2_ENST00000538948.1_Frame_Shift_Del_p.S434fs|PIEZO2_ENST00000285141.4_Frame_Shift_Del_p.S269fs|PIEZO2_ENST00000302079.6_Frame_Shift_Del_p.S2414fs|PIEZO2_ENST00000581680.1_5'Flank	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2477					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										GTGTCCCTAGAAAAAGCTTGT	0.398																																							uc002kor.3		NA																	0				ovary(1)	1						c.(1300-1302)TCTfs		family with sequence similarity 38, member B							149.0	148.0	148.0					18																	10681669		2203	4300	6503	SO:0001589	frameshift_variant	63895					integral to membrane	ion channel activity	g.chr18:10681669delA	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.7429delT	18.37:g.10681669delA	ENSP00000421377:p.Ser2477fs					FAM38B_uc002koq.2_Frame_Shift_Del_p.S269fs	p.S434fs	NM_022068	NP_071351	Q9H5I5	PIEZ2_HUMAN			9	1440	-			2477					B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Frame_Shift_Del	DEL	ENST00000503781.3	37	c.1300delT																																																																																					0.398	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068		25	67	NA	NA	NA	NA	NA	25	67	---	---	---	---
ZAN	7455	broad.mit.edu	37	7	100373314	100373314	+	RNA	DEL	C	C	-			TCGA-55-7727-01A-11D-2167-08	TCGA-55-7727-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e4390b89-911b-447e-8b5a-8849274c1691	866211ea-f591-496a-a45b-51b1f3821bf0	g.chr7:100373314delC	ENST00000348028.3	+	0	6215				ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000449052.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AGGTCACCCTCCCCGCCATCT	0.567																																							uc003uwj.2		NA																	0				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11						c.(6049-6051)CTCfs		zonadhesin isoform 3							84.0	83.0	83.0					7																	100373314		2098	4220	6318			7455				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane		g.chr7:100373314delC	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100373314delC						ZAN_uc003uwk.2_Frame_Shift_Del_p.L2017fs|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kke.1_Frame_Shift_Del_p.L104fs	p.L2017fs	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	STAD - Stomach adenocarcinoma(171;0.19)		34	6216	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		2017			Extracellular (Potential).|VWFD 3.		A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Frame_Shift_Del	DEL	ENST00000348028.3	37	c.6051delC																																																																																					0.567	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386		8	89	NA	NA	NA	NA	NA	8	89	---	---	---	---
