#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CATSPER4	378807	broad.mit.edu	37	1	26520352	26520352	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:26520352G>T	ENST00000456354.2	+	3	499	c.432G>T	c.(430-432)tgG>tgT	p.W144C		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	144					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		TCCTTGGCTGGCTCAATGGCT	0.507																																							uc010oez.1		NA																	0				ovary(1)	1						c.(430-432)TGG>TGT		cation channel, sperm associated 4							176.0	148.0	158.0					1																	26520352		2203	4300	6503	SO:0001583	missense	378807				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity	g.chr1:26520352G>T	BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.432G>T	1.37:g.26520352G>T	ENSP00000390423:p.Trp144Cys					CATSPER4_uc010oey.1_5'UTR|CATSPER4_uc009vsf.2_RNA	p.W144C	NM_198137	NP_937770	Q7RTX7	CTSR4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)	3	432	+		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)	144			Helical; Name=Segment S2; (Potential).		A1A4W6|Q5VY71	Missense_Mutation	SNP	ENST00000456354.2	37	c.432G>T	CCDS30645.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.659729	0.47572	.	.	ENSG00000188782	ENST00000338855;ENST00000456354	D;D	0.98455	-4.94;-4.94	5.01	3.03	0.35002	Ion transport (1);	0.281001	0.26065	N	0.026553	D	0.98254	0.9422	M	0.69358	2.11	0.49389	D	0.999783	D	0.89917	1.0	D	0.77557	0.99	D	0.97603	1.0124	10	0.87932	D	0	-3.3605	7.9746	0.30147	0.0:0.1763:0.6412:0.1825	.	144	Q7RTX7	CTSR4_HUMAN	C	144	ENSP00000341006:W144C;ENSP00000390423:W144C	ENSP00000341006:W144C	W	+	3	0	CATSPER4	26392939	1.000000	0.71417	0.541000	0.28102	0.952000	0.60782	3.105000	0.50314	0.450000	0.26774	0.491000	0.48974	TGG		0.507	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019849.2	NM_198137		14	95	1	0	1.3612e-06	0.003163	1.65116e-06	14	95				
ARID1A	8289	broad.mit.edu	37	1	27099440	27099440	+	Missense_Mutation	SNP	A	A	G	rs200814245		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:27099440A>G	ENST00000324856.7	+	14	4048	c.3677A>G	c.(3676-3678)tAt>tGt	p.Y1226C	ARID1A_ENST00000540690.1_5'Flank|ARID1A_ENST00000457599.2_Missense_Mutation_p.Y1226C|ARID1A_ENST00000374152.2_Missense_Mutation_p.Y843C	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1226					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.M1220fs*9(1)|p.M1220fs*2(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CGCATGTCCTATGAGCCAAAT	0.488			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		uc001bmv.1		NA		Rec	yes		1	1p35.3	8289	Mis|N|F|S|D	AT rich interactive domain 1A (SWI-like)			E			clear cell ovarian carcinoma|RCC		2	Deletion - Frameshift(2)	p.M1220fs*9(1)|p.M1220fs*2(1)	ovary(2)	ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142						c.(3676-3678)TAT>TGT		AT rich interactive domain 1A isoform a							102.0	107.0	105.0					1																	27099440		2203	4300	6503	SO:0001583	missense	8289				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	g.chr1:27099440A>G	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3677A>G	1.37:g.27099440A>G	ENSP00000320485:p.Tyr1226Cys					ARID1A_uc001bmt.1_Missense_Mutation_p.Y1225C|ARID1A_uc001bmu.1_Missense_Mutation_p.Y1226C|ARID1A_uc001bmw.1_Missense_Mutation_p.Y843C|ARID1A_uc001bmx.1_Missense_Mutation_p.Y72C|ARID1A_uc009vsm.1_5'UTR|ARID1A_uc009vsn.1_5'Flank	p.Y1226C	NM_006015	NP_006006	O14497	ARI1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)	14	4050	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	1226					D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	c.3677A>G	CCDS285.1	.	.	.	.	.	.	.	.	.	.	A	14.30	2.495420	0.44352	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.04234	3.81;3.97;3.67	5.34	5.34	0.76211	.	0.057175	0.64402	D	0.000001	T	0.19248	0.0462	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.98;0.956;0.998;0.996	T	0.00121	-1.2029	10	0.62326	D	0.03	-6.0148	15.4919	0.75611	1.0:0.0:0.0:0.0	.	843;1226;1226;879	O14497-3;O14497;O14497-2;Q4LE49	.;ARI1A_HUMAN;.;.	C	1226;1226;843	ENSP00000320485:Y1226C;ENSP00000387636:Y1226C;ENSP00000363267:Y843C	ENSP00000320485:Y1226C	Y	+	2	0	ARID1A	26972027	1.000000	0.71417	0.980000	0.43619	0.996000	0.88848	8.761000	0.91691	2.253000	0.74438	0.533000	0.62120	TAT		0.488	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135		23	58	0	0	0	0.00333	0	23	58				
RABGGTB	5876	broad.mit.edu	37	1	76253189	76253189	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:76253189C>G	ENST00000319942.3	+	2	82	c.11C>G	c.(10-12)cCa>cGa	p.P4R	RABGGTB_ENST00000496055.1_3'UTR|SNORD45A_ENST00000384512.1_RNA|SNORD45C_ENST00000383893.1_RNA|SNORD45B_ENST00000364617.1_RNA|RABGGTB_ENST00000370826.3_Missense_Mutation_p.P4R|RABGGTB_ENST00000535300.1_5'UTR	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit	4					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						AAGGGCACTCCACAGAAGGAT	0.378																																							uc001dgy.1		NA																	0				ovary(1)	1						c.(10-12)CCA>CGA		RAB geranylgeranyltransferase, beta subunit							134.0	121.0	125.0					1																	76253189		2203	4300	6503	SO:0001583	missense	5876				protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity	g.chr1:76253189C>G	U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.11C>G	1.37:g.76253189C>G	ENSP00000317473:p.Pro4Arg					RABGGTB_uc009wbt.1_RNA|RABGGTB_uc001dha.1_5'UTR|SNORD45A_uc009wbu.1_5'Flank|SNORD45B_uc009wbv.1_5'Flank	p.P4R	NM_004582	NP_004573	P53611	PGTB2_HUMAN			2	82	+			4					Q92697	Missense_Mutation	SNP	ENST00000319942.3	37	c.11C>G	CCDS669.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.259982	0.39995	.	.	ENSG00000137955	ENST00000319942;ENST00000370824;ENST00000370826	.	.	.	5.35	2.26	0.28386	.	0.157258	0.64402	D	0.000019	T	0.30634	0.0771	M	0.63843	1.955	0.80722	D	1	P	0.36392	0.551	B	0.33042	0.157	T	0.09443	-1.0674	9	0.20519	T	0.43	-6.9479	9.1217	0.36791	0.2646:0.6655:0.0:0.07	.	4	P53611	PGTB2_HUMAN	R	4	.	ENSP00000317473:P4R	P	+	2	0	RABGGTB	76025777	0.991000	0.36638	0.521000	0.27850	0.892000	0.51952	3.162000	0.50755	0.558000	0.29135	0.655000	0.94253	CCA		0.378	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026972.1	NM_004582		9	50	0	0	0	0.006214	0	9	50				
TTLL7	79739	broad.mit.edu	37	1	84412840	84412840	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:84412840A>G	ENST00000260505.8	-	6	850	c.473T>C	c.(472-474)aTa>aCa	p.I158T	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	158	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		TGGTTTCACTATAAAAGTTTT	0.328																																							uc001djc.2		NA																	0				ovary(1)	1						c.(472-474)ATA>ACA		tubulin tyrosine ligase-like family, member 7							121.0	123.0	122.0					1																	84412840		2203	4300	6503	SO:0001583	missense	79739				cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity	g.chr1:84412840A>G	AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.473T>C	1.37:g.84412840A>G	ENSP00000260505:p.Ile158Thr					TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_RNA|TTLL7_uc001djf.2_Intron|TTLL7_uc001djg.2_RNA	p.I158T	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN		all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)	6	869	-			158			TTL.		Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	ENST00000260505.8	37	c.473T>C	CCDS690.2	.	.	.	.	.	.	.	.	.	.	A	22.7	4.329986	0.81690	.	.	ENSG00000137941	ENST00000260505;ENST00000370703	T	0.15834	2.39	5.57	5.57	0.84162	.	0.042810	0.85682	N	0.000000	T	0.47507	0.1449	H	0.96604	3.85	0.80722	D	1	D	0.63046	0.992	D	0.63381	0.914	T	0.67511	-0.5652	10	0.87932	D	0	.	15.7219	0.77718	1.0:0.0:0.0:0.0	.	158	Q6ZT98	TTLL7_HUMAN	T	158	ENSP00000260505:I158T	ENSP00000260505:I158T	I	-	2	0	TTLL7	84185428	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.855000	0.92236	2.116000	0.64780	0.528000	0.53228	ATA		0.328	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686		11	35	0	0	0	0.001368	0	11	35				
TTLL7	79739	broad.mit.edu	37	1	84415555	84415555	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:84415555T>A	ENST00000260505.8	-	4	649	c.272A>T	c.(271-273)aAt>aTt	p.N91I	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	91	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		TACCTGATAATTTTGCAGCTC	0.338																																							uc001djc.2		NA																	0				ovary(1)	1						c.(271-273)AAT>ATT		tubulin tyrosine ligase-like family, member 7							96.0	99.0	98.0					1																	84415555		2202	4300	6502	SO:0001583	missense	79739				cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity	g.chr1:84415555T>A	AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.272A>T	1.37:g.84415555T>A	ENSP00000260505:p.Asn91Ile					TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_RNA|TTLL7_uc001djf.2_Intron|TTLL7_uc001djg.2_RNA	p.N91I	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN		all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)	4	668	-			91			TTL.		Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	ENST00000260505.8	37	c.272A>T	CCDS690.2	.	.	.	.	.	.	.	.	.	.	T	21.3	4.133306	0.77662	.	.	ENSG00000137941	ENST00000260505;ENST00000370703	T	0.03951	3.75	5.4	5.4	0.78164	.	0.091610	0.64402	D	0.000001	T	0.08179	0.0204	L	0.45352	1.415	0.80722	D	1	D	0.71674	0.998	D	0.65987	0.94	T	0.28554	-1.0040	10	0.39692	T	0.17	.	15.4347	0.75137	0.0:0.0:0.0:1.0	.	91	Q6ZT98	TTLL7_HUMAN	I	91	ENSP00000260505:N91I	ENSP00000260505:N91I	N	-	2	0	TTLL7	84188143	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	7.522000	0.81844	2.047000	0.60756	0.533000	0.62120	AAT		0.338	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686		6	45	0	0	0	0.001168	0	6	45				
RBMXL1	494115	broad.mit.edu	37	1	89448933	89448933	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:89448933G>C	ENST00000321792.5	-	2	1004	c.577C>G	c.(577-579)Cca>Gca	p.P193A	CCBL2_ENST00000446900.2_Intron|CCBL2_ENST00000370485.2_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.P193A|RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000370491.3_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	193					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										CTTCGAGGTGGACCTCCATAA	0.488																																							uc009wcx.2		NA																	0					0						c.(577-579)CCA>GCA		RNA binding motif protein, X-linked-like 1							175.0	174.0	174.0					1																	89448933		2203	4300	6503	SO:0001583	missense	494115						nucleotide binding|RNA binding	g.chr1:89448933G>C	BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.577C>G	1.37:g.89448933G>C	ENSP00000318415:p.Pro193Ala					CCBL2_uc001dmp.2_Intron|CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron|RBMXL1_uc001dms.2_Missense_Mutation_p.P193A	p.P193A	NM_001162536	NP_001156008	Q96E39	RBMXL_HUMAN			3	1293	-			193						Missense_Mutation	SNP	ENST00000321792.5	37	c.577C>G	CCDS716.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434302	0.83776	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.77098	-1.07;-1.07	1.76	1.76	0.24704	RBM1CTR (1);	0.000000	0.85682	D	0.000000	T	0.74635	0.3742	M	0.74881	2.28	0.41306	D	0.987074	P	0.46327	0.876	P	0.51657	0.676	T	0.76876	-0.2797	10	0.66056	D	0.02	-8.0392	9.1404	0.36899	0.0:0.0:1.0:0.0	.	193	Q96E39	RBMXL_HUMAN	A	193	ENSP00000318415:P193A;ENSP00000446099:P193A	ENSP00000318415:P193A	P	-	1	0	RBMXL1	89221521	1.000000	0.71417	0.427000	0.26684	0.792000	0.44763	4.272000	0.58908	0.982000	0.38575	0.306000	0.20318	CCA		0.488	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610		4	131	0	0	0	0.009096	0	4	131				
VCAM1	7412	broad.mit.edu	37	1	101186081	101186081	+	Silent	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:101186081G>A	ENST00000294728.2	+	2	215	c.114G>A	c.(112-114)caG>caA	p.Q38Q	VCAM1_ENST00000370119.4_Silent_p.Q38Q|VCAM1_ENST00000370115.1_Silent_p.Q38Q|VCAM1_ENST00000347652.2_Silent_p.Q38Q	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	38	Ig-like C2-type 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	ATCTTGCTCAGATTGGTGACT	0.433																																							uc001dti.2		NA																	0				central_nervous_system(1)	1						c.(112-114)CAG>CAA		vascular cell adhesion molecule 1 isoform a	Carvedilol(DB01136)						89.0	91.0	90.0					1																	101186081		2203	4300	6503	SO:0001819	synonymous_variant	7412				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding	g.chr1:101186081G>A	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.114G>A	1.37:g.101186081G>A						VCAM1_uc001dtj.2_Silent_p.Q38Q|VCAM1_uc010ouj.1_Silent_p.Q38Q	p.Q38Q	NM_001078	NP_001069	P19320	VCAM1_HUMAN		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	2	234	+		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)	38			Ig-like C2-type 1.|Extracellular (Potential).		A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Silent	SNP	ENST00000294728.2	37	c.114G>A	CCDS773.1																																																																																				0.433	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078		9	74	0	0	0	0.010729	0	9	74				
GJA5	2702	broad.mit.edu	37	1	147230556	147230556	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:147230556G>T	ENST00000271348.2	-	2	952	c.791C>A	c.(790-792)cCc>cAc	p.P264H	GJA5_ENST00000369237.1_Missense_Mutation_p.P264H|RP11-433J22.2_ENST00000428911.1_RNA	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	264					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			AAAGTCGGGGGGTGGTGTGCA	0.527																																							uc001eps.1		NA																	0				ovary(1)	1						c.(790-792)CCC>CAC		connexin 40							73.0	79.0	77.0					1																	147230556		2203	4300	6503	SO:0001583	missense	2702				angiogenesis|cell-cell junction assembly|muscle contraction	integral to membrane		g.chr1:147230556G>T		CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.791C>A	1.37:g.147230556G>T	ENSP00000271348:p.Pro264His					GJA5_uc001ept.1_Missense_Mutation_p.P264H	p.P264H	NM_181703	NP_859054	P36382	CXA5_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.202)		2	932	-	all_hematologic(923;0.0276)		264			Cytoplasmic (Potential).		Q5T3B6|Q5U0N6	Missense_Mutation	SNP	ENST00000271348.2	37	c.791C>A	CCDS929.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095835	0.56075	.	.	ENSG00000143140	ENST00000271348;ENST00000369237	D;D	0.86769	-2.17;-2.17	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.92289	0.7554	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.91224	0.5009	10	0.45353	T	0.12	.	18.8328	0.92148	0.0:0.0:1.0:0.0	.	264	P36382	CXA5_HUMAN	H	264	ENSP00000271348:P264H;ENSP00000358240:P264H	ENSP00000271348:P264H	P	-	2	0	GJA5	145697180	1.000000	0.71417	0.742000	0.31022	0.713000	0.41058	7.830000	0.86741	2.677000	0.91161	0.563000	0.77884	CCC		0.527	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039422.2	NM_181703		18	98	1	0	5.03518e-11	0.007413	6.9276e-11	18	98				
FLG	2312	broad.mit.edu	37	1	152278958	152278958	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:152278958G>A	ENST00000368799.1	-	3	8439	c.8404C>T	c.(8404-8406)Cac>Tac	p.H2802Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2802	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAATGCTCGTGGTGGTACCCC	0.607									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(8404-8406)CAC>TAC		filaggrin							178.0	250.0	226.0					1																	152278958		2200	4297	6497	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152278958G>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8404C>T	1.37:g.152278958G>A	ENSP00000357789:p.His2802Tyr						p.H2802Y	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	8440	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2802			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.8404C>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	8.743	0.919483	0.17982	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.01665	4.7	4.47	4.47	0.54385	.	.	.	.	.	T	0.01661	0.0053	L	0.28115	0.83	0.09310	N	1	D	0.69078	0.997	P	0.57911	0.829	T	0.55952	-0.8059	9	0.44086	T	0.13	-7.6506	13.0368	0.58877	0.0:0.0:1.0:0.0	.	2802	P20930	FILA_HUMAN	Y	2802;64	ENSP00000357789:H2802Y	ENSP00000357786:H64Y	H	-	1	0	FLG	150545582	0.001000	0.12720	0.025000	0.17156	0.007000	0.05969	0.911000	0.28584	2.186000	0.69663	0.306000	0.20318	CAC		0.607	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		64	607	0	0	0	0.00361	0	64	607				
FLG	2312	broad.mit.edu	37	1	152280504	152280504	+	Silent	SNP	G	G	A	rs141571186		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:152280504G>A	ENST00000368799.1	-	3	6893	c.6858C>T	c.(6856-6858)caC>caT	p.H2286H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2286	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTGTCTTCGTGATGGGACC	0.557									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(6856-6858)CAC>CAT		filaggrin							256.0	261.0	259.0					1																	152280504		2203	4300	6503	SO:0001819	synonymous_variant	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152280504G>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6858C>T	1.37:g.152280504G>A							p.H2286H	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6894	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2286			Ser-rich.		Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	c.6858C>T	CCDS30860.1																																																																																				0.557	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		42	659	0	0	0	0.00361	0	42	659				
TRIM46	80128	broad.mit.edu	37	1	155150586	155150586	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:155150586C>A	ENST00000334634.4	+	6	1018	c.1018C>A	c.(1018-1020)Cag>Aag	p.Q340K	TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000545012.1_Missense_Mutation_p.Q214K|TRIM46_ENST00000368385.4_Missense_Mutation_p.Q340K|TRIM46_ENST00000392451.2_Missense_Mutation_p.Q340K|TRIM46_ENST00000368383.3_Missense_Mutation_p.Q340K|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000543729.1_Missense_Mutation_p.Q347K|TRIM46_ENST00000368382.1_Missense_Mutation_p.Q317K	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	340						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AGAATGCCAGCAGGAGCGGCT	0.637																																							uc001fhs.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1018-1020)CAG>AAG		tripartite motif-containing 46							33.0	36.0	35.0					1																	155150586		2203	4300	6503	SO:0001583	missense	80128					intracellular	zinc ion binding	g.chr1:155150586C>A		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.1018C>A	1.37:g.155150586C>A	ENSP00000334657:p.Gln340Lys					RAG1AP1_uc010pey.1_Intron|TRIM46_uc009wpe.1_RNA|TRIM46_uc001fhq.2_RNA|TRIM46_uc001fhr.2_Missense_Mutation_p.Q340K|TRIM46_uc001fht.1_RNA|TRIM46_uc010pfa.1_Missense_Mutation_p.Q214K|TRIM46_uc001fhu.1_Missense_Mutation_p.Q317K|TRIM46_uc009wpg.1_Missense_Mutation_p.Q327K|TRIM46_uc001fhv.3_Missense_Mutation_p.Q327K|TRIM46_uc001fhw.1_RNA	p.Q340K	NM_025058	NP_079334	Q7Z4K8	TRI46_HUMAN	Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		6	1101	+	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		340			Potential.		A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	ENST00000334634.4	37	c.1018C>A	CCDS1097.1	.	.	.	.	.	.	.	.	.	.	C	4.041	0.005258	0.07866	.	.	ENSG00000163462	ENST00000543729;ENST00000430513;ENST00000368385;ENST00000545012;ENST00000392451;ENST00000368383;ENST00000368382;ENST00000334634	T;T;T;T;T;T;T	0.48201	0.88;1.02;1.02;0.82;1.02;1.02;1.02	3.59	3.59	0.41128	.	0.081587	0.50627	D	0.000116	T	0.09024	0.0223	N	0.08118	0	0.30325	N	0.787212	B;B;B;B	0.14012	0.002;0.005;0.001;0.009	B;B;B;B	0.12837	0.004;0.001;0.004;0.008	T	0.21999	-1.0229	10	0.14252	T	0.57	.	7.0334	0.24980	0.0:0.8741:0.0:0.1259	.	340;317;340;340	Q5VT61;B1AVQ4;Q7Z4K8;Q7Z4K8-2	.;.;TRI46_HUMAN;.	K	347;298;340;214;340;340;317;340	ENSP00000442719:Q347K;ENSP00000357369:Q340K;ENSP00000440254:Q214K;ENSP00000376245:Q340K;ENSP00000357367:Q340K;ENSP00000357366:Q317K;ENSP00000334657:Q340K	ENSP00000334657:Q340K	Q	+	1	0	TRIM46	153417210	0.998000	0.40836	1.000000	0.80357	0.984000	0.73092	0.664000	0.25068	2.011000	0.59026	0.313000	0.20887	CAG		0.637	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086728.1	NM_025058		21	50	1	0	3.51602e-12	0.008871	4.93687e-12	21	50				
ARHGEF11	9826	broad.mit.edu	37	1	156926306	156926306	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:156926306C>T	ENST00000361409.2	-	18	2199	c.1457G>A	c.(1456-1458)cGt>cAt	p.R486H	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.R526H	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	486	RGSL. {ECO:0000255|PROSITE- ProRule:PRU00171}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTCTCGAAGACGGATCCCAGC	0.532																																							uc001fqo.2		NA																	0				ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9						c.(1456-1458)CGT>CAT		Rho guanine nucleotide exchange factor (GEF) 11							204.0	172.0	183.0					1																	156926306		2203	4300	6503	SO:0001583	missense	9826				actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr1:156926306C>T	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.1457G>A	1.37:g.156926306C>T	ENSP00000354644:p.Arg486His					ARHGEF11_uc001fqn.2_Missense_Mutation_p.R526H|ARHGEF11_uc001fqp.1_Missense_Mutation_p.R15H	p.R486H	NM_014784	NP_055599	O15085	ARHGB_HUMAN			18	2497	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		486			RGSL.		D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	c.1457G>A	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	C	13.84	2.356144	0.41700	.	.	ENSG00000132694	ENST00000368194;ENST00000361409	D;D	0.83837	-1.77;-1.77	5.08	4.17	0.49024	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	0.117792	0.38663	N	0.001616	T	0.55561	0.1928	L	0.35341	1.055	0.80722	D	1	P;B	0.40144	0.704;0.323	B;B	0.23716	0.048;0.019	T	0.65105	-0.6249	10	0.59425	D	0.04	-6.0609	9.5546	0.39330	0.0:0.8396:0.0:0.1604	.	486;526	O15085;O15085-2	ARHGB_HUMAN;.	H	526;486	ENSP00000357177:R526H;ENSP00000354644:R486H	ENSP00000354644:R486H	R	-	2	0	ARHGEF11	155192930	0.991000	0.36638	1.000000	0.80357	0.564000	0.35744	2.859000	0.48364	1.373000	0.46208	-0.225000	0.12378	CGT		0.532	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236		13	172	0	0	0	0.001855	0	13	172				
BLZF1	8548	broad.mit.edu	37	1	169349788	169349788	+	Silent	SNP	T	T	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:169349788T>C	ENST00000367808.3	+	5	1161	c.738T>C	c.(736-738)gcT>gcC	p.A246A	BLZF1_ENST00000329281.2_Silent_p.A246A			Q9H2G9	GO45_HUMAN	basic leucine zipper nuclear factor 1	246					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|mitotic cell cycle (GO:0000278)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	14	all_hematologic(923;0.208)					CACACGGGGCTATACAAGATC	0.403																																							uc001gfx.1		NA																	0				skin(1)	1						c.(736-738)GCT>GCC		basic leucine zipper nuclear factor 1							141.0	115.0	124.0					1																	169349788		2203	4300	6503	SO:0001819	synonymous_variant	8548				cell proliferation|Golgi organization|Golgi to plasma membrane protein transport|regulation of cell growth|regulation of transcription from RNA polymerase II promoter	Golgi lumen|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding	g.chr1:169349788T>C	U79751	CCDS1278.1	1q24	2008-08-01	2008-08-01		ENSG00000117475	ENSG00000117475			1065	protein-coding gene	gene with protein product		608692				9129147	Standard	NM_003666		Approved	JEM-1	uc001gfy.3	Q9H2G9	OTTHUMG00000035453	ENST00000367808.3:c.738T>C	1.37:g.169349788T>C						BLZF1_uc001gfy.2_Silent_p.A246A|BLZF1_uc009wvp.1_Silent_p.A223A	p.A246A	NM_003666	NP_003657	Q9H2G9	GO45_HUMAN			5	1175	+	all_hematologic(923;0.208)		246					O15298|Q5T531|Q5T533|Q9GZX4	Silent	SNP	ENST00000367808.3	37	c.738T>C	CCDS1278.1																																																																																				0.403	BLZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086109.1	NM_003666		4	81	0	0	0	0.009096	0	4	81				
PRG4	10216	broad.mit.edu	37	1	186276429	186276429	+	Silent	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:186276429C>T	ENST00000445192.2	+	7	1623	c.1578C>T	c.(1576-1578)acC>acT	p.T526T	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367483.4_Silent_p.T485T|PRG4_ENST00000367485.4_Silent_p.T433T|PRG4_ENST00000367486.3_Silent_p.T483T	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	526	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CACCCACCACCACCAAGTCTG	0.637																																							uc001gru.3		NA																	0				skin(1)	1						c.(1576-1578)ACC>ACT		proteoglycan 4 isoform A							134.0	119.0	124.0					1																	186276429		2203	4298	6501	SO:0001819	synonymous_variant	10216				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity	g.chr1:186276429C>T	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1578C>T	1.37:g.186276429C>T						PRG4_uc001grt.3_Silent_p.T485T|PRG4_uc009wyl.2_Silent_p.T433T|PRG4_uc009wym.2_Silent_p.T392T|PRG4_uc010poo.1_Intron	p.T526T	NM_005807	NP_005798	Q92954	PRG4_HUMAN			7	1629	+			526			59 X 8 AA repeats of K-X-P-X-P-T-T-X.|23.		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	c.1578C>T	CCDS1369.1																																																																																				0.637	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807		4	131	0	0	0	0.009096	0	4	131				
CACNA1S	779	broad.mit.edu	37	1	201029913	201029913	+	Missense_Mutation	SNP	C	C	T	rs142102094		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:201029913C>T	ENST00000362061.3	-	26	3513	c.3287G>A	c.(3286-3288)cGc>cAc	p.R1096H	CACNA1S_ENST00000367338.3_Missense_Mutation_p.R1096H	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1096					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R1096H(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTCAGTGGGCGGGCCTTCAG	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		20761	0.001		0.0	False		,,,				2504	0.0						uc001gvv.2		NA																	1	Substitution - Missense(1)		prostate(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(3286-3288)CGC>CAC		calcium channel, voltage-dependent, L type,	Magnesium Sulfate(DB00653)|Verapamil(DB00661)	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	260.0	253.0	255.0		3287	4.2	1.0	1	dbSNP_134	255	0,8600		0,0,4300	no	missense	CACNA1S	NM_000069.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	1096/1874	201029913	1,13005	2203	4300	6503	SO:0001583	missense	779				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity	g.chr1:201029913C>T	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3287G>A	1.37:g.201029913C>T	ENSP00000355192:p.Arg1096His						p.R1096H	NM_000069	NP_000060	Q13698	CAC1S_HUMAN			26	3514	-			1096			Cytoplasmic (Potential).		A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	c.3287G>A	CCDS1407.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	11.16	1.557782	0.27827	2.27E-4	0.0	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.96459	-4.02;-3.94	5.17	4.25	0.50352	.	0.000000	0.85682	D	0.000000	D	0.94660	0.8278	M	0.80183	2.485	0.48288	D	0.999621	P	0.37914	0.611	B	0.32022	0.139	D	0.93561	0.6895	10	0.62326	D	0.03	.	10.0932	0.42460	0.0:0.7838:0.1398:0.0764	.	1096	Q13698	CAC1S_HUMAN	H	1096	ENSP00000355192:R1096H;ENSP00000356307:R1096H	ENSP00000355192:R1096H	R	-	2	0	CACNA1S	199296536	1.000000	0.71417	1.000000	0.80357	0.083000	0.17756	6.046000	0.71029	1.271000	0.44313	-0.175000	0.13238	CGC		0.532	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069		5	368	0	0	0	0.001168	0	5	368				
RYR2	6262	broad.mit.edu	37	1	237947181	237947181	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:237947181C>G	ENST00000366574.2	+	90	12486	c.12169C>G	c.(12169-12171)Cac>Gac	p.H4057D	RYR2_ENST00000360064.6_Missense_Mutation_p.H4063D|RYR2_ENST00000542537.1_Missense_Mutation_p.H4041D|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4057					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGCCATAAGCACTACACGCA	0.468																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(12169-12171)CAC>GAC		cardiac muscle ryanodine receptor							43.0	42.0	42.0					1																	237947181		1974	4153	6127	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237947181C>G	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12169C>G	1.37:g.237947181C>G	ENSP00000355533:p.His4057Asp					RYR2_uc010pya.1_Missense_Mutation_p.H472D	p.H4057D	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	12289	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4057			EF-hand.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.12169C>G	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995829	0.54147	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.81908	-1.55;-1.55;-1.55	5.85	5.85	0.93711	EF-hand-like domain (1);	0.000000	0.64402	D	0.000002	T	0.74291	0.3697	N	0.04746	-0.17	0.80722	D	1	P;P	0.42785	0.536;0.79	B;B	0.43445	0.42;0.306	T	0.79047	-0.1963	10	0.59425	D	0.04	.	20.1577	0.98120	0.0:1.0:0.0:0.0	.	1031;4057	B4DGV4;Q92736	.;RYR2_HUMAN	D	4057;4063;4041;1031	ENSP00000355533:H4057D;ENSP00000353174:H4063D;ENSP00000443798:H4041D	ENSP00000353174:H4063D	H	+	1	0	RYR2	236013804	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.880000	0.69698	2.767000	0.95098	0.655000	0.94253	CAC		0.468	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		5	23	0	0	0	0.000602	0	5	23				
CHRM3	1131	broad.mit.edu	37	1	240071045	240071045	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:240071045G>T	ENST00000255380.4	+	5	1073	c.294G>T	c.(292-294)caG>caT	p.Q98H		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	98					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TCAACAAGCAGCTGAAGACGG	0.468																																							uc001hyp.2		NA																	0				ovary(4)|skin(1)	5						c.(292-294)CAG>CAT		cholinergic receptor, muscarinic 3	Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)						125.0	102.0	110.0					1																	240071045		2203	4300	6503	SO:0001583	missense	1131				cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity	g.chr1:240071045G>T	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.294G>T	1.37:g.240071045G>T	ENSP00000255380:p.Gln98His						p.Q98H	NM_000740	NP_000731	P20309	ACM3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		5	1073	+	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	98			Cytoplasmic (By similarity).		Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	ENST00000255380.4	37	c.294G>T	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268804	0.40095	.	.	ENSG00000133019	ENST00000255380;ENST00000448020	T;T	0.72051	-0.62;1.24	5.9	3.05	0.35203	GPCR, rhodopsin-like superfamily (1);	0.114744	0.64402	D	0.000013	T	0.73690	0.3619	L	0.35593	1.075	0.58432	D	0.999999	D	0.89917	1.0	D	0.79108	0.992	T	0.71258	-0.4646	10	0.49607	T	0.09	-15.4265	10.1236	0.42637	0.2852:0.0:0.7148:0.0	.	98	P20309	ACM3_HUMAN	H	98	ENSP00000255380:Q98H;ENSP00000404764:Q98H	ENSP00000255380:Q98H	Q	+	3	2	CHRM3	238137668	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	1.891000	0.39738	0.410000	0.25675	0.650000	0.86243	CAG		0.468	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740		17	36	1	0	2.4624e-09	0.008871	3.25672e-09	17	36				
OR6F1	343169	broad.mit.edu	37	1	247875362	247875362	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:247875362A>T	ENST00000302084.2	-	1	743	c.696T>A	c.(694-696)agT>agA	p.S232R	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TGCTCCGGCCACTGGCAGAGG	0.522																																							uc001idj.1		NA																	0					0						c.(694-696)AGT>AGA		olfactory receptor, family 6, subfamily F,							120.0	109.0	112.0					1																	247875362		2203	4300	6503	SO:0001583	missense	343169				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247875362A>T	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.696T>A	1.37:g.247875362A>T	ENSP00000305640:p.Ser232Arg						p.S232R	NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	696	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		232			Cytoplasmic (Potential).		B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	ENST00000302084.2	37	c.696T>A	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	A	0.274	-0.990783	0.02162	.	.	ENSG00000169214	ENST00000302084	T	0.00123	8.7	3.72	-7.44	0.01379	GPCR, rhodopsin-like superfamily (1);	0.543405	0.16220	N	0.224084	T	0.00073	0.0002	N	0.20357	0.565	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.43621	-0.9380	10	0.46703	T	0.11	0.0096	2.493	0.04615	0.1244:0.3888:0.2331:0.2537	.	232	Q8NGZ6	OR6F1_HUMAN	R	232	ENSP00000305640:S232R	ENSP00000305640:S232R	S	-	3	2	OR6F1	245941985	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.814000	0.00359	-2.280000	0.00675	-1.208000	0.01637	AGT		0.522	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286		13	98	0	0	0	0.001368	0	13	98				
OR14C36	127066	broad.mit.edu	37	1	248512610	248512610	+	Silent	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr1:248512610C>T	ENST00000317861.1	+	1	534	c.534C>T	c.(532-534)gaC>gaT	p.D178D		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						TCTTCTGTGACATCCCCTCTC	0.512																																							uc010pzl.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(532-534)GAC>GAT		olfactory receptor, family 14, subfamily C,							160.0	140.0	147.0					1																	248512610		2203	4300	6503	SO:0001819	synonymous_variant	127066				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248512610C>T	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.534C>T	1.37:g.248512610C>T							p.D178D	NM_001001918	NP_001001918	Q8NHC7	O14CZ_HUMAN			1	534	+			178			Extracellular (Potential).		Q6IEZ6	Silent	SNP	ENST00000317861.1	37	c.534C>T	CCDS31112.1																																																																																				0.512	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918		24	61	0	0	0	0.00632	0	24	61				
CDH23	64072	broad.mit.edu	37	10	73544152	73544152	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr10:73544152G>A	ENST00000224721.6	+	41	5497	c.5492G>A	c.(5491-5493)cGg>cAg	p.R1831Q		NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	1826	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GCCCGTGACCGGGGGATGCCC	0.617																																							uc001jrx.3		NA																	0				central_nervous_system(5)|large_intestine(4)|ovary(2)	11						c.(5476-5478)CGG>CAG		cadherin-like 23 isoform 1 precursor							52.0	57.0	56.0					10																	73544152		1948	4124	6072	SO:0001583	missense	64072				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding	g.chr10:73544152G>A	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.5492G>A	10.37:g.73544152G>A	ENSP00000224721:p.Arg1831Gln						p.R1826Q	NM_022124	NP_071407	Q9H251	CAD23_HUMAN			40	5854	+			1826			Cadherin 17.|Extracellular (Potential).		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37	c.5477G>A		.	.	.	.	.	.	.	.	.	.	g	20.2	3.950911	0.73787	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721	.	.	.	5.44	5.44	0.79542	Cadherin (4);Cadherin-like (1);	0.074155	0.56097	D	0.000039	T	0.43166	0.1235	L	0.27053	0.805	0.80722	D	1	B	0.31893	0.345	B	0.28553	0.091	T	0.31833	-0.9929	9	0.17832	T	0.49	.	15.644	0.77033	0.0:0.0:0.8623:0.1377	.	1826	Q9H251	CAD23_HUMAN	Q	1831;1826;1829	.	ENSP00000224721:R1831Q	R	+	2	0	CDH23	73214158	1.000000	0.71417	0.999000	0.59377	0.834000	0.47266	7.124000	0.77185	2.556000	0.86216	0.450000	0.29827	CGG		0.617	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		10	60	0	0	0	0.010729	0	10	60				
SH2D4B	387694	broad.mit.edu	37	10	82329944	82329944	+	Silent	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr10:82329944G>T	ENST00000470604.2	+	2	216	c.216G>T	c.(214-216)ggG>ggT	p.G72G	SH2D4B_ENST00000339284.2_Silent_p.G73G|SH2D4B_ENST00000313455.4_Silent_p.G24G			Q5SQS7	SH24B_HUMAN	SH2 domain containing 4B	72										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)	13			Colorectal(32;0.229)			GGCTCCTAGGGGCAGATGGCG	0.517																																							uc001kck.1		NA																	0					0						c.(217-219)GGG>GGT		SH2 domain containing 4B isoform 1							94.0	92.0	92.0					10																	82329944		2203	4300	6503	SO:0001819	synonymous_variant	387694							g.chr10:82329944G>T		CCDS7370.1, CCDS44449.1	10q23.1	2013-02-14			ENSG00000178217	ENSG00000178217		"""SH2 domain containing"""	31440	protein-coding gene	gene with protein product							Standard	NM_207372		Approved		uc001kck.1	Q5SQS7	OTTHUMG00000018617	ENST00000470604.2:c.216G>T	10.37:g.82329944G>T						SH2D4B_uc001kcl.1_Silent_p.G24G	p.G73G	NM_207372	NP_997255	Q5SQS7	SH24B_HUMAN	Colorectal(32;0.229)		2	649	+			72					Q5SQS5|Q6ZVW9|Q6ZVZ3	Silent	SNP	ENST00000470604.2	37	c.219G>T																																																																																					0.517	SH2D4B-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_351984		24	102	1	0	4.47668e-21	0.003954	6.84865e-21	24	102				
RNLS	55328	broad.mit.edu	37	10	90342049	90342049	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr10:90342049G>C	ENST00000331772.4	-	2	156	c.134C>G	c.(133-135)aCa>aGa	p.T45R	RNLS_ENST00000371947.3_Missense_Mutation_p.T45R|RNLS_ENST00000437752.1_Intron|RNLS_ENST00000466945.1_5'UTR	NM_001031709.2	NP_001026879.2	Q5VYX0	RNLS_HUMAN	renalase, FAD-dependent amine oxidase	45					cardiac left ventricle morphogenesis (GO:0003214)|dopamine metabolic process (GO:0042417)|epinephrine metabolic process (GO:0042414)|heart contraction (GO:0060047)|norepinephrine metabolic process (GO:0042415)|phosphate ion homeostasis (GO:0055062)|regulation of systemic arterial blood pressure (GO:0003073)|response to epinephrine (GO:0071871)|response to ischemia (GO:0002931)|response to norepinephrine (GO:0071873)|response to salt (GO:1902074)	extracellular space (GO:0005615)	oxidoreductase activity (GO:0016491)			breast(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	7						ACTGCAGGCTGTAGTCATTCT	0.443																																							uc001kfe.2		NA																	0				ovary(1)	1						c.(133-135)ACA>AGA		renalase isoform 1							185.0	154.0	165.0					10																	90342049		2203	4300	6503	SO:0001583	missense	55328					extracellular region	oxidoreductase activity	g.chr10:90342049G>C	BC005364	CCDS7388.1, CCDS31239.1	10q23.31	2009-04-22	2009-04-22	2009-04-22	ENSG00000184719	ENSG00000184719			25641	protein-coding gene	gene with protein product		609360	"""chromosome 10 open reading frame 59"""	C10orf59		15841207, 17565281	Standard	NM_001031709		Approved	FLJ11218, renalase	uc001kfe.3	Q5VYX0	OTTHUMG00000018692	ENST00000331772.4:c.134C>G	10.37:g.90342049G>C	ENSP00000332530:p.Thr45Arg					RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Missense_Mutation_p.T45R	p.T45R	NM_001031709	NP_001026879	Q5VYX0	RNLS_HUMAN			2	269	-			45					Q9BS33|Q9NUP8	Missense_Mutation	SNP	ENST00000331772.4	37	c.134C>G	CCDS31239.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.050209	0.75846	.	.	ENSG00000184719	ENST00000371947;ENST00000331772	D;D	0.82344	-1.6;-1.6	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.92580	0.7643	M	0.87328	2.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93202	0.6592	10	0.87932	D	0	.	18.8259	0.92119	0.0:0.0:1.0:0.0	.	45;45	Q5VYX0;Q5VYX0-2	RNLS_HUMAN;.	R	45	ENSP00000361015:T45R;ENSP00000332530:T45R	ENSP00000332530:T45R	T	-	2	0	RNLS	90332029	1.000000	0.71417	0.091000	0.20842	0.974000	0.67602	6.741000	0.74837	2.746000	0.94184	0.591000	0.81541	ACA		0.443	RNLS-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049250.1	NM_018363		7	28	0	0	0	0.001984	0	7	28				
SLIT1	6585	broad.mit.edu	37	10	98807524	98807524	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr10:98807524A>T	ENST00000266058.4	-	16	1802	c.1557T>A	c.(1555-1557)tgT>tgA	p.C519*	SLIT1_ENST00000371070.4_Nonsense_Mutation_p.C519*|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	519	LRRNT 3.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CGTTGGCCTCACAGCGGCACT	0.642																																							uc001kmw.2		NA																	0				ovary(4)	4						c.(1555-1557)TGT>TGA		slit homolog 1 precursor							76.0	70.0	72.0					10																	98807524		2203	4300	6503	SO:0001587	stop_gained	6585				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding	g.chr10:98807524A>T	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1557T>A	10.37:g.98807524A>T	ENSP00000266058:p.Cys519*					SLIT1_uc009xvh.1_Nonsense_Mutation_p.C529*	p.C519*	NM_003061	NP_003052	O75093	SLIT1_HUMAN		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)	16	1809	-		Colorectal(252;0.162)	519			LRRNT 3.		Q5T0V1|Q8WWZ2|Q9UIL7	Nonsense_Mutation	SNP	ENST00000266058.4	37	c.1557T>A	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.322373	0.81580	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	.	.	.	4.87	-9.73	0.00512	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.3079	0.98638	0.8526:0.0:0.1474:0.0	.	.	.	.	X	519;529;519;512	.	ENSP00000266058:C519X	C	-	3	2	SLIT1	98797514	0.003000	0.15002	0.602000	0.28890	0.729000	0.41735	-0.984000	0.03755	-2.268000	0.00685	-0.376000	0.06991	TGT		0.642	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061		20	55	0	0	0	0.008871	0	20	55				
WNT8B	7479	broad.mit.edu	37	10	102242322	102242322	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr10:102242322G>A	ENST00000343737.5	+	6	933	c.805G>A	c.(805-807)Ggc>Agc	p.G269S		NM_003393.3	NP_003384.2	Q93098	WNT8B_HUMAN	wingless-type MMTV integration site family, member 8B	269					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|negative regulation of gene expression (GO:0010629)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of gene expression (GO:0010628)|response to estradiol (GO:0032355)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4		Colorectal(252;0.117)		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)		GGGCACCGAAGGCCGAGAGTG	0.706											OREG0020440	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001krb.2		NA																	0				ovary(1)|breast(1)|large_intestine(1)|skin(1)	4						c.(805-807)GGC>AGC		wingless-type MMTV integration site family,							10.0	12.0	11.0					10																	102242322		2184	4288	6472	SO:0001583	missense	7479				anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|determination of dorsal identity|endoderm development|eye development|gastrulation|hypothalamus development|negative regulation of anterior neural cell fate commitment of the neural plate by Wnt receptor signaling pathway|otic placode formation|positive regulation of gene expression|response to estradiol stimulus|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity	g.chr10:102242322G>A	X91940	CCDS7494.1	10q24	2003-11-12			ENSG00000075290	ENSG00000075290		"""Wingless-type MMTV integration sites"""	12789	protein-coding gene	gene with protein product		601396				8661156	Standard	NM_003393		Approved		uc001krb.3	Q93098	OTTHUMG00000018912	ENST00000343737.5:c.805G>A	10.37:g.102242322G>A	ENSP00000340677:p.Gly269Ser		OREG0020440	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1365		p.G269S	NM_003393	NP_003384	Q93098	WNT8B_HUMAN		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)	6	919	+		Colorectal(252;0.117)	269					O00771|Q5VX55|Q8WYK9	Missense_Mutation	SNP	ENST00000343737.5	37	c.805G>A	CCDS7494.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.739625	0.89573	.	.	ENSG00000075290	ENST00000343737	D	0.82255	-1.59	5.28	3.42	0.39159	.	0.045937	0.85682	D	0.000000	D	0.92731	0.7689	H	0.95504	3.68	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.92528	0.6031	10	0.87932	D	0	.	10.2108	0.43138	0.0711:0.0:0.7927:0.1362	.	269	Q93098	WNT8B_HUMAN	S	269	ENSP00000340677:G269S	ENSP00000340677:G269S	G	+	1	0	WNT8B	102232312	1.000000	0.71417	0.995000	0.50966	0.864000	0.49448	9.761000	0.98940	0.614000	0.30107	0.313000	0.20887	GGC		0.706	WNT8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049867.1	NM_003393		3	17	0	0	0	0.004672	0	3	17				
SUFU	51684	broad.mit.edu	37	10	104356990	104356990	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr10:104356990G>T	ENST00000369902.3	+	7	1016	c.850G>T	c.(850-852)Gat>Tat	p.D284Y	SUFU_ENST00000471000.1_3'UTR|SUFU_ENST00000423559.2_Missense_Mutation_p.D284Y|SUFU_ENST00000369899.2_Missense_Mutation_p.D284Y	NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	284					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		GCCCCCCGAGGATGACGAGGA	0.607			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation		OREG0020482	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001kvy.1		NA	yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	D|F|S	suppressor of fused homolog (Drosophila)			O		medulloblastoma	medulloblastoma		0				central_nervous_system(4)|skin(2)|breast(1)	7						c.(850-852)GAT>TAT		suppressor of fused							97.0	91.0	93.0					10																	104356990		2203	4300	6503	SO:0001583	missense	51684	Medulloblastoma_associated_with_Germline_SUFU_Mutation	Familial Cancer Database		negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding	g.chr10:104356990G>T	AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.850G>T	10.37:g.104356990G>T	ENSP00000358918:p.Asp284Tyr		OREG0020482	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1381	SUFU_uc001kvw.1_Missense_Mutation_p.D284Y|SUFU_uc001kvx.2_Missense_Mutation_p.D284Y|SUFU_uc009xxe.1_RNA|SUFU_uc009xxf.1_RNA	p.D284Y	NM_016169	NP_057253	Q9UMX1	SUFU_HUMAN		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)	7	996	+		Colorectal(252;0.207)	284					Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Missense_Mutation	SNP	ENST00000369902.3	37	c.850G>T	CCDS7537.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.039453	0.93630	.	.	ENSG00000107882	ENST00000369902;ENST00000369899;ENST00000423559	T;T;T	0.47177	0.85;0.85;0.85	6.03	6.03	0.97812	Suppressor of fused C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.61400	0.2344	L	0.51422	1.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.974	D;D;P	0.87578	0.998;0.997;0.683	T	0.51196	-0.8736	10	0.02654	T	1	-20.0933	20.5568	0.99304	0.0:0.0:1.0:0.0	.	284;284;284	Q9UMX1;Q9UMX1-2;Q9UMX1-3	SUFU_HUMAN;.;.	Y	284	ENSP00000358918:D284Y;ENSP00000358915:D284Y;ENSP00000411597:D284Y	ENSP00000358915:D284Y	D	+	1	0	SUFU	104346980	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	9.476000	0.97823	2.861000	0.98227	0.655000	0.94253	GAT		0.607	SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050089.1	NM_016169		13	127	1	0	5.50884e-06	0.001368	6.56577e-06	13	127				
SLK	9748	broad.mit.edu	37	10	105770586	105770586	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr10:105770586G>A	ENST00000369755.3	+	13	3342	c.2797G>A	c.(2797-2799)Gtg>Atg	p.V933M	SLK_ENST00000474260.1_Intron|SLK_ENST00000335753.4_Intron	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	933					apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TATAAATGAAGTGGAGAAAGC	0.438																																					NSCLC(111;540 1651 1927 4474 17706)	NSCLC(111;540 1651 1927 4474 17706)	uc001kxo.1		NA																	0				ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8						c.(2797-2799)GTG>ATG		serine/threonine kinase 2							69.0	69.0	69.0					10																	105770586		2203	4300	6503	SO:0001583	missense	9748				apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity	g.chr10:105770586G>A		CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.2797G>A	10.37:g.105770586G>A	ENSP00000358770:p.Val933Met					SLK_uc001kxp.1_Intron	p.V933M	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	13	2831	+		Colorectal(252;0.178)	933			Potential.		D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	ENST00000369755.3	37	c.2797G>A	CCDS7553.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281107	0.80692	.	.	ENSG00000065613	ENST00000369755	T	0.36157	1.27	5.43	5.43	0.79202	Protein kinase-like domain (1);	0.176588	0.34046	N	0.004304	T	0.45558	0.1348	L	0.56199	1.76	0.80722	D	1	P	0.45531	0.86	P	0.46510	0.519	T	0.47005	-0.9150	10	0.87932	D	0	.	19.2391	0.93875	0.0:0.0:1.0:0.0	.	933	Q9H2G2	SLK_HUMAN	M	933	ENSP00000358770:V933M	ENSP00000358770:V933M	V	+	1	0	SLK	105760576	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.877000	0.87225	2.536000	0.85505	0.467000	0.42956	GTG		0.438	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1	NM_014720		5	35	0	0	0	0.001168	0	5	35				
DMBT1	1755	broad.mit.edu	37	10	124353097	124353097	+	Missense_Mutation	SNP	G	G	A	rs561523976	byFrequency	TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr10:124353097G>A	ENST00000338354.3	+	21	2619	c.2513G>A	c.(2512-2514)cGg>cAg	p.R838Q	DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000368955.3_Missense_Mutation_p.R828Q|DMBT1_ENST00000368956.2_Intron|DMBT1_ENST00000368909.3_Missense_Mutation_p.R838Q|DMBT1_ENST00000344338.3_Missense_Mutation_p.R828Q|DMBT1_ENST00000330163.4_Intron			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	838					defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCCCAGTCCCGGCCGACACCC	0.522													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18942	0.0		0.0	False		,,,				2504	0.0				Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	0				central_nervous_system(7)	7						c.(2512-2514)CGG>CAG		deleted in malignant brain tumors 1 isoform b							442.0	332.0	367.0					10																	124353097		1906	4073	5979	SO:0001583	missense	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124353097G>A		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2513G>A	10.37:g.124353097G>A	ENSP00000342210:p.Arg838Gln					DMBT1_uc001lgl.1_Missense_Mutation_p.R828Q|DMBT1_uc001lgm.1_Intron|DMBT1_uc009xzz.1_Missense_Mutation_p.R838Q|DMBT1_uc010qtx.1_Intron	p.R838Q	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN			21	2619	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	838					A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37	c.2513G>A		.	.	.	.	.	.	.	.	.	.	G	0.027	-1.363585	0.01235	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000344338;ENST00000368909;ENST00000368955	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	1.93	-3.85	0.04243	.	.	.	.	.	T	0.11153	0.0272	N	0.02539	-0.55	0.09310	N	1	B;D;B	0.58268	0.139;0.982;0.0	B;B;B	0.39971	0.04;0.315;0.0	T	0.15752	-1.0426	9	0.13108	T	0.6	.	1.0288	0.01533	0.2619:0.395:0.1479:0.1951	.	838;828;838	Q9UGM3-6;Q9UGM3-3;Q9UGM3	.;.;DMBT1_HUMAN	Q	838;838;838;838;838;838;828;838;828	ENSP00000342210:R838Q;ENSP00000343175:R828Q;ENSP00000357905:R838Q;ENSP00000357951:R828Q	ENSP00000342210:R838Q	R	+	2	0	DMBT1	124343087	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.437000	0.06914	-1.326000	0.02266	-1.760000	0.00671	CGG		0.522	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		53	347	0	0	0	0.00361	0	53	347				
OSBPL5	114879	broad.mit.edu	37	11	3125497	3125497	+	Silent	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:3125497G>T	ENST00000263650.7	-	10	1329	c.1170C>A	c.(1168-1170)ccC>ccA	p.P390P	OSBPL5_ENST00000389989.3_Silent_p.P322P|OSBPL5_ENST00000542243.1_Intron|OSBPL5_ENST00000525498.1_Silent_p.P301P|OSBPL5_ENST00000348039.5_Silent_p.P322P	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	390					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		GTACGAACGTGGGTAGCACCA	0.627																																							uc001lxk.2		NA																	0				large_intestine(2)|central_nervous_system(1)	3						c.(1168-1170)CCC>CCA		oxysterol-binding protein-like protein 5 isoform							115.0	85.0	95.0					11																	3125497		2202	4298	6500	SO:0001819	synonymous_variant	114879				cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding	g.chr11:3125497G>T	AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.1170C>A	11.37:g.3125497G>T						OSBPL5_uc010qxq.1_Silent_p.P301P|OSBPL5_uc009ydw.2_Silent_p.P322P|OSBPL5_uc001lxl.2_Silent_p.P322P|OSBPL5_uc009ydx.2_Silent_p.P414P	p.P390P	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)	10	1328	-		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)	390					A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Silent	SNP	ENST00000263650.7	37	c.1170C>A	CCDS31344.1																																																																																				0.627	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032332.2			8	68	1	0	0.000157383	0.00308	0.000183316	8	68				
ART5	116969	broad.mit.edu	37	11	3660985	3660985	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:3660985G>A	ENST00000397068.3	-	2	1066	c.674C>T	c.(673-675)cCc>cTc	p.P225L	TRPC2_ENST00000526541.1_RNA|ART5_ENST00000359918.4_Missense_Mutation_p.P225L|ART5_ENST00000397067.3_Intron	NM_053017.3	NP_443750.2	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5	225					protein ADP-ribosylation (GO:0006471)	extracellular region (GO:0005576)|membrane (GO:0016020)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ nucleosidase activity (GO:0003953)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)	11		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTCATGGGGGGGAATCAGCAC	0.502																																							uc001lyb.1		NA																	0				ovary(1)	1						c.(673-675)CCC>CTC		ADP-ribosyltransferase 5 precursor							69.0	83.0	78.0					11																	3660985		2201	4298	6499	SO:0001583	missense	116969					extracellular region	NAD(P)+-protein-arginine ADP-ribosyltransferase activity	g.chr11:3660985G>A	Y16835	CCDS7743.1, CCDS73242.1	11p15.4	2008-02-05			ENSG00000167311	ENSG00000167311			24049	protein-coding gene	gene with protein product		610625				11587854, 10448534	Standard	NM_001079536		Approved		uc001lyb.1	Q96L15	OTTHUMG00000011842	ENST00000397068.3:c.674C>T	11.37:g.3660985G>A	ENSP00000380258:p.Pro225Leu					ART5_uc001lyc.1_Missense_Mutation_p.P225L|ART5_uc001lyd.2_Intron|ART5_uc009yea.2_Intron	p.P225L	NM_053017	NP_443750	Q96L15	NAR5_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)	2	1067	-		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)	225					C9IYG7|Q6UX84|Q86W02	Missense_Mutation	SNP	ENST00000397068.3	37	c.674C>T	CCDS7743.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039960	0.55003	.	.	ENSG00000167311	ENST00000397068;ENST00000359918;ENST00000425767	T;T;T	0.14893	2.47;2.47;2.47	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.33177	0.0854	M	0.75447	2.3	0.80722	D	1	P	0.49961	0.93	P	0.48654	0.585	T	0.01858	-1.1259	10	0.62326	D	0.03	-20.707	18.3732	0.90420	0.0:0.0:1.0:0.0	.	225	Q96L15	NAR5_HUMAN	L	225;225;106	ENSP00000380258:P225L;ENSP00000352992:P225L;ENSP00000413852:P106L	ENSP00000352992:P225L	P	-	2	0	ART5	3617561	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.946000	0.63576	2.941000	0.99782	0.655000	0.94253	CCC		0.502	ART5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032760.2	NM_053017		5	99	0	0	0	0.001168	0	5	99				
OR52A1	23538	broad.mit.edu	37	11	5172979	5172979	+	Silent	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:5172979G>A	ENST00000380367.1	-	2	1038	c.621C>T	c.(619-621)ttC>ttT	p.F207F	OR52A1_ENST00000328942.1_Silent_p.F207F			Q9UKL2	O52A1_HUMAN	olfactory receptor, family 52, subfamily A, member 1	207					sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	19		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGCTACAGTGAAGGCCACAA	0.423																																							uc010qyy.1		NA																	0				ovary(1)|breast(1)	2						c.(619-621)TTC>TTT		olfactory receptor, family 52, subfamily A,							176.0	164.0	168.0					11																	5172979		2201	4298	6499	SO:0001819	synonymous_variant	23538				sensory perception of smell	integral to plasma membrane	olfactory receptor activity	g.chr11:5172979G>A	AF154673	CCDS31374.1	11p15.4	2012-08-09			ENSG00000182070	ENSG00000182070		"""GPCR / Class A : Olfactory receptors"""	8318	protein-coding gene	gene with protein product						10512676	Standard	NM_012375		Approved	HPFH1OR	uc010qyy.2	Q9UKL2	OTTHUMG00000066603	ENST00000380367.1:c.621C>T	11.37:g.5172979G>A							p.F207F	NM_012375	NP_036507	Q9UKL2	O52A1_HUMAN		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	621	-		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)	207			Helical; Name=5; (Potential).		Q6IF31	Silent	SNP	ENST00000380367.1	37	c.621C>T	CCDS31374.1																																																																																				0.423	OR52A1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142810.2	NM_012375		16	101	0	0	0	0.004007	0	16	101				
ILK	3611	broad.mit.edu	37	11	6631242	6631242	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:6631242G>C	ENST00000396751.2	+	10	1510	c.1054G>C	c.(1054-1056)Gca>Cca	p.A352P	RP11-732A19.2_ENST00000527398.1_RNA|ILK_ENST00000526711.1_3'UTR|TAF10_ENST00000531760.1_5'Flank|ILK_ENST00000420936.2_Missense_Mutation_p.A352P|ILK_ENST00000299421.4_Missense_Mutation_p.A352P|ILK_ENST00000528995.1_Missense_Mutation_p.A291P|ILK_ENST00000537806.1_Missense_Mutation_p.A218P	NM_001014795.1	NP_001014795.1	Q13418	ILK_HUMAN	integrin-linked kinase	352	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell junction assembly (GO:0034329)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|extracellular fibril organization (GO:0043206)|fibroblast migration (GO:0010761)|integrin-mediated signaling pathway (GO:0007229)|myelin assembly (GO:0032288)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|peptidyl-serine phosphorylation (GO:0018105)|platelet aggregation (GO:0070527)|positive regulation of axon extension (GO:0045773)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		TCGCATGTATGCACCTGCCTG	0.507																																							uc001mee.2		NA																	0				central_nervous_system(1)	1						c.(1054-1056)GCA>CCA		integrin-linked kinase							97.0	98.0	98.0					11																	6631242		2201	4296	6497	SO:0001583	missense	3611				cell junction assembly|cell proliferation|cell-matrix adhesion|integrin-mediated signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of transcription, DNA-dependent	cytosol|focal adhesion	ATP binding|protein serine/threonine kinase activity	g.chr11:6631242G>C	U40282	CCDS7768.1, CCDS60712.1, CCDS60713.1	11p15.4	2014-09-17			ENSG00000166333	ENSG00000166333		"""Ankyrin repeat domain containing"""	6040	protein-coding gene	gene with protein product		602366				8538749	Standard	NM_004517		Approved		uc001mef.3	Q13418	OTTHUMG00000133407	ENST00000396751.2:c.1054G>C	11.37:g.6631242G>C	ENSP00000379975:p.Ala352Pro					ILK_uc001mef.2_Missense_Mutation_p.A352P|ILK_uc010rap.1_Missense_Mutation_p.A218P|ILK_uc010raq.1_Missense_Mutation_p.A291P|ILK_uc001meg.2_Missense_Mutation_p.A198P|ILK_uc001meh.2_Missense_Mutation_p.A352P|ILK_uc001mei.2_5'Flank	p.A352P	NM_001014794	NP_001014794	Q13418	ILK_HUMAN		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)	11	1189	+		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)	352			Protein kinase.		B7Z1I0|B7Z418|D3DQU0|P57043|Q68DZ3	Missense_Mutation	SNP	ENST00000396751.2	37	c.1054G>C	CCDS7768.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.715893	0.30413	.	.	ENSG00000166333	ENST00000299421;ENST00000537806;ENST00000420936;ENST00000528995;ENST00000396751	D;D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38	4.87	4.87	0.63330	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.135413	0.52532	D	0.000078	T	0.73063	0.3539	N	0.01505	-0.83	0.80722	D	1	P;B	0.37708	0.606;0.377	B;B	0.35470	0.203;0.203	T	0.77915	-0.2409	10	0.37606	T	0.19	.	15.6822	0.77381	0.0:0.0:1.0:0.0	.	291;352	B7Z418;Q13418	.;ILK_HUMAN	P	352;218;352;291;352	ENSP00000299421:A352P;ENSP00000439606:A218P;ENSP00000403487:A352P;ENSP00000435323:A291P;ENSP00000379975:A352P	ENSP00000299421:A352P	A	+	1	0	ILK	6587818	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.308000	0.72820	2.700000	0.92200	0.563000	0.77884	GCA		0.507	ILK-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384519.1	NM_004517		3	70	0	0	0	0.000602	0	3	70				
SPON1	10418	broad.mit.edu	37	11	14101549	14101549	+	RNA	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:14101549C>A	ENST00000310358.7	+	0	1193							Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)		p.H219N(1)		NS(1)|endometrium(1)|large_intestine(5)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	21				Epithelial(150;0.00898)		CGAGAAGACACACCCAAAGGA	0.488																																							uc001mle.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(658-660)CAC>AAC		spondin 1, extracellular matrix protein							119.0	115.0	116.0					11																	14101549		1961	4147	6108			10418				cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding	g.chr11:14101549C>A	AB018305	CCDS73262.1	11p15.2	2014-05-06	2004-03-05		ENSG00000152268	ENSG00000262655			11252	protein-coding gene	gene with protein product		604989	"""spondin 1, (f-spondin) extracellular matrix protein"""			9872452	Standard	NM_006108		Approved	KIAA0762, f-spondin	uc001mle.3	Q9HCB6	OTTHUMG00000181576		11.37:g.14101549C>A							p.H220N	NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN		Epithelial(150;0.00898)	6	1196	+			220			Spondin.		A8K6W5|O94862|Q8NCD7|Q8WUR5	Missense_Mutation	SNP	ENST00000310358.7	37	c.658C>A		.	.	.	.	.	.	.	.	.	.	C	19.81	3.896102	0.72639	.	.	ENSG00000152268	ENST00000310358	.	.	.	6.17	6.17	0.99709	Spondin, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.76990	0.4065	.	.	.	0.53005	D	0.999965	P	0.48911	0.917	P	0.57101	0.813	T	0.77032	-0.2738	7	0.62326	D	0.03	.	18.3732	0.90420	0.0:1.0:0.0:0.0	.	220	Q9HCB6	SPON1_HUMAN	N	219	.	ENSP00000309297:H219N	H	+	1	0	SPON1	14058125	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	6.985000	0.76193	2.941000	0.99782	0.655000	0.94253	CAC		0.488	SPON1-201	KNOWN	basic	processed_transcript	processed_transcript		NM_145584		10	52	1	0	4.68919e-08	0.008291	5.97071e-08	10	52				
RAG2	5897	broad.mit.edu	37	11	36614887	36614887	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:36614887G>A	ENST00000311485.3	-	2	993	c.832C>T	c.(832-834)Cag>Tag	p.Q278*	C11orf74_ENST00000347206.4_5'Flank|C11orf74_ENST00000446510.2_5'Flank|C11orf74_ENST00000334307.5_5'Flank|C11orf74_ENST00000534635.1_5'Flank|RAG2_ENST00000528428.1_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	278					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				TTTTCAAGCTGATAGCCACCA	0.423									Familial Hemophagocytic Lymphohistiocytosis																														uc001mwv.3		NA																	0				skin(3)|ovary(1)|pancreas(1)	5						c.(832-834)CAG>TAG		recombination activating gene 2							93.0	92.0	93.0					11																	36614887		2202	4298	6500	SO:0001587	stop_gained	5897	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding	g.chr11:36614887G>A	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.832C>T	11.37:g.36614887G>A	ENSP00000308620:p.Gln278*					C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	p.Q278*	NM_000536	NP_000527	P55895	RAG2_HUMAN			2	1020	-	all_lung(20;0.226)	all_hematologic(20;0.00756)	278					A8K9E9|Q8TBL4	Nonsense_Mutation	SNP	ENST00000311485.3	37	c.832C>T	CCDS7903.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.746456	0.89663	.	.	ENSG00000175097	ENST00000311485	.	.	.	5.69	5.69	0.88448	.	0.063724	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	0.0307	15.3051	0.73987	0.0:0.1394:0.8606:0.0	.	.	.	.	X	278	.	ENSP00000308620:Q278X	Q	-	1	0	RAG2	36571463	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.834000	0.39171	2.692000	0.91855	0.650000	0.86243	CAG		0.423	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389536.1	NM_000536		6	75	0	0	0	0.001984	0	6	75				
OR5AS1	219447	broad.mit.edu	37	11	55798753	55798753	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:55798753C>A	ENST00000313555.1	+	1	859	c.859C>A	c.(859-861)Cca>Aca	p.P287T		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P287T(1)		endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					CATGTTTAATCCAATAATTTA	0.343																																							uc010riw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|liver(1)|skin(1)	5						c.(859-861)CCA>ACA		olfactory receptor, family 5, subfamily AS,							54.0	54.0	54.0					11																	55798753		2201	4296	6497	SO:0001583	missense	219447				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55798753C>A	AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.859C>A	11.37:g.55798753C>A	ENSP00000324111:p.Pro287Thr						p.P287T	NM_001001921	NP_001001921	Q8N127	O5AS1_HUMAN			1	859	+	Esophageal squamous(21;0.00693)		287			Helical; Name=7; (Potential).		Q6IFB8	Missense_Mutation	SNP	ENST00000313555.1	37	c.859C>A	CCDS31516.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.663234	0.29515	.	.	ENSG00000181785	ENST00000313555	T	0.63913	-0.07	5.0	3.11	0.35812	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33217	U	0.005142	T	0.70072	0.3182	L	0.46157	1.445	0.28467	N	0.915591	D	0.89917	1.0	D	0.85130	0.997	T	0.63708	-0.6576	10	0.87932	D	0	.	9.3658	0.38223	0.0:0.7735:0.1451:0.0814	.	287	Q8N127	O5AS1_HUMAN	T	287	ENSP00000324111:P287T	ENSP00000324111:P287T	P	+	1	0	OR5AS1	55555329	0.994000	0.37717	0.114000	0.21550	0.312000	0.27988	3.498000	0.53302	0.500000	0.27991	-0.245000	0.11935	CCA		0.343	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921		4	30	1	0	1.024e-07	0.000602	1.2958e-07	4	30				
OR8H1	219469	broad.mit.edu	37	11	56058115	56058115	+	Missense_Mutation	SNP	C	C	A	rs142532321		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:56058115C>A	ENST00000313022.2	-	1	451	c.424G>T	c.(424-426)Gct>Tct	p.A142S		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A142T(1)		NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					GTGACAAGAGCGCAACACAGC	0.443																																							uc010rje.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(424-426)GCT>TCT		olfactory receptor, family 8, subfamily H,							88.0	84.0	85.0					11																	56058115		2201	4296	6497	SO:0001583	missense	219469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56058115C>A	AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.424G>T	11.37:g.56058115C>A	ENSP00000323595:p.Ala142Ser						p.A142S	NM_001005199	NP_001005199	Q8NGG4	OR8H1_HUMAN			1	424	-	Esophageal squamous(21;0.00448)		142			Helical; Name=4; (Potential).		B2RNI7|Q6IFC5	Missense_Mutation	SNP	ENST00000313022.2	37	c.424G>T	CCDS31526.1	.	.	.	.	.	.	.	.	.	.	C	0.862	-0.734961	0.03111	.	.	ENSG00000181693	ENST00000313022;ENST00000395186	T	0.00130	8.69	3.82	-6.65	0.01795	GPCR, rhodopsin-like superfamily (1);	1.344440	0.04727	N	0.420459	T	0.00073	0.0002	N	0.04655	-0.195	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.11966	-1.0566	10	0.21540	T	0.41	.	1.4659	0.02405	0.1201:0.2749:0.2509:0.3541	.	142	Q8NGG4	OR8H1_HUMAN	S	142;138	ENSP00000323595:A142S	ENSP00000323595:A142S	A	-	1	0	OR8H1	55814691	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.224000	0.01213	-1.233000	0.02551	-0.738000	0.03535	GCT		0.443	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370019.1	NM_001005199		10	47	1	0	1.76689e-08	0.006214	2.27807e-08	10	47				
GPHA2	170589	broad.mit.edu	37	11	64702312	64702312	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:64702312C>T	ENST00000279168.2	-	4	377	c.323G>A	c.(322-324)aGg>aAg	p.R108K	GPHA2_ENST00000533257.1_Missense_Mutation_p.R108K	NM_130769.3	NP_570125.1	Q96T91	GPHA2_HUMAN	glycoprotein hormone alpha 2	108						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|prostate(1)	3						GAGCTCCTCCCTCCGGCTCCC	0.617																																							uc001oca.2		NA																	0					0						c.(322-324)AGG>AAG		glycoprotein hormone alpha 2 precursor							102.0	92.0	96.0					11																	64702312		2201	4297	6498	SO:0001583	missense	170589					extracellular region	hormone activity	g.chr11:64702312C>T	AF260739	CCDS8086.1	11q13.1	2008-07-18				ENSG00000149735			18054	protein-coding gene	gene with protein product	"""glycoprotein alpha 2"", ""cysteine knot protein"""	609651				11809971	Standard	NM_130769		Approved	GPA2, ZSIG51, A2, MGC126572	uc001oca.3	Q96T91		ENST00000279168.2:c.323G>A	11.37:g.64702312C>T	ENSP00000279168:p.Arg108Lys						p.R108K	NM_130769	NP_570125	Q96T91	GPHA2_HUMAN			4	378	-			108					Q52LE2	Missense_Mutation	SNP	ENST00000279168.2	37	c.323G>A	CCDS8086.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.727080	0.30593	.	.	ENSG00000149735	ENST00000279168;ENST00000533257	T;T	0.28454	1.61;1.61	4.52	-2.45	0.06481	Cystine knot, C-terminal (1);	0.658267	0.13998	N	0.348334	T	0.17959	0.0431	L	0.34521	1.04	0.34130	D	0.665151	B	0.02656	0.0	B	0.01281	0.0	T	0.39440	-0.9614	10	0.12430	T	0.62	.	10.146	0.42764	0.0:0.3167:0.0:0.6833	.	108	Q96T91	GPHA2_HUMAN	K	108	ENSP00000279168:R108K;ENSP00000432918:R108K	ENSP00000279168:R108K	R	-	2	0	GPHA2	64458888	0.253000	0.23982	0.007000	0.13788	0.867000	0.49689	0.258000	0.18387	-0.333000	0.08476	0.655000	0.94253	AGG		0.617	GPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385470.1	NM_130769		21	68	0	0	0	0.012319	0	21	68				
SHANK2	22941	broad.mit.edu	37	11	70319334	70319334	+	Silent	SNP	G	G	A	rs566820305	byFrequency	TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:70319334G>A	ENST00000423696.2	-	16	4089	c.4053C>T	c.(4051-4053)acC>acT	p.T1351T	SHANK2_ENST00000449833.2_Silent_p.T1135T|SHANK2_ENST00000409161.1_Silent_p.T1134T|SHANK2_ENST00000338508.4_Silent_p.T1731T			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1351					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			AAGGAGAGGCGGTGGCAGCAG	0.597													G|||	2	0.000399361	0.0	0.0	5008	,	,		14588	0.001		0.001	False		,,,				2504	0.0						uc001oqc.2		NA																	0				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(5188-5190)ACC>ACT		SH3 and multiple ankyrin repeat domains 2							52.0	67.0	62.0					11																	70319334		2200	4294	6494	SO:0001819	synonymous_variant	22941				intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding	g.chr11:70319334G>A	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.4053C>T	11.37:g.70319334G>A						SHANK2_uc010rqn.1_Silent_p.T1142T|SHANK2_uc001opz.2_Silent_p.T1135T|uc009ysn.1_Intron|SHANK2_uc001opy.2_Silent_p.T66T	p.T1730T	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)		22	5268	-			1351					C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Silent	SNP	ENST00000423696.2	37	c.5190C>T																																																																																					0.597	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309		16	99	0	0	0	0.003163	0	16	99				
FAM168A	23201	broad.mit.edu	37	11	73141755	73141755	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:73141755T>A	ENST00000064778.4	-	3	415	c.131A>T	c.(130-132)aAt>aTt	p.N44I	FAM168A_ENST00000356467.4_Missense_Mutation_p.N44I|FAM168A_ENST00000450446.2_Missense_Mutation_p.N44I			Q92567	F168A_HUMAN	family with sequence similarity 168, member A	44										endometrium(3)|kidney(1)|lung(1)	5						ACTGGGACTATTGGTGGGGTA	0.507																																							uc001otz.1		NA																	0					0						c.(130-132)AAT>ATT		hypothetical protein LOC23201							110.0	110.0	110.0					11																	73141755		1921	4120	6041	SO:0001583	missense	23201							g.chr11:73141755T>A	BC014932	CCDS41689.1, CCDS66165.1, CCDS73346.1	11q13.4	2008-06-11	2008-06-11	2008-06-11		ENSG00000054965			28999	protein-coding gene	gene with protein product	"""tongue cancer chemotherapy resistance-associated protein 1"""		"""KIAA0280"""	KIAA0280			Standard	XM_005273852		Approved	TCRP1	uc001oty.1	Q92567		ENST00000064778.4:c.131A>T	11.37:g.73141755T>A	ENSP00000064778:p.Asn44Ile					FAM168A_uc001oty.1_Missense_Mutation_p.N44I|FAM168A_uc009ytp.1_Missense_Mutation_p.N44I	p.N44I	NM_015159	NP_055974	Q92567	F168A_HUMAN			3	410	-			44					A2ICY2|A2ID81|Q86UG2	Missense_Mutation	SNP	ENST00000064778.4	37	c.131A>T		.	.	.	.	.	.	.	.	.	.	T	16.06	3.015665	0.54468	.	.	ENSG00000054965	ENST00000064778;ENST00000450446;ENST00000356467	.	.	.	5.95	3.61	0.41365	.	0.182941	0.64402	D	0.000015	T	0.15219	0.0367	N	0.08118	0	0.32723	N	0.510027	P;B;B	0.37276	0.589;0.073;0.022	B;B;B	0.29862	0.108;0.102;0.04	T	0.16600	-1.0397	9	0.54805	T	0.06	.	6.6636	0.23029	0.0:0.2351:0.0:0.7649	.	44;44;44	Q92567-3;Q92567;Q92567-2	.;F168A_HUMAN;.	I	44	.	ENSP00000064778:N44I	N	-	2	0	FAM168A	72819403	0.997000	0.39634	1.000000	0.80357	0.954000	0.61252	0.247000	0.18179	1.034000	0.39945	0.533000	0.62120	AAT		0.507	FAM168A-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000397424.1	NM_015159		53	106	0	0	0	0.00361	0	53	106				
ATM	472	broad.mit.edu	37	11	108128265	108128265	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:108128265G>T	ENST00000452508.2	+	16	2497	c.2308G>T	c.(2308-2310)Gaa>Taa	p.E770*	ATM_ENST00000278616.4_Nonsense_Mutation_p.E770*			Q13315	ATM_HUMAN	ATM serine/threonine kinase	770					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.E770*(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GACAAATGAGGAATTCAGAAT	0.328			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		1	Substitution - Nonsense(1)	p.E770*(1)	haematopoietic_and_lymphoid_tissue(1)	haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(2308-2310)GAA>TAA	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							106.0	115.0	112.0					11																	108128265		2201	4298	6499	SO:0001587	stop_gained	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108128265G>T	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.2308G>T	11.37:g.108128265G>T	ENSP00000388058:p.Glu770*	TSP Lung(14;0.12)				ATM_uc009yxr.1_Nonsense_Mutation_p.E770*	p.E770*	NM_000051	NP_000042	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	15	2693	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	770					B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Nonsense_Mutation	SNP	ENST00000452508.2	37	c.2308G>T	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	42	9.657169	0.99231	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	.	.	.	6.17	6.17	0.99709	.	0.318230	0.38837	N	0.001554	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	770	.	ENSP00000278616:E770X	E	+	1	0	ATM	107633475	1.000000	0.71417	0.809000	0.32408	0.381000	0.30169	6.441000	0.73439	2.941000	0.99782	0.655000	0.94253	GAA		0.328	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		21	48	1	0	3.01185e-09	0.003954	3.95788e-09	21	48				
OR8D4	338662	broad.mit.edu	37	11	123777637	123777637	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:123777637T>A	ENST00000321355.2	+	1	529	c.499T>A	c.(499-501)Tct>Act	p.S167T		NM_001005197.1	NP_001005197.1	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D, member 4	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|lung(16)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		ACTCAGGTTGTCTTTCTGTGG	0.423																																							uc010saa.1		NA																	0				skin(1)	1						c.(499-501)TCT>ACT		olfactory receptor, family 8, subfamily D,							220.0	213.0	215.0					11																	123777637		2202	4299	6501	SO:0001583	missense	338662				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123777637T>A	AB065761	CCDS31698.1	11q24.1	2012-08-09			ENSG00000181518	ENSG00000181518		"""GPCR / Class A : Olfactory receptors"""	14840	protein-coding gene	gene with protein product							Standard	NM_001005197		Approved		uc010saa.2	Q8NGM9	OTTHUMG00000165960	ENST00000321355.2:c.499T>A	11.37:g.123777637T>A	ENSP00000325381:p.Ser167Thr						p.S167T	NM_001005197	NP_001005197	Q8NGM9	OR8D4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)	1	499	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	167			Extracellular (Potential).		Q6IFE9	Missense_Mutation	SNP	ENST00000321355.2	37	c.499T>A	CCDS31698.1	.	.	.	.	.	.	.	.	.	.	T	0.018	-1.485059	0.01027	.	.	ENSG00000181518	ENST00000321355	T	0.00076	8.76	5.81	-1.03	0.10102	GPCR, rhodopsin-like superfamily (1);	0.468479	0.18027	N	0.154060	T	0.00073	0.0002	L	0.31294	0.92	0.09310	N	1	B	0.12630	0.006	B	0.20767	0.031	T	0.46830	-0.9163	10	0.02654	T	1	.	1.3582	0.02186	0.2929:0.1351:0.1093:0.4627	.	167	Q8NGM9	OR8D4_HUMAN	T	167	ENSP00000325381:S167T	ENSP00000325381:S167T	S	+	1	0	OR8D4	123282847	0.000000	0.05858	0.061000	0.19648	0.245000	0.25701	-0.224000	0.09164	0.109000	0.17891	0.533000	0.62120	TCT		0.423	OR8D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387262.1	NM_001005197		16	184	0	0	0	0.004007	0	16	184				
WNT5B	81029	broad.mit.edu	37	12	1755170	1755170	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr12:1755170C>G	ENST00000397196.2	+	5	1064	c.832C>G	c.(832-834)Ctg>Gtg	p.L278V	WNT5B_ENST00000537031.1_Missense_Mutation_p.L278V|WNT5B_ENST00000310594.3_Missense_Mutation_p.L278V|WNT5B_ENST00000545747.1_3'UTR	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	278					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			CCCGGAGGACCTGGTCTATGT	0.687																																							uc009zdq.2		NA																	0				skin(1)	1						c.(832-834)CTG>GTG		wingless-type MMTV integration site family,							36.0	37.0	37.0					12																	1755170		2203	4299	6502	SO:0001583	missense	81029				angiogenesis|anterior/posterior pattern formation|cell migration involved in gastrulation|cellular response to retinoic acid|chondrocyte differentiation|convergent extension involved in axis elongation|convergent extension involved in gastrulation|dorsal/ventral axis specification|endocrine pancreas development|fat cell differentiation|lens fiber cell development|negative regulation of canonical Wnt receptor signaling pathway|neuron differentiation|positive regulation of cell migration|positive regulation of fat cell differentiation|respiratory system development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding	g.chr12:1755170C>G	AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.832C>G	12.37:g.1755170C>G	ENSP00000380379:p.Leu278Val					WNT5B_uc001qjj.2_Missense_Mutation_p.L278V|WNT5B_uc001qjk.2_Missense_Mutation_p.L278V|WNT5B_uc001qjl.2_Missense_Mutation_p.L278V	p.L278V	NM_032642	NP_116031	Q9H1J7	WNT5B_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00109)		5	1074	+	Ovarian(42;0.107)		278					A8K315|D3DUP9|Q96S49|Q9BV04	Missense_Mutation	SNP	ENST00000397196.2	37	c.832C>G	CCDS8510.1	.	.	.	.	.	.	.	.	.	.	C	19.19	3.779962	0.70222	.	.	ENSG00000111186	ENST00000537031;ENST00000310594;ENST00000397196	D;D;D	0.86230	-2.09;-2.09;-2.09	5.15	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.94945	0.8365	H	0.97896	4.1	0.80722	D	1	D	0.55385	0.971	P	0.62382	0.901	D	0.95308	0.8409	10	0.87932	D	0	.	10.5016	0.44808	0.0:0.8429:0.0:0.1571	.	278	Q9H1J7	WNT5B_HUMAN	V	278	ENSP00000439312:L278V;ENSP00000308887:L278V;ENSP00000380379:L278V	ENSP00000308887:L278V	L	+	1	2	WNT5B	1625431	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.092000	0.50207	2.673000	0.90976	0.655000	0.94253	CTG		0.687	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206747.2			14	44	0	0	0	0.003163	0	14	44				
WBP11	51729	broad.mit.edu	37	12	14947586	14947586	+	Silent	SNP	A	A	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr12:14947586A>G	ENST00000261167.2	-	7	839	c.606T>C	c.(604-606)ccT>ccC	p.P202P		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	202	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						GACCAGGGGGAGGGCCAGGAG	0.512																																							uc001rci.2		NA																	0				ovary(1)|lung(1)	2						c.(604-606)CCT>CCC		WW domain binding protein 11							100.0	107.0	105.0					12																	14947586		2203	4300	6503	SO:0001819	synonymous_variant	51729				mRNA processing|RNA splicing|rRNA processing	cytoplasm	single-stranded DNA binding|WW domain binding	g.chr12:14947586A>G	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.606T>C	12.37:g.14947586A>G							p.P202P	NM_016312	NP_057396	Q9Y2W2	WBP11_HUMAN			7	767	-			202			Pro-rich.		Q96AY8	Silent	SNP	ENST00000261167.2	37	c.606T>C	CCDS8666.1																																																																																				0.512	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400850.1	NM_016312		3	192	0	0	0	0.009096	0	3	192				
PIK3C2G	5288	broad.mit.edu	37	12	18716397	18716397	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr12:18716397A>C	ENST00000266497.5	+	26	3782	c.3744A>C	c.(3742-3744)caA>caC	p.Q1248H	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.Q1248H|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.Q1289H			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1248	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				TTCACAGCCAACTTCAGAAGC	0.403																																							uc001rdt.2		NA																	0				lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21						c.(3742-3744)CAA>CAC		phosphoinositide-3-kinase, class 2 gamma							76.0	71.0	73.0					12																	18716397		1887	4125	6012	SO:0001583	missense	5288				cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity	g.chr12:18716397A>C	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.3744A>C	12.37:g.18716397A>C	ENSP00000266497:p.Gln1248His					PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.Q1289H|PIK3C2G_uc010sic.1_Missense_Mutation_p.Q1067H	p.Q1248H	NM_004570	NP_004561	O75747	P3C2G_HUMAN			27	3860	+		Hepatocellular(102;0.194)	1248			PX.		A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	c.3744A>C	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	A	11.77	1.737056	0.30774	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.40476	1.03;1.03;1.03	4.29	0.334	0.15948	Phox homologous domain (5);	0.740662	0.12773	N	0.440395	T	0.24509	0.0594	L	0.29908	0.895	0.36955	D	0.893075	B;B;B	0.23058	0.079;0.064;0.046	B;B;B	0.20767	0.031;0.018;0.031	T	0.24048	-1.0171	10	0.66056	D	0.02	-6.0263	0.5926	0.00730	0.4383:0.204:0.194:0.1638	.	1288;1289;1248	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	H	1248;1248;1289	ENSP00000404845:Q1248H;ENSP00000266497:Q1248H;ENSP00000445381:Q1289H	ENSP00000266497:Q1248H	Q	+	3	2	PIK3C2G	18607664	0.102000	0.21896	0.999000	0.59377	0.960000	0.62799	-1.209000	0.03002	0.039000	0.15632	-0.256000	0.11100	CAA		0.403	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570		4	79	0	0	0	0.009096	0	4	79				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GTT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	p.G12V	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		8	30	1	0	0.000442599	0.006214	0.000504071	8	30				
CCNT1	904	broad.mit.edu	37	12	49087591	49087591	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr12:49087591C>T	ENST00000261900.3	-	9	1628	c.1406G>A	c.(1405-1407)gGa>gAa	p.G469E		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	469					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						AGCTTTATCTCCACCTGCCAC	0.443																																							uc001rse.1		NA																	0				ovary(3)|lung(1)|breast(1)|skin(1)	6						c.(1405-1407)GGA>GAA		cyclin T1							61.0	64.0	63.0					12																	49087591		2203	4300	6503	SO:0001583	missense	904				cell cycle|cell division|interspecies interaction between organisms|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	DNA binding|protein kinase binding	g.chr12:49087591C>T	AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.1406G>A	12.37:g.49087591C>T	ENSP00000261900:p.Gly469Glu					LOC144438_uc001rsd.3_5'Flank|CCNT1_uc009zkz.1_Missense_Mutation_p.G184E	p.G469E	NM_001240	NP_001231	O60563	CCNT1_HUMAN			9	1729	-			469					A9XU13|E7EX76|O60581	Missense_Mutation	SNP	ENST00000261900.3	37	c.1406G>A	CCDS8766.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710315	0.30322	.	.	ENSG00000129315	ENST00000261900	T	0.18810	2.19	5.0	5.0	0.66597	.	0.406288	0.26560	N	0.023687	T	0.12902	0.0313	L	0.38175	1.15	0.35328	D	0.78533	P	0.50617	0.937	B	0.37692	0.256	T	0.07966	-1.0745	10	0.02654	T	1	-10.0392	13.1053	0.59244	0.1611:0.8389:0.0:0.0	.	469	O60563	CCNT1_HUMAN	E	469	ENSP00000261900:G469E	ENSP00000261900:G469E	G	-	2	0	CCNT1	47373858	0.176000	0.23096	1.000000	0.80357	0.913000	0.54294	1.743000	0.38258	2.475000	0.83589	0.561000	0.74099	GGA		0.443	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1	NM_001240		23	72	0	0	0	0.00278	0	23	72				
NAV3	89795	broad.mit.edu	37	12	78401192	78401192	+	Missense_Mutation	SNP	C	C	A	rs573896613	byFrequency	TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr12:78401192C>A	ENST00000397909.2	+	8	2047	c.1874C>A	c.(1873-1875)cCg>cAg	p.P625Q	NAV3_ENST00000536525.2_Missense_Mutation_p.P625Q|NAV3_ENST00000228327.6_Missense_Mutation_p.P625Q|NAV3_ENST00000266692.7_Missense_Mutation_p.P625Q			Q8IVL0	NAV3_HUMAN	neuron navigator 3	625						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.P625Q(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CATAGCCACCCGAATACCGCG	0.478										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(1873-1875)CCG>CAG		neuron navigator 3							122.0	120.0	121.0					12																	78401192		2068	4200	6268	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78401192C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.1874C>A	12.37:g.78401192C>A	ENSP00000381007:p.Pro625Gln	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.P625Q	p.P625Q	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			8	2047	+			625					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.1874C>A		.	.	.	.	.	.	.	.	.	.	C	18.23	3.577759	0.65878	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41	4.84	4.84	0.62591	.	0.384049	0.18564	U	0.137533	T	0.41834	0.1176	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	0.981;1.0	P;D	0.91635	0.831;0.999	T	0.29731	-1.0002	10	0.62326	D	0.03	-4.6907	17.9357	0.89011	0.0:1.0:0.0:0.0	.	625;625	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	Q	625	ENSP00000446628:P625Q;ENSP00000446132:P625Q;ENSP00000381007:P625Q;ENSP00000228327:P625Q;ENSP00000266692:P625Q	ENSP00000228327:P625Q	P	+	2	0	NAV3	76925323	1.000000	0.71417	0.925000	0.36789	0.570000	0.35934	7.625000	0.83145	2.243000	0.73865	0.555000	0.69702	CCG		0.478	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		26	122	1	0	1.17739e-12	0.005443	1.68787e-12	26	122				
GALNT4	8693	broad.mit.edu	37	12	89916917	89916917	+	Silent	SNP	A	A	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr12:89916917A>G	ENST00000529983.2	-	1	1666	c.1410T>C	c.(1408-1410)gcT>gcC	p.A470A	POC1B-GALNT4_ENST00000548729.1_Silent_p.A467A|RP11-734K2.4_ENST00000605233.1_RNA|POC1B_ENST00000313546.3_Intron|POC1B_ENST00000541909.1_Intron|POC1B_ENST00000549504.1_Intron|POC1B_ENST00000393179.4_Intron|GALNT4_ENST00000413530.1_Silent_p.A298A|POC1B_ENST00000549035.1_Intron|POC1B-GALNT4_ENST00000547474.1_3'UTR	NM_003774.4	NP_003765.2	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	470	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(4)|kidney(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)	14						GTGAAAGGTTAGCACCTGTGG	0.418																																							uc001tbd.2		NA																	0					0						c.(1408-1410)GCT>GCC		polypeptide N-acetylgalactosaminyltransferase 4							68.0	68.0	68.0					12																	89916917		1865	4099	5964	SO:0001819	synonymous_variant	8693				carbohydrate metabolic process	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:89916917A>G	Y08564	CCDS53817.1	12q21.33	2014-03-13	2014-03-13		ENSG00000257594	ENSG00000257594	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4126	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 4"""	603565	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)"""			9804815	Standard	NM_003774		Approved	GalNAc-T4	uc001tbd.3	Q8N4A0	OTTHUMG00000166292	ENST00000529983.2:c.1410T>C	12.37:g.89916917A>G						POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc001tbc.2_Intron|POC1B_uc010sun.1_Intron|GALNT4_uc001tbe.2_Silent_p.A467A|GALNT4_uc010suo.1_Silent_p.A162A	p.A470A	NM_003774	NP_003765	Q8N4A0	GALT4_HUMAN			1	1619	-			470			Ricin B-type lectin.|Lumenal (Potential).		B2R775|B4DMX6|O00208	Silent	SNP	ENST00000529983.2	37	c.1410T>C	CCDS53817.1																																																																																				0.418	GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388973.2	NM_003774		18	53	0	0	0	0.006122	0	18	53				
CSNK1A1L	122011	broad.mit.edu	37	13	37679151	37679151	+	Silent	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr13:37679151C>T	ENST00000379800.3	-	1	652	c.243G>A	c.(241-243)caG>caA	p.Q81Q		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	81	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		TGTCTTTTTCCTGACCATACC	0.468																																							uc001uwm.1		NA																	0				large_intestine(1)	1						c.(241-243)CAG>CAA		casein kinase 1, alpha 1-like							128.0	115.0	120.0					13																	37679151		2203	4300	6503	SO:0001819	synonymous_variant	122011				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr13:37679151C>T	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.243G>A	13.37:g.37679151C>T							p.Q81Q	NM_145203	NP_660204	Q8N752	KC1AL_HUMAN		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)	1	651	-		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)	81			Protein kinase.		Q5T2N2	Silent	SNP	ENST00000379800.3	37	c.243G>A	CCDS9363.1																																																																																				0.468	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203		17	68	0	0	0	0.00499	0	17	68				
OR4L1	122742	broad.mit.edu	37	14	20528750	20528750	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:20528750C>A	ENST00000315683.1	+	1	547	c.547C>A	c.(547-549)Ctt>Att	p.L183I		NM_001004717.1	NP_001004717.1	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L, member 1	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(16)|ovary(2)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		TGATCTTCCCCTTGTGATCAA	0.398																																							uc001vwn.1		NA																	0				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(547-549)CTT>ATT		olfactory receptor, family 4, subfamily L,							213.0	194.0	201.0					14																	20528750		2203	4300	6503	SO:0001583	missense	122742				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20528750C>A		CCDS32029.1	14q11.2	2013-09-23			ENSG00000176246	ENSG00000176246		"""GPCR / Class A : Olfactory receptors"""	15356	protein-coding gene	gene with protein product				OR4L2P			Standard	NM_001004717		Approved		uc001vwn.1	Q8NH43	OTTHUMG00000169492	ENST00000315683.1:c.547C>A	14.37:g.20528750C>A	ENSP00000319217:p.Leu183Ile						p.L183I	NM_001004717	NP_001004717	Q8NH43	OR4L1_HUMAN	Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)	1	547	+	all_cancers(95;0.00108)		183			Extracellular (Potential).		Q6IEZ5	Missense_Mutation	SNP	ENST00000315683.1	37	c.547C>A	CCDS32029.1	.	.	.	.	.	.	.	.	.	.	.	10.83	1.459944	0.26248	.	.	ENSG00000176246	ENST00000315683	T	0.00099	8.73	4.37	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.146062	0.31760	N	0.007104	T	0.00210	0.0006	L	0.58583	1.82	0.18873	N	0.999981	B	0.15473	0.013	B	0.29862	0.108	T	0.22661	-1.0210	10	0.52906	T	0.07	.	11.8436	0.52368	0.1764:0.8236:0.0:0.0	.	183	Q8NH43	OR4L1_HUMAN	I	183	ENSP00000319217:L183I	ENSP00000319217:L183I	L	+	1	0	OR4L1	19598590	0.000000	0.05858	0.987000	0.45799	0.752000	0.42762	0.063000	0.14410	1.199000	0.43173	-0.133000	0.14855	CTT		0.398	OR4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404381.1			17	200	1	0	1.33834e-09	0.007413	1.78155e-09	17	200				
TMEM55B	90809	broad.mit.edu	37	14	20926775	20926775	+	Silent	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:20926775G>A	ENST00000250489.4	-	7	1063	c.777C>T	c.(775-777)ggC>ggT	p.G259G	TMEM55B_ENST00000398020.4_Silent_p.G266G|TMEM55B_ENST00000554028.1_Silent_p.G92G			Q86T03	TM55B_HUMAN	transmembrane protein 55B	259						endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			endometrium(3)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	11	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)		AAAGAGCCCGGCCCAAACACA	0.562																																							uc001vxl.2		NA																	0					0						c.(775-777)GGC>GGT		transmembrane protein 55B isoform 2							71.0	64.0	66.0					14																	20926775		2203	4300	6503	SO:0001819	synonymous_variant	90809					integral to membrane|late endosome membrane|lysosomal membrane	hydrolase activity	g.chr14:20926775G>A	BC002867	CCDS9551.1, CCDS41911.1	14q11.1	2002-11-27	2005-07-18	2005-07-18	ENSG00000165782	ENSG00000165782			19299	protein-coding gene	gene with protein product		609865	"""chromosome 14 open reading frame 9"""	C14orf9			Standard	NM_144568		Approved	MGC26684	uc001vxk.2	Q86T03	OTTHUMG00000029545	ENST00000250489.4:c.777C>T	14.37:g.20926775G>A						TMEM55B_uc001vxk.2_Silent_p.G266G	p.G259G	NM_144568	NP_653169	Q86T03	TM55B_HUMAN	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)	7	930	-	all_cancers(95;0.00123)	all_lung(585;0.235)	259			Helical; (Potential).		B2RA35|Q86U09|Q8WUC0|Q9BU67|Q9NSU8	Silent	SNP	ENST00000250489.4	37	c.777C>T	CCDS9551.1	.	.	.	.	.	.	.	.	.	.	G	6.393	0.440599	0.12104	.	.	ENSG00000165782	ENST00000553460	.	.	.	5.0	2.04	0.26737	.	.	.	.	.	T	0.45296	0.1335	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25433	-1.0132	4	.	.	.	-6.4599	2.8151	0.05453	0.1607:0.1602:0.5368:0.1423	.	.	.	.	S	99	.	.	P	-	1	0	TMEM55B	19996615	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.532000	0.23067	0.233000	0.21120	0.563000	0.77884	CCG		0.562	TMEM55B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000073643.3	NM_144568		3	55	0	0	0	0.009096	0	3	55				
MYH7	4625	broad.mit.edu	37	14	23886428	23886429	+	Nonsense_Mutation	DNP	TG	TG	AA	rs61737803	byFrequency	TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:23886428_23886429TG>AA	ENST00000355349.3	-	32	4614_4615	c.4452_4453CA>TT	c.(4450-4455)ctCAag>ctTTag	p.K1485*	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1485					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TAGGCGTTCTTGAGTTTGAAGA	0.589																																							uc001wjx.2		NA																	0				ovary(3)|skin(1)	4						c.(4450-4455)CTCAAG>CTTTAG		myosin, heavy chain 7, cardiac muscle, beta																																				SO:0001587	stop_gained	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23886428_23886429TG>AA	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4452_4453delinsAA	14.37:g.23886428_23886429delinsAA	ENSP00000347507:p.Lys1485*						p.K1485*	NM_000257	NP_000248	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	32	4558_4559	-	all_cancers(95;2.54e-05)		1485			Potential.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Nonsense_Mutation	DNP	ENST00000355349.3	37	c.4452_4453CA>TT	CCDS9601.1																																																																																				0.589	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		18	157	0	0	0	0.004672	0	18	157				
C14orf182	283551	broad.mit.edu	37	14	50458973	50458973	+	Splice_Site	SNP	C	C	A	rs189770231		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:50458973C>A	ENST00000399206.1	-	3	2093		c.e3+1		C14orf182_ENST00000529902.1_Splice_Site	NM_001012706.1	NP_001012724.1	A1A4T8	CN182_HUMAN	chromosome 14 open reading frame 182											large_intestine(2)|urinary_tract(1)	3						ATTCAACTTACCTCATTCATT	0.398													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18825	0.0		0.0	False		,,,				2504	0.0						uc001wxi.1		NA																	0					0						c.e3+1		hypothetical protein LOC283551							148.0	138.0	141.0					14																	50458973		1835	4092	5927	SO:0001630	splice_region_variant	283551							g.chr14:50458973C>A	AK090420	CCDS41949.1	14q22.1	2009-02-24			ENSG00000214900	ENSG00000214900			27503	protein-coding gene	gene with protein product							Standard	NM_001012706		Approved		uc001wxi.1	A1A4T8		ENST00000399206.1:c.321+1G>T	14.37:g.50458973C>A								NM_001012706	NP_001012724	A1A4T8	CN182_HUMAN			3	2093	-								A8MYX4	Splice_Site	SNP	ENST00000399206.1	37	c.372_splice	CCDS41949.1																																																																																				0.398	C14orf182-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395717.1	NM_001012706	Intron	25	84	1	0	1.04121e-07	0.005443	1.3095e-07	25	84				
PELI2	57161	broad.mit.edu	37	14	56763464	56763464	+	Silent	SNP	G	G	A	rs139388844	byFrequency	TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:56763464G>A	ENST00000267460.4	+	6	1129	c.843G>A	c.(841-843)cgG>cgA	p.R281R		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	281					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)			kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						ACGCCGCCCGGCCTCAGTGTC	0.582													G|||	4	0.000798722	0.003	0.0	5008	,	,		18552	0.0		0.0	False		,,,				2504	0.0						uc001xch.2		NA																	0		p.R281Q(1)		ovary(1)	1						c.(841-843)CGG>CGA		pellino 2		G		31,4375	36.8+/-68.6	0,31,2172	43.0	46.0	45.0		843	-3.0	0.7	14	dbSNP_134	45	0,8600		0,0,4300	no	coding-synonymous	PELI2	NM_021255.2		0,31,6472	AA,AG,GG		0.0,0.7036,0.2384		281/421	56763464	31,12975	2203	4300	6503	SO:0001819	synonymous_variant	57161				innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of protein phosphorylation|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	protein binding	g.chr14:56763464G>A	AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.843G>A	14.37:g.56763464G>A							p.R281R	NM_021255	NP_067078	Q9HAT8	PELI2_HUMAN			6	1129	+			281					B2RDY5	Silent	SNP	ENST00000267460.4	37	c.843G>A	CCDS9726.1																																																																																				0.582	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276925.1			13	33	0	0	0	0.00245	0	13	33				
RHOJ	57381	broad.mit.edu	37	14	63735888	63735888	+	Splice_Site	SNP	T	T	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:63735888T>C	ENST00000316754.3	+	2	699		c.e2+2		RHOJ_ENST00000557133.1_3'UTR|RHOJ_ENST00000555125.1_Splice_Site	NM_020663.4	NP_065714.1	Q9H4E5	RHOJ_HUMAN	ras homolog family member J						actin cytoskeleton organization (GO:0030036)|GTP catabolic process (GO:0006184)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		GCGGGACAGGTACATTTTTAT	0.453																																							uc001xgb.1		NA																	0					0						c.e2+2		ras homolog gene family, member J precursor							137.0	120.0	126.0					14																	63735888		2203	4300	6503	SO:0001630	splice_region_variant	57381				actin cytoskeleton organization|regulation of cell shape|regulation of small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity	g.chr14:63735888T>C	AK027351	CCDS9757.1	14q23.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000126785	ENSG00000126785			688	protein-coding gene	gene with protein product		607653	"""RAS-like, family 7, member B"", ""ras homolog gene family, member J"""	RASL7B, ARHJ		10967094	Standard	NM_020663		Approved	FLJ14445, TCL	uc001xgb.2	Q9H4E5	OTTHUMG00000140342	ENST00000316754.3:c.237+2T>C	14.37:g.63735888T>C							p.Q79_splice	NM_020663	NP_065714	Q9H4E5	RHOJ_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)	2	680	+								Q96KC1	Splice_Site	SNP	ENST00000316754.3	37	c.237_splice	CCDS9757.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.979248	0.74360	.	.	ENSG00000126785	ENST00000316754;ENST00000555125	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3224	0.60440	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RHOJ	62805641	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.948000	0.63590	2.102000	0.63906	0.533000	0.62120	.		0.453	RHOJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276975.3		Intron	5	74	0	0	0	0.001984	0	5	74				
SYNE2	23224	broad.mit.edu	37	14	64457753	64457753	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:64457753G>C	ENST00000344113.4	+	21	2778	c.2566G>C	c.(2566-2568)Gaa>Caa	p.E856Q	SYNE2_ENST00000358025.3_Missense_Mutation_p.E856Q|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.E856Q	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	856					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ATCCCAGAAGGAACTTGAATC	0.433																																							uc001xgm.2		NA																	0				ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(2566-2568)GAA>CAA		spectrin repeat containing, nuclear envelope 2							76.0	73.0	74.0					14																	64457753		1843	4097	5940	SO:0001583	missense	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64457753G>C	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.2566G>C	14.37:g.64457753G>C	ENSP00000341781:p.Glu856Gln					SYNE2_uc001xgl.2_Missense_Mutation_p.E856Q	p.E856Q	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	21	2796	+			856			Potential.|Cytoplasmic (Potential).		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	c.2566G>C	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.737880	0.49045	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.60299	0.54;0.54;0.2	6.06	6.06	0.98353	.	0.114811	0.37955	N	0.001869	T	0.70587	0.3241	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.68682	-0.5344	10	0.49607	T	0.09	.	16.1209	0.81357	0.0:0.0:1.0:0.0	.	856;856	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	Q	856	ENSP00000350719:E856Q;ENSP00000341781:E856Q;ENSP00000452570:E856Q	ENSP00000261678:E856Q	E	+	1	0	SYNE2	63527506	1.000000	0.71417	0.956000	0.39512	0.484000	0.33280	3.071000	0.50041	2.882000	0.98803	0.655000	0.94253	GAA		0.433	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		27	50	0	0	0	0.007291	0	27	50				
SMOC1	64093	broad.mit.edu	37	14	70480191	70480191	+	Silent	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:70480191G>T	ENST00000381280.4	+	10	1282	c.1029G>T	c.(1027-1029)gcG>gcT	p.A343A	SMOC1_ENST00000361956.3_Silent_p.A343A	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	Q9H4F8	SMOC1_HUMAN	SPARC related modular calcium binding 1	343					cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|eye development (GO:0001654)|limb development (GO:0060173)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of osteoblast differentiation (GO:0045667)|signal transduction (GO:0007165)	basement membrane (GO:0005604)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	21				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		ACTCAGCAGCGCCCACTGGAG	0.512											OREG0022771	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001xls.1		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)	2						c.(1027-1029)GCG>GCT		secreted modular calcium-binding protein 1							73.0	70.0	71.0					14																	70480191		2203	4300	6503	SO:0001819	synonymous_variant	64093				cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding	g.chr14:70480191G>T	AJ249900	CCDS9798.1, CCDS32110.1	14q24.1	2010-08-05			ENSG00000198732	ENSG00000198732			20318	protein-coding gene	gene with protein product		608488				12130637	Standard	NM_001034852		Approved		uc001xlt.2	Q9H4F8		ENST00000381280.4:c.1029G>T	14.37:g.70480191G>T			OREG0022771	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1122	SMOC1_uc001xlt.1_Silent_p.A343A	p.A343A	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN		all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)	10	1282	+			343					A8K1S3|B2R7P5|Q96F78	Silent	SNP	ENST00000381280.4	37	c.1029G>T	CCDS9798.1																																																																																				0.512	SMOC1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000412467.1			10	88	1	0	0.00829132	0.008291	0.00889906	10	88				
ADAM21P1	145241	broad.mit.edu	37	14	70712645	70712645	+	RNA	SNP	A	A	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:70712645A>T	ENST00000530196.1	-	0	1873					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		CTGCAAAGTAAAATGATCTTG	0.393																																							uc010ttg.1		NA																	0					0						c.(1222-1224)TTT>TAT		SubName: Full=ADAM21-like protein;																																						145241							g.chr14:70712645A>T			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70712645A>T							p.F408Y	NR_003951						1	1874	-									Missense_Mutation	SNP	ENST00000530196.1	37	c.1223T>A																																																																																					0.393	ADAM21P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000390451.1	NG_002467		25	84	0	0	0	0.003755	0	25	84				
SPATA7	55812	broad.mit.edu	37	14	88897527	88897527	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:88897527A>T	ENST00000393545.4	+	9	1329	c.1040A>T	c.(1039-1041)cAg>cTg	p.Q347L	SPATA7_ENST00000045347.7_Missense_Mutation_p.Q347L|SPATA7_ENST00000556553.1_Missense_Mutation_p.Q315L|SPATA7_ENST00000356583.5_Missense_Mutation_p.Q315L	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	347					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						GCAATGTGTCAGTATTCCCTG	0.358																																							uc001xwq.2		NA																	0				ovary(1)	1						c.(1039-1041)CAG>CTG		spermatogenesis-associated protein 7 isoform a							232.0	213.0	219.0					14																	88897527		2203	4300	6503	SO:0001583	missense	55812				response to stimulus|visual perception			g.chr14:88897527A>T	AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.1040A>T	14.37:g.88897527A>T	ENSP00000377176:p.Gln347Leu					SPATA7_uc001xwr.2_Missense_Mutation_p.Q315L|SPATA7_uc001xws.2_Missense_Mutation_p.Q283L|SPATA7_uc001xwt.2_Missense_Mutation_p.Q241L|SPATA7_uc001xwu.2_Missense_Mutation_p.Q3L	p.Q347L	NM_018418	NP_060888	Q9P0W8	SPAT7_HUMAN			9	1191	+			347					Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Missense_Mutation	SNP	ENST00000393545.4	37	c.1040A>T	CCDS9883.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	9.351|9.351	1.065554|1.065554	0.20067|0.20067	.|.	.|.	ENSG00000042317|ENSG00000042317	ENST00000556553;ENST00000393545;ENST00000356583;ENST00000045347|ENST00000556406	T;T;T;T|.	0.19250|.	2.16;2.16;2.16;2.16|.	4.86|4.86	2.27|2.27	0.28462|0.28462	.|.	0.827056|.	0.10601|.	N|.	0.655606|.	T|T	0.36496|0.36496	0.0969|0.0969	L|L	0.46157|0.46157	1.445|1.445	0.09310|0.09310	N|N	1|1	B;P;P;B|.	0.36535|.	0.302;0.557;0.557;0.096|.	B;B;B;B|.	0.35971|.	0.085;0.215;0.203;0.049|.	T|T	0.24548|0.24548	-1.0157|-1.0157	10|5	0.28530|.	T|.	0.3|.	-1.931|-1.931	4.7032|4.7032	0.12837|0.12837	0.6425:0.251:0.1064:0.0|0.6425:0.251:0.1064:0.0	.|.	347;315;315;347|.	Q9P0W8-3;A8K3L6;Q9P0W8-2;Q9P0W8|.	.;.;.;SPAT7_HUMAN|.	L|C	315;347;315;347|5	ENSP00000451128:Q315L;ENSP00000377176:Q347L;ENSP00000348991:Q315L;ENSP00000045347:Q347L|.	ENSP00000045347:Q347L|.	Q|S	+|+	2|1	0|0	SPATA7|SPATA7	87967280|87967280	0.006000|0.006000	0.16342|0.16342	0.009000|0.009000	0.14445|0.14445	0.011000|0.011000	0.07611|0.07611	0.983000|0.983000	0.29552|0.29552	0.803000|0.803000	0.34113|0.34113	-0.545000|-0.545000	0.04230|0.04230	CAG|AGT		0.358	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1			76	137	0	0	0	0.00361	0	76	137				
DDX24	57062	broad.mit.edu	37	14	94526457	94526457	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:94526457C>A	ENST00000330836.5	-	5	2031	c.1900G>T	c.(1900-1902)Gcc>Tcc	p.A634S	DDX24_ENST00000555054.1_Missense_Mutation_p.A591S|DDX24_ENST00000544005.1_Missense_Mutation_p.A384S	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	634	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		TCCAGACGGGCAAACTGCTCC	0.517																																							uc001ycj.2		NA																	0		p.A634A(1)		ovary(2)|kidney(1)|skin(1)	4						c.(1900-1902)GCC>TCC		DEAD (Asp-Glu-Ala-Asp) box polypeptide 24							74.0	71.0	72.0					14																	94526457		2203	4300	6503	SO:0001583	missense	57062				RNA metabolic process	cytoplasm|nucleolus|nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding	g.chr14:94526457C>A	AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.1900G>T	14.37:g.94526457C>A	ENSP00000328690:p.Ala634Ser					DDX24_uc010twq.1_Missense_Mutation_p.A591S|DDX24_uc010twr.1_Missense_Mutation_p.A384S	p.A634S	NM_020414	NP_065147	Q9GZR7	DDX24_HUMAN		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)	5	1999	-		all_cancers(154;0.12)	634			Helicase C-terminal.		E7EMJ4|Q4V9L5	Missense_Mutation	SNP	ENST00000330836.5	37	c.1900G>T	CCDS9918.1	.	.	.	.	.	.	.	.	.	.	C	19.75	3.886027	0.72410	.	.	ENSG00000089737	ENST00000330836;ENST00000544005;ENST00000440370;ENST00000543787;ENST00000555054;ENST00000542247	T;T;T	0.75154	-0.91;-0.91;-0.91	5.87	5.87	0.94306	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.67468	0.2896	N	0.04994	-0.135	0.58432	D	0.999998	B	0.32968	0.392	B	0.44224	0.444	T	0.67522	-0.5649	10	0.41790	T	0.15	7.0666	20.5827	0.99408	0.0:1.0:0.0:0.0	.	634	Q9GZR7	DDX24_HUMAN	S	634;384;579;260;591;591	ENSP00000328690:A634S;ENSP00000440623:A384S;ENSP00000452145:A591S	ENSP00000328690:A634S	A	-	1	0	DDX24	93596210	1.000000	0.71417	0.996000	0.52242	0.585000	0.36419	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GCC		0.517	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412861.1	NM_020414		26	51	1	0	1.1804e-14	0.003954	1.74087e-14	26	51				
AHNAK2	113146	broad.mit.edu	37	14	105404423	105404423	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:105404423C>T	ENST00000333244.5	-	7	17484	c.17365G>A	c.(17365-17367)Ggc>Agc	p.G5789S	AHNAK2_ENST00000557457.1_Missense_Mutation_p.G787S	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5789						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGTCCCAGGCCTGACCCTTTG	0.498																																							uc010axc.1		NA																	0				ovary(1)	1						c.(17365-17367)GGC>AGC		AHNAK nucleoprotein 2							107.0	103.0	104.0					14																	105404423		2006	4179	6185	SO:0001583	missense	113146					nucleus		g.chr14:105404423C>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.17365G>A	14.37:g.105404423C>T	ENSP00000353114:p.Gly5789Ser					AHNAK2_uc001ypx.2_Missense_Mutation_p.G5689S	p.G5789S	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	17485	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	5789					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.17365G>A	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.216369	0.58452	.	.	ENSG00000185567	ENST00000557457;ENST00000333244	T;T	0.03580	3.88;3.89	3.87	2.89	0.33648	.	0.690341	0.10539	U	0.662970	T	0.04182	0.0116	L	0.36672	1.1	0.09310	N	1	P	0.37330	0.59	B	0.38156	0.266	T	0.39354	-0.9618	10	0.87932	D	0	.	6.2006	0.20573	0.0:0.7033:0.1914:0.1053	.	5789	Q8IVF2	AHNK2_HUMAN	S	787;5789	ENSP00000450998:G787S;ENSP00000353114:G5789S	ENSP00000353114:G5789S	G	-	1	0	AHNAK2	104475468	0.001000	0.12720	0.004000	0.12327	0.001000	0.01503	0.979000	0.29500	1.692000	0.51112	0.561000	0.74099	GGC		0.498	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		11	46	0	0	0	0.003163	0	11	46				
OCA2	4948	broad.mit.edu	37	15	28235784	28235784	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr15:28235784T>A	ENST00000354638.3	-	10	1209	c.1054A>T	c.(1054-1056)Aga>Tga	p.R352*	OCA2_ENST00000382996.2_Nonsense_Mutation_p.R352*|OCA2_ENST00000353809.5_Intron	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	352					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GCCAGAGTTCTGTGCACGATC	0.542									Oculocutaneous Albinism																														uc001zbh.3		NA																	0				ovary(3)|breast(1)|pancreas(1)	5						c.(1054-1056)AGA>TGA		oculocutaneous albinism II							147.0	125.0	133.0					15																	28235784		2203	4300	6503	SO:0001587	stop_gained	4948	Oculocutaneous_Albinism	Familial Cancer Database		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding	g.chr15:28235784T>A		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1054A>T	15.37:g.28235784T>A	ENSP00000346659:p.Arg352*					OCA2_uc010ayv.2_Intron	p.R352*	NM_000275	NP_000266	Q04671	P_HUMAN		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)	10	1164	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	352			Cytoplasmic (Potential).		Q15211|Q15212|Q96EN1|Q9UMI5	Nonsense_Mutation	SNP	ENST00000354638.3	37	c.1054A>T	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	T	36	5.796678	0.96952	.	.	ENSG00000104044	ENST00000354638;ENST00000382996	.	.	.	5.91	4.76	0.60689	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.0127	12.4896	0.55893	0.0:0.0:0.1397:0.8603	.	.	.	.	X	352	.	ENSP00000346659:R352X	R	-	1	2	OCA2	25909379	1.000000	0.71417	1.000000	0.80357	0.108000	0.19459	4.092000	0.57707	1.031000	0.39867	0.533000	0.62120	AGA		0.542	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275		28	129	0	0	0	0.005443	0	28	129				
CAPN3	825	broad.mit.edu	37	15	42684893	42684893	+	Missense_Mutation	SNP	C	C	G	rs374833797		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr15:42684893C>G	ENST00000397163.3	+	7	1221	c.1002C>G	c.(1000-1002)caC>caG	p.H334Q	CAPN3_ENST00000356316.3_Missense_Mutation_p.H247Q|CAPN3_ENST00000318023.7_Missense_Mutation_p.H334Q|CAPN3_ENST00000349748.3_Missense_Mutation_p.H286Q|CAPN3_ENST00000357568.3_Missense_Mutation_p.H334Q|RP11-164J13.1_ENST00000495723.1_RNA	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	334	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.		H -> Q (in LGMD2A).		apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		TCAGAGGTCACGCCTACTCTG	0.567																																							uc001zpn.1		NA																	0				central_nervous_system(1)	1	GRCh37	CM970214	CAPN3	M		c.(1000-1002)CAC>CAG		calpain 3 isoform a							83.0	66.0	72.0					15																	42684893		2203	4299	6502	SO:0001583	missense	825				muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity	g.chr15:42684893C>G	X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.1002C>G	15.37:g.42684893C>G	ENSP00000380349:p.His334Gln					CAPN3_uc001zpk.1_Missense_Mutation_p.H107Q|CAPN3_uc001zpl.1_Missense_Mutation_p.H247Q|CAPN3_uc010udf.1_Missense_Mutation_p.H247Q|CAPN3_uc010udg.1_Missense_Mutation_p.H199Q|CAPN3_uc001zpo.1_Missense_Mutation_p.H334Q|CAPN3_uc001zpp.1_Missense_Mutation_p.H286Q	p.H334Q	NM_000070	NP_000061	P20807	CAN3_HUMAN		GBM - Glioblastoma multiforme(94;7.36e-07)	7	1308	+		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)	334		H -> Q (in LGMD2A).	Calpain catalytic.	By similarity.	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	ENST00000397163.3	37	c.1002C>G	CCDS45245.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189741	0.78789	.	.	ENSG00000092529	ENST00000356316;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023	D;D;D;D;D	0.99454	-5.92;-5.92;-5.92;-5.92;-5.92	5.37	-4.36	0.03645	Peptidase C2, calpain, catalytic domain (3);	0.125006	0.52532	U	0.000066	D	0.99245	0.9737	M	0.74647	2.275	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.999;0.985;0.999;0.999;0.998	D;D;P;D;D;D	0.78314	0.987;0.991;0.809;0.985;0.991;0.991	D	0.98192	1.0463	10	0.87932	D	0	.	15.8756	0.79159	0.0:0.7163:0.0:0.2837	.	199;247;286;334;334;247	C6EVS4;C6EVS3;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;CAN3_HUMAN;.	Q	247;334;334;286;334	ENSP00000348667:H247Q;ENSP00000380349:H334Q;ENSP00000350181:H334Q;ENSP00000183936:H286Q;ENSP00000326281:H334Q	ENSP00000326281:H334Q	H	+	3	2	CAPN3	40472185	0.050000	0.20438	0.966000	0.40874	0.989000	0.77384	-0.743000	0.04845	-0.783000	0.04534	-0.150000	0.13652	CAC		0.567	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421075.1			12	36	0	0	0	0.001368	0	12	36				
CDAN1	146059	broad.mit.edu	37	15	43021262	43021262	+	Silent	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr15:43021262G>A	ENST00000356231.3	-	19	2627	c.2604C>T	c.(2602-2604)ttC>ttT	p.F868F		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	868			F -> I (in CDAN1A). {ECO:0000269|PubMed:12434312}.		chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		TTTCTGCCACGAACTCTACGG	0.547																																							uc001zql.2		NA																	0				ovary(2)	2						c.(2602-2604)TTC>TTT		codanin 1							107.0	105.0	106.0					15																	43021262		2203	4299	6502	SO:0001819	synonymous_variant	146059					integral to membrane	protein binding	g.chr15:43021262G>A	AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.2604C>T	15.37:g.43021262G>A						CDAN1_uc001zqj.2_RNA|CDAN1_uc001zqk.2_Silent_p.F194F	p.F868F	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN		GBM - Glioblastoma multiforme(94;2.49e-07)	19	2721	-		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)	868		F -> I (in CDA1).			Q6NYD0|Q7Z7L5|Q969N3	Silent	SNP	ENST00000356231.3	37	c.2604C>T	CCDS32209.1																																																																																				0.547	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300		15	117	0	0	0	0.004007	0	15	117				
TPSD1	23430	broad.mit.edu	37	16	1306688	1306688	+	Splice_Site	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr16:1306688C>T	ENST00000211076.3	+	2	402	c.254C>T	c.(253-255)cCg>cTg	p.P85L	RP11-616M22.5_ENST00000566997.1_RNA|TPSD1_ENST00000397534.2_Splice_Site_p.P78L	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	85	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				TGCGTGGAACCGTGAGTCTCC	0.697																																							uc002clb.1		NA																	0					0						c.(253-255)CCG>CTG		tryptase delta 1 precursor							36.0	44.0	42.0					16																	1306688		2199	4297	6496	SO:0001630	splice_region_variant	23430				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr16:1306688C>T	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.254+1C>T	16.37:g.1306688C>T						TPSD1_uc010brm.1_Missense_Mutation_p.P23L	p.P85L	NM_012217	NP_036349	Q9BZJ3	TRYD_HUMAN			2	263	+		Hepatocellular(780;0.00369)	85			Peptidase S1.		O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Missense_Mutation	SNP	ENST00000211076.3	37	c.254C>T	CCDS10432.1	.	.	.	.	.	.	.	.	.	.	-	5.198	0.222018	0.09863	.	.	ENSG00000095917	ENST00000397534;ENST00000211076	D;D	0.88277	-2.36;-2.36	3.0	-2.9	0.05648	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.648219	0.13633	N	0.373557	T	0.70369	0.3216	N	0.16266	0.395	0.21675	N	0.999596	B;P	0.39782	0.411;0.688	B;B	0.35312	0.136;0.2	T	0.65286	-0.6205	10	0.22706	T	0.39	.	1.5371	0.02548	0.3159:0.2576:0.309:0.1175	.	78;85	C9JJL5;Q9BZJ3	.;TRYD_HUMAN	L	78;85	ENSP00000380668:P78L;ENSP00000211076:P85L	ENSP00000211076:P85L	P	+	2	0	TPSD1	1246689	0.001000	0.12720	0.021000	0.16686	0.066000	0.16364	-0.000000	0.12993	-0.254000	0.09500	0.185000	0.17295	CCG		0.697	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2		Missense_Mutation	6	52	0	0	0	0.00308	0	6	52				
UNKL	64718	broad.mit.edu	37	16	1453292	1453292	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr16:1453292C>G	ENST00000389221.4	-	3	340	c.341G>C	c.(340-342)cGt>cCt	p.R114P	UNKL_ENST00000503648.1_5'UTR|UNKL_ENST00000301712.5_Missense_Mutation_p.R114P|UNKL_ENST00000397462.1_Missense_Mutation_p.R201P|UNKL_ENST00000508903.2_Missense_Mutation_p.R114P	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	114					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				TTTGTAGTAACGCAGGTGGTA	0.612																																							uc010bro.1		NA																	0					0						c.(340-342)CGT>CCT		unkempt homolog (Drosophila)-like isoform 2							277.0	187.0	217.0					16																	1453292		2198	4300	6498	SO:0001583	missense	64718					cytoplasm|nucleus	ligase activity|nucleic acid binding|zinc ion binding	g.chr16:1453292C>G	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.341G>C	16.37:g.1453292C>G	ENSP00000373873:p.Arg114Pro					UNKL_uc002clq.2_Missense_Mutation_p.R114P	p.R114P	NM_001037125	NP_001032202	Q9H9P5	UNKL_HUMAN			3	349	-		Hepatocellular(780;0.0893)	114					B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	ENST00000389221.4	37	c.341G>C	CCDS53981.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.034170	0.35893	.	.	ENSG00000059145	ENST00000389221;ENST00000508903;ENST00000397462;ENST00000301712	T	0.68181	-0.31	3.77	3.77	0.43336	.	0.000000	0.85682	D	0.000000	D	0.83672	0.5305	M	0.89658	3.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87234	0.2262	10	0.72032	D	0.01	.	13.5415	0.61676	0.0:1.0:0.0:0.0	.	114	Q9H9P5-5	.	P	114;114;201;114	ENSP00000373873:R114P	ENSP00000301712:R114P	R	-	2	0	UNKL	1393293	1.000000	0.71417	1.000000	0.80357	0.519000	0.34347	7.286000	0.78671	2.114000	0.64651	0.456000	0.33151	CGT		0.612	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001037125		8	26	0	0	0	0.006214	0	8	26				
TFAP4	7023	broad.mit.edu	37	16	4310225	4310225	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr16:4310225T>G	ENST00000204517.6	-	6	1016	c.688A>C	c.(688-690)Acc>Ccc	p.T230P		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	230	Pro-rich.				cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						GGGTGGTGGGTGGGGGCCGGA	0.622																																							uc010uxg.1		NA																	0				ovary(1)	1						c.(688-690)ACC>CCC		transcription factor AP-4 (activating enhancer																																				SO:0001583	missense	7023				DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation by host of viral transcription|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|regulation of S phase of mitotic cell cycle	transcriptional repressor complex	E-box binding|histone deacetylase binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr16:4310225T>G	X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.688A>C	16.37:g.4310225T>G	ENSP00000204517:p.Thr230Pro						p.T230P	NM_003223	NP_003214	Q01664	TFAP4_HUMAN			6	942	-			230			Pro-rich.		O60409	Missense_Mutation	SNP	ENST00000204517.6	37	c.688A>C	CCDS10510.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.947766	0.73787	.	.	ENSG00000090447	ENST00000204517	D	0.98978	-5.29	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.98692	0.9561	L	0.48362	1.52	0.54753	D	0.999989	D	0.71674	0.998	D	0.73708	0.981	D	0.98750	1.0720	10	0.34782	T	0.22	.	14.1705	0.65506	0.0:0.0:0.0:1.0	.	230	Q01664	TFAP4_HUMAN	P	230	ENSP00000204517:T230P	ENSP00000204517:T230P	T	-	1	0	TFAP4	4250226	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.369000	0.79578	1.996000	0.58369	0.460000	0.39030	ACC		0.622	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251595.2	NM_003223		4	57	0	0	0	0.004482	0	4	57				
RBFOX1	54715	broad.mit.edu	37	16	7637286	7637286	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr16:7637286A>G	ENST00000550418.1	+	7	1440	c.452A>G	c.(451-453)aAt>aGt	p.N151S	RBFOX1_ENST00000311745.5_Missense_Mutation_p.N171S|RBFOX1_ENST00000436368.2_Missense_Mutation_p.N171S|RBFOX1_ENST00000547372.1_Missense_Mutation_p.N194S|RBFOX1_ENST00000535565.2_Missense_Mutation_p.N139S|RBFOX1_ENST00000553186.1_Missense_Mutation_p.N151S|RBFOX1_ENST00000547338.1_Missense_Mutation_p.N151S|RBFOX1_ENST00000552089.1_Intron|RBFOX1_ENST00000340209.4_Missense_Mutation_p.N156S|RBFOX1_ENST00000422070.4_Missense_Mutation_p.N194S|RBFOX1_ENST00000355637.4_Missense_Mutation_p.N171S	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	151	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.	Interaction with RNA.			mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						ATTATTTTTAATGAGCGAGGC	0.289																																					Ovarian(157;934 2567 15163 39509)		uc002cys.2		NA																	0					0						c.(451-453)AAT>AGT		ataxin 2-binding protein 1 isoform 4							66.0	71.0	69.0					16																	7637286		2197	4293	6490	SO:0001583	missense	54715				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding	g.chr16:7637286A>G	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.452A>G	16.37:g.7637286A>G	ENSP00000450031:p.Asn151Ser					A2BP1_uc010buf.1_Missense_Mutation_p.N151S|A2BP1_uc002cyr.1_Missense_Mutation_p.N150S|A2BP1_uc002cyt.2_Missense_Mutation_p.N151S|A2BP1_uc010uxz.1_Missense_Mutation_p.N194S|A2BP1_uc010uya.1_Missense_Mutation_p.N139S|A2BP1_uc002cyv.1_Missense_Mutation_p.N151S|A2BP1_uc010uyb.1_Missense_Mutation_p.N151S|A2BP1_uc002cyw.2_Missense_Mutation_p.N171S|A2BP1_uc002cyy.2_Missense_Mutation_p.N171S|A2BP1_uc002cyx.2_Missense_Mutation_p.N171S|A2BP1_uc010uyc.1_Missense_Mutation_p.N171S	p.N151S	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)	7	1440	+		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)	151			RRM.	Interaction with RNA.	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	37	c.452A>G	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	A	18.11	3.550007	0.65311	.	.	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000551752;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23;1.23;1.23;1.23;1.23;1.23;1.23	5.91	5.91	0.95273	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.51702	0.1690	L	0.35854	1.095	0.80722	D	1	P;D;P;D;B;D;P;D;P	0.76494	0.5;0.999;0.867;0.999;0.161;0.992;0.841;0.97;0.822	P;D;P;D;B;D;B;P;P	0.80764	0.619;0.994;0.877;0.994;0.429;0.984;0.352;0.804;0.583	T	0.53627	-0.8412	10	0.87932	D	0	-12.7022	16.3483	0.83171	1.0:0.0:0.0:0.0	.	171;139;194;171;171;171;151;151;194	F8WAC5;F5H0M1;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;.;.;.;.;RFOX1_HUMAN;.	S	150;151;151;194;194;139;151;151;171;171;171;171;156	ENSP00000450402:N150S;ENSP00000450031:N151S;ENSP00000447753:N151S;ENSP00000446842:N194S;ENSP00000391269:N194S;ENSP00000447281:N151S;ENSP00000447717:N151S;ENSP00000402745:N171S;ENSP00000309117:N171S;ENSP00000347855:N171S;ENSP00000344196:N156S	ENSP00000309117:N171S	N	+	2	0	RBFOX1	7577287	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.930000	0.92872	2.254000	0.74563	0.533000	0.62120	AAT		0.289	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891		7	67	0	0	0	0.006214	0	7	67				
IL4R	3566	broad.mit.edu	37	16	27374684	27374684	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr16:27374684C>T	ENST00000395762.2	+	11	2270	c.2011C>T	c.(2011-2013)Cca>Tca	p.P671S	IL4R_ENST00000543915.2_Missense_Mutation_p.P671S|IL4R_ENST00000380922.3_Missense_Mutation_p.P656S|IL4R_ENST00000170630.2_Missense_Mutation_p.P671S	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	671					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						CTCACATCTCCCAAGCAGCTC	0.642																																							uc002don.2		NA																	0				ovary(1)|skin(1)	2						c.(2011-2013)CCA>TCA		interleukin 4 receptor alpha chain isoform a							48.0	49.0	49.0					16																	27374684		2197	4300	6497	SO:0001583	missense	3566				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity	g.chr16:27374684C>T	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.2011C>T	16.37:g.27374684C>T	ENSP00000379111:p.Pro671Ser					IL4R_uc002dop.3_Missense_Mutation_p.P656S|IL4R_uc010bxy.2_Missense_Mutation_p.P671S|IL4R_uc002doo.2_Missense_Mutation_p.P511S	p.P671S	NM_000418	NP_000409	P24394	IL4RA_HUMAN			11	2253	+			671			Cytoplasmic (Potential).		B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	ENST00000395762.2	37	c.2011C>T	CCDS10629.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035245	0.54896	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T	0.39056	1.11;1.11;1.1;1.11	4.52	0.928	0.19443	.	1.522360	0.03800	N	0.264340	T	0.51329	0.1668	L	0.55481	1.735	0.09310	N	1	D;D;D	0.65815	0.995;0.995;0.995	P;P;P	0.55999	0.789;0.68;0.68	T	0.36383	-0.9750	10	0.59425	D	0.04	-17.1016	5.1581	0.15046	0.0:0.453:0.4224:0.1247	.	656;671;671	B4E076;B9EGC0;P24394	.;.;IL4RA_HUMAN	S	671;671;656;671	ENSP00000379111:P671S;ENSP00000441667:P671S;ENSP00000370309:P656S;ENSP00000170630:P671S	ENSP00000170630:P671S	P	+	1	0	IL4R	27282185	0.000000	0.05858	0.009000	0.14445	0.059000	0.15707	0.071000	0.14594	0.883000	0.36040	0.561000	0.74099	CCA		0.642	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4			9	47	0	0	0	0.010729	0	9	47				
ZNF423	23090	broad.mit.edu	37	16	49672130	49672130	+	Silent	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr16:49672130G>T	ENST00000561648.1	-	4	986	c.933C>A	c.(931-933)ctC>ctA	p.L311L	ZNF423_ENST00000535559.1_Silent_p.L194L|ZNF423_ENST00000567169.1_Silent_p.L194L|ZNF423_ENST00000562871.1_Silent_p.L251L|ZNF423_ENST00000562520.1_Silent_p.L251L|ZNF423_ENST00000262383.2_Silent_p.L311L|ZNF423_ENST00000563137.2_Silent_p.L251L	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	311					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GGATATGGGCGAGCAGTGTGT	0.607																																							uc002efs.2		NA																	0				ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(931-933)CTC>CTA		zinc finger protein 423							125.0	87.0	100.0					16																	49672130		2198	4300	6498	SO:0001819	synonymous_variant	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49672130G>T	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.933C>A	16.37:g.49672130G>T						ZNF423_uc010vgn.1_Silent_p.L194L	p.L311L	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN			5	1231	-		all_cancers(37;0.0155)	311			C2H2-type 7.		O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	c.933C>A	CCDS32445.1																																																																																				0.607	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		19	40	1	0	1.96292e-10	0.010504	2.63006e-10	19	40				
NOD2	64127	broad.mit.edu	37	16	50756544	50756544	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr16:50756544A>T	ENST00000300589.2	+	8	2831	c.2726A>T	c.(2725-2727)aAc>aTc	p.N909I		NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	909					activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				TTCTGGGGCAACAGAGTGGGT	0.527																																							uc002egm.1		NA																	0				ovary(3)|skin(1)	4						c.(2725-2727)AAC>ATC		nucleotide-binding oligomerization domain							251.0	271.0	264.0					16																	50756544		2198	4300	6498	SO:0001583	missense	64127				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding	g.chr16:50756544A>T	AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.2726A>T	16.37:g.50756544A>T	ENSP00000300589:p.Asn909Ile					NOD2_uc010cbl.1_Missense_Mutation_p.N659I|NOD2_uc010cbm.1_Missense_Mutation_p.N659I|NOD2_uc010cbn.1_RNA|NOD2_uc010cbo.1_RNA|NOD2_uc010cbp.1_RNA|NOD2_uc010cbq.1_Missense_Mutation_p.N47I|NOD2_uc010cbr.1_RNA|NOD2_uc010vgq.1_5'UTR	p.N909I	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN			8	2831	+		all_cancers(37;0.0156)	909			LRR 5.		E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	ENST00000300589.2	37	c.2726A>T	CCDS10746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.0|22.0	4.236149|4.236149	0.79800|0.79800	.|.	.|.	ENSG00000167207|ENSG00000167207	ENST00000526417;ENST00000300589;ENST00000431240|ENST00000534057	T|.	0.66995|.	-0.24|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.122356|.	0.50627|.	D|.	0.000117|.	D|D	0.88085|0.88085	0.6342|0.6342	H|H	0.98238|0.98238	4.18|4.18	0.49915|0.49915	D|D	0.999832|0.999832	D;D|.	0.69078|.	0.987;0.997|.	D;D|.	0.69824|.	0.936;0.966|.	D|D	0.91752|0.91752	0.5413|0.5413	10|5	0.87932|.	D|.	0|.	.|.	12.7354|12.7354	0.57220|0.57220	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	882;909|.	Q9HC29-2;Q9HC29|.	.;NOD2_HUMAN|.	I|H	882;909;49|120	ENSP00000300589:N909I|.	ENSP00000300589:N909I|.	N|Q	+|+	2|3	0|2	NOD2|NOD2	49314045|49314045	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.981000|0.981000	0.71138|0.71138	5.091000|5.091000	0.64505|0.64505	2.269000|2.269000	0.75478|0.75478	0.533000|0.533000	0.62120|0.62120	AAC|CAA		0.527	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256876.2	NM_022162		100	334	0	0	0	0.00361	0	100	334				
GPR97	222487	broad.mit.edu	37	16	57717908	57717908	+	Silent	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr16:57717908C>T	ENST00000333493.4	+	9	1107	c.946C>T	c.(946-948)Ctg>Ttg	p.L316L	RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000327655.6_Silent_p.L106L|GPR97_ENST00000450388.3_Silent_p.L196L	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	316					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GGGTGGCAGCCTGTTCCTCCT	0.602																																							uc002emh.2		NA																	0				ovary(1)	1						c.(946-948)CTG>TTG		G protein-coupled receptor 97 precursor							85.0	87.0	86.0					16																	57717908		2198	4300	6498	SO:0001819	synonymous_variant	222487				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr16:57717908C>T	AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.946C>T	16.37:g.57717908C>T						GPR97_uc010vhv.1_Silent_p.L196L|GPR97_uc010cdd.2_Intron|GPR97_uc010cde.2_Intron	p.L316L	NM_170776	NP_740746	Q86Y34	GPR97_HUMAN			9	1049	+			316			Helical; Name=2; (Potential).		Q6ZMF4|Q86SL9|Q8IZF1	Silent	SNP	ENST00000333493.4	37	c.946C>T	CCDS10786.1																																																																																				0.602	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2	NM_170776		26	57	0	0	0	0.003954	0	26	57				
PMFBP1	83449	broad.mit.edu	37	16	72166806	72166806	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr16:72166806C>A	ENST00000237353.10	-	10	1549	c.1288G>T	c.(1288-1290)Gag>Tag	p.E430*	PMFBP1_ENST00000355636.6_Nonsense_Mutation_p.E285*|PMFBP1_ENST00000537465.1_Nonsense_Mutation_p.E430*	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	430						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				TTCTCCAGCTCCTTCTCCTTT	0.512																																							uc002fcc.3		NA																	0				ovary(2)	2						c.(1288-1290)GAG>TAG		polyamine modulated factor 1 binding protein 1							133.0	116.0	122.0					16																	72166806		2198	4300	6498	SO:0001587	stop_gained	83449							g.chr16:72166806C>A	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.1288G>T	16.37:g.72166806C>A	ENSP00000237353:p.Glu430*					PMFBP1_uc002fcd.2_Nonsense_Mutation_p.E430*|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Nonsense_Mutation_p.E285*	p.E430*	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN			10	1460	-		Ovarian(137;0.179)	430			Potential.		B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Nonsense_Mutation	SNP	ENST00000237353.10	37	c.1288G>T	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	C	42	9.468243	0.99180	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	.	.	.	5.15	5.15	0.70609	.	0.296053	0.24488	N	0.038098	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-14.4977	15.5343	0.75990	0.0:1.0:0.0:0.0	.	.	.	.	X	430;430;285	.	ENSP00000237353:E430X	E	-	1	0	PMFBP1	70724307	0.648000	0.27313	0.747000	0.31113	0.577000	0.36160	2.237000	0.43061	2.392000	0.81423	0.561000	0.74099	GAG		0.512	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293		48	89	1	0	1.22102e-19	0.00361	1.85414e-19	48	89				
GUCY2D	3000	broad.mit.edu	37	17	7910764	7910764	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr17:7910764A>G	ENST00000254854.4	+	6	1634	c.1484A>G	c.(1483-1485)cAa>cGa	p.Q495R		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	495					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				CTTCACATGCAAATGGTCTCC	0.597																																							uc002gjt.2		NA																	0				skin(1)	1						c.(1483-1485)CAA>CGA		guanylate cyclase 2D, membrane (retina-specific)							116.0	111.0	113.0					17																	7910764		2203	4300	6503	SO:0001583	missense	3000				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity	g.chr17:7910764A>G	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1484A>G	17.37:g.7910764A>G	ENSP00000254854:p.Gln495Arg						p.Q495R	NM_000180	NP_000171	Q02846	GUC2D_HUMAN			6	1558	+		Prostate(122;0.157)	495			Cytoplasmic (Potential).		Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	37	c.1484A>G	CCDS11127.1	.	.	.	.	.	.	.	.	.	.	A	11.84	1.760102	0.31137	.	.	ENSG00000132518	ENST00000254854	D	0.82984	-1.67	5.52	4.45	0.53987	.	0.000000	0.49305	D	0.000149	T	0.75391	0.3843	L	0.47716	1.5	0.33694	D	0.613716	B	0.27765	0.188	B	0.25614	0.062	T	0.77795	-0.2454	10	0.31617	T	0.26	.	9.9827	0.41824	0.9191:0.0:0.0809:0.0	.	495	Q02846	GUC2D_HUMAN	R	495	ENSP00000254854:Q495R	ENSP00000254854:Q495R	Q	+	2	0	GUCY2D	7851489	0.999000	0.42202	0.997000	0.53966	0.992000	0.81027	2.968000	0.49224	2.106000	0.64143	0.459000	0.35465	CAA		0.597	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2			20	121	0	0	0	0.00278	0	20	121				
MYH3	4621	broad.mit.edu	37	17	10541609	10541609	+	Silent	SNP	C	C	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr17:10541609C>G	ENST00000583535.1	-	27	3567	c.3480G>C	c.(3478-3480)acG>acC	p.T1160T	MYH3_ENST00000226209.7_Silent_p.T1160T	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1160					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						GCTCTATCTGCGTGGAGGTGA	0.667																																							uc002gmq.1		NA																	0				ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(3478-3480)ACG>ACC		myosin, heavy chain 3, skeletal muscle,							57.0	52.0	53.0					17																	10541609		2203	4300	6503	SO:0001819	synonymous_variant	4621				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10541609C>G		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.3480G>C	17.37:g.10541609C>G							p.T1160T	NM_002470	NP_002461	P11055	MYH3_HUMAN			26	3557	-			1160			Potential.		Q15492	Silent	SNP	ENST00000583535.1	37	c.3480G>C	CCDS11157.1																																																																																				0.667	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470		18	45	0	0	0	0.008871	0	18	45				
PPM1D	8493	broad.mit.edu	37	17	58711300	58711300	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr17:58711300T>C	ENST00000305921.3	+	3	1020	c.788T>C	c.(787-789)aTt>aCt	p.I263T		NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	263	PP2C-like.				G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			AGCACAGTTATTGACCAGATT	0.378																																							uc002iyt.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(787-789)ATT>ACT		protein phosphatase 1D							126.0	111.0	116.0					17																	58711300		2203	4300	6503	SO:0001583	missense	8493				negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity	g.chr17:58711300T>C	U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.788T>C	17.37:g.58711300T>C	ENSP00000306682:p.Ile263Thr					PPM1D_uc010ddm.1_RNA	p.I263T	NM_003620	NP_003611	O15297	PPM1D_HUMAN	Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)		3	1010	+	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		263			PP2C-like.		Q53XP4|Q6P991|Q8IVR6	Missense_Mutation	SNP	ENST00000305921.3	37	c.788T>C	CCDS11625.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.391860	0.83011	.	.	ENSG00000170836	ENST00000305921;ENST00000544712;ENST00000392995	T;T	0.50001	0.76;0.83	5.44	5.44	0.79542	Protein phosphatase 2C-like (4);	0.047550	0.85682	D	0.000000	T	0.51092	0.1654	L	0.43598	1.365	0.80722	D	1	P	0.45531	0.86	P	0.48840	0.592	T	0.55302	-0.8162	10	0.87932	D	0	-14.5151	15.1769	0.72920	0.0:0.0:0.0:1.0	.	263	O15297	PPM1D_HUMAN	T	263;111;263	ENSP00000306682:I263T;ENSP00000376720:I263T	ENSP00000306682:I263T	I	+	2	0	PPM1D	56066082	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.443000	0.80521	2.063000	0.61619	0.528000	0.53228	ATT		0.378	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449474.1	NM_003620		8	85	0	0	0	0.006214	0	8	85				
TNRC6C	57690	broad.mit.edu	37	17	76046101	76046101	+	Missense_Mutation	SNP	G	G	A	rs183883077	byFrequency	TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr17:76046101G>A	ENST00000588061.1	+	5	1685	c.958G>A	c.(958-960)Gtt>Att	p.V320I	TNRC6C_ENST00000544502.1_Missense_Mutation_p.V320I|TNRC6C_ENST00000335749.4_Missense_Mutation_p.V320I|TNRC6C_ENST00000541771.1_Missense_Mutation_p.V320I|TNRC6C_ENST00000301624.4_Missense_Mutation_p.V320I|TNRC6C_ENST00000588847.1_Missense_Mutation_p.V320I			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	320	Gly-rich.|Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CAACAATGGCGTTGGTAATAT	0.557													G|||	5	0.000998403	0.0038	0.0	5008	,	,		20467	0.0		0.0	False		,,,				2504	0.0						uc002jud.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(958-960)GTT>ATT		trinucleotide repeat containing 6C isoform 2		G	ILE/VAL,ILE/VAL	4,3870		0,4,1933	56.0	57.0	57.0		958,958	1.8	0.0	17		57	1,8275		0,1,4137	yes	missense,missense	TNRC6C	NM_001142640.1,NM_018996.3	29,29	0,5,6070	AA,AG,GG		0.0121,0.1033,0.0412	benign,benign	320/1727,320/1691	76046101	5,12145	1937	4138	6075	SO:0001583	missense	57690				gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding	g.chr17:76046101G>A	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.958G>A	17.37:g.76046101G>A	ENSP00000468647:p.Val320Ile					TNRC6C_uc002juf.2_Missense_Mutation_p.V320I|TNRC6C_uc002jue.2_Missense_Mutation_p.V320I	p.V320I	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)		4	1558	+			320			Sufficient for interaction with argonaute family proteins.|Gly-rich.		G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	37	c.958G>A	CCDS45798.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	5.525	0.281758	0.10458	0.001033	1.21E-4	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.14266	2.52;2.53;2.53;2.52	5.16	1.81	0.25067	.	0.428319	0.24001	N	0.042472	T	0.05410	0.0143	N	0.16478	0.41	0.09310	N	1	B;B;B	0.16396	0.017;0.017;0.008	B;B;B	0.09377	0.004;0.004;0.002	T	0.30592	-0.9973	10	0.34782	T	0.22	-3.8601	10.2702	0.43479	0.1967:0.0:0.8033:0.0	.	320;320;320	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	I	320	ENSP00000336783:V320I;ENSP00000301624:V320I;ENSP00000440310:V320I;ENSP00000442421:V320I	ENSP00000301624:V320I	V	+	1	0	TNRC6C	73557696	0.228000	0.23718	0.003000	0.11579	0.761000	0.43186	2.242000	0.43106	0.217000	0.20800	-0.136000	0.14681	GTT		0.557	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996		6	73	0	0	0	0.001984	0	6	73				
CBX2	84733	broad.mit.edu	37	17	77758643	77758643	+	Silent	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr17:77758643G>A	ENST00000310942.4	+	5	1505	c.1401G>A	c.(1399-1401)tcG>tcA	p.S467S		NM_005189.2	NP_005180.1	Q14781	CBX2_HUMAN	chromobox homolog 2	467	Poly-Ser.				cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|development of primary sexual characteristics (GO:0045137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GTAGCAGCTCGGACTCCGACC	0.682																																							uc002jxc.2		NA																	0					0						c.(1399-1401)TCG>TCA		chromobox homolog 2 isoform 1							34.0	33.0	33.0					17																	77758643		2202	4300	6502	SO:0001819	synonymous_variant	84733				cell differentiation|chromatin modification|development of primary sexual characteristics|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	PcG protein complex	DNA binding	g.chr17:77758643G>A	BC004252, BG354579	CCDS11764.1, CCDS32757.1	17q25.3	2010-07-06	2010-06-24		ENSG00000173894	ENSG00000173894			1552	protein-coding gene	gene with protein product	"""Pc class homolog (Drosophila)"""	602770	"""chromobox homolog 2 (Drosophila Pc class)"", ""cell division cycle associated 6"""	CDCA6		7782071, 2477932	Standard	NM_005189		Approved	MGC10561	uc002jxc.3	Q14781		ENST00000310942.4:c.1401G>A	17.37:g.77758643G>A							p.S467S	NM_005189	NP_005180	Q14781	CBX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		5	1443	+			467			Poly-Ser.		Q0VDA5|Q9BTB1	Silent	SNP	ENST00000310942.4	37	c.1401G>A	CCDS32757.1																																																																																				0.682	CBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437040.1	NM_032647		8	21	0	0	0	0.00308	0	8	21				
DSG4	147409	broad.mit.edu	37	18	28991245	28991245	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr18:28991245C>G	ENST00000308128.4	+	15	2324	c.2189C>G	c.(2188-2190)tCg>tGg	p.S730W	DSG4_ENST00000359747.4_Missense_Mutation_p.S749W|RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	730					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GGAGGTGTATCGGGAGTGGAG	0.607																																							uc002kwq.2		NA																	0				central_nervous_system(5)|ovary(3)	8						c.(2188-2190)TCG>TGG		desmoglein 4 isoform 2 preproprotein							89.0	82.0	84.0					18																	28991245		2203	4300	6503	SO:0001583	missense	147409				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding	g.chr18:28991245C>G	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.2189C>G	18.37:g.28991245C>G	ENSP00000311859:p.Ser730Trp					DSG4_uc002kwr.2_Missense_Mutation_p.S749W	p.S730W	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00504)		15	2324	+			730			Cytoplasmic (Potential).		A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	37	c.2189C>G	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034063	0.75504	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.59502	0.26;0.26	5.97	5.97	0.96955	.	0.000000	0.30293	N	0.009957	T	0.74764	0.3759	M	0.62723	1.935	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.993	T	0.75599	-0.3262	10	0.87932	D	0	.	17.5774	0.87955	0.0:1.0:0.0:0.0	.	749;730	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	W	730;749	ENSP00000311859:S730W;ENSP00000352785:S749W	ENSP00000311859:S730W	S	+	2	0	DSG4	27245243	0.602000	0.26916	0.962000	0.40283	0.783000	0.44284	2.986000	0.49370	2.820000	0.97059	0.655000	0.94253	TCG		0.607	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986		29	93	0	0	0	0.002836	0	29	93				
ASXL3	80816	broad.mit.edu	37	18	31324952	31324952	+	Missense_Mutation	SNP	A	A	C	rs568504492		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr18:31324952A>C	ENST00000269197.5	+	12	5140	c.5140A>C	c.(5140-5142)Agt>Cgt	p.S1714R		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1714					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TTCCACCTCAAGTCCCATGGA	0.552																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(5140-5142)AGT>CGT		additional sex combs like 3							83.0	85.0	84.0					18																	31324952		2027	4203	6230	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31324952A>C	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.5140A>C	18.37:g.31324952A>C	ENSP00000269197:p.Ser1714Arg					ASXL3_uc002kxq.2_Missense_Mutation_p.S1421R	p.S1714R	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN			12	5195	+			1714					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.5140A>C	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	A	3.144	-0.175705	0.06421	.	.	ENSG00000141431	ENST00000269197	T	0.15139	2.45	5.86	3.67	0.42095	.	.	.	.	.	T	0.10981	0.0268	N	0.19112	0.55	0.09310	N	1	B	0.29805	0.257	B	0.32289	0.143	T	0.34675	-0.9819	9	0.25751	T	0.34	.	7.4875	0.27441	0.4149:0.0:0.5851:0.0	.	1714	Q9C0F0	ASXL3_HUMAN	R	1714	ENSP00000269197:S1714R	ENSP00000269197:S1714R	S	+	1	0	ASXL3	29578950	0.081000	0.21417	0.003000	0.11579	0.044000	0.14063	2.012000	0.40932	0.602000	0.29896	0.533000	0.62120	AGT		0.552	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			20	68	0	0	0	0.008871	0	20	68				
ALPK2	115701	broad.mit.edu	37	18	56196383	56196383	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr18:56196383T>A	ENST00000361673.3	-	6	5654	c.5441A>T	c.(5440-5442)cAt>cTt	p.H1814L		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1814	Ig-like 2.			H -> R (in Ref. 1; BX647796). {ECO:0000305}.		nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						AGAATCTTCATGAATTTCTGC	0.393																																							uc002lhj.3		NA																	0				ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(5440-5442)CAT>CTT		heart alpha-kinase							147.0	136.0	140.0					18																	56196383		2203	4300	6503	SO:0001583	missense	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56196383T>A	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.5441A>T	18.37:g.56196383T>A	ENSP00000354991:p.His1814Leu					ALPK2_uc002lhk.1_Missense_Mutation_p.H1145L	p.H1814L	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN			6	5655	-			1814	H -> R (in Ref. 1; BX647796).		Ig-like 2.		Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	c.5441A>T	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	T	20.8	4.048797	0.75846	.	.	ENSG00000198796	ENST00000361673	T	0.26957	1.7	5.44	5.44	0.79542	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.084143	0.51477	D	0.000090	T	0.40272	0.1110	L	0.39245	1.2	0.42982	D	0.994467	B;B	0.33022	0.342;0.394	P;P	0.51657	0.547;0.676	T	0.36648	-0.9739	10	0.59425	D	0.04	-17.7666	15.1562	0.72743	0.0:0.0:0.0:1.0	.	1809;1814	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	L	1814	ENSP00000354991:H1814L	ENSP00000354991:H1814L	H	-	2	0	ALPK2	54347363	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.060000	0.64312	2.062000	0.61559	0.533000	0.62120	CAT		0.393	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		18	98	0	0	0	0.007413	0	18	98				
ADNP2	22850	broad.mit.edu	37	18	77895908	77895908	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr18:77895908G>T	ENST00000262198.4	+	4	3067	c.2612G>T	c.(2611-2613)gGc>gTc	p.G871V		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	871					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		GGGAGCACCGGCAAGCGAGTG	0.577																																							uc002lnw.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(2611-2613)GGC>GTC		ADNP homeobox 2							60.0	62.0	61.0					18																	77895908		2203	4300	6503	SO:0001583	missense	22850				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:77895908G>T	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2612G>T	18.37:g.77895908G>T	ENSP00000262198:p.Gly871Val						p.G871V	NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)	4	3067	+		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)	871					A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	c.2612G>T	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	G	3.890	-0.024255	0.07634	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.18	1.29	0.21616	.	1.174700	0.05956	N	0.639831	T	0.28234	0.0697	N	0.24115	0.695	0.09310	N	0.999998	B	0.27416	0.178	B	0.29785	0.107	T	0.28808	-1.0032	8	.	.	.	-1.7094	4.7762	0.13180	0.4047:0.2834:0.3119:0.0	.	871	Q6IQ32	ADNP2_HUMAN	V	871	.	.	G	+	2	0	ADNP2	75996899	0.000000	0.05858	0.281000	0.24762	0.180000	0.23129	0.452000	0.21795	0.328000	0.23435	0.655000	0.94253	GGC		0.577	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913		11	56	1	0	1.08611e-07	0.010729	1.34941e-07	11	56				
SHC2	25759	broad.mit.edu	37	19	436408	436408	+	Silent	SNP	G	G	A	rs376382613		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:436408G>A	ENST00000264554.6	-	6	797	c.798C>T	c.(796-798)taC>taT	p.Y266Y		NM_012435.2	NP_036567.2	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing) transforming protein 2	266	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of MAPK activity (GO:0000187)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)	cytosol (GO:0005829)				endometrium(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTTGGCGACGTAGGCCACGT	0.716																																							uc002loq.3		NA																	0					0						c.(796-798)TAC>TAT		SHC (Src homology 2 domain containing)		G		1,3795		0,1,1897	24.0	30.0	28.0		798	-6.9	0.8	19		28	0,8202		0,0,4101	no	coding-synonymous	SHC2	NM_012435.2		0,1,5998	AA,AG,GG		0.0,0.0263,0.0083		266/583	436408	1,11997	1898	4101	5999	SO:0001819	synonymous_variant	25759				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol		g.chr19:436408G>A	AB001451	CCDS45891.1	19p13.3	2013-02-14				ENSG00000129946		"""SH2 domain containing"""	29869	protein-coding gene	gene with protein product	"""neuronal Shc adaptor homolog"""	605217				7527937, 9507002	Standard	NM_012435		Approved	SLI, SCK, SHCB	uc002loq.4	P98077		ENST00000264554.6:c.798C>T	19.37:g.436408G>A						SHC2_uc002lop.3_Silent_p.Y7Y	p.Y266Y	NM_012435	NP_036567	P98077	SHC2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	6	798	-		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	266			PID.		O60230|Q9NPL5|Q9UCX4	Silent	SNP	ENST00000264554.6	37	c.798C>T	CCDS45891.1																																																																																				0.716	SHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451840.3			7	54	0	0	0	0.006214	0	7	54				
KEAP1	9817	broad.mit.edu	37	19	10610139	10610139	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:10610139C>T	ENST00000171111.5	-	2	1118	c.571G>A	c.(571-573)Gct>Act	p.A191T	KEAP1_ENST00000588024.1_5'UTR|KEAP1_ENST00000393623.2_Missense_Mutation_p.A191T	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	191	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	ATCTGCTCAGCGAAGTTGGCG	0.607																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(571-573)GCT>ACT		kelch-like ECH-associated protein 1							88.0	70.0	76.0					19																	10610139		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10610139C>T	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.571G>A	19.37:g.10610139C>T	ENSP00000171111:p.Ala191Thr					KEAP1_uc002mor.1_Missense_Mutation_p.A191T	p.A191T	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		2	727	-			191			BACK.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.571G>A	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.482865	0.84747	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.81078	-1.45;-1.45	4.81	4.81	0.61882	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.90116	0.6912	M	0.86097	2.795	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	D	0.91883	0.5517	10	0.87932	D	0	.	15.3825	0.74669	0.0:1.0:0.0:0.0	.	191	Q14145	KEAP1_HUMAN	T	191	ENSP00000171111:A191T;ENSP00000377245:A191T	ENSP00000171111:A191T	A	-	1	0	KEAP1	10471139	1.000000	0.71417	0.997000	0.53966	0.637000	0.38172	7.628000	0.83189	2.232000	0.73038	0.561000	0.74099	GCT		0.607	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		6	40	0	0	0	0.001984	0	6	40				
RFX1	5989	broad.mit.edu	37	19	14076266	14076266	+	Missense_Mutation	SNP	C	C	A	rs377533889		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:14076266C>A	ENST00000254325.4	-	16	2440	c.2206G>T	c.(2206-2208)Gtg>Ttg	p.V736L		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	736					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			CTCACCTTCACCCGCAGCATC	0.617																																							uc002mxv.2		NA																	0				lung(1)|pancreas(1)	2						c.(2206-2208)GTG>TTG		regulatory factor X1							171.0	181.0	178.0					19																	14076266		2203	4300	6503	SO:0001583	missense	5989				immune response	nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr19:14076266C>A		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.2206G>T	19.37:g.14076266C>A	ENSP00000254325:p.Val736Leu						p.V736L	NM_002918	NP_002909	P22670	RFX1_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)		16	2478	-			736						Missense_Mutation	SNP	ENST00000254325.4	37	c.2206G>T	CCDS12301.1	.	.	.	.	.	.	.	.	.	.	c	14.07	2.424629	0.43020	.	.	ENSG00000132005	ENST00000254325	T	0.07908	3.15	4.02	4.02	0.46733	.	0.130838	0.52532	D	0.000076	T	0.08758	0.0217	L	0.39245	1.2	0.41086	D	0.985564	B	0.21688	0.059	B	0.20184	0.028	T	0.19614	-1.0300	10	0.27785	T	0.31	-22.0861	15.0907	0.72192	0.0:1.0:0.0:0.0	.	736	P22670	RFX1_HUMAN	L	736	ENSP00000254325:V736L	ENSP00000254325:V736L	V	-	1	0	RFX1	13937266	0.998000	0.40836	1.000000	0.80357	0.919000	0.55068	2.463000	0.45058	2.074000	0.62210	0.462000	0.41574	GTG		0.617	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918		45	148	1	0	1.11015e-26	0.00361	1.75062e-26	45	148				
GTPBP3	84705	broad.mit.edu	37	19	17451852	17451852	+	Splice_Site	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:17451852G>T	ENST00000324894.8	+	8	1042		c.e8-1		GTPBP3_ENST00000361619.5_Splice_Site|GTPBP3_ENST00000598038.1_Intron|GTPBP3_ENST00000600625.1_Intron|GTPBP3_ENST00000358792.7_Splice_Site	NM_032620.3|NM_133644.3	NP_116009.2|NP_598399.2	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial)						tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)	18						TGCTCCCGCAGGCTAGAGCAG	0.612																																							uc010eas.2		NA																	0				skin(1)	1						c.e8-1		GTP binding protein 3 (mitochondrial) isoform V							76.0	61.0	66.0					19																	17451852		2203	4300	6503	SO:0001630	splice_region_variant	84705				tRNA modification	mitochondrion	GTP binding|GTPase activity	g.chr19:17451852G>T	AF360742	CCDS32950.1, CCDS32951.1, CCDS56088.1, CCDS59364.1	19p13.2	2008-02-05				ENSG00000130299			14880	protein-coding gene	gene with protein product		608536				1290633	Standard	NM_001128855		Approved	MSS1, THDF1, GTPBG3, MTGP1, FLJ14700	uc010xpo.2	Q969Y2		ENST00000324894.8:c.975-1G>T	19.37:g.17451852G>T						GTPBP3_uc010xpo.1_Splice_Site_p.R347_splice|GTPBP3_uc002ngh.3_Intron|GTPBP3_uc002ngg.3_Splice_Site_p.R357_splice|GTPBP3_uc002ngi.3_Splice_Site	p.R325_splice	NM_032620	NP_116009	Q969Y2	GTPB3_HUMAN			8	1040	+								A6NFH1|A6NIG5|A6NKR4|A8K7B4|B7Z4V8|Q8TCY6|Q8WUW9|Q969G4|Q9BX61	Splice_Site	SNP	ENST00000324894.8	37	c.975_splice	CCDS32951.1	.	.	.	.	.	.	.	.	.	.	G	9.847	1.192539	0.21954	.	.	ENSG00000130299	ENST00000361619;ENST00000324894;ENST00000358792	.	.	.	4.48	3.45	0.39498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3153	0.43734	0.0989:0.0:0.9011:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GTPBP3	17312852	1.000000	0.71417	0.996000	0.52242	0.072000	0.16883	7.231000	0.78106	1.024000	0.39682	0.491000	0.48974	.		0.612	GTPBP3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463624.1	NM_032620	Intron	13	47	1	0	9.05144e-12	0.001855	1.26228e-11	13	47				
ZNF506	440515	broad.mit.edu	37	19	19906467	19906467	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:19906467T>A	ENST00000540806.2	-	4	317	c.229A>T	c.(229-231)Atg>Ttg	p.M77L	CTC-559E9.6_ENST00000589657.1_RNA|ZNF506_ENST00000450683.2_Missense_Mutation_p.M45L|ZNF506_ENST00000443905.2_Missense_Mutation_p.M77L|ZNF506_ENST00000587461.1_Intron|CTC-559E9.4_ENST00000590274.1_lincRNA|CTC-559E9.6_ENST00000591884.1_RNA			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	77					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						TGAGAATACATAACTGAAAGA	0.303																																							uc010eci.2		NA																	0					0						c.(229-231)ATG>TTG		zinc finger protein 506 isoform 1							28.0	28.0	28.0					19																	19906467		2096	4228	6324	SO:0001583	missense	440515				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding	g.chr19:19906467T>A	AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.229A>T	19.37:g.19906467T>A	ENSP00000440625:p.Met77Leu					ZNF506_uc002nog.2_Intron|ZNF506_uc002noh.3_Missense_Mutation_p.M45L	p.M77L	NM_001099269	NP_001092739	Q5JVG8	ZN506_HUMAN			4	377	-			77					B3KTH6	Missense_Mutation	SNP	ENST00000540806.2	37	c.229A>T	CCDS42531.1	.	.	.	.	.	.	.	.	.	.	t	1.786	-0.480647	0.04383	.	.	ENSG00000081665	ENST00000443905;ENST00000540806;ENST00000450683	T;T;T	0.05199	3.5;3.5;3.48	1.27	1.27	0.21489	.	.	.	.	.	T	0.04363	0.0120	L	0.38838	1.175	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.10450	0.005;0.002	T	0.47837	-0.9086	9	0.09338	T	0.73	.	4.3696	0.11241	0.0:0.0:0.0:1.0	.	77;45	Q5JVG8;Q5JVG8-2	ZN506_HUMAN;.	L	77;77;45	ENSP00000393835:M77L;ENSP00000440625:M77L;ENSP00000408892:M45L	ENSP00000393835:M77L	M	-	1	0	ZNF506	19767467	0.000000	0.05858	0.028000	0.17463	0.026000	0.11368	-0.161000	0.10026	0.358000	0.24211	0.347000	0.21830	ATG		0.303	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460794.1	XM_036218		9	22	0	0	0	0.004482	0	9	22				
ZNF98	148198	broad.mit.edu	37	19	22574896	22574896	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:22574896C>T	ENST00000357774.5	-	4	1262	c.1141G>A	c.(1141-1143)Gaa>Aaa	p.E381K		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	381					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CCACATTCTTCACACTTGTAG	0.383																																							uc002nqt.2		NA																	0				ovary(1)|skin(1)	2						c.(1141-1143)GAA>AAA		zinc finger protein 98							10.0	10.0	10.0					19																	22574896		1515	3512	5027	SO:0001583	missense	148198				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22574896C>T		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1141G>A	19.37:g.22574896C>T	ENSP00000350418:p.Glu381Lys						p.E381K	NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN			4	1263	-		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)	381			C2H2-type 8.			Missense_Mutation	SNP	ENST00000357774.5	37	c.1141G>A	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	8.999	0.979675	0.18812	.	.	ENSG00000197360	ENST00000357774	T	0.06608	3.28	1.28	-2.56	0.06268	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05502	0.0145	L	0.28556	0.865	0.09310	N	1	P	0.40000	0.698	P	0.44696	0.458	T	0.35151	-0.9800	9	0.24483	T	0.36	.	5.1075	0.14793	0.0:0.1849:0.5345:0.2806	.	381	A6NK75	ZNF98_HUMAN	K	381	ENSP00000350418:E381K	ENSP00000350418:E381K	E	-	1	0	ZNF98	22366736	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-10.235000	0.00007	-0.905000	0.03871	0.305000	0.20034	GAA		0.383	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626		5	30	0	0	0	0.010729	0	5	30				
HAMP	57817	broad.mit.edu	37	19	35775872	35775872	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:35775872C>A	ENST00000598398.1	+	4	478	c.182C>A	c.(181-183)aCc>aAc	p.T61N	HAMP_ENST00000222304.3_Missense_Mutation_p.T61N	NM_021175.2	NP_066998.1	P81172	HEPC_HUMAN	hepcidin antimicrobial peptide	61					cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|immune response (GO:0006955)|killing of cells of other organism (GO:0031640)	apical cortex (GO:0045179)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			AGGCGAGACACCCACTTCCCC	0.597																																							uc002nyw.2		NA																	0				central_nervous_system(1)	1						c.(181-183)ACC>AAC		hepcidin antimicrobial peptide preproprotein							161.0	147.0	152.0					19																	35775872		2203	4300	6503	SO:0001583	missense	57817				defense response to bacterium|defense response to fungus|immune response|killing of cells of other organism	extracellular region	hormone activity	g.chr19:35775872C>A	AF309489	CCDS12454.1	19q13.1	2014-09-17				ENSG00000105697			15598	protein-coding gene	gene with protein product		606464				11034317, 11113132	Standard	NM_021175		Approved	LEAP-1, HEPC, HFE2B, LEAP1	uc002nyw.3	P81172		ENST00000598398.1:c.182C>A	19.37:g.35775872C>A	ENSP00000471894:p.Thr61Asn						p.T61N	NM_021175	NP_066998	P81172	HEPC_HUMAN	Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)		3	253	+	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		61					Q1HE14|Q9BY68	Missense_Mutation	SNP	ENST00000598398.1	37	c.182C>A	CCDS12454.1	.	.	.	.	.	.	.	.	.	.	C	18.25	3.581679	0.65992	.	.	ENSG00000105697	ENST00000222304	D	0.89050	-2.46	4.51	3.42	0.39159	.	0.394776	0.21899	N	0.067464	D	0.90024	0.6885	.	.	.	0.31909	N	0.614929	D	0.63046	0.992	P	0.54060	0.741	D	0.90379	0.4386	9	0.72032	D	0.01	-14.1188	10.5816	0.45259	0.0:0.8058:0.1942:0.0	.	61	P81172	HEPC_HUMAN	N	61	ENSP00000222304:T61N	ENSP00000222304:T61N	T	+	2	0	HAMP	40467712	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	0.845000	0.27668	2.348000	0.79779	0.561000	0.74099	ACC		0.597	HAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466067.1	NM_021175		18	186	1	0	1.10513e-12	0.002299	1.59544e-12	18	186				
SBSN	374897	broad.mit.edu	37	19	36019165	36019165	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:36019165C>A	ENST00000452271.2	-	1	47	c.19G>T	c.(19-21)Gtc>Ttc	p.V7F	SBSN_ENST00000518157.1_Missense_Mutation_p.V7F	NM_001166034.1	NP_001159506.1	Q6UWP8	SBSN_HUMAN	suprabasin	7						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				large_intestine(5)|lung(6)|ovary(1)|prostate(2)	14	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CAGGAGCCGACCAGACGTGCA	0.592																																							uc002oae.1		NA																	0				ovary(1)	1						c.(19-21)GTC>TTC		suprabasin isoform 2 precursor							39.0	36.0	37.0					19																	36019165		2203	4300	6503	SO:0001583	missense	374897					extracellular region		g.chr19:36019165C>A	AY358701	CCDS12464.1, CCDS54253.1	19q13.13	2008-02-05							24950	protein-coding gene	gene with protein product		609969				12228223	Standard	NM_198538		Approved	UNQ698, HLAR698	uc002oad.2	Q6UWP8		ENST00000452271.2:c.19G>T	19.37:g.36019165C>A	ENSP00000430242:p.Val7Phe					SBSN_uc002oad.1_Missense_Mutation_p.V7F	p.V7F	NM_198538	NP_940940	Q6UWP8	SBSN_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)		1	89	-	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		7					A8K5J0|E9PBV3	Missense_Mutation	SNP	ENST00000452271.2	37	c.19G>T	CCDS54253.1	.	.	.	.	.	.	.	.	.	.	C	7.580	0.668585	0.14776	.	.	ENSG00000189001	ENST00000452271;ENST00000518157	T;T	0.52754	0.65;0.67	4.38	-0.962	0.10333	.	1.754410	0.03439	N	0.209091	T	0.36853	0.0982	L	0.36672	1.1	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.10450	0.001;0.005	T	0.29518	-1.0009	10	0.66056	D	0.02	.	3.593	0.07995	0.139:0.3052:0.452:0.1038	.	7;7	Q6UWP8;E9PBV3	SBSN_HUMAN;.	F	7	ENSP00000430242:V7F;ENSP00000428771:V7F	ENSP00000430242:V7F	V	-	1	0	SBSN	40711005	0.007000	0.16637	0.000000	0.03702	0.109000	0.19521	0.067000	0.14510	-0.269000	0.09298	0.555000	0.69702	GTC		0.592	SBSN-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109463.3	NM_198538		12	22	1	0	7.03913e-09	0.001368	9.13304e-09	12	22				
KLK7	5650	broad.mit.edu	37	19	51483496	51483496	+	Splice_Site	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:51483496C>A	ENST00000391807.1	-	4	570	c.469G>T	c.(469-471)Gtg>Ttg	p.V157L	KLK7_ENST00000597707.1_Splice_Site_p.V85L|KLK7_ENST00000595820.1_Splice_Site_p.V157L|KLK7_ENST00000595638.1_5'Flank|KLK7_ENST00000336317.4_Splice_Site_p.V44L|CTB-147C22.9_ENST00000594512.1_RNA	NM_139277.2	NP_644806.1	P49862	KLK7_HUMAN	kallikrein-related peptidase 7	157	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(2)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		ggCCACCTACCATCTGGGCTC	0.662																																							uc002puo.2		NA																	0					0						c.(469-471)GTG>TTG		stratum corneum chymotryptic enzyme							34.0	32.0	33.0					19																	51483496		2203	4300	6503	SO:0001630	splice_region_variant	5650				epidermis development|proteolysis	extracellular region	serine-type endopeptidase activity	g.chr19:51483496C>A	L33404	CCDS12812.1, CCDS59414.1	19q13.33	2011-09-07	2006-10-27			ENSG00000169035		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6368	protein-coding gene	gene with protein product		604438	"""kallikrein 7 (chymotryptic, stratum corneum)"""	PRSS6		8034709, 16800724, 16800723	Standard	NM_005046		Approved	SCCE	uc021uyj.1	P49862		ENST00000391807.1:c.469+1G>T	19.37:g.51483496C>A						KLK7_uc002pup.2_Missense_Mutation_p.V157L|KLK7_uc010yco.1_Missense_Mutation_p.V31L|KLK7_uc010eok.2_Missense_Mutation_p.V85L	p.V157L	NM_139277	NP_644806	P49862	KLK7_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)	4	571	-		all_neural(266;0.026)	157			Peptidase S1.		A8K0U5|Q8N5N9|Q8NFV7	Missense_Mutation	SNP	ENST00000391807.1	37	c.469G>T	CCDS12812.1	.	.	.	.	.	.	.	.	.	.	c	17.83	3.486036	0.63962	.	.	ENSG00000169035	ENST00000304045;ENST00000391807;ENST00000336317	D;T	0.92545	-3.06;3.37	4.21	3.17	0.36434	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.84669	0.5523	N	0.25426	0.745	0.32959	D	0.520847	B	0.21905	0.062	B	0.25506	0.061	T	0.79945	-0.1589	8	.	.	.	.	7.925	0.29870	0.0:0.8822:0.0:0.1178	.	157	P49862	KLK7_HUMAN	L	157;157;44	ENSP00000375683:V157L;ENSP00000337540:V44L	.	V	-	1	0	KLK7	56175308	0.788000	0.28762	0.079000	0.20413	0.862000	0.49288	1.273000	0.33121	0.916000	0.36871	0.448000	0.29417	GTG		0.662	KLK7-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464344.1	NM_005046	Missense_Mutation	9	14	1	0	0.000442599	0.006214	0.000504071	9	14				
ZNF610	162963	broad.mit.edu	37	19	52869067	52869067	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:52869067T>A	ENST00000403906.3	+	6	892	c.436T>A	c.(436-438)Tac>Aac	p.Y146N	ZNF610_ENST00000327920.8_Missense_Mutation_p.Y146N|ZNF610_ENST00000601151.1_Missense_Mutation_p.Y103N|ZNF610_ENST00000321287.8_Missense_Mutation_p.Y146N	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	146					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		AAGGAAAATTTACAGAAGTAA	0.348																																							uc002pyx.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(436-438)TAC>AAC		zinc finger protein 610 isoform a							99.0	108.0	105.0					19																	52869067		2203	4300	6503	SO:0001583	missense	162963				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52869067T>A	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.436T>A	19.37:g.52869067T>A	ENSP00000383922:p.Tyr146Asn					ZNF610_uc002pyy.3_Missense_Mutation_p.Y146N|ZNF610_uc002pyz.3_Missense_Mutation_p.Y103N|ZNF610_uc002pza.2_Missense_Mutation_p.Y146N	p.Y146N	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)	6	842	+			146					A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	ENST00000403906.3	37	c.436T>A	CCDS12851.1	.	.	.	.	.	.	.	.	.	.	T	1.729	-0.494646	0.04322	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T	0.04917	3.53;3.53	1.11	-2.21	0.06973	.	.	.	.	.	T	0.04588	0.0125	L	0.38953	1.18	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39099	-0.9630	9	0.51188	T	0.08	.	2.0618	0.03594	0.4638:0.2085:0.0:0.3277	.	103;146	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	N	146;103;146	ENSP00000383922:Y146N;ENSP00000327597:Y146N	ENSP00000324441:Y103N	Y	+	1	0	ZNF610	57560879	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.110000	0.10824	-1.738000	0.01348	0.260000	0.18958	TAC		0.348	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530		16	124	0	0	0	0.00499	0	16	124				
RDH13	112724	broad.mit.edu	37	19	55556498	55556498	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:55556498C>A	ENST00000415061.3	-	7	1083	c.940G>T	c.(940-942)Gcc>Tcc	p.A314S	RDH13_ENST00000396247.3_Missense_Mutation_p.A243S|CTC-550B14.7_ENST00000586961.1_RNA|CTC-550B14.6_ENST00000585492.1_RNA|RDH13_ENST00000592423.1_5'Flank|CTC-550B14.7_ENST00000593060.1_RNA|CTC-550B14.7_ENST00000586845.1_RNA	NM_001145971.1	NP_001139443.1	Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 (all-trans/9-cis)	314					eye photoreceptor cell development (GO:0042462)|response to high light intensity (GO:0009644)|retina layer formation (GO:0010842)	mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	ACCAGGCGGGCACTTTCAGCC	0.622																																							uc002qio.3		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(940-942)GCC>TCC		retinol dehydrogenase 13 isoform 1	Vitamin A(DB00162)						27.0	32.0	30.0					19																	55556498		1879	4102	5981	SO:0001583	missense	112724						binding|oxidoreductase activity	g.chr19:55556498C>A		CCDS42627.1, CCDS54320.1	19q13.42	2011-09-14	2006-05-09			ENSG00000160439	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19978	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 3"""		"""retinol dehydrogenase 13 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_138412		Approved	SDR7C3	uc002qio.3	Q8NBN7		ENST00000415061.3:c.940G>T	19.37:g.55556498C>A	ENSP00000391121:p.Ala314Ser					RDH13_uc002qip.2_Missense_Mutation_p.A243S|RDH13_uc010esr.1_RNA	p.A314S	NM_001145971	NP_001139443	Q8NBN7	RDH13_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	7	1125	-			314					Q6UX79|Q96G88	Missense_Mutation	SNP	ENST00000415061.3	37	c.940G>T	CCDS54320.1	.	.	.	.	.	.	.	.	.	.	C	4.131	0.022550	0.08006	.	.	ENSG00000160439	ENST00000415061;ENST00000396247	T;T	0.65364	-0.15;-0.15	4.61	3.58	0.41010	NAD(P)-binding domain (1);	0.566830	0.18979	N	0.125934	T	0.47210	0.1433	L	0.35341	1.055	0.27323	N	0.956979	B	0.13594	0.008	B	0.06405	0.002	T	0.21552	-1.0242	10	0.24483	T	0.36	.	10.5256	0.44945	0.0:0.9019:0.0:0.0981	.	314	Q8NBN7	RDH13_HUMAN	S	314;243	ENSP00000391121:A314S;ENSP00000379547:A243S	ENSP00000379547:A243S	A	-	1	0	RDH13	60248310	0.999000	0.42202	0.999000	0.59377	0.257000	0.26127	1.919000	0.40015	2.571000	0.86741	0.313000	0.20887	GCC		0.622	RDH13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451470.1	NM_138412		10	23	1	0	1.33987e-11	0.008291	1.8559e-11	10	23				
AGBL5	60509	broad.mit.edu	37	2	27293105	27293105	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:27293105C>A	ENST00000360131.4	+	15	2794	c.2635C>A	c.(2635-2637)Cca>Aca	p.P879T		NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	879					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAAATCTCCCCCACTGACTGT	0.498																																							uc002rie.2		NA																	0				ovary(1)|breast(1)	2						c.(2635-2637)CCA>ACA		ATP/GTP binding protein-like 5 isoform 1							141.0	129.0	133.0					2																	27293105		1854	4098	5952	SO:0001583	missense	60509				protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr2:27293105C>A	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.2635C>A	2.37:g.27293105C>A	ENSP00000353249:p.Pro879Thr					AGBL5_uc002rif.2_RNA	p.P879T	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN			15	2852	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		879					A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	ENST00000360131.4	37	c.2635C>A	CCDS1732.3	.	.	.	.	.	.	.	.	.	.	C	11.97	1.798318	0.31777	.	.	ENSG00000084693	ENST00000360131	T	0.15372	2.43	5.21	4.33	0.51752	.	0.367696	0.26684	N	0.023036	T	0.12347	0.0300	N	0.24115	0.695	0.30354	N	0.784475	B	0.23377	0.084	B	0.24155	0.051	T	0.06972	-1.0797	10	0.87932	D	0	-1.9804	9.8575	0.41094	0.0:0.9074:0.0:0.0926	.	879	Q8NDL9	CBPC5_HUMAN	T	879	ENSP00000353249:P879T	ENSP00000353249:P879T	P	+	1	0	AGBL5	27146609	0.919000	0.31177	0.971000	0.41717	0.912000	0.54170	1.162000	0.31786	1.434000	0.47414	0.561000	0.74099	CCA		0.498	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831		23	73	1	0	9.57634e-11	0.00333	1.3001e-10	23	73				
BIRC6	57448	broad.mit.edu	37	2	32640261	32640261	+	Missense_Mutation	SNP	C	C	G	rs542376337		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:32640261C>G	ENST00000421745.2	+	10	2036	c.1902C>G	c.(1900-1902)agC>agG	p.S634R		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	634					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TTCTTTATAGCATCAAGGAAT	0.363																																					Pancreas(94;175 1509 16028 18060 45422)	Pancreas(94;175 1509 16028 18060 45422)	uc010ezu.2		NA																	0				ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14						c.(1900-1902)AGC>AGG		baculoviral IAP repeat-containing 6							73.0	72.0	72.0					2																	32640261		2203	4300	6503	SO:0001583	missense	57448				anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding	g.chr2:32640261C>G	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1902C>G	2.37:g.32640261C>G	ENSP00000393596:p.Ser634Arg						p.S634R	NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN			10	2036	+	Acute lymphoblastic leukemia(172;0.155)		634					Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	c.1902C>G	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	15.73	2.919501	0.52653	.	.	ENSG00000115760	ENST00000421745	T	0.79033	-1.23	5.56	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.74824	0.3767	N	0.24115	0.695	0.51767	D	0.999933	D	0.54772	0.968	P	0.53360	0.724	T	0.77872	-0.2426	10	0.59425	D	0.04	.	13.7651	0.62990	0.0:0.9251:0.0:0.0749	.	634	Q9NR09	BIRC6_HUMAN	R	634	ENSP00000393596:S634R	ENSP00000393596:S634R	S	+	3	2	BIRC6	32493765	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.894000	0.39768	1.455000	0.47813	0.650000	0.86243	AGC		0.363	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		7	17	0	0	0	0.004482	0	7	17				
NAT8	9027	broad.mit.edu	37	2	73868535	73868535	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:73868535A>T	ENST00000272425.3	-	2	370	c.221T>A	c.(220-222)cTg>cAg	p.L74Q		NM_003960.3|NM_016347.2	NP_003951.3|NP_057431.2			N-acetyltransferase 8 (GCN5-related, putative)											breast(1)|endometrium(2)|kidney(2)|lung(2)|ovary(1)|prostate(1)	9						AAGGAACCACAGGGCAGGGAA	0.552																																							uc002sji.1		NA																	0				ovary(1)	1						c.(220-222)CTG>CAG		N-acetyltransferase 8							112.0	117.0	115.0					2																	73868535		2203	4300	6503	SO:0001583	missense	9027				gastrulation with mouth forming second|response to drug	integral to membrane	N-acetyltransferase activity	g.chr2:73868535A>T	AB013094	CCDS1926.1	2p13.2	2012-03-20	2008-09-24		ENSG00000144035	ENSG00000144035			18069	protein-coding gene	gene with protein product		606716	"""N-acetyltransferase 8"""			11397015, 9852678, 19011241	Standard	NM_003960		Approved	Hcml1, TSC501, GLA, ATase2	uc002sji.1	Q9UHE5	OTTHUMG00000129818	ENST00000272425.3:c.221T>A	2.37:g.73868535A>T	ENSP00000272425:p.Leu74Gln						p.L74Q	NM_003960	NP_003951	Q9UHE5	NAT8_HUMAN			2	388	-			74			Helical; (Potential).|N-acetyltransferase.			Missense_Mutation	SNP	ENST00000272425.3	37	c.221T>A	CCDS1926.1	.	.	.	.	.	.	.	.	.	.	A	15.12	2.739398	0.49045	.	.	ENSG00000144035	ENST00000272425	T	0.36699	1.24	3.8	2.66	0.31614	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (1);	0.507098	0.18313	N	0.145046	T	0.45836	0.1362	M	0.69463	2.115	0.09310	N	1	D	0.65815	0.995	P	0.59761	0.863	T	0.29058	-1.0024	10	0.54805	T	0.06	-32.3996	3.5063	0.07692	0.6403:0.2367:0.1229:0.0	.	74	Q9UHE5	NAT8_HUMAN	Q	74	ENSP00000272425:L74Q	ENSP00000272425:L74Q	L	-	2	0	NAT8	73722043	0.015000	0.18098	0.130000	0.21974	0.309000	0.27889	1.055000	0.30467	1.685000	0.51034	0.524000	0.50904	CTG		0.552	NAT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327854.1	NM_003960		30	84	0	0	0	0.012213	0	30	84				
IL1RL2	8808	broad.mit.edu	37	2	102835488	102835488	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:102835488A>G	ENST00000264257.2	+	7	926	c.800A>G	c.(799-801)aAc>aGc	p.N267S	IL1RL2_ENST00000539491.1_Missense_Mutation_p.N267S|IL1RL2_ENST00000481806.1_3'UTR|IL1RL2_ENST00000441515.2_Missense_Mutation_p.N149S	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	267	Ig-like C2-type 3.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						AGAGTCAATAACACTTTGGTG	0.378																																							uc002tbs.2		NA																	0				ovary(2)	2						c.(799-801)AAC>AGC		interleukin 1 receptor-like 2 precursor							182.0	163.0	169.0					2																	102835488		2203	4300	6503	SO:0001583	missense	8808				cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity	g.chr2:102835488A>G	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.800A>G	2.37:g.102835488A>G	ENSP00000264257:p.Asn267Ser					IL1RL2_uc002tbt.2_Missense_Mutation_p.N149S	p.N267S	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN			7	926	+			267			Extracellular (Potential).|Ig-like C2-type 3.		A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Missense_Mutation	SNP	ENST00000264257.2	37	c.800A>G	CCDS2056.1	.	.	.	.	.	.	.	.	.	.	A	8.114	0.779536	0.16120	.	.	ENSG00000115598	ENST00000264257;ENST00000441515;ENST00000539491	T;T;T	0.13538	2.58;2.58;2.58	4.8	-0.215	0.13157	.	0.756504	0.12900	N	0.429869	T	0.12902	0.0313	L	0.59436	1.845	0.09310	N	1	B;B	0.21688	0.059;0.021	B;B	0.18263	0.021;0.012	T	0.22068	-1.0227	10	0.42905	T	0.14	.	7.3584	0.26731	0.6199:0.0:0.3801:0.0	.	149;267	A4FU63;Q9HB29	.;ILRL2_HUMAN	S	267;149;267	ENSP00000264257:N267S;ENSP00000413348:N149S;ENSP00000442184:N267S	ENSP00000264257:N267S	N	+	2	0	IL1RL2	102201920	0.000000	0.05858	0.005000	0.12908	0.541000	0.35023	0.103000	0.15292	-0.108000	0.12066	0.533000	0.62120	AAC		0.378	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253290.1	NM_003854		15	92	0	0	0	0.003163	0	15	92				
IL18RAP	8807	broad.mit.edu	37	2	103061723	103061723	+	Missense_Mutation	SNP	G	G	C	rs375315557		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:103061723G>C	ENST00000264260.2	+	9	1584	c.995G>C	c.(994-996)cGc>cCc	p.R332P	IL18RAP_ENST00000409369.1_Missense_Mutation_p.R190P	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	332	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						CGTGATCTTCGCAGGAAGTTT	0.423																																							uc002tbx.2		NA																	0				skin(3)|ovary(2)	5						c.(994-996)CGC>CCC		interleukin 18 receptor accessory protein							113.0	105.0	107.0					2																	103061723		2203	4300	6503	SO:0001583	missense	8807				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity	g.chr2:103061723G>C	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.995G>C	2.37:g.103061723G>C	ENSP00000264260:p.Arg332Pro					IL18RAP_uc010fiz.2_Missense_Mutation_p.R190P	p.R332P	NM_003853	NP_003844	O95256	I18RA_HUMAN			9	1479	+			332			Ig-like C2-type 2.|Extracellular (Potential).		B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	c.995G>C	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881253	0.33255	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.13657	2.57;2.57	5.63	-4.12	0.03916	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.326070	0.04542	N	0.388360	T	0.17831	0.0428	L	0.57536	1.79	0.09310	N	1	P	0.46142	0.873	P	0.46172	0.506	T	0.42582	-0.9443	10	0.34782	T	0.22	.	8.7879	0.34832	0.5636:0.0:0.3371:0.0992	.	332	O95256	I18RA_HUMAN	P	332;190	ENSP00000264260:R332P;ENSP00000387201:R190P	ENSP00000264260:R332P	R	+	2	0	IL18RAP	102428155	0.000000	0.05858	0.000000	0.03702	0.585000	0.36419	-0.945000	0.03909	-0.460000	0.07003	-0.126000	0.14955	CGC		0.423	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853		11	42	0	0	0	0.008291	0	11	42				
MYO7B	4648	broad.mit.edu	37	2	128384580	128384580	+	Silent	SNP	C	C	T	rs183041806		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:128384580C>T	ENST00000409816.2	+	30	4200	c.4168C>T	c.(4168-4170)Ctg>Ttg	p.L1390L	MYO7B_ENST00000428314.1_Silent_p.L1390L|MYO7B_ENST00000409090.1_Silent_p.L243L|RP11-286H15.1_ENST00000609697.1_RNA|MYO7B_ENST00000389524.4_Silent_p.L1390L			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1390	FERM 1. {ECO:0000255|PROSITE- ProRule:PRU00084}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AGTCACACCACTGGCCGTGCG	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		14827	0.0		0.001	False		,,,				2504	0.0						uc002top.2		NA																	0				ovary(1)|pancreas(1)	2						c.(4168-4170)CTG>TTG		myosin VIIB							25.0	28.0	27.0					2																	128384580		1998	4171	6169	SO:0001819	synonymous_variant	4648					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity	g.chr2:128384580C>T		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.4168C>T	2.37:g.128384580C>T						MYO7B_uc002toq.1_Silent_p.L243L|MYO7B_uc002tor.1_Silent_p.L243L	p.L1390L	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0753)	31	4221	+	Colorectal(110;0.1)		1390			FERM 1.		Q14786|Q8TEE1	Silent	SNP	ENST00000409816.2	37	c.4168C>T	CCDS46405.1																																																																																				0.612	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		5	12	0	0	0	0.000602	0	5	12				
NCKAP5	344148	broad.mit.edu	37	2	133486463	133486463	+	Missense_Mutation	SNP	C	C	T	rs368736527	byFrequency	TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:133486463C>T	ENST00000409261.1	-	18	5879	c.5506G>A	c.(5506-5508)Gga>Aga	p.G1836R	NCKAP5_ENST00000405974.3_Missense_Mutation_p.G517R|NCKAP5_ENST00000317721.6_Missense_Mutation_p.G1836R|NCKAP5_ENST00000409213.1_Missense_Mutation_p.G517R	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1836										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TCAGCATATCCGAATGATGAG	0.537													C|||	3	0.000599042	0.0	0.0	5008	,	,		17019	0.0		0.0	False		,,,				2504	0.0031						uc002ttp.2		NA																	0					0						c.(5506-5508)GGA>AGA		Nck-associated protein 5 isoform 1		C	ARG/GLY,ARG/GLY	0,3998		0,0,1999	208.0	212.0	210.0		5506,1549	-3.8	0.0	2		210	1,8333		0,1,4166	no	missense,missense	NCKAP5	NM_207363.2,NM_207481.3	125,125	0,1,6165	TT,TC,CC		0.012,0.0,0.0081	benign,benign	1836/1910,517/591	133486463	1,12331	1999	4167	6166	SO:0001583	missense	344148						protein binding	g.chr2:133486463C>T	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.5506G>A	2.37:g.133486463C>T	ENSP00000387128:p.Gly1836Arg					NCKAP5_uc002ttq.2_Missense_Mutation_p.G517R	p.G1836R	NM_207363	NP_997246	O14513	NCKP5_HUMAN			18	5880	-			1836					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.5506G>A	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234901	0.39498	0.0	1.2E-4	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.42513	2.99;0.97;2.99;0.97	4.55	-3.81	0.04294	.	0.615614	0.11854	U	0.523056	T	0.18923	0.0454	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.0;0.003	B;B	0.06405	0.001;0.002	T	0.12734	-1.0536	10	0.59425	D	0.04	.	7.0394	0.25010	0.0:0.2999:0.2122:0.4879	.	517;1836	O14513-2;O14513	.;NCKP5_HUMAN	R	1836;517;1836;517;517	ENSP00000387128:G1836R;ENSP00000386952:G517R;ENSP00000380603:G1836R;ENSP00000385692:G517R	ENSP00000380603:G1836R	G	-	1	0	NCKAP5	133202933	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.450000	0.06803	-0.903000	0.03881	-0.229000	0.12294	GGA		0.537	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		20	249	0	0	0	0.008871	0	20	249				
ACVR1	90	broad.mit.edu	37	2	158637031	158637031	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:158637031C>A	ENST00000263640.3	-	4	578	c.149G>T	c.(148-150)gGc>gTc	p.G50V	ACVR1_ENST00000434821.1_Missense_Mutation_p.G50V|ACVR1_ENST00000410057.2_Missense_Mutation_p.G50V|ACVR1_ENST00000487456.1_5'UTR|ACVR1_ENST00000409283.2_Missense_Mutation_p.G50V	NM_001105.4	NP_001096.1	Q04771	ACVR1_HUMAN	activin A receptor, type I	50					activin receptor signaling pathway (GO:0032924)|acute inflammatory response (GO:0002526)|atrial septum primum morphogenesis (GO:0003289)|BMP signaling pathway (GO:0030509)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to glucocorticoid stimulus (GO:0071385)|determination of left/right symmetry (GO:0007368)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion cell fate commitment (GO:0061445)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation with mouth forming second (GO:0001702)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|mesoderm formation (GO:0001707)|mitral valve morphogenesis (GO:0003183)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of signal transduction (GO:0009968)|neural crest cell migration (GO:0001755)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of bone mineralization (GO:0030501)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of ossification (GO:0030278)|regulation of skeletal muscle tissue development (GO:0048641)|smooth muscle cell differentiation (GO:0051145)|transforming growth factor beta receptor signaling pathway (GO:0007179)|urogenital system development (GO:0001655)	activin receptor complex (GO:0048179)|apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	19				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	GCACTGCTGGCCTTCACAGTG	0.507																																							uc002tzm.3		NA																	0				ovary(2)|skin(1)	3						c.(148-150)GGC>GTC		activin A receptor, type I precursor	Adenosine triphosphate(DB00171)						109.0	106.0	107.0					2																	158637031		2203	4300	6503	SO:0001583	missense	90				BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding	g.chr2:158637031C>A		CCDS2206.1	2q23-q24	2008-06-13			ENSG00000115170	ENSG00000115170			171	protein-coding gene	gene with protein product		102576		ACVRLK2		8397373	Standard	NM_001105		Approved	SKR1, ALK2, ACVR1A	uc010fog.2	Q04771	OTTHUMG00000131967	ENST00000263640.3:c.149G>T	2.37:g.158637031C>A	ENSP00000263640:p.Gly50Val					ACVR1_uc002tzn.3_Missense_Mutation_p.G50V|ACVR1_uc010fog.2_Missense_Mutation_p.G50V	p.G50V	NM_001111067	NP_001104537	Q04771	ACVR1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.104)	5	488	-			50			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000263640.3	37	c.149G>T	CCDS2206.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.863646	0.91511	.	.	ENSG00000115170	ENST00000263640;ENST00000409283;ENST00000434821;ENST00000410057;ENST00000412025;ENST00000440523;ENST00000539637;ENST00000424669	D;D;D;D;D;D;D;D	0.91945	-2.94;-2.94;-2.94;-2.94;-2.94;-2.94;-2.94;-2.94	5.2	5.2	0.72013	TGF-beta receptor/activin receptor, type I/II (1);	0.000000	0.85682	D	0.000000	D	0.95947	0.8680	M	0.78049	2.395	0.80722	D	1	D	0.67145	0.996	D	0.70227	0.968	D	0.96418	0.9309	10	0.87932	D	0	.	18.3385	0.90297	0.0:1.0:0.0:0.0	.	50	Q04771	ACVR1_HUMAN	V	50	ENSP00000263640:G50V;ENSP00000387273:G50V;ENSP00000405004:G50V;ENSP00000387127:G50V;ENSP00000403006:G50V;ENSP00000401189:G50V;ENSP00000440091:G50V;ENSP00000400767:G50V	ENSP00000263640:G50V	G	-	2	0	ACVR1	158345277	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.701000	0.84566	2.423000	0.82170	0.655000	0.94253	GGC		0.507	ACVR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254927.1	NM_001105		8	70	1	0	2.17888e-05	0.006214	2.5524e-05	8	70				
COL5A2	1290	broad.mit.edu	37	2	189912942	189912942	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:189912942C>A	ENST00000374866.3	-	45	3468	c.3194G>T	c.(3193-3195)gGa>gTa	p.G1065V		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1065					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TACACGTTCTCCAACAGCACC	0.343																																							uc002uqk.2		NA																	0				ovary(2)	2						c.(3193-3195)GGA>GTA		alpha 2 type V collagen preproprotein							66.0	69.0	68.0					2																	189912942		2203	4300	6503	SO:0001583	missense	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189912942C>A	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3194G>T	2.37:g.189912942C>A	ENSP00000364000:p.Gly1065Val					COL5A2_uc010frx.2_Missense_Mutation_p.G641V	p.G1065V	NM_000393	NP_000384	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		45	3469	-			1065					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	c.3194G>T	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	16.32	3.090134	0.55968	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.99186	-5.53	5.39	5.39	0.77823	.	0.000000	0.50627	D	0.000111	D	0.99661	0.9874	H	0.98818	4.34	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	0.998;1.0	D	0.97448	1.0026	10	0.87932	D	0	.	19.3515	0.94389	0.0:1.0:0.0:0.0	.	705;1065	Q5PR22;P05997	.;CO5A2_HUMAN	V	1065;705	ENSP00000364000:G1065V	ENSP00000364000:G1065V	G	-	2	0	COL5A2	189621187	1.000000	0.71417	1.000000	0.80357	0.391000	0.30476	7.091000	0.76923	2.809000	0.96659	0.557000	0.71058	GGA		0.343	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		8	41	1	0	0.00448238	0.004482	0.00486184	8	41				
CCDC150	284992	broad.mit.edu	37	2	197584364	197584364	+	Silent	SNP	A	A	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:197584364A>T	ENST00000389175.4	+	19	2274	c.2139A>T	c.(2137-2139)tcA>tcT	p.S713S	CCDC150_ENST00000487663.1_3'UTR|CCDC150_ENST00000409270.1_Silent_p.S200S|CCDC150_ENST00000272831.7_Silent_p.S360S	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	713										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GGAGGGATTCAGAGATTGCAG	0.438																																							uc002utp.1		NA																	0					0						c.(2137-2139)TCA>TCT		coiled-coil domain containing 150							92.0	95.0	94.0					2																	197584364		1882	4108	5990	SO:0001819	synonymous_variant	284992							g.chr2:197584364A>T		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.2139A>T	2.37:g.197584364A>T						CCDC150_uc010zgs.1_Silent_p.S360S|CCDC150_uc010zgt.1_Silent_p.S130S|CCDC150_uc002utq.1_Silent_p.S28S|CCDC150_uc002utr.1_Silent_p.S28S	p.S713S	NM_001080539	NP_001074008	Q8NCX0	CC150_HUMAN			19	2274	+			713			Potential.		Q6P5U6|Q6P663|Q8N8V5	Silent	SNP	ENST00000389175.4	37	c.2139A>T	CCDS46478.1																																																																																				0.438	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539		5	18	0	0	0	0.000602	0	5	18				
CDK5R2	8941	broad.mit.edu	37	2	219825610	219825610	+	Silent	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:219825610C>A	ENST00000302625.4	+	1	1234	c.1068C>A	c.(1066-1068)gcC>gcA	p.A356A	AC097468.7_ENST00000429343.1_RNA	NM_003936.4	NP_003927.1	Q13319	CD5R2_HUMAN	cyclin-dependent kinase 5, regulatory subunit 2 (p39)	356					cerebellum development (GO:0021549)|hippocampus development (GO:0021766)|layer formation in cerebral cortex (GO:0021819)|neuron migration (GO:0001764)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|superior olivary nucleus maturation (GO:0021722)	cyclin-dependent protein kinase 5 holoenzyme complex (GO:0016533)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	cyclin-dependent protein kinase 5 activator activity (GO:0016534)|lipid binding (GO:0008289)			central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	8		Renal(207;0.0474)		Epithelial(149;9.77e-07)|all cancers(144;0.000167)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCTGCGCGGCCGGAACCAAGC	0.751																																							uc002vjf.2		NA																	0				ovary(1)	1						c.(1066-1068)GCC>GCA		cyclin-dependent kinase 5, regulatory subunit 2							5.0	5.0	5.0					2																	219825610		1151	2692	3843	SO:0001819	synonymous_variant	8941				regulation of cyclin-dependent protein kinase activity	cyclin-dependent protein kinase 5 holoenzyme complex	cyclin-dependent protein kinase 5 activator activity	g.chr2:219825610C>A	U34051	CCDS2427.1	2q35	2008-05-22			ENSG00000171450	ENSG00000171450			1776	protein-coding gene	gene with protein product	"""neuronal CDK5 activator isoform"""	603764				7592934	Standard	NM_003936		Approved	p39nck5ai, P39, NCK5AI	uc002vjf.4	Q13319	OTTHUMG00000133083	ENST00000302625.4:c.1068C>A	2.37:g.219825610C>A							p.A356A	NM_003936	NP_003927	Q13319	CD5R2_HUMAN		Epithelial(149;9.77e-07)|all cancers(144;0.000167)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	1	1213	+		Renal(207;0.0474)	356					Q4ZFW6	Silent	SNP	ENST00000302625.4	37	c.1068C>A	CCDS2427.1																																																																																				0.751	CDK5R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256728.1	NM_003936		6	9	1	0	0.00116845	0.001168	0.00129476	6	9				
ALPI	248	broad.mit.edu	37	2	233323439	233323439	+	Silent	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr2:233323439C>T	ENST00000295463.3	+	10	1358	c.1281C>T	c.(1279-1281)gaC>gaT	p.D427D		NM_001631.3	NP_001622.2	P09923	PPBI_HUMAN	alkaline phosphatase, intestinal	427					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(2)|upper_aerodigestive_tract(1)	24		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		TGCGACCAGACGTGAATGAGA	0.662																																							uc002vst.3		NA																	0				central_nervous_system(1)	1						c.(1279-1281)GAC>GAT		intestinal alkaline phosphatase precursor							68.0	62.0	64.0					2																	233323439		2203	4300	6503	SO:0001819	synonymous_variant	248				phosphorylation	anchored to membrane|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding|protein binding	g.chr2:233323439C>T	M15694	CCDS2492.1	2q37.1	2008-02-05			ENSG00000163295	ENSG00000163295	3.1.3.1		437	protein-coding gene	gene with protein product		171740				3468508, 3469665	Standard	NM_001631		Approved		uc002vst.4	P09923	OTTHUMG00000133258	ENST00000295463.3:c.1281C>T	2.37:g.233323439C>T						ALPI_uc002vsu.3_Silent_p.D338D	p.D427D	NM_001631	NP_001622	P09923	PPBI_HUMAN		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)	10	1358	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	427					B2R7Y4|Q53S80|Q9UBV5|Q9UCL2	Silent	SNP	ENST00000295463.3	37	c.1281C>T	CCDS2492.1																																																																																				0.662	ALPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257035.2	NM_001631		9	53	0	0	0	0.006214	0	9	53				
SEL1L2	80343	broad.mit.edu	37	20	13847462	13847462	+	Silent	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr20:13847462G>T	ENST00000284951.5	-	15	1364	c.1290C>A	c.(1288-1290)gcC>gcA	p.A430A	SEL1L2_ENST00000378072.5_Silent_p.A430A|SEL1L2_ENST00000486903.1_5'UTR			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	430						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						AATATTTGAAGGCAAGTTTAT	0.368																																							uc010gcf.2		NA																	0				ovary(2)	2						c.(1288-1290)GCC>GCA		sel-1 suppressor of lin-12-like 2 precursor							77.0	74.0	75.0					20																	13847462		1824	4079	5903	SO:0001819	synonymous_variant	80343					integral to membrane	binding	g.chr20:13847462G>T	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.1290C>A	20.37:g.13847462G>T						SEL1L2_uc002woq.3_Silent_p.A291A|SEL1L2_uc010zrl.1_Silent_p.A430A|SEL1L2_uc002wor.2_RNA	p.A430A	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN			15	1372	-			430			Extracellular (Potential).|Sel1-like 8.		B4DXX5	Silent	SNP	ENST00000284951.5	37	c.1290C>A																																																																																					0.368	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078067.3	NM_025229		13	86	1	0	5.50884e-06	0.001368	6.56577e-06	13	86				
CST4	1472	broad.mit.edu	37	20	23667775	23667775	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr20:23667775G>T	ENST00000217423.3	-	2	362	c.292C>A	c.(292-294)Cag>Aag	p.Q98K		NM_001899.2	NP_001890.1	P01036	CYTS_HUMAN	cystatin S	98					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	16	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)					AAGTTGGGCTGGGACTTGGTA	0.582																																							uc002wto.1		NA																	0				breast(1)	1						c.(292-294)CAG>AAG		cystatin S precursor							197.0	173.0	181.0					20																	23667775		2203	4297	6500	SO:0001583	missense	1472					extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr20:23667775G>T		CCDS13159.1	20p11.2	2008-04-15			ENSG00000101441	ENSG00000101441			2476	protein-coding gene	gene with protein product		123857				1801729	Standard	NM_001899		Approved		uc002wto.1	P01036	OTTHUMG00000032083	ENST00000217423.3:c.292C>A	20.37:g.23667775G>T	ENSP00000217423:p.Gln98Lys						p.Q98K	NM_001899	NP_001890	P01036	CYTS_HUMAN			2	348	-	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)		98					Q9UBI5|Q9UCS9	Missense_Mutation	SNP	ENST00000217423.3	37	c.292C>A	CCDS13159.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.276443	0.40294	.	.	ENSG00000101441	ENST00000217423	T	0.13778	2.56	1.94	-0.424	0.12321	Proteinase inhibitor I25, cystatin (2);	1.150700	0.06735	U	0.777301	T	0.22322	0.0538	M	0.86502	2.82	0.09310	N	1	P	0.36959	0.575	B	0.41236	0.351	T	0.30327	-0.9982	10	0.32370	T	0.25	.	4.1522	0.10244	0.0:0.2588:0.4775:0.2637	.	98	P01036	CYTS_HUMAN	K	98	ENSP00000217423:Q98K	ENSP00000217423:Q98K	Q	-	1	0	CST4	23615775	0.014000	0.17966	0.176000	0.23000	0.413000	0.31143	0.034000	0.13776	-0.067000	0.12976	0.205000	0.17691	CAG		0.582	CST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078349.2	NM_001899		21	192	1	0	7.26314e-15	0.007291	1.07894e-14	21	192				
FRG1B	284802	broad.mit.edu	37	20	29624070	29624070	+	Missense_Mutation	SNP	G	G	A	rs113131305	byFrequency	TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr20:29624070G>A	ENST00000278882.3	+	4	474	c.94G>A	c.(94-96)Gct>Act	p.A32T	FRG1B_ENST00000358464.4_Missense_Mutation_p.A32T|FRG1B_ENST00000439954.2_Missense_Mutation_p.A37T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	32								p.A32T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCAGTTTATGGCTGTCAAATT	0.279													.|||	3	0.000599042	0.0	0.0	5008	,	,		18542	0.001		0.002	False		,,,				2504	0.0						uc010ztl.1		NA																	2	Substitution - Missense(2)		kidney(2)		0						c.(4-6)GCT>ACT		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29624070G>A			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.94G>A	20.37:g.29624070G>A	ENSP00000278882:p.Ala32Thr					FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron	p.A2T							1	36	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.4G>A		.	.	.	.	.	.	.	.	.	.	g	13.90	2.374450	0.42105	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.48522	0.81	1.91	1.91	0.25777	.	0.171467	0.50627	D	0.000119	T	0.51601	0.1684	.	.	.	0.43304	D	0.995305	P	0.35894	0.526	P	0.47470	0.548	T	0.56300	-0.8002	9	0.56958	D	0.05	.	9.8627	0.41125	0.0:0.0:1.0:0.0	.	37	F5H5R5	.	T	32;37;32	ENSP00000408863:A37T	ENSP00000278882:A32T	A	+	1	0	FRG1B	28237731	1.000000	0.71417	0.999000	0.59377	0.324000	0.28378	7.759000	0.85235	1.383000	0.46405	0.184000	0.17185	GCT		0.279	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		3	27	0	0	0	0.001168	0	3	27				
FRG1B	284802	broad.mit.edu	37	20	29628300	29628300	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr20:29628300G>A	ENST00000278882.3	+	6	682	c.302G>A	c.(301-303)aGt>aAt	p.S101N	FRG1B_ENST00000358464.4_Missense_Mutation_p.S101N|FRG1B_ENST00000439954.2_Missense_Mutation_p.S106N			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	101								p.S101N(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GAAGCAAAAAGTAAAACAGCA	0.358																																							uc010ztl.1		NA																	2	Substitution - Missense(2)		prostate(2)		0						c.(211-213)AGT>AAT		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29628300G>A			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.302G>A	20.37:g.29628300G>A	ENSP00000278882:p.Ser101Asn					FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.S23N	p.S71N							3	244	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.212G>A		.	.	.	.	.	.	.	.	.	.	g	10.56	1.384968	0.25031	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.49139	0.79	2.08	2.08	0.27032	Actin cross-linking (1);	0.125588	0.64402	N	0.000001	T	0.33265	0.0857	.	.	.	0.40357	D	0.979199	B;B	0.16802	0.003;0.019	B;B	0.16289	0.007;0.015	T	0.20605	-1.0270	9	0.33940	T	0.23	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	106;101	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	N	101;106;101	ENSP00000408863:S106N	ENSP00000278882:S101N	S	+	2	0	FRG1B	28241961	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	2.004000	0.40854	1.475000	0.48197	0.423000	0.28283	AGT		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		4	91	0	0	0	0.009096	0	4	91				
PHF20	51230	broad.mit.edu	37	20	34526674	34526674	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr20:34526674G>T	ENST00000374012.3	+	16	2485	c.2356G>T	c.(2356-2358)Ggg>Tgg	p.G786W	PHF20_ENST00000439301.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	786					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					ACAGCACTCAGGGGAGGGGAG	0.547																																							uc002xek.1		NA																	0				ovary(1)	1						c.(2356-2358)GGG>TGG		PHD finger protein 20							101.0	102.0	102.0					20																	34526674		2203	4300	6503	SO:0001583	missense	51230				regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding	g.chr20:34526674G>T	AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.2356G>T	20.37:g.34526674G>T	ENSP00000363124:p.Gly786Trp						p.G786W	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN			16	2467	+	Breast(12;0.00631)|all_lung(11;0.0145)		786					A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	c.2356G>T	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.585016	0.66105	.	.	ENSG00000025293	ENST00000374012	T	0.31769	1.48	5.87	4.92	0.64577	.	0.337533	0.39475	N	0.001351	T	0.34571	0.0902	L	0.38175	1.15	0.80722	D	1	D	0.59767	0.986	P	0.49752	0.621	T	0.13442	-1.0509	10	0.59425	D	0.04	.	15.2083	0.73198	0.0675:0.0:0.9325:0.0	.	786	Q9BVI0	PHF20_HUMAN	W	786	ENSP00000363124:G786W	ENSP00000363124:G786W	G	+	1	0	PHF20	33990088	0.997000	0.39634	0.998000	0.56505	0.941000	0.58515	2.801000	0.47908	1.616000	0.50265	0.655000	0.94253	GGG		0.547	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436		15	132	1	0	1.52009e-12	0.003163	2.14909e-12	15	132				
PTPRT	11122	broad.mit.edu	37	20	40944458	40944458	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr20:40944458C>A	ENST00000373187.1	-	12	2043	c.2044G>T	c.(2044-2046)Ggt>Tgt	p.G682C	PTPRT_ENST00000373193.3_Missense_Mutation_p.G682C|PTPRT_ENST00000373184.1_Missense_Mutation_p.G682C|PTPRT_ENST00000373190.1_Missense_Mutation_p.G682C|PTPRT_ENST00000356100.2_Missense_Mutation_p.G682C|PTPRT_ENST00000373201.1_Missense_Mutation_p.G682C|PTPRT_ENST00000373198.4_Missense_Mutation_p.G682C			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	682	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TTATTGTCACCCACTGTAAAT	0.517																																							uc002xkg.2		NA																	0				skin(8)|ovary(7)|lung(5)	20						c.(2044-2046)GGT>TGT		protein tyrosine phosphatase, receptor type, T							122.0	121.0	121.0					20																	40944458		1980	4138	6118	SO:0001583	missense	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:40944458C>A	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2044G>T	20.37:g.40944458C>A	ENSP00000362283:p.Gly682Cys					PTPRT_uc010ggj.2_Missense_Mutation_p.G682C	p.G682C	NM_007050	NP_008981	O14522	PTPRT_HUMAN			12	2228	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	682			Extracellular (Potential).|Fibronectin type-III 4.		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	c.2044G>T	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799122	0.90538	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;D;D;T;T	0.86366	-0.77;-0.77;-0.78;-2.11;-2.01;-0.78;-0.83	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.94644	0.8273	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95052	0.8188	10	0.87932	D	0	.	19.5559	0.95347	0.0:1.0:0.0:0.0	.	682;682	O14522-1;O14522	.;PTPRT_HUMAN	C	682	ENSP00000362286:G682C;ENSP00000362283:G682C;ENSP00000362289:G682C;ENSP00000348408:G682C;ENSP00000362294:G682C;ENSP00000362280:G682C;ENSP00000362297:G682C	ENSP00000348408:G682C	G	-	1	0	PTPRT	40377872	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.788000	0.85771	2.624000	0.88883	0.563000	0.77884	GGT		0.517	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			15	106	1	0	2.48551e-13	0.00499	3.63949e-13	15	106				
EEF1A2	1917	broad.mit.edu	37	20	62122063	62122063	+	Silent	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr20:62122063C>A	ENST00000298049.7	-	5	868	c.798G>T	c.(796-798)cgG>cgT	p.R266R	EEF1A2_ENST00000217182.3_Silent_p.R266R			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	266					positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			CGGTCTCCACCCGGCCCACGG	0.662																																							uc002yfd.1		NA																	0					0						c.(796-798)CGG>CGT		eukaryotic translation elongation factor 1 alpha							27.0	29.0	28.0					20																	62122063		2193	4286	6479	SO:0001819	synonymous_variant	1917					nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity	g.chr20:62122063C>A	AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.798G>T	20.37:g.62122063C>A						EEF1A2_uc002yfe.1_Silent_p.R266R|EEF1A2_uc010gkg.1_Silent_p.R266R	p.R266R	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	BRCA - Breast invasive adenocarcinoma(10;1.22e-05)		5	899	-	all_cancers(38;9.45e-12)		266					B5BUF3|E1P5J1|P54266|Q0VGC7	Silent	SNP	ENST00000298049.7	37	c.798G>T	CCDS13522.1																																																																																				0.662	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080495.1	NM_001958		10	48	1	0	1.08611e-07	0.010729	1.34941e-07	10	48				
BAGE2	85319	broad.mit.edu	37	21	11049593	11049593	+	RNA	SNP	G	G	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr21:11049593G>C	ENST00000470054.1	-	0	515							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CCGGGCTGTCGCACACTGCAC	0.383																																							uc002yit.1		NA																	0					0						c.(307-309)GCG>GGG		B melanoma antigen family, member 2 precursor							74.0	59.0	64.0					21																	11049593		692	1591	2283			85319							g.chr21:11049593G>C	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11049593G>C							p.A103G	NM_182482	NP_872288			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	4	516	-								A8K925|Q08ER0	Missense_Mutation	SNP	ENST00000470054.1	37	c.308C>G																																																																																					0.383	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482		4	177	0	0	0	0.00308	0	4	177				
PFKL	5211	broad.mit.edu	37	21	45741641	45741641	+	Silent	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr21:45741641G>T	ENST00000349048.4	+	13	1276	c.1221G>T	c.(1219-1221)gtG>gtT	p.V407V	PFKL_ENST00000403390.1_Silent_p.V454V	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver	407	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		TCCTGAATGTGGGGGCCCCGG	0.642																																							uc002zel.2		NA																	0					0						c.(1219-1221)GTG>GTT		liver phosphofructokinase							48.0	53.0	51.0					21																	45741641		2202	4300	6502	SO:0001819	synonymous_variant	5211				fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding	g.chr21:45741641G>T		CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.1221G>T	21.37:g.45741641G>T						PFKL_uc002zek.2_Silent_p.V454V|PFKL_uc002zem.2_5'UTR|PFKL_uc002zen.2_5'UTR	p.V407V	NM_002626	NP_002617	P17858	K6PL_HUMAN		Colorectal(79;0.0811)	13	1280	+			407					Q96A64|Q96IH4|Q9BR91	Silent	SNP	ENST00000349048.4	37	c.1221G>T	CCDS33582.1																																																																																				0.642	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195805.1			4	46	1	0	0.00024832	0.009096	0.000285987	4	46				
PFKL	5211	broad.mit.edu	37	21	45741647	45741647	+	Silent	SNP	C	C	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr21:45741647C>G	ENST00000349048.4	+	13	1282	c.1227C>G	c.(1225-1227)gcC>gcG	p.A409A	PFKL_ENST00000403390.1_Silent_p.A456A	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver	409	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		ATGTGGGGGCCCCGGCGGCTG	0.642																																							uc002zel.2		NA																	0					0						c.(1225-1227)GCC>GCG		liver phosphofructokinase							49.0	54.0	53.0					21																	45741647		2202	4300	6502	SO:0001819	synonymous_variant	5211				fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding	g.chr21:45741647C>G		CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.1227C>G	21.37:g.45741647C>G						PFKL_uc002zek.2_Silent_p.A456A|PFKL_uc002zem.2_5'UTR|PFKL_uc002zen.2_5'UTR	p.A409A	NM_002626	NP_002617	P17858	K6PL_HUMAN		Colorectal(79;0.0811)	13	1286	+			409					Q96A64|Q96IH4|Q9BR91	Silent	SNP	ENST00000349048.4	37	c.1227C>G	CCDS33582.1																																																																																				0.642	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195805.1			5	47	0	0	0	0.000602	0	5	47				
PPARG	5468	broad.mit.edu	37	3	12434185	12434185	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr3:12434185A>G	ENST00000287820.6	+	4	674	c.553A>G	c.(553-555)Aaa>Gaa	p.K185E	PPARG_ENST00000397010.2_Missense_Mutation_p.K157E|PPARG_ENST00000397015.2_Missense_Mutation_p.K157E|PPARG_ENST00000397000.1_Missense_Mutation_p.K157E|PPARG_ENST00000397026.2_Missense_Mutation_p.K163E|PPARG_ENST00000397012.2_Missense_Mutation_p.K157E|PPARG_ENST00000539812.1_Missense_Mutation_p.K155E|PPARG_ENST00000309576.6_Missense_Mutation_p.K157E	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	185					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	GATCCACAAAAAAAGTAGAAA	0.363			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																																uc003bwx.2		NA		Dom	yes		3	3p25	5468	T	"""peroxisome proliferative activated receptor, gamma"""	yes	Insulin resistance ; lipodystrophy|familial partial L;diabetes mellitus|insulin-resistantI|with acanthosis nigricans and hypertension	E	PAX8		follicular thyroid		0				ovary(1)|kidney(1)	2						c.(553-555)AAA>GAA		peroxisome proliferative activated receptor	Atorvastatin(DB01076)|Icosapent(DB00159)|Pioglitazone(DB01132)|Rosiglitazone(DB00412)|Troglitazone(DB00197)						102.0	103.0	103.0					3																	12434185		2203	4300	6503	SO:0001583	missense	5468				activation of caspase activity|cell fate commitment|cell maturation|cellular response to insulin stimulus|epithelial cell differentiation|glucose homeostasis|induction of apoptosis|innate immune response|lipid homeostasis|lipoprotein transport|long-chain fatty acid transport|low-density lipoprotein particle receptor biosynthetic process|monocyte differentiation|negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|placenta development|positive regulation of fat cell differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to lipid|response to low-density lipoprotein particle stimulus|white fat cell differentiation	cytosol|nucleoplasm	activating transcription factor binding|arachidonic acid binding|drug binding|enzyme binding|prostaglandin receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr3:12434185A>G	X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.553A>G	3.37:g.12434185A>G	ENSP00000287820:p.Lys185Glu					PPARG_uc003bwr.2_Missense_Mutation_p.K157E|PPARG_uc003bws.2_Missense_Mutation_p.K157E|PPARG_uc003bwu.2_Missense_Mutation_p.K157E|PPARG_uc003bwv.2_Missense_Mutation_p.K157E|PPARG_uc010hea.1_RNA|PPARG_uc003bwq.1_Missense_Mutation_p.K157E|PPARG_uc003bwt.1_Missense_Mutation_p.K157E|PPARG_uc003bww.1_Missense_Mutation_p.K185E	p.K185E	NM_015869	NP_056953	P37231	PPARG_HUMAN			4	644	+			185			NR C4-type.|Nuclear receptor.		A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Missense_Mutation	SNP	ENST00000287820.6	37	c.553A>G	CCDS2609.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.229583	0.79688	.	.	ENSG00000132170	ENST00000397010;ENST00000309576;ENST00000397015;ENST00000397012;ENST00000397026;ENST00000397000;ENST00000539812;ENST00000287820	D;D;D;D;D;D;D;D	0.97209	-4.29;-4.29;-4.29;-4.29;-4.29;-4.29;-4.29;-4.29	5.57	5.57	0.84162	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.94009	0.8081	N	0.21508	0.67	0.80722	D	1	P;P;P	0.43885	0.82;0.622;0.82	B;B;B	0.41466	0.358;0.224;0.358	D	0.94707	0.7888	10	0.59425	D	0.04	.	15.7245	0.77743	1.0:0.0:0.0:0.0	.	185;171;157	P37231;Q4W4C7;E9PFX5	PPARG_HUMAN;.;.	E	157;157;157;157;163;157;155;185	ENSP00000380205:K157E;ENSP00000312472:K157E;ENSP00000380210:K157E;ENSP00000380207:K157E;ENSP00000380221:K163E;ENSP00000380196:K157E;ENSP00000438940:K155E;ENSP00000287820:K185E	ENSP00000287820:K185E	K	+	1	0	PPARG	12409185	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.303000	0.96183	2.106000	0.64143	0.402000	0.26972	AAA		0.363	PPARG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251979.2	NM_005037		8	55	0	0	0	0.004482	0	8	55				
CX3CR1	1524	broad.mit.edu	37	3	39307265	39307265	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr3:39307265G>A	ENST00000541347.1	-	2	975	c.736C>T	c.(736-738)Ccc>Tcc	p.P246S	CX3CR1_ENST00000358309.3_Missense_Mutation_p.P278S|CX3CR1_ENST00000399220.2_Missense_Mutation_p.P246S|CX3CR1_ENST00000542107.1_Missense_Mutation_p.P246S	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	246					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)			endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		ACGTTGTAGGGTGTCCAGAAG	0.468																																							uc003cjl.2		NA																	0				lung(3)	3						c.(736-738)CCC>TCC		chemokine (C-X3-C motif) receptor 1							112.0	115.0	114.0					3																	39307265		1926	4134	6060	SO:0001583	missense	1524				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity	g.chr3:39307265G>A	BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.736C>T	3.37:g.39307265G>A	ENSP00000439140:p.Pro246Ser						p.P246S	NM_001337	NP_001328	P49238	CX3C1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)	2	828	-			246			Helical; Name=6; (Potential).		A0N0N6|B2R5Z4|J3KP17	Missense_Mutation	SNP	ENST00000541347.1	37	c.736C>T	CCDS43069.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765495	0.90020	.	.	ENSG00000168329	ENST00000399220;ENST00000538756;ENST00000358309;ENST00000541347;ENST00000542107	T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36	5.77	5.77	0.91146	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.93822	0.8024	H	0.97758	4.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95512	0.8587	10	0.87932	D	0	.	18.5474	0.91052	0.0:0.0:1.0:0.0	.	246	P49238	CX3C1_HUMAN	S	246;254;278;246;246	ENSP00000382166:P246S;ENSP00000351059:P278S;ENSP00000439140:P246S;ENSP00000444928:P246S	ENSP00000351059:P278S	P	-	1	0	CX3CR1	39282269	1.000000	0.71417	0.843000	0.33291	0.931000	0.56810	9.790000	0.99075	2.726000	0.93360	0.655000	0.94253	CCC		0.468	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343613.1	NM_001337		13	40	0	0	0	0.001368	0	13	40				
MITF	4286	broad.mit.edu	37	3	69987131	69987132	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr3:69987131_69987132GG>TT	ENST00000448226.2	+	3	640_641	c.513_514GG>TT	c.(511-516)ccGGtg>ccTTtg	p.V172L	MITF_ENST00000394348.1_3'UTR|MITF_ENST00000352241.4_Missense_Mutation_p.V172L|MITF_ENST00000394351.3_Missense_Mutation_p.V65L|MITF_ENST00000394355.2_Missense_Mutation_p.V147L|MITF_ENST00000314589.5_Missense_Mutation_p.V156L|MITF_ENST00000531774.1_Intron|MITF_ENST00000328528.6_Missense_Mutation_p.V171L|MITF_ENST00000314557.6_Missense_Mutation_p.V65L|MITF_ENST00000472437.1_Missense_Mutation_p.V120L			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	172					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		TCATGCCACCGGTGCCGGGGAG	0.505			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														Melanoma(29;269 969 31479 41502 42961)	Melanoma(29;269 969 31479 41502 42961)	uc003dnz.2		NA		Dom	yes		3	3p14.1	4286	A	microphthalmia-associated transcription factor	yes	Waardenburg syndrome type 2|Tietz syndrome	E			melanoma 		0				ovary(2)	2						c.(511-516)CCGGTG>CCTTTG		microphthalmia-associated transcription factor																																				SO:0001583	missense	4286				melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription	g.chr3:69987131_69987132GG>TT		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	Exception_encountered	3.37:g.69987131_69987132delinsTT	ENSP00000391803:p.Val172Leu					MITF_uc011bgb.1_Missense_Mutation_p.V120L|MITF_uc003doa.2_Missense_Mutation_p.V171L|MITF_uc003dob.2_Missense_Mutation_p.V156L|MITF_uc003dod.2_Missense_Mutation_p.V147L|MITF_uc003doe.2_Missense_Mutation_p.V65L|MITF_uc003dof.2_Missense_Mutation_p.V65L	p.V172L	NM_198159	NP_937802	O75030	MITF_HUMAN		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)	3	629_630	+		Lung NSC(201;0.0384)|Prostate(884;0.0526)	172					B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Missense_Mutation	DNP	ENST00000448226.2	37	c.513_514GG>TT																																																																																					0.505	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159		11	57	0	0	0	0.004672	0	11	57				
MORC1	27136	broad.mit.edu	37	3	108829596	108829596	+	Splice_Site	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr3:108829596C>A	ENST00000483760.1	-	3	197	c.154G>T	c.(154-156)Gtg>Ttg	p.V52L	MORC1_ENST00000232603.5_Splice_Site_p.V52L|MORC1-AS1_ENST00000480826.1_RNA					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						ATCTGCTCACCTGAAAAGACA	0.294																																							uc003dxl.2		NA																	0				ovary(3)|skin(3)|breast(2)	8						c.(154-156)GTG>TTG		MORC family CW-type zinc finger 1							47.0	49.0	48.0					3																	108829596		2202	4300	6502	SO:0001630	splice_region_variant	27136				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding	g.chr3:108829596C>A	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.154+1G>T	3.37:g.108829596C>A						MORC1_uc011bhn.1_Missense_Mutation_p.V52L	p.V52L	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN			3	241	-			52						Missense_Mutation	SNP	ENST00000483760.1	37	c.154G>T		.	.	.	.	.	.	.	.	.	.	C	18.13	3.554255	0.65425	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	D;D	0.94828	-3.53;-3.53	5.05	5.05	0.67936	ATPase-like, ATP-binding domain (3);	0.146657	0.32093	N	0.006593	D	0.94115	0.8113	L	0.28014	0.82	0.33867	D	0.6345	D;B	0.71674	0.998;0.115	D;B	0.67548	0.952;0.345	D	0.94668	0.7854	9	.	.	.	-15.3712	13.7753	0.63050	0.0:1.0:0.0:0.0	.	52;52	E7ERX1;Q86VD1	.;MORC1_HUMAN	L	52	ENSP00000232603:V52L;ENSP00000417282:V52L	.	V	-	1	0	MORC1	110312286	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.683000	0.54663	2.619000	0.88677	0.563000	0.77884	GTG		0.294	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		Missense_Mutation	3	18	1	0	0.00024832	0.009096	0.000285987	3	18				
PARP14	54625	broad.mit.edu	37	3	122437576	122437576	+	Silent	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr3:122437576C>A	ENST00000474629.2	+	14	4844	c.4578C>A	c.(4576-4578)tcC>tcA	p.S1526S	PARP14_ENST00000475640.1_3'UTR	NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1526	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		AACAGGAATCCCGGGCAGATT	0.383																																							uc003efq.3		NA																	0				ovary(2)|breast(2)|lung(1)|pancreas(1)	6						c.(4576-4578)TCC>TCA		poly (ADP-ribose) polymerase family, member 14							194.0	191.0	192.0					3																	122437576		1876	4120	5996	SO:0001819	synonymous_variant	54625				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity	g.chr3:122437576C>A	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.4578C>A	3.37:g.122437576C>A						PARP14_uc010hrk.2_RNA|PARP14_uc003efr.2_Silent_p.S1243S|PARP14_uc003efs.1_Silent_p.S1243S	p.S1526S	NM_017554	NP_060024	Q460N5	PAR14_HUMAN		GBM - Glioblastoma multiforme(114;0.0531)	14	4637	+			1526			WWE.		B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	ENST00000474629.2	37	c.4578C>A	CCDS46894.1																																																																																				0.383	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554		45	116	1	0	2.13384e-23	0.00361	3.289e-23	45	116				
PLSCR5	389158	broad.mit.edu	37	3	146309535	146309535	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr3:146309535C>T	ENST00000443512.1	-	5	1590	c.587G>A	c.(586-588)tGt>tAt	p.C196Y	PLSCR5-AS1_ENST00000473817.1_RNA|PLSCR5_ENST00000492200.1_Missense_Mutation_p.C196Y|PLSCR5_ENST00000482567.1_Missense_Mutation_p.C184Y	NM_001085420.1	NP_001078889.1	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5	196										endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						AAAACAGCCACATGTCACACA	0.348																																							uc003ewb.2		NA																	0					0						c.(586-588)TGT>TAT		phospholipid scramblase family, member 5							62.0	61.0	61.0					3																	146309535		1884	4110	5994	SO:0001583	missense	389158							g.chr3:146309535C>T	AY436642	CCDS46931.1	3q24	2004-06-28			ENSG00000231213	ENSG00000231213			19952	protein-coding gene	gene with protein product							Standard	NM_001085420		Approved		uc010hvc.3	A0PG75	OTTHUMG00000159437	ENST00000443512.1:c.587G>A	3.37:g.146309535C>T	ENSP00000390111:p.Cys196Tyr					PLSCR5_uc010hvb.2_Missense_Mutation_p.C184Y|PLSCR5_uc010hvc.2_Missense_Mutation_p.C196Y	p.C196Y	NM_001085420	NP_001078889	A0PG75	PLS5_HUMAN			5	1591	-			196					B2RXK5	Missense_Mutation	SNP	ENST00000443512.1	37	c.587G>A	CCDS46931.1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.835618	0.50951	.	.	ENSG00000231213	ENST00000492200;ENST00000482567;ENST00000443512	T;T;T	0.22945	1.93;1.93;1.93	5.68	4.81	0.61882	Tubby, C-terminal (1);	.	.	.	.	T	0.54886	0.1886	M	0.86864	2.845	0.35866	D	0.827897	B;D	0.67145	0.018;0.996	B;D	0.72625	0.037;0.978	T	0.69007	-0.5259	9	0.41790	T	0.15	-11.4468	14.4888	0.67637	0.0:0.9298:0.0:0.0702	.	184;196	B2RXK5;A0PG75	.;PLS5_HUMAN	Y	196;184;196	ENSP00000417184:C196Y;ENSP00000418626:C184Y;ENSP00000390111:C196Y	ENSP00000390111:C196Y	C	-	2	0	PLSCR5	147792225	1.000000	0.71417	0.870000	0.34147	0.989000	0.77384	5.579000	0.67457	1.420000	0.47138	0.655000	0.94253	TGT		0.348	PLSCR5-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355365.1	XM_371670		4	23	0	0	0	0.001168	0	4	23				
ABCF3	55324	broad.mit.edu	37	3	183906908	183906908	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr3:183906908C>G	ENST00000429586.2	+	10	1195	c.1010C>G	c.(1009-1011)gCc>gGc	p.A337G	ABCF3_ENST00000292808.5_Missense_Mutation_p.A331G|EIF2B5_ENST00000444495.1_Intron	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	337	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ATGAGGCTGGCCCTGGCCCGG	0.562																																							uc003fmz.2		NA																	0				ovary(3)|lung(1)	4						c.(1009-1011)GCC>GGC		ATP-binding cassette, sub-family F (GCN20),							51.0	53.0	52.0					3																	183906908		2203	4300	6503	SO:0001583	missense	55324						ATP binding|ATPase activity	g.chr3:183906908C>G	U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1010C>G	3.37:g.183906908C>G	ENSP00000411471:p.Ala337Gly					ABCF3_uc003fna.2_Missense_Mutation_p.A331G|ABCF3_uc003fnb.2_Missense_Mutation_p.A18G	p.A337G	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		10	1143	+	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		337			ABC transporter 1.		A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	ENST00000429586.2	37	c.1010C>G	CCDS3254.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.796609	0.90453	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.94576	-3.46;-3.46	5.32	5.32	0.75619	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96719	0.8929	M	0.64170	1.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.97158	0.9836	10	0.72032	D	0.01	-15.2561	17.9901	0.89166	0.0:1.0:0.0:0.0	.	331;337	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	G	337;331	ENSP00000411471:A337G;ENSP00000292808:A331G	ENSP00000292808:A331G	A	+	2	0	ABCF3	185389602	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.315000	0.65810	2.490000	0.84030	0.563000	0.77884	GCC		0.562	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346047.1	NM_018358		8	20	0	0	0	0.006214	0	8	20				
CTBP1	1487	broad.mit.edu	37	4	1206787	1206787	+	Silent	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr4:1206787G>A	ENST00000290921.6	-	8	1234	c.1053C>T	c.(1051-1053)gtC>gtT	p.V351V	CTBP1_ENST00000382952.3_Silent_p.V340V	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1	351	Interaction with GLIS2 2. {ECO:0000250}.				Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		GGTCCTTGTTGACACAGTTCT	0.652																																							uc003gcv.1		NA																	0				ovary(1)	1						c.(1051-1053)GTC>GTT		C-terminal binding protein 1 isoform 1							103.0	98.0	100.0					4																	1206787		2203	4300	6503	SO:0001819	synonymous_variant	1487				interspecies interaction between organisms|negative regulation of cell proliferation|negative regulation of histone H4 acetylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|protein phosphorylation|regulation of cell cycle|regulation of transcription by chromatin organization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|viral genome replication|white fat cell differentiation	cytoplasm|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein C-terminus binding|protein domain specific binding|transcription factor binding	g.chr4:1206787G>A	U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259	ENST00000290921.6:c.1053C>T	4.37:g.1206787G>A						uc003gcs.1_Intron|CTBP1_uc003gct.1_Silent_p.V332V|CTBP1_uc003gcu.1_Silent_p.V340V|CTBP1_uc003gcw.2_Silent_p.V25V	p.V351V	NM_001328	NP_001319	Q13363	CTBP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)	8	1218	-			351			Interaction with GLIS2 2 (By similarity).		Q4W5N3|Q7Z2Q5	Silent	SNP	ENST00000290921.6	37	c.1053C>T	CCDS3348.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.752064	0.31046	.	.	ENSG00000159692	ENST00000503594;ENST00000504092	.	.	.	4.57	-1.9	0.07665	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-55.5137	8.742	0.34562	0.1301:0.6047:0.2652:0.0	.	.	.	.	X	94;198	.	.	Q	-	1	0	CTBP1	1196787	0.982000	0.34865	0.991000	0.47740	0.968000	0.65278	0.212000	0.17497	-0.265000	0.09352	0.561000	0.74099	CAA		0.652	CTBP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000202938.1	NM_001328		8	97	0	0	0	0.006214	0	8	97				
ZCCHC4	29063	broad.mit.edu	37	4	25351193	25351193	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr4:25351193G>C	ENST00000302874.4	+	7	863	c.839G>C	c.(838-840)gGt>gCt	p.G280A	ZCCHC4_ENST00000505451.1_3'UTR	NM_024936.2	NP_079212.2	Q9H5U6	ZCHC4_HUMAN	zinc finger, CCHC domain containing 4	280							methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)	9		Breast(46;0.0503)				CCTCCGTTTGGTGGCTTGGTT	0.373																																							uc003grl.3		NA																	0				ovary(2)	2						c.(838-840)GGT>GCT		zinc finger, CCHC domain containing 4							196.0	188.0	190.0					4																	25351193		1879	4096	5975	SO:0001583	missense	29063						methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr4:25351193G>C	AF161537	CCDS43218.1	4p15.31	2014-02-18			ENSG00000168228	ENSG00000168228		"""Zinc fingers, CCHC domain containing"""	22917	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 4"""	611792				11042152	Standard	NM_024936		Approved	HSPC052, FLJ23024, ZGRF4	uc003grl.4	Q9H5U6	OTTHUMG00000160563	ENST00000302874.4:c.839G>C	4.37:g.25351193G>C	ENSP00000303468:p.Gly280Ala					ZCCHC4_uc003grm.1_RNA|ZCCHC4_uc003grn.3_Missense_Mutation_p.G46A	p.G280A	NM_024936	NP_079212	Q9H5U6	ZCHC4_HUMAN			7	875	+		Breast(46;0.0503)	280					B2RXF6|B4DRD8|B7ZW20|Q5IW78|Q96AN7	Missense_Mutation	SNP	ENST00000302874.4	37	c.839G>C	CCDS43218.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.8|21.8	4.202851|4.202851	0.79127|0.79127	.|.	.|.	ENSG00000168228|ENSG00000168228	ENST00000302874|ENST00000505412	T|.	0.47177|.	0.85|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.098468|.	0.64402|.	D|.	0.000001|.	T|T	0.76147|0.76147	0.3947|0.3947	M|M	0.77486|0.77486	2.375|2.375	0.52501|0.52501	D|D	0.99995|0.99995	D|.	0.89917|.	1.0|.	D|.	0.78314|.	0.991|.	T|T	0.76790|0.76790	-0.2829|-0.2829	10|5	0.87932|.	D|.	0|.	-13.152|-13.152	16.0971|16.0971	0.81132|0.81132	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	280|.	Q9H5U6|.	ZCHC4_HUMAN|.	A|C	280|144	ENSP00000303468:G280A|.	ENSP00000303468:G280A|.	G|W	+|+	2|3	0|0	ZCCHC4|ZCCHC4	24960291|24960291	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.071000|7.071000	0.76770|0.76770	2.520000|2.520000	0.84964|0.84964	0.655000|0.655000	0.94253|0.94253	GGT|TGG		0.373	ZCCHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361151.1			3	158	0	0	0	0.004672	0	3	158				
GUF1	60558	broad.mit.edu	37	4	44687997	44687997	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr4:44687997A>G	ENST00000281543.5	+	7	885	c.691A>G	c.(691-693)Aat>Gat	p.N231D	GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						ACTTGGAACAAATGTTGAGAG	0.313																																							uc003gww.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(691-693)AAT>GAT		GUF1 GTPase homolog							128.0	132.0	131.0					4																	44687997		2203	4298	6501	SO:0001583	missense	60558				translation	mitochondrial inner membrane	GTP binding|GTPase activity	g.chr4:44687997A>G		CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.691A>G	4.37:g.44687997A>G	ENSP00000281543:p.Asn231Asp					GUF1_uc010ifz.1_RNA	p.N231D	NM_021927	NP_068746	Q8N442	GUF1_HUMAN			7	898	+			231						Missense_Mutation	SNP	ENST00000281543.5	37	c.691A>G	CCDS3468.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.849533	0.91277	.	.	ENSG00000151806	ENST00000281543	T	0.28895	1.59	5.72	5.72	0.89469	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	T	0.49712	0.1573	M	0.64170	1.965	0.80722	D	1	D	0.58970	0.984	P	0.59703	0.862	T	0.51919	-0.8644	10	0.87932	D	0	-25.0855	15.1683	0.72846	1.0:0.0:0.0:0.0	.	231	Q8N442	GUF1_HUMAN	D	231	ENSP00000281543:N231D	ENSP00000281543:N231D	N	+	1	0	GUF1	44382754	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.837000	0.92110	2.169000	0.68431	0.460000	0.39030	AAT		0.313	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250469.3	NM_021927		6	68	0	0	0	0.004482	0	6	68				
CWH43	80157	broad.mit.edu	37	4	49052739	49052739	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr4:49052739G>A	ENST00000226432.4	+	15	2077	c.1894G>A	c.(1894-1896)Gaa>Aaa	p.E632K	CWH43_ENST00000513409.1_Missense_Mutation_p.E605K	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	632					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						CTCCCATGCTGAACTGAGTGA	0.383																																							uc003gyv.2		NA																	0				skin(2)|ovary(1)	3						c.(1894-1896)GAA>AAA		cell wall biogenesis 43 C-terminal homolog							94.0	94.0	94.0					4																	49052739		2203	4300	6503	SO:0001583	missense	80157				GPI anchor biosynthetic process	integral to membrane		g.chr4:49052739G>A		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1894G>A	4.37:g.49052739G>A	ENSP00000226432:p.Glu632Lys					CWH43_uc011bzl.1_Missense_Mutation_p.E605K	p.E632K	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN			15	2076	+			632					B2RPD7	Missense_Mutation	SNP	ENST00000226432.4	37	c.1894G>A	CCDS3486.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.105758	0.37145	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.42513	1.55;0.97	5.13	3.37	0.38596	Endonuclease/exonuclease/phosphatase (1);	0.929083	0.09043	N	0.856948	T	0.32164	0.0820	L	0.29908	0.895	0.23903	N	0.99652	B	0.26547	0.152	B	0.29785	0.107	T	0.30031	-0.9992	9	.	.	.	.	8.5515	0.33455	0.0798:0.2903:0.63:0.0	.	632	Q9H720	PG2IP_HUMAN	K	632;605	ENSP00000226432:E632K;ENSP00000422802:E605K	.	E	+	1	0	CWH43	48747496	0.988000	0.35896	0.833000	0.33012	0.852000	0.48524	1.735000	0.38176	0.826000	0.34661	0.655000	0.94253	GAA		0.383	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087		7	78	0	0	0	0.004482	0	7	78				
EPHA5	2044	broad.mit.edu	37	4	66467836	66467836	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr4:66467836C>T	ENST00000273854.3	-	3	1033	c.433G>A	c.(433-435)Ggg>Agg	p.G145R	EPHA5_ENST00000432638.2_Missense_Mutation_p.G145R|EPHA5_ENST00000511294.1_Missense_Mutation_p.G145R|EPHA5_ENST00000354839.4_Missense_Mutation_p.G145R	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	145	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TTACAGGTCCCCAGTCCTCCA	0.423										TSP Lung(17;0.13)																													uc003hcy.2		NA																	0				lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(433-435)GGG>AGG		ephrin receptor EphA5 isoform a precursor							72.0	75.0	74.0					4																	66467836		2203	4300	6503	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66467836C>T	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.433G>A	4.37:g.66467836C>T	ENSP00000273854:p.Gly145Arg	TSP Lung(17;0.13)				EPHA5_uc003hcx.2_Missense_Mutation_p.G76R|EPHA5_uc003hcz.2_Missense_Mutation_p.G145R|EPHA5_uc011cah.1_Missense_Mutation_p.G145R|EPHA5_uc011cai.1_Missense_Mutation_p.G145R|EPHA5_uc003hda.2_Missense_Mutation_p.G145R	p.G145R	NM_004439	NP_004430	P54756	EPHA5_HUMAN			3	626	-			145			Extracellular (Potential).		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.433G>A	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.678092	0.88542	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.03689	3.84;3.84;3.84;3.84	5.68	5.68	0.88126	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000006	T	0.16811	0.0404	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.996	T	0.00098	-1.2069	10	0.44086	T	0.13	.	19.7821	0.96420	0.0:1.0:0.0:0.0	.	145;145;145;145	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	R	145	ENSP00000273854:G145R;ENSP00000389208:G145R;ENSP00000346899:G145R;ENSP00000427638:G145R	ENSP00000273854:G145R	G	-	1	0	EPHA5	66150431	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.803000	0.85983	2.682000	0.91365	0.655000	0.94253	GGG		0.423	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		15	52	0	0	0	0.003163	0	15	52				
MRPS18C	51023	broad.mit.edu	37	4	84377294	84377294	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr4:84377294G>A	ENST00000295491.4	+	1	177	c.64G>A	c.(64-66)Gct>Act	p.A22T	HELQ_ENST00000295488.3_5'Flank|HELQ_ENST00000510985.1_5'Flank|MRPS18C_ENST00000507019.1_Missense_Mutation_p.A22T|MRPS18C_ENST00000507349.1_Missense_Mutation_p.A22T|HELQ_ENST00000440639.2_5'Flank	NM_016067.2	NP_057151.1	Q9Y3D5	RT18C_HUMAN	mitochondrial ribosomal protein S18C	22					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5		Hepatocellular(203;0.114)				CTTGGTAACGGCTGCTGTCAG	0.512																																							uc003hor.3		NA																	0					0						c.(64-66)GCT>ACT		mitochondrial ribosomal protein S18C precursor							161.0	161.0	161.0					4																	84377294		2203	4300	6503	SO:0001583	missense	51023				translation	mitochondrial small ribosomal subunit	structural constituent of ribosome	g.chr4:84377294G>A		CCDS3604.1, CCDS75159.1	4q21.21-q21.23	2012-09-13			ENSG00000163319	ENSG00000163319		"""Mitochondrial ribosomal proteins / small subunits"""	16633	protein-coding gene	gene with protein product		611983				11279123, 10810093	Standard	XM_005263043		Approved	MRPS18-1, CGI-134, FLJ11146, FLJ22967	uc003hor.4	Q9Y3D5	OTTHUMG00000130430	ENST00000295491.4:c.64G>A	4.37:g.84377294G>A	ENSP00000295491:p.Ala22Thr					HELQ_uc003hom.2_5'Flank|HELQ_uc010ikb.2_5'Flank|HELQ_uc003hol.3_5'Flank|HELQ_uc010ikc.2_5'Flank|HELQ_uc003hon.1_5'Flank|HELQ_uc003hoo.1_5'Flank|HELQ_uc003hop.1_5'Flank|HELQ_uc003hoq.1_5'Flank|MRPS18C_uc011ccu.1_Missense_Mutation_p.A22T	p.A22T	NM_016067	NP_057151	Q9Y3D5	RT18C_HUMAN			1	177	+		Hepatocellular(203;0.114)	22						Missense_Mutation	SNP	ENST00000295491.4	37	c.64G>A	CCDS3604.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.73|15.73	2.919049|2.919049	0.52546|0.52546	.|.	.|.	ENSG00000163319|ENSG00000163319	ENST00000295491;ENST00000507019;ENST00000507349;ENST00000505719|ENST00000509970	.|.	.|.	.|.	5.02|5.02	2.28|2.28	0.28536|0.28536	.|.	0.722516|.	0.12747|.	N|.	0.442483|.	T|T	0.42040|0.42040	0.1185|0.1185	M|M	0.63428|0.63428	1.95|1.95	0.09310|0.09310	N|N	1|1	B|.	0.30793|.	0.295|.	B|.	0.32211|.	0.142|.	T|T	0.33369|0.33369	-0.9871|-0.9871	9|5	0.44086|.	T|.	0.13|.	-3.3125|-3.3125	4.357|4.357	0.11183|0.11183	0.1884:0.0:0.6331:0.1785|0.1884:0.0:0.6331:0.1785	.|.	22|.	Q9Y3D5|.	RT18C_HUMAN|.	T|D	22;22;22;18|20	.|.	ENSP00000295491:A22T|.	A|G	+|+	1|2	0|0	MRPS18C|MRPS18C	84596318|84596318	0.004000|0.004000	0.15560|0.15560	0.025000|0.025000	0.17156|0.17156	0.028000|0.028000	0.11728|0.11728	0.560000|0.560000	0.23500|0.23500	0.265000|0.265000	0.21872|0.21872	0.655000|0.655000	0.94253|0.94253	GCT|GGC		0.512	MRPS18C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252820.2			24	128	0	0	0	0.003954	0	24	128				
PIK3R1	5295	broad.mit.edu	37	5	67590998	67590998	+	Silent	SNP	T	T	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr5:67590998T>C	ENST00000521381.1	+	13	2207	c.1591T>C	c.(1591-1593)Ttg>Ctg	p.L531L	PIK3R1_ENST00000396611.1_Silent_p.L531L|PIK3R1_ENST00000320694.8_Silent_p.L231L|PIK3R1_ENST00000274335.5_Silent_p.L531L|PIK3R1_ENST00000336483.5_Silent_p.L261L|PIK3R1_ENST00000523872.1_Silent_p.L168L|PIK3R1_ENST00000521657.1_Silent_p.L531L	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	531					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	TTATGATAAGTTGAAGTCTCG	0.363			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																													uc003jva.2		NA		Rec	yes		5	5q13.1	5295	Mis|F|O	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""			"""E, O"""			gliobastoma|ovarian|colorectal		2	Whole gene deletion(1)|Unknown(1)	p.?(1)	large_intestine(1)|lung(1)	endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101						c.(1591-1593)TTG>CTG		phosphoinositide-3-kinase, regulatory subunit 1	Isoproterenol(DB01064)						83.0	86.0	85.0					5																	67590998		2203	4300	6503	SO:0001819	synonymous_variant	5295				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	g.chr5:67590998T>C	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1591T>C	5.37:g.67590998T>C		TCGA GBM(4;<1E-08)				PIK3R1_uc003jvb.2_Silent_p.L531L|PIK3R1_uc003jvc.2_Silent_p.L231L|PIK3R1_uc003jvd.2_Silent_p.L261L|PIK3R1_uc003jve.2_Silent_p.L210L|PIK3R1_uc011crb.1_Silent_p.L201L	p.L531L	NM_181523	NP_852664	P27986	P85A_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	13	2151	+		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)	531					B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Silent	SNP	ENST00000521381.1	37	c.1591T>C	CCDS3993.1																																																																																				0.363	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504		6	43	0	0	0	0.00308	0	6	43				
TMEM173	340061	broad.mit.edu	37	5	138857009	138857009	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr5:138857009C>A	ENST00000330794.4	-	7	1184	c.851G>T	c.(850-852)aGg>aTg	p.R284M	TMEM173_ENST00000511850.1_5'Flank	NM_198282.2	NP_938023.1	Q86WV6	STING_HUMAN	transmembrane protein 173	284	c-di-GMP-binding domain (CBD).				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	cyclic-di-GMP binding (GO:0035438)|cyclic-GMP-AMP binding (GO:0061507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(6)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CTGCTCAAGCCTATCCTCCCG	0.572																																							uc003lep.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(850-852)AGG>ATG		transmembrane protein 173							91.0	86.0	88.0					5																	138857009		2203	4300	6503	SO:0001583	missense	340061				activation of innate immune response|apoptosis|cellular response to exogenous dsRNA|defense response to virus|innate immune response|interferon-beta production|positive regulation of defense response to virus by host|positive regulation of protein binding|positive regulation of protein import into nucleus, translocation|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane|perinuclear region of cytoplasm|plasma membrane	protein homodimerization activity|protein kinase binding|transcription factor binding	g.chr5:138857009C>A		CCDS4215.1	5q31.2	2009-11-06			ENSG00000184584	ENSG00000184584			27962	protein-coding gene	gene with protein product		612374				12477932	Standard	XM_005268445		Approved	FLJ38577, NET23	uc003lep.3	Q86WV6	OTTHUMG00000129239	ENST00000330794.4:c.851G>T	5.37:g.138857009C>A	ENSP00000331288:p.Arg284Met						p.R284M	NM_198282	NP_938023	Q86WV6	TM173_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		7	1102	-			284			Cytoplasmic (Potential).		A8K3P6|B6EB35|D6RBX0|D6RE01|D6RID9	Missense_Mutation	SNP	ENST00000330794.4	37	c.851G>T	CCDS4215.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.306948	0.81247	.	.	ENSG00000184584	ENST00000330794	T	0.30714	1.52	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.59985	0.2234	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63129	-0.6706	10	0.87932	D	0	-29.3486	19.1973	0.93695	0.0:1.0:0.0:0.0	.	284	Q86WV6	TM173_HUMAN	M	284	ENSP00000331288:R284M	ENSP00000331288:R284M	R	-	2	0	TMEM173	138837193	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	6.130000	0.71663	2.653000	0.90120	0.561000	0.74099	AGG		0.572	TMEM173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251338.1	NM_198282		26	90	1	0	4.4004e-07	0.00333	5.36954e-07	26	90				
PCDHGA1	56114	broad.mit.edu	37	5	140712464	140712464	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr5:140712464C>T	ENST00000517417.1	+	1	2213	c.2213C>T	c.(2212-2214)tCg>tTg	p.S738L	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.S738L	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	738					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGCCCGGTTCGCACTTTGTG	0.642																																							uc003lji.1		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(2212-2214)TCG>TTG		protocadherin gamma subfamily A, 1 isoform 1							73.0	77.0	76.0					5																	140712464		2203	4300	6503	SO:0001583	missense	56114				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140712464C>T	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.2213C>T	5.37:g.140712464C>T	ENSP00000431083:p.Ser738Leu					PCDHGA1_uc011dan.1_Missense_Mutation_p.S738L	p.S738L	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2213	+			738			Cytoplasmic (Potential).		Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	c.2213C>T	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.426486	0.62733	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.48836	0.8;0.8	4.04	4.04	0.47022	.	0.000000	0.43260	D	0.000592	T	0.58694	0.2140	M	0.85099	2.735	0.09310	N	1	B;P	0.38455	0.395;0.632	B;P	0.46049	0.312;0.502	T	0.58769	-0.7578	10	0.87932	D	0	.	10.1224	0.42630	0.0:0.906:0.0:0.094	.	738;738	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	L	738	ENSP00000431083:S738L;ENSP00000367345:S738L	ENSP00000367345:S738L	S	+	2	0	PCDHGA1	140692648	0.000000	0.05858	0.006000	0.13384	0.027000	0.11550	0.269000	0.18589	2.245000	0.73994	0.585000	0.79938	TCG		0.642	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		24	80	0	0	0	0.00278	0	24	80				
PCDHGA9	56107	broad.mit.edu	37	5	140784592	140784592	+	Silent	SNP	C	C	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr5:140784592C>G	ENST00000573521.1	+	1	2073	c.2073C>G	c.(2071-2073)ctC>ctG	p.L691L	PCDHGA8_ENST00000398604.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	691					homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCTTACCCTCTACCTCGTTG	0.592																																							uc003lkh.1		NA																	0					0						c.(2071-2073)CTC>CTG		protocadherin gamma subfamily A, 9 isoform 1							112.0	124.0	120.0					5																	140784592		2157	4275	6432	SO:0001819	synonymous_variant	56107				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140784592C>G	AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.2073C>G	5.37:g.140784592C>G						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Silent_p.L691L	p.L691L	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2073	+			691			Extracellular (Potential).		A2RU65|Q9Y5C9	Silent	SNP	ENST00000573521.1	37	c.2073C>G	CCDS58981.1																																																																																				0.592	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921		32	103	0	0	0	0.002836	0	32	103				
PDGFRB	5159	broad.mit.edu	37	5	149498364	149498364	+	Silent	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr5:149498364G>T	ENST00000261799.4	-	21	3319	c.2850C>A	c.(2848-2850)ccC>ccA	p.P950P		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	950	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCTGGGAGAAGGGGGGCCGAA	0.577			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																		uc003lro.2		NA		Dom	yes		5	5q31-q32	5159	T	"""platelet-derived growth factor receptor, beta polypeptide"""			L	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP		MPD|AML|CMML|CML		0				central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17						c.(2848-2850)CCC>CCA		platelet-derived growth factor receptor beta	Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)						97.0	100.0	99.0					5																	149498364		2203	4300	6503	SO:0001819	synonymous_variant	5159				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity	g.chr5:149498364G>T	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.2850C>A	5.37:g.149498364G>T						PDGFRB_uc010jhd.2_Silent_p.P789P	p.P950P	NM_002609	NP_002600	P09619	PGFRB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		21	3319	-		all_hematologic(541;0.224)	950			Cytoplasmic (Potential).|Protein kinase.		B5A957|Q8N5L4	Silent	SNP	ENST00000261799.4	37	c.2850C>A	CCDS4303.1																																																																																				0.577	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609		20	139	1	0	5.35356e-11	0.00278	7.31653e-11	20	139				
HUS1B	135458	broad.mit.edu	37	6	656374	656374	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr6:656374G>C	ENST00000380907.2	-	1	589	c.571C>G	c.(571-573)Ctg>Gtg	p.L191V	EXOC2_ENST00000448181.3_Intron|EXOC2_ENST00000230449.4_Intron	NM_148959.3	NP_683762.2	Q8NHY5	HUS1B_HUMAN	HUS1 checkpoint homolog b (S. pombe)	191					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)	checkpoint clamp complex (GO:0030896)|nucleolus (GO:0005730)				endometrium(3)|large_intestine(1)|lung(7)	11	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)		TCTATACTCAGGGTCATCCTG	0.562																																							uc003mtg.2		NA																	0					0						c.(571-573)CTG>GTG		HUS1 checkpoint protein B							88.0	97.0	94.0					6																	656374		2203	4300	6503	SO:0001583	missense	135458							g.chr6:656374G>C	AF508547	CCDS4470.1	6p25.3	2008-08-08	2001-11-28		ENSG00000188996	ENSG00000188996			16485	protein-coding gene	gene with protein product		609713	"""HUS1 (S. pombe) checkpoint homolog b"""			11944979	Standard	NM_148959		Approved		uc003mtg.3	Q8NHY5	OTTHUMG00000090059	ENST00000380907.2:c.571C>G	6.37:g.656374G>C	ENSP00000370293:p.Leu191Val					EXOC2_uc003mtd.2_Intron|EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	p.L191V	NM_148959	NP_683762	Q8NHY5	HUS1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)	1	591	-	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)	191					Q5T4Z2	Missense_Mutation	SNP	ENST00000380907.2	37	c.571C>G	CCDS4470.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.398021	0.42512	.	.	ENSG00000188996	ENST00000380907	T	0.21191	2.02	3.73	-2.12	0.07165	.	0.105090	0.39020	U	0.001487	T	0.11239	0.0274	M	0.75085	2.285	0.49213	D	0.999769	P	0.41624	0.757	P	0.44673	0.457	T	0.06991	-1.0796	10	0.38643	T	0.18	.	4.2595	0.10733	0.3973:0.1964:0.4063:0.0	.	191	Q8NHY5	HUS1B_HUMAN	V	191	ENSP00000370293:L191V	ENSP00000370293:L191V	L	-	1	2	HUS1B	601374	1.000000	0.71417	0.018000	0.16275	0.002000	0.02628	0.697000	0.25556	-0.492000	0.06687	-0.302000	0.09304	CTG		0.562	HUS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205617.2	NM_148959		40	164	0	0	0	0.007835	0	40	164				
SLC17A4	10050	broad.mit.edu	37	6	25771165	25771165	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr6:25771165G>T	ENST00000377905.4	+	6	750	c.631G>T	c.(631-633)Ggg>Tgg	p.G211W	SLC17A4_ENST00000439485.2_Intron|SLC17A4_ENST00000397076.2_Intron	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	211					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GTCAATGCTGGGGTCCTTCAT	0.493																																							uc003nfe.2		NA																	0				skin(1)	1						c.(631-633)GGG>TGG		solute carrier family 17 (sodium phosphate),							297.0	278.0	285.0					6																	25771165		2203	4300	6503	SO:0001583	missense	10050				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity	g.chr6:25771165G>T	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.631G>T	6.37:g.25771165G>T	ENSP00000367137:p.Gly211Trp					SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Intron|SLC17A4_uc003nfg.2_Missense_Mutation_p.G148W|SLC17A4_uc010jqa.2_5'Flank	p.G211W	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN			6	750	+			211			Helical; (Potential).		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	37	c.631G>T	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.656291	0.88056	.	.	ENSG00000146039	ENST00000377905	T	0.77877	-1.13	5.39	5.39	0.77823	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.49916	D	0.000134	D	0.91462	0.7305	H	0.97587	4.035	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93688	0.7004	10	0.87932	D	0	.	15.025	0.71663	0.0:0.0:1.0:0.0	.	211	Q9Y2C5	S17A4_HUMAN	W	211	ENSP00000367137:G211W	ENSP00000367137:G211W	G	+	1	0	SLC17A4	25879144	1.000000	0.71417	0.928000	0.36995	0.401000	0.30781	6.672000	0.74477	2.709000	0.92574	0.563000	0.77884	GGG		0.493	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1			33	121	1	0	4.00102e-26	0.00623	6.26113e-26	33	121				
HLA-C	3107	broad.mit.edu	37	6	31238055	31238055	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr6:31238055C>A	ENST00000376228.5	-	4	841	c.827G>T	c.(826-828)gGa>gTa	p.G276V	HLA-C_ENST00000383329.3_Missense_Mutation_p.G276V	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	276	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CTGCTCTTGTCCAGAAGGCAC	0.607																																							uc003nsy.2		NA																	0					0						c.(826-828)GGA>GTA		major histocompatibility complex, class I, C							40.0	37.0	38.0					6																	31238055		2201	4296	6497	SO:0001583	missense	3107				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex		g.chr6:31238055C>A	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.827G>T	6.37:g.31238055C>A	ENSP00000365402:p.Gly276Val					HLA-C_uc011dnj.1_Missense_Mutation_p.G248V|HLA-C_uc003nsx.2_Missense_Mutation_p.G155V|HLA-C_uc003nsz.2_Missense_Mutation_p.G276V|HLA-C_uc010jsl.2_Missense_Mutation_p.G276V|HLA-C_uc003nta.2_Missense_Mutation_p.G276V|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron|HLA-C_uc011dnl.1_Missense_Mutation_p.G155V	p.G276V	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN			4	834	-			276			Extracellular (Potential).|Alpha-3.|Ig-like C1-type.		O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	c.827G>T	CCDS34393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	5.200|5.200	0.222421|0.222421	0.09863|0.09863	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.02812	.|4.15;4.15	2.67|2.67	1.78|1.78	0.24846|0.24846	.|Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	.|0.175245	.|0.26684	.|U	.|0.023029	T|T	0.10165|0.10165	0.0249|0.0249	H|H	0.94264|0.94264	3.515|3.515	0.44048|0.44048	D|D	0.996787|0.996787	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0	T|T	0.00624|0.00624	-1.1639|-1.1639	5|10	.|0.87932	.|D	.|0	.|.	5.5453|5.5453	0.17061|0.17061	0.0:0.8394:0.0:0.1606|0.0:0.8394:0.0:0.1606	.|.	.|276;276;276;276	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	Y|V	240|276;276;276;313	.|ENSP00000365402:G276V;ENSP00000372819:G276V	.|ENSP00000365402:G276V	D|G	-|-	1|2	0|0	HLA-C|HLA-C	31346034|31346034	0.000000|0.000000	0.05858|0.05858	0.787000|0.787000	0.31911|0.31911	0.130000|0.130000	0.20726|0.20726	0.028000|0.028000	0.13644|0.13644	0.699000|0.699000	0.31761|0.31761	0.298000|0.298000	0.19748|0.19748	GAC|GGA		0.607	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117		5	19	1	0	0.00116845	0.001168	0.00129476	5	19				
LEMD2	221496	broad.mit.edu	37	6	33756865	33756865	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr6:33756865C>G	ENST00000293760.5	-	1	48	c.29G>C	c.(28-30)cGg>cCg	p.R10P	LEMD2_ENST00000508327.1_5'Flank	NM_181336.3	NP_851853.1	Q8NC56	LEMD2_HUMAN	LEM domain containing 2	10	LEM. {ECO:0000255|PROSITE- ProRule:PRU00313}.				negative regulation of MAPK cascade (GO:0043409)|skeletal muscle cell differentiation (GO:0035914)	integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear membrane (GO:0031965)				central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)|pancreas(1)	9						CAGCTCCCGCCGCAGTTCCAG	0.766																																							uc011drm.1		NA																	0				central_nervous_system(1)	1						c.(28-30)CGG>CCG		LEM domain containing 2 isoform 1							11.0	13.0	13.0					6																	33756865		1628	3733	5361	SO:0001583	missense	221496					integral to nuclear inner membrane		g.chr6:33756865C>G		CCDS4785.1, CCDS47411.1	6p21.31	2009-11-06			ENSG00000161904	ENSG00000161904			21244	protein-coding gene	gene with protein product						12477932	Standard	NM_001143944		Approved	dJ482C21.1, NET25	uc011drm.2	Q8NC56	OTTHUMG00000014535	ENST00000293760.5:c.29G>C	6.37:g.33756865C>G	ENSP00000293760:p.Arg10Pro					LEMD2_uc011drl.1_5'Flank|LEMD2_uc003ofe.2_5'UTR	p.R10P	NM_181336	NP_851853	Q8NC56	LEMD2_HUMAN			1	42	-			10			LEM.		B4DVH5|E7EVT2|Q5T972|Q5T974	Missense_Mutation	SNP	ENST00000293760.5	37	c.29G>C	CCDS4785.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.211719	0.79240	.	.	ENSG00000161904	ENST00000293760	T	0.50548	0.74	4.29	3.42	0.39159	LEM-like domain (2);Lamino-associated polypeptide 2/emerin (3);	0.000000	0.43110	D	0.000609	T	0.56572	0.1994	M	0.83012	2.62	0.80722	D	1	D	0.69078	0.997	D	0.66351	0.943	T	0.61317	-0.7087	10	0.49607	T	0.09	-7.3214	10.191	0.43026	0.0:0.9047:0.0:0.0953	.	10	Q8NC56	LEMD2_HUMAN	P	10	ENSP00000293760:R10P	ENSP00000293760:R10P	R	-	2	0	LEMD2	33864843	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.782000	0.26788	1.005000	0.39183	0.655000	0.94253	CGG		0.766	LEMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040209.3	XM_166338		6	31	0	0	0	0.00308	0	6	31				
TDRD6	221400	broad.mit.edu	37	6	46656968	46656968	+	Missense_Mutation	SNP	G	G	A	rs373561239		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr6:46656968G>A	ENST00000316081.6	+	1	1103	c.1103G>A	c.(1102-1104)cGa>cAa	p.R368Q	RP11-446F17.3_ENST00000571590.1_RNA|RP11-446F17.3_ENST00000434329.2_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.R368Q|RP11-446F17.3_ENST00000422284.2_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	368	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GAATATTTTCGAATGCCGGTG	0.547																																							uc003oyj.2		NA																	0				breast(3)|ovary(2)|skin(1)	6						c.(1102-1104)CGA>CAA		tudor domain containing 6							136.0	120.0	125.0					6																	46656968		2203	4300	6503	SO:0001583	missense	221400				cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding	g.chr6:46656968G>A	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.1103G>A	6.37:g.46656968G>A	ENSP00000346065:p.Arg368Gln					TDRD6_uc010jze.2_Missense_Mutation_p.R362Q	p.R368Q	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	Lung(136;0.192)		1	1103	+			368			Tudor 2.		B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	c.1103G>A	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.488230	0.84854	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.08896	3.04;3.04	5.65	5.65	0.86999	Tudor subgroup (1);Maternal tudor protein (1);	0.255981	0.36932	N	0.002340	T	0.13372	0.0324	L	0.36672	1.1	0.47621	D	0.999473	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.14254	-1.0479	10	0.22706	T	0.39	-7.8198	19.5221	0.95189	0.0:0.0:1.0:0.0	.	368;368	F5H5M3;O60522	.;TDRD6_HUMAN	Q	368	ENSP00000443299:R368Q;ENSP00000346065:R368Q	ENSP00000346065:R368Q	R	+	2	0	TDRD6	46764927	1.000000	0.71417	0.715000	0.30552	0.828000	0.46876	6.062000	0.71155	2.941000	0.99782	0.655000	0.94253	CGA		0.547	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443		19	84	0	0	0	0.008871	0	19	84				
REPS1	85021	broad.mit.edu	37	6	139229864	139229864	+	Silent	SNP	T	T	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr6:139229864T>C	ENST00000450536.2	-	18	2731	c.2157A>G	c.(2155-2157)gaA>gaG	p.E719E	REPS1_ENST00000409812.2_Silent_p.E628E|REPS1_ENST00000258062.5_Silent_p.E718E|REPS1_ENST00000367663.4_Silent_p.E692E|REPS1_ENST00000415951.2_Silent_p.E660E			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	719	Interaction with RALBP1. {ECO:0000250}.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		TTTGTGTATGTTCATCAACTT	0.398																																							uc003qii.2		NA																	0				lung(1)|breast(1)	2						c.(2155-2157)GAA>GAG		RALBP1 associated Eps domain containing 1							196.0	177.0	184.0					6																	139229864		2203	4300	6503	SO:0001819	synonymous_variant	85021					coated pit|plasma membrane	calcium ion binding|SH3 domain binding	g.chr6:139229864T>C		CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.2157A>G	6.37:g.139229864T>C						REPS1_uc003qig.3_Silent_p.E692E|REPS1_uc011edr.1_Silent_p.E718E|REPS1_uc003qij.2_Silent_p.E628E|REPS1_uc003qik.2_Silent_p.E325E	p.E719E	NM_031922	NP_114128	Q96D71	REPS1_HUMAN		GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)	18	2736	-			719			Interaction with RALBP1 (By similarity).		B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Silent	SNP	ENST00000450536.2	37	c.2157A>G		.	.	.	.	.	.	.	.	.	.	T	9.510	1.105542	0.20632	.	.	ENSG00000135597	ENST00000478483;ENST00000526022	.	.	.	5.35	3.97	0.46021	.	.	.	.	.	T	0.44371	0.1290	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40757	-0.9546	4	.	.	.	-15.9907	8.0355	0.30491	0.0:0.2012:0.0:0.7988	.	.	.	.	S	98;4	.	.	N	-	2	0	REPS1	139271557	0.989000	0.36119	1.000000	0.80357	0.962000	0.63368	0.087000	0.14958	0.847000	0.35167	0.477000	0.44152	AAC		0.398	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000042447.3			12	88	0	0	0	0.001855	0	12	88				
ACTB	60	broad.mit.edu	37	7	5567400	5567400	+	Missense_Mutation	SNP	G	G	C	rs71531321		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr7:5567400G>C	ENST00000331789.5	-	6	1298	c.1107C>G	c.(1105-1107)atC>atG	p.I369M	ACTB_ENST00000464611.1_5'UTR|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	369					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		TGCGGTGGACGATGGAGGGGC	0.537																																							uc003sos.3		NA																	0					0						c.(1105-1107)ATC>ATG		beta actin							125.0	130.0	128.0					7																	5567400		2203	4300	6503	SO:0001583	missense	60				'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton	g.chr7:5567400G>C	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.1107C>G	7.37:g.5567400G>C	ENSP00000349960:p.Ile369Met					ACTB_uc003sor.3_Missense_Mutation_p.I247M|ACTB_uc003sot.3_Missense_Mutation_p.I369M|ACTB_uc003soq.3_Missense_Mutation_p.I247M|ACTB_uc010ksy.2_Missense_Mutation_p.I247M	p.I369M	NM_001101	NP_001092	P60709	ACTB_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)	5	1143	-		Ovarian(82;0.0606)	369					A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000331789.5	37	c.1107C>G	CCDS5341.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.759510	0.31137	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000320713	D	0.94966	-3.57	5.55	0.859	0.19036	.	0.000000	0.64402	D	0.000015	D	0.97219	0.9091	H	0.94808	3.585	0.37974	D	0.933379	P	0.47409	0.895	D	0.77004	0.989	D	0.95484	0.8563	10	0.87932	D	0	.	5.1334	0.14922	0.2827:0.0:0.4779:0.2393	.	369	P60709	ACTB_HUMAN	M	369;345;341;288	ENSP00000349960:I369M	ENSP00000440549:I288M	I	-	3	3	ACTB	5533926	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.409000	0.34680	0.242000	0.21303	0.650000	0.86243	ATC		0.537	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	NM_001101		26	241	0	0	0	0.009535	0	26	241				
ETV1	2115	broad.mit.edu	37	7	13971233	13971233	+	Silent	SNP	G	G	A	rs577222571		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr7:13971233G>A	ENST00000430479.1	-	9	1363	c.696C>T	c.(694-696)caC>caT	p.H232H	ETV1_ENST00000403685.1_Silent_p.H214H|ETV1_ENST00000405192.2_Silent_p.H232H|ETV1_ENST00000242066.5_Silent_p.H214H|ETV1_ENST00000403527.1_Silent_p.H192H|ETV1_ENST00000399357.3_Silent_p.H129H|ETV1_ENST00000405218.2_Silent_p.H232H|ETV1_ENST00000343495.5_Silent_p.H214H|ETV1_ENST00000405358.4_Silent_p.H246H|ETV1_ENST00000476720.2_5'UTR|ETV1_ENST00000420159.2_Silent_p.H174H	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	232					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H232H(1)	TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						ACACTGGGTCGTGGTACTCCT	0.522			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																		uc011jxq.1		NA		Dom	yes		7	7p22	2115	T	ets variant gene 1			"""M, E"""	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3		Ewing sarcoma|prostate	TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	1	Substitution - coding silent(1)		large_intestine(1)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35						c.(694-696)CAC>CAT		ets variant gene 1 isoform a							132.0	129.0	130.0					7																	13971233		2016	4180	6196	SO:0001819	synonymous_variant	2115				transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:13971233G>A		CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.696C>T	7.37:g.13971233G>A						ETV1_uc011jxn.1_Silent_p.H192H|ETV1_uc011jxo.1_Silent_p.H129H|ETV1_uc011jxp.1_Silent_p.H174H|ETV1_uc003ssw.3_Silent_p.H232H|ETV1_uc003ssx.2_RNA|ETV1_uc011jxr.1_Silent_p.H214H|ETV1_uc011jxs.1_Silent_p.H214H|ETV1_uc010ktv.2_Silent_p.H101H	p.H232H	NM_004956	NP_004947	P50549	ETV1_HUMAN			9	1435	-			232					A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Silent	SNP	ENST00000430479.1	37	c.696C>T	CCDS55088.1																																																																																				0.522	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326111.1	NM_004956		9	37	0	0	0	0.008291	0	9	37				
WIPF3	644150	broad.mit.edu	37	7	29918676	29918676	+	Missense_Mutation	SNP	C	C	T	rs201706623		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr7:29918676C>T	ENST00000409290.1	+	3	275	c.275C>T	c.(274-276)gCg>gTg	p.A92V	WIPF3_ENST00000242140.5_Missense_Mutation_p.A92V|WIPF3_ENST00000409123.1_Missense_Mutation_p.A92V	NM_001080529.2	NP_001073998.2	A6NGB9	WIPF3_HUMAN	WAS/WASL interacting protein family, member 3	92					cell differentiation (GO:0030154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)				breast(2)|large_intestine(3)|lung(6)|ovary(1)	12						ACACGAGGCGCGAGCACACCT	0.517													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21217	0.0		0.0	False		,,,				2504	0.0						uc003taj.1		NA																	0				ovary(1)	1						c.(274-276)GCG>GTG		WAS/WASL interacting protein family, member 3		C	VAL/ALA	2,3942		0,2,1970	66.0	70.0	68.0		275	3.7	0.5	7		68	1,8325		0,1,4162	yes	missense	WIPF3	NM_001080529.2	64	0,3,6132	TT,TC,CC		0.012,0.0507,0.0244	benign	92/484	29918676	3,12267	1972	4163	6135	SO:0001583	missense	644150							g.chr7:29918676C>T	AK094250	CCDS56472.1	7p15.1	2006-10-12			ENSG00000122574	ENSG00000122574			22004	protein-coding gene	gene with protein product		612432					Standard	NM_001080529		Approved	CR16, FLJ36931	uc022aaz.1	A6NGB9	OTTHUMG00000152761	ENST00000409290.1:c.275C>T	7.37:g.29918676C>T	ENSP00000386878:p.Ala92Val						p.A92V	NM_001080529	NP_001073998	A6NGB9	WIPF3_HUMAN			3	275	+			92					B8ZZV2	Missense_Mutation	SNP	ENST00000409290.1	37	c.275C>T	CCDS56472.1	.	.	.	.	.	.	.	.	.	.	C	10.04	1.242509	0.22796	5.07E-4	1.2E-4	ENSG00000122574	ENST00000409123;ENST00000409290;ENST00000242140	T;T;T	0.51817	0.69;0.71;0.69	5.5	3.69	0.42338	.	0.268443	0.27961	N	0.017159	T	0.36744	0.0978	L	0.39898	1.24	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32903	-0.9889	10	0.62326	D	0.03	.	8.3422	0.32249	0.0:0.2195:0.6248:0.1557	.	92	A6NGB9	WIPF3_HUMAN	V	92	ENSP00000386790:A92V;ENSP00000386878:A92V;ENSP00000242140:A92V	ENSP00000242140:A92V	A	+	2	0	WIPF3	29885201	0.977000	0.34250	0.480000	0.27341	0.002000	0.02628	1.640000	0.37186	0.855000	0.35359	-0.271000	0.10264	GCG		0.517	WIPF3-002	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327705.1			3	10	0	0	0	0.009096	0	3	10				
ABCA13	154664	broad.mit.edu	37	7	48559687	48559687	+	Silent	SNP	T	T	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr7:48559687T>C	ENST00000435803.1	+	53	13872	c.13848T>C	c.(13846-13848)ccT>ccC	p.P4616P	ABCA13_ENST00000544596.1_Silent_p.P346P	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4616					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTATTTTTCCTCAATTCTGTC	0.368																																							uc003toq.2		NA																	0				ovary(5)|central_nervous_system(4)|skin(1)	10						c.(13846-13848)CCT>CCC		ATP binding cassette, sub-family A (ABC1),							111.0	101.0	104.0					7																	48559687		1848	4089	5937	SO:0001819	synonymous_variant	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48559687T>C	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.13848T>C	7.37:g.48559687T>C						ABCA13_uc010kys.1_Silent_p.P1691P|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Silent_p.P346P	p.P4616P	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN			53	13873	+			4616			Helical; (Potential).		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	c.13848T>C	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	T	10.28	1.306039	0.23736	.	.	ENSG00000179869	ENST00000435451	.	.	.	5.35	-1.99	0.07457	.	.	.	.	.	T	0.37972	0.1023	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32025	-0.9922	4	.	.	.	.	0.2072	0.00152	0.2549:0.1682:0.2453:0.3316	.	.	.	.	P	137	.	.	S	+	1	0	ABCA13	48530233	0.997000	0.39634	0.953000	0.39169	0.970000	0.65996	0.200000	0.17257	-0.223000	0.09943	0.528000	0.53228	TCA		0.368	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		2	16	0	0	0	0.004672	0	2	16				
PCLO	27445	broad.mit.edu	37	7	82430833	82430833	+	Splice_Site	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr7:82430833C>A	ENST00000333891.9	-	22	15345		c.e22+1			NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTTTTACTTACCTTCAGTGTC	0.338																																							uc003uhx.2		NA																	0				ovary(7)	7						c.e22+1		piccolo isoform 1							108.0	110.0	109.0					7																	82430833		1834	4088	5922	SO:0001630	splice_region_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82430833C>A	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.15007+1G>T	7.37:g.82430833C>A							p.A5003_splice	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN			22	15296	-									Splice_Site	SNP	ENST00000333891.9	37	c.15007_splice	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237291	0.39498	.	.	ENSG00000186472	ENST00000333891	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7497	0.96263	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PCLO	82268769	1.000000	0.71417	1.000000	0.80357	0.196000	0.23810	5.359000	0.66074	2.677000	0.91161	0.484000	0.47621	.		0.338	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	Intron	15	37	1	0	3.27435e-08	0.00245	4.19526e-08	15	37				
SAMD9L	219285	broad.mit.edu	37	7	92765094	92765094	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr7:92765094G>A	ENST00000318238.4	-	5	1407	c.191C>T	c.(190-192)cCa>cTa	p.P64L	SAMD9L_ENST00000437805.1_Missense_Mutation_p.P64L|SAMD9L_ENST00000411955.1_Missense_Mutation_p.P64L	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	64	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CAAAAGTGCTGGACCCCATGG	0.413																																							uc003umh.1		NA																	0				ovary(4)	4						c.(190-192)CCA>CTA		sterile alpha motif domain containing 9-like							122.0	125.0	124.0					7																	92765094		2203	4299	6502	SO:0001583	missense	219285							g.chr7:92765094G>A	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.191C>T	7.37:g.92765094G>A	ENSP00000326247:p.Pro64Leu					SAMD9L_uc003umj.1_Missense_Mutation_p.P64L|SAMD9L_uc003umi.1_Missense_Mutation_p.P64L|SAMD9L_uc010lfb.1_Missense_Mutation_p.P64L|SAMD9L_uc003umk.1_Missense_Mutation_p.P64L|SAMD9L_uc010lfc.1_Missense_Mutation_p.P64L|SAMD9L_uc010lfd.1_Missense_Mutation_p.P64L|SAMD9L_uc011khx.1_Missense_Mutation_p.P55L	p.P64L	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		5	1407	-	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		64			SAM.		A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	c.191C>T	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	G	19.72	3.880361	0.72294	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805;ENST00000394472;ENST00000446959;ENST00000439952;ENST00000414791;ENST00000446033	T;T;T	0.29397	1.57;1.57;1.57	4.59	4.59	0.56863	Sterile alpha motif/pointed domain (2);	0.117295	0.37012	N	0.002299	T	0.52403	0.1732	M	0.61703	1.905	0.58432	D	0.999999	D;D	0.71674	0.998;0.961	D;P	0.68039	0.955;0.804	T	0.56715	-0.7933	10	0.72032	D	0.01	-12.7846	17.1617	0.86805	0.0:0.0:1.0:0.0	.	64;64	Q8IVG5-2;Q8IVG5	.;SAM9L_HUMAN	L	64	ENSP00000326247:P64L;ENSP00000405760:P64L;ENSP00000408796:P64L	ENSP00000326247:P64L	P	-	2	0	SAMD9L	92603030	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.866000	0.56040	2.380000	0.81148	0.460000	0.39030	CCA		0.413	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		14	92	0	0	0	0.003163	0	14	92				
LRRN3	54674	broad.mit.edu	37	7	110762846	110762846	+	Silent	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr7:110762846C>A	ENST00000422987.3	+	2	849	c.18C>A	c.(16-18)ctC>ctA	p.L6L	IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000437687.1_Intron|LRRN3_ENST00000451085.1_Silent_p.L6L|LRRN3_ENST00000308478.5_Silent_p.L6L|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000452895.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	6					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		ACATGCCACTCCGAATTCATG	0.418																																							uc003vft.3		NA																	0				skin(3)|ovary(2)|pancreas(2)|central_nervous_system(1)	8						c.(16-18)CTC>CTA		leucine rich repeat neuronal 3 precursor							114.0	101.0	105.0					7																	110762846		2203	4300	6503	SO:0001819	synonymous_variant	54674					integral to membrane		g.chr7:110762846C>A	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.18C>A	7.37:g.110762846C>A						IMMP2L_uc003vfq.1_Intron|IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron|LRRN3_uc003vfu.3_Silent_p.L6L|LRRN3_uc003vfs.3_Silent_p.L6L	p.L6L	NM_001099660	NP_001093130	Q9H3W5	LRRN3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)	4	1064	+			6					O43377|Q6I9V8|Q8IYQ6	Silent	SNP	ENST00000422987.3	37	c.18C>A	CCDS5754.1																																																																																				0.418	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334		17	78	1	0	5.3912e-06	0.006122	6.50116e-06	17	78				
KMT2C	58508	broad.mit.edu	37	7	151962266	151962266	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr7:151962266G>C	ENST00000262189.6	-	8	1259	c.1041C>G	c.(1039-1041)tgC>tgG	p.C347W	KMT2C_ENST00000355193.2_Missense_Mutation_p.C347W	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	347			C -> G (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CCGGGCTGTCGCACACTGCAC	0.378																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0		p.C347G(1)		large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(1039-1041)TGC>TGG		myeloid/lymphoid or mixed-lineage leukemia 3							108.0	98.0	101.0					7																	151962266		2203	4296	6499	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151962266G>C	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1041C>G	7.37:g.151962266G>C	ENSP00000262189:p.Cys347Trp						p.C347W	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	8	1260	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	347		C -> G (in a colorectal cancer sample; somatic mutation).	PHD-type 1.|RING-type.		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.1041C>G	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	5.709	0.315292	0.10789	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.99840	-7.08;-7.08	4.65	1.75	0.24633	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.45867	U	0.000337	D	0.99809	0.9917	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98147	1.0439	10	0.87932	D	0	.	10.1991	0.43073	0.3075:0.0:0.6925:0.0	.	347	Q8NEZ4	MLL3_HUMAN	W	347	ENSP00000262189:C347W;ENSP00000347325:C347W	ENSP00000262189:C347W	C	-	3	2	MLL3	151593199	0.993000	0.37304	1.000000	0.80357	0.048000	0.14542	0.222000	0.17699	0.472000	0.27344	-0.262000	0.10625	TGC		0.378	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			6	213	0	0	0	0.001168	0	6	213				
HTR5A	3361	broad.mit.edu	37	7	154875951	154875951	+	Silent	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr7:154875951G>A	ENST00000287907.2	+	2	1404	c.828G>A	c.(826-828)cgG>cgA	p.R276R	HTR5A_ENST00000486819.1_3'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	276					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	ACACGTGGCGGGAGCAGAAGG	0.612																																							uc003wlu.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(826-828)CGG>CGA		5-hydroxytryptamine receptor 5A							107.0	85.0	92.0					7																	154875951		2203	4300	6503	SO:0001819	synonymous_variant	3361					integral to plasma membrane	serotonin receptor activity	g.chr7:154875951G>A		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.828G>A	7.37:g.154875951G>A							p.R276R	NM_024012	NP_076917	P47898	5HT5A_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	2	892	+	all_neural(206;0.119)	all_hematologic(28;0.0592)	276			Cytoplasmic (By similarity).		Q2M2D2	Silent	SNP	ENST00000287907.2	37	c.828G>A	CCDS5936.1																																																																																				0.612	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012		3	47	0	0	0	0.004672	0	3	47				
USP17L2	377630	broad.mit.edu	37	8	11994973	11994973	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr8:11994973T>G	ENST00000333796.3	-	1	1613	c.1297A>C	c.(1297-1299)Acc>Ccc	p.T433P	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	433	Mediates interaction with SUDS3.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						TGGTCTAAGGTGCTTTCCTGA	0.542																																							uc003wvc.1		NA																	0				skin(2)|upper_aerodigestive_tract(1)	3						c.(1297-1299)ACC>CCC		deubiquitinating enzyme 3							59.0	63.0	62.0					8																	11994973		1416	3234	4650	SO:0001583	missense	377630				apoptosis|cell cycle|G2/M transition checkpoint|mitotic cell cycle G1/S transition checkpoint|protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr8:11994973T>G	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.1297A>C	8.37:g.11994973T>G	ENSP00000333329:p.Thr433Pro					FAM66D_uc011kxp.1_Intron|FAM66D_uc011kxo.1_Intron	p.T433P	NM_201402	NP_958804	Q6R6M4	U17L2_HUMAN			1	1297	-			433						Missense_Mutation	SNP	ENST00000333796.3	37	c.1297A>C	CCDS43713.1	.	.	.	.	.	.	.	.	.	.	T	9.766	1.171409	0.21621	.	.	ENSG00000223443	ENST00000333796	T	0.60299	0.2	0.745	-1.49	0.08718	Hyaluronan/mRNA-binding protein (1);	0.706198	0.11774	U	0.530841	T	0.62270	0.2414	L	0.52011	1.625	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.51434	-0.8706	10	0.54805	T	0.06	.	2.757	0.05295	0.4153:0.0:0.0:0.5847	.	433	Q6R6M4	U17L2_HUMAN	P	433	ENSP00000333329:T433P	ENSP00000333329:T433P	T	-	1	0	USP17L2	12032382	0.057000	0.20700	0.002000	0.10522	0.006000	0.05464	0.928000	0.28831	-0.382000	0.07870	-0.771000	0.03389	ACC		0.542	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383303.2	NM_201402		9	32	0	0	0	0.004482	0	9	32				
CLVS1	157807	broad.mit.edu	37	8	62289263	62289263	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr8:62289263C>A	ENST00000519846.1	+	4	1027	c.555C>A	c.(553-555)gaC>gaA	p.D185E	CLVS1_ENST00000325897.4_Missense_Mutation_p.D185E|CLVS1_ENST00000518592.1_5'UTR			Q8IUQ0	CLVS1_HUMAN	clavesin 1	185	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						TAATTATAGACTGGAGTAATT	0.423																																							uc003xuh.2		NA																	0				skin(4)|ovary(1)	5						c.(553-555)GAC>GAA		retinaldehyde binding protein 1-like 1							78.0	78.0	78.0					8																	62289263		2203	4300	6503	SO:0001583	missense	157807				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity	g.chr8:62289263C>A	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.555C>A	8.37:g.62289263C>A	ENSP00000428402:p.Asp185Glu					CLVS1_uc003xug.2_3'UTR|CLVS1_uc003xui.2_RNA|CLVS1_uc010lyp.2_Missense_Mutation_p.D185E	p.D185E	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN			3	879	+			185			CRAL-TRIO.		B2R7M5|C8UZT3|Q8NB32	Missense_Mutation	SNP	ENST00000519846.1	37	c.555C>A	CCDS6176.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.294230	0.81025	.	.	ENSG00000177182	ENST00000519846;ENST00000325897	D;D	0.96011	-3.88;-3.88	5.64	4.77	0.60923	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.000000	0.85682	D	0.000000	D	0.97695	0.9244	M	0.87682	2.9	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.98150	1.0441	10	0.72032	D	0.01	-8.8167	12.5881	0.56428	0.0:0.8617:0.0:0.1383	.	185	Q8IUQ0	CLVS1_HUMAN	E	185	ENSP00000428402:D185E;ENSP00000325506:D185E	ENSP00000325506:D185E	D	+	3	2	CLVS1	62451817	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.194000	0.42668	1.405000	0.46838	0.585000	0.79938	GAC		0.423	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	NM_173519		19	58	1	0	0.000958276	0.007413	0.00107938	19	58				
ZFHX4	79776	broad.mit.edu	37	8	77616827	77616827	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr8:77616827C>A	ENST00000521891.2	+	2	952	c.504C>A	c.(502-504)gaC>gaA	p.D168E	ZFHX4_ENST00000050961.6_Missense_Mutation_p.D168E|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D168E|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D168E	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	168					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGTTCCTGGACTCCCTGGCAT	0.473										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(502-504)GAC>GAA		zinc finger homeodomain 4							63.0	62.0	62.0					8																	77616827		1976	4159	6135	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77616827C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.504C>A	8.37:g.77616827C>A	ENSP00000430497:p.Asp168Glu	HNSCC(33;0.089)				ZFHX4_uc003yat.1_Missense_Mutation_p.D168E|ZFHX4_uc003yau.1_Missense_Mutation_p.D168E|ZFHX4_uc003yaw.1_Missense_Mutation_p.D168E	p.D168E	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		2	891	+			168					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.504C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	12.61	1.990841	0.35131	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	5.42	4.53	0.55603	.	0.000000	0.47093	U	0.000256	T	0.21550	0.0519	N	0.24115	0.695	0.42116	D	0.991401	B;P;P;B	0.36837	0.435;0.571;0.571;0.07	B;B;B;B	0.33392	0.078;0.163;0.163;0.023	T	0.08432	-1.0722	10	0.62326	D	0.03	.	14.7588	0.69590	0.0:0.9293:0.0:0.0707	.	168;168;168;168	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	E	168	ENSP00000430497:D168E;ENSP00000399605:D168E;ENSP00000050961:D168E;ENSP00000430848:D168E	ENSP00000050961:D168E	D	+	3	2	ZFHX4	77779382	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.771000	0.47670	2.821000	0.97095	0.650000	0.86243	GAC		0.473	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		7	28	1	0	0.00198382	0.001984	0.00218647	7	28				
SLC7A13	157724	broad.mit.edu	37	8	87242189	87242189	+	Silent	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr8:87242189C>A	ENST00000297524.3	-	1	421	c.318G>T	c.(316-318)ggG>ggT	p.G106G	SLC7A13_ENST00000520624.1_Intron|SLC7A13_ENST00000419776.2_Silent_p.G106G	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	106						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)	p.G106G(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						CAGCAACTACCCCTGACCCCA	0.493																																							uc003ydq.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(316-318)GGG>GGT		solute carrier family 7, (cationic amino acid							63.0	61.0	62.0					8																	87242189		2203	4300	6503	SO:0001819	synonymous_variant	157724					integral to membrane	amino acid transmembrane transporter activity	g.chr8:87242189C>A	AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.318G>T	8.37:g.87242189C>A						SLC7A13_uc003ydr.1_Silent_p.G106G	p.G106G	NM_138817	NP_620172	Q8TCU3	S7A13_HUMAN			1	416	-			106			Helical; Name=3; (Potential).		Q05C37|Q08AH9|Q96N84	Silent	SNP	ENST00000297524.3	37	c.318G>T	CCDS34917.1																																																																																				0.493	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1	NM_138817		4	29	1	0	0.00116845	0.001168	0.00129476	4	29				
DCAF4L2	138009	broad.mit.edu	37	8	88886072	88886072	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr8:88886072C>A	ENST00000319675.3	-	1	224	c.128G>T	c.(127-129)tGc>tTc	p.C43F		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	43										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						AGCTATACGGCAATAGTTGGC	0.507																																							uc003ydz.2		NA																	0				ovary(1)	1						c.(127-129)TGC>TTC		WD repeat domain 21C							95.0	85.0	89.0					8																	88886072		2203	4300	6503	SO:0001583	missense	138009							g.chr8:88886072C>A	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.128G>T	8.37:g.88886072C>A	ENSP00000316496:p.Cys43Phe						p.C43F	NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN			1	225	-			43						Missense_Mutation	SNP	ENST00000319675.3	37	c.128G>T	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	C	8.102	0.776806	0.16120	.	.	ENSG00000176566	ENST00000319675	T	0.71222	-0.55	2.23	-1.36	0.09085	WD40 repeat-like-containing domain (1);	0.094484	0.85682	D	0.000000	T	0.74068	0.3668	M	0.66939	2.045	0.09310	N	1	D	0.60160	0.987	P	0.60609	0.877	T	0.65849	-0.6068	10	0.87932	D	0	.	5.918	0.19065	0.0:0.4994:0.0:0.5006	.	43	Q8NA75	DC4L2_HUMAN	F	43	ENSP00000316496:C43F	ENSP00000316496:C43F	C	-	2	0	DCAF4L2	88955188	0.972000	0.33761	0.000000	0.03702	0.100000	0.18952	-0.292000	0.08332	-0.366000	0.08064	0.467000	0.42956	TGC		0.507	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		14	78	1	0	6.81908e-15	0.00245	1.02037e-14	14	78				
NCALD	83988	broad.mit.edu	37	8	102731524	102731524	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr8:102731524C>T	ENST00000311028.3	-	5	712	c.334G>A	c.(334-336)Gga>Aga	p.G112R	NCALD_ENST00000519508.2_Missense_Mutation_p.G112R|NCALD_ENST00000521599.1_Missense_Mutation_p.G112R|NCALD_ENST00000395923.1_Missense_Mutation_p.G112R|NCALD_ENST00000522951.1_Missense_Mutation_p.G112R|NCALD_ENST00000220931.6_Missense_Mutation_p.G112R	NM_001040624.1|NM_001040626.1	NP_001035714.1|NP_001035716.1	P61601	NCALD_HUMAN	neurocalcin delta	112	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium-mediated signaling (GO:0019722)|regulation of systemic arterial blood pressure (GO:0003073)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	clathrin coat of trans-Golgi network vesicle (GO:0030130)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)	8	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			TAGCCATTTCCGTCCAGGTCG	0.463																																							uc003yke.2		NA																	0					0						c.(334-336)GGA>AGA		neurocalcin delta							129.0	122.0	124.0					8																	102731524		2203	4300	6503	SO:0001583	missense	83988				synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding	g.chr8:102731524C>T	AF052142	CCDS6292.1	8q22.3	2014-08-12			ENSG00000104490	ENSG00000104490		"""EF-hand domain containing"""	7655	protein-coding gene	gene with protein product		606722				11267673	Standard	XM_006716672		Approved		uc003ykk.3	P61601	OTTHUMG00000164876	ENST00000311028.3:c.334G>A	8.37:g.102731524C>T	ENSP00000310587:p.Gly112Arg					NCALD_uc003ykf.2_Missense_Mutation_p.G112R|NCALD_uc003ykg.2_Missense_Mutation_p.G112R|NCALD_uc003ykh.2_Missense_Mutation_p.G112R|NCALD_uc003yki.2_Missense_Mutation_p.G112R|NCALD_uc003ykj.2_Missense_Mutation_p.G112R|NCALD_uc003ykk.2_Missense_Mutation_p.G112R|NCALD_uc003ykl.2_Missense_Mutation_p.G112R	p.G112R	NM_032041	NP_114430	P61601	NCALD_HUMAN	all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)		2	703	-	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		112			EF-hand 3.|2 (Potential).		P29554|Q8IYC3|Q9H0W2	Missense_Mutation	SNP	ENST00000311028.3	37	c.334G>A	CCDS6292.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704949	0.68615	.	.	ENSG00000104490	ENST00000395923;ENST00000311028;ENST00000220931;ENST00000521599;ENST00000519508;ENST00000522951;ENST00000522448;ENST00000520690;ENST00000518727;ENST00000520425;ENST00000518166;ENST00000522252	T;T;T;T;T;T;T;T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75;-0.75;-0.75;-0.54;-0.54;-0.54;-0.63;-0.58;-0.58	5.13	5.13	0.70059	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.77075	0.4077	L	0.57536	1.79	0.80722	D	1	D	0.58970	0.984	P	0.47402	0.546	T	0.79645	-0.1717	10	0.52906	T	0.07	.	18.5707	0.91135	0.0:1.0:0.0:0.0	.	112	P61601	NCALD_HUMAN	R	112	ENSP00000379256:G112R;ENSP00000310587:G112R;ENSP00000220931:G112R;ENSP00000428105:G112R;ENSP00000430476:G112R;ENSP00000428781:G112R;ENSP00000429466:G112R;ENSP00000429255:G112R;ENSP00000430731:G112R;ENSP00000430925:G112R;ENSP00000429522:G112R;ENSP00000428598:G112R	ENSP00000220931:G112R	G	-	1	0	NCALD	102800700	1.000000	0.71417	0.210000	0.23637	0.314000	0.28054	7.731000	0.84895	2.359000	0.80004	0.557000	0.71058	GGA		0.463	NCALD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380732.2			15	133	0	0	0	0.004007	0	15	133				
SMARCA2	6595	broad.mit.edu	37	9	2039691	2039691	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr9:2039691G>T	ENST00000382203.1	+	4	790	c.581G>T	c.(580-582)cGa>cTa	p.R194L	SMARCA2_ENST00000382194.1_Missense_Mutation_p.R194L|SMARCA2_ENST00000357248.2_Missense_Mutation_p.R194L|SMARCA2_ENST00000349721.2_Missense_Mutation_p.R194L|SMARCA2_ENST00000491574.1_3'UTR|RP11-264I13.2_ENST00000426860.1_RNA			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	194	QLQ. {ECO:0000255|PROSITE- ProRule:PRU01001}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		ATGCTGGCCCGAGGCCAGCCC	0.587																																							uc003zhc.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(580-582)CGA>CTA		SWI/SNF-related matrix-associated							30.0	33.0	32.0					9																	2039691		2203	4300	6503	SO:0001583	missense	6595				chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding	g.chr9:2039691G>T	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.581G>T	9.37:g.2039691G>T	ENSP00000371638:p.Arg194Leu					SMARCA2_uc003zhd.2_Missense_Mutation_p.R194L|SMARCA2_uc010mha.2_Missense_Mutation_p.R185L	p.R194L	NM_003070	NP_003061	P51531	SMCA2_HUMAN		GBM - Glioblastoma multiforme(50;0.0475)	4	680	+		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)	194					B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	c.581G>T	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	G	34	5.391053	0.95988	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000450198;ENST00000382203;ENST00000382194	D;D;T;D;D	0.90133	-2.54;-2.62;0.49;-2.54;-2.62	5.6	5.6	0.85130	Glutamine-Leucine-Glutamine, QLQ (2);	0.000000	0.64402	D	0.000001	D	0.95284	0.8470	M	0.79258	2.445	0.80722	D	1	D;D	0.55800	0.966;0.973	P;D	0.65773	0.897;0.938	D	0.95298	0.8401	10	0.72032	D	0.01	-17.1108	19.6091	0.95594	0.0:0.0:1.0:0.0	.	194;194	P51531-2;P51531	.;SMCA2_HUMAN	L	194	ENSP00000265773:R194L;ENSP00000349788:R194L;ENSP00000392081:R194L;ENSP00000371638:R194L;ENSP00000371629:R194L	ENSP00000265773:R194L	R	+	2	0	SMARCA2	2029691	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.860000	0.99555	2.650000	0.89964	0.655000	0.94253	CGA		0.587	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070		5	29	1	0	0.000602214	0.000602	0.000682066	5	29				
MPDZ	8777	broad.mit.edu	37	9	13216825	13216825	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr9:13216825C>A	ENST00000319217.7	-	10	1485	c.1238G>T	c.(1237-1239)aGc>aTc	p.S413I	MPDZ_ENST00000381015.4_Missense_Mutation_p.S413I|MPDZ_ENST00000546205.1_Missense_Mutation_p.S413I|MPDZ_ENST00000381022.2_Missense_Mutation_p.S413I|MPDZ_ENST00000536827.1_Missense_Mutation_p.S413I|MPDZ_ENST00000447879.1_Missense_Mutation_p.S413I|MPDZ_ENST00000541718.1_Missense_Mutation_p.S413I	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	413	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		AACGGCACTGCTTTTTGTAAT	0.318																																							uc010mia.1		NA																	0				ovary(5)|central_nervous_system(1)	6						c.(1237-1239)AGC>ATC		multiple PDZ domain protein							151.0	135.0	140.0					9																	13216825		1823	4070	5893	SO:0001583	missense	8777				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding	g.chr9:13216825C>A	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.1238G>T	9.37:g.13216825C>A	ENSP00000320006:p.Ser413Ile					MPDZ_uc010mhy.2_Missense_Mutation_p.S413I|MPDZ_uc010mhz.2_Missense_Mutation_p.S413I|MPDZ_uc011lmn.1_Missense_Mutation_p.S413I|MPDZ_uc003zlb.3_Missense_Mutation_p.S413I	p.S413I	NM_003829	NP_003820	O75970	MPDZ_HUMAN		GBM - Glioblastoma multiforme(50;2.03e-06)	9	1295	-			413			PDZ 3.		A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37	c.1238G>T		.	.	.	.	.	.	.	.	.	.	C	21.6	4.169011	0.78339	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67;1.67;1.67	5.77	5.77	0.91146	.	0.000000	0.51477	D	0.000100	T	0.37999	0.1024	L	0.47190	1.495	0.80722	D	1	P;P;P	0.44877	0.845;0.813;0.813	P;B;B	0.44860	0.462;0.332;0.414	T	0.15896	-1.0421	10	0.87932	D	0	.	19.9837	0.97340	0.0:1.0:0.0:0.0	.	413;413;413	B7ZMI4;O75970-3;O75970-2	.;.;.	I	413	ENSP00000320006:S413I;ENSP00000439807:S413I;ENSP00000370410:S413I;ENSP00000444151:S413I;ENSP00000415208:S413I;ENSP00000370403:S413I;ENSP00000446358:S413I	ENSP00000320006:S413I	S	-	2	0	MPDZ	13206825	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.523000	0.67099	2.723000	0.93209	0.655000	0.94253	AGC		0.318	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		7	26	1	0	3.09899e-07	0.004482	3.80414e-07	7	26				
ADAMTSL1	92949	broad.mit.edu	37	9	18680333	18680333	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr9:18680333C>A	ENST00000380548.4	+	11	1499	c.1160C>A	c.(1159-1161)gCg>gAg	p.A387E	ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.A387E|ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.A370E|ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.A387E	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	387	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CCATGGACCGCGTGCTCCTCC	0.602																																							uc003zne.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5						c.(1159-1161)GCG>GAG		ADAMTS-like 1 isoform 4 precursor							43.0	39.0	41.0					9																	18680333		2203	4300	6503	SO:0001583	missense	92949					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr9:18680333C>A	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.1160C>A	9.37:g.18680333C>A	ENSP00000369921:p.Ala387Glu					ADAMTSL1_uc003znb.2_Missense_Mutation_p.A370E|ADAMTSL1_uc003znc.3_Missense_Mutation_p.A387E	p.A387E	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN		GBM - Glioblastoma multiforme(50;1.29e-17)	11	1287	+			387			TSP type-1 2.		A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	c.1160C>A	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.570796	0.28003	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000380566;ENST00000276935	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	6.17	6.17	0.99709	.	.	.	.	.	T	0.46658	0.1404	N	0.05554	-0.025	0.80722	D	1	D;B	0.57257	0.979;0.087	P;B	0.62885	0.908;0.041	T	0.31223	-0.9951	9	0.08179	T	0.78	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	387;370	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	E	387;387;370;387	ENSP00000369921:A387E;ENSP00000327887:A387E;ENSP00000369940:A370E;ENSP00000276935:A387E	ENSP00000276935:A387E	A	+	2	0	ADAMTSL1	18670333	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.739000	0.84976	2.941000	0.99782	0.655000	0.94253	GCG		0.602	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			9	25	1	0	1.12685e-05	0.004482	1.33529e-05	9	25				
SLC28A3	64078	broad.mit.edu	37	9	86905118	86905118	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr9:86905118C>G	ENST00000376238.4	-	11	1149	c.1100G>C	c.(1099-1101)gGg>gCg	p.G367A	SLC28A3_ENST00000537648.1_Missense_Mutation_p.G298A|RP11-380F14.2_ENST00000419815.1_RNA	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	367			G -> R (reduced transport of inosine and thymidine). {ECO:0000269|PubMed:15738947}.		pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	GGTAGAGAACCCGGCGGTCAT	0.458																																					Ovarian(106;425 1539 34835 42413 43572)	Ovarian(106;425 1539 34835 42413 43572)	uc010mpz.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						c.(1099-1101)GGG>GCG		concentrative Na+-nucleoside cotransporter							114.0	108.0	110.0					9																	86905118		2203	4300	6503	SO:0001583	missense	64078				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding	g.chr9:86905118C>G	AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1100G>C	9.37:g.86905118C>G	ENSP00000365413:p.Gly367Ala					SLC28A3_uc011lsy.1_Missense_Mutation_p.G298A|SLC28A3_uc004anu.1_Missense_Mutation_p.G367A	p.G367A	NM_022127	NP_071410	Q9HAS3	S28A3_HUMAN			11	1225	-			367		G -> R (reduced transport of inosine and thymidine).	Helical; (Potential).		A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	ENST00000376238.4	37	c.1100G>C	CCDS6670.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743031	0.89663	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	T;T	0.29142	1.58;1.58	5.82	5.82	0.92795	Nucleoside recognition (1);	0.000000	0.85682	D	0.000000	T	0.66147	0.2760	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.72124	-0.4385	10	0.87932	D	0	-17.6672	20.1008	0.97874	0.0:1.0:0.0:0.0	.	367	Q9HAS3	S28A3_HUMAN	A	367;298	ENSP00000365413:G367A;ENSP00000446438:G298A	ENSP00000365413:G367A	G	-	2	0	SLC28A3	86094938	1.000000	0.71417	0.915000	0.36163	0.583000	0.36354	7.686000	0.84128	2.756000	0.94617	0.563000	0.77884	GGG		0.458	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052874.1	NM_022127		12	63	0	0	0	0.003163	0	12	63				
SPATA31E1	286234	broad.mit.edu	37	9	90500907	90500907	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr9:90500907A>T	ENST00000325643.5	+	4	1571	c.1505A>T	c.(1504-1506)cAg>cTg	p.Q502L		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	502					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											cacatggcccagccccaacat	0.632																																							uc004app.3		NA																	0				ovary(3)	3						c.(1504-1506)CAG>CTG		chromosome 9 open reading frame 79							48.0	51.0	50.0					9																	90500907		2203	4300	6503	SO:0001583	missense	286234					integral to membrane		g.chr9:90500907A>T	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.1505A>T	9.37:g.90500907A>T	ENSP00000322640:p.Gln502Leu					C9orf79_uc004apo.1_Missense_Mutation_p.Q314L	p.Q502L	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN			4	1540	+			502					B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	c.1505A>T	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	a	11.79	1.745148	0.30955	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.12255	2.7	2.2	1.04	0.20106	.	1.267590	0.05657	N	0.586134	T	0.16342	0.0393	L	0.46819	1.47	0.09310	N	1	P;P	0.49783	0.928;0.9	P;P	0.47573	0.55;0.451	T	0.18618	-1.0331	10	0.45353	T	0.12	.	3.7706	0.08640	0.804:0.0:0.196:0.0	.	502;154	Q6ZUB1;Q8NA33	CI079_HUMAN;.	L	502;154	ENSP00000322640:Q502L	ENSP00000322640:Q502L	Q	+	2	0	C9orf79	89690727	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.209000	0.09358	0.294000	0.22547	0.491000	0.48974	CAG		0.632	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828		20	46	0	0	0	0.007413	0	20	46				
NOL8	55035	broad.mit.edu	37	9	95077881	95077881	+	Silent	SNP	T	T	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr9:95077881T>C	ENST00000535387.1	-	6	1025	c.1026A>G	c.(1024-1026)aaA>aaG	p.K342K	NOL8_ENST00000542053.1_Silent_p.K274K|NOL8_ENST00000358855.4_Silent_p.K274K|NOL8_ENST00000545558.1_Silent_p.K342K|NOL8_ENST00000442668.2_Silent_p.K342K					nucleolar protein 8											endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						GAACGCCTGATTTGAAATCAT	0.353																																							uc004arv.2		NA																	0				ovary(1)	1						c.(1024-1026)AAA>AAG		nucleolar protein 8							68.0	60.0	63.0					9																	95077881		1838	4091	5929	SO:0001819	synonymous_variant	55035				DNA replication|positive regulation of cell growth	nucleolus	nucleotide binding|protein binding|RNA binding	g.chr9:95077881T>C	AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000535387.1:c.1026A>G	9.37:g.95077881T>C						NOL8_uc010mqw.2_RNA|NOL8_uc004arw.2_Intron|NOL8_uc011ltw.1_Silent_p.K274K	p.K342K	NM_017948	NP_060418	Q76FK4	NOL8_HUMAN			7	1363	-			342						Silent	SNP	ENST00000535387.1	37	c.1026A>G	CCDS47993.1																																																																																				0.353	NOL8-010	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053082.2	NM_017948		4	18	0	0	0	0.000602	0	4	18				
FAM120A	23196	broad.mit.edu	37	9	96233568	96233568	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr9:96233568G>A	ENST00000277165.6	+	2	814	c.620G>A	c.(619-621)cGg>cAg	p.R207Q	FAM120A_ENST00000340893.4_Missense_Mutation_p.R207Q|FAM120A_ENST00000333936.5_Missense_Mutation_p.R207Q|FAM120A_ENST00000375389.3_Missense_Mutation_p.R207Q	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	207						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						AAACTGAGCCGGAACGGGAAA	0.458																																							uc004atw.2		NA																	0					0						c.(619-621)CGG>CAG		oxidative stress-associated Src activator							162.0	137.0	145.0					9																	96233568		2203	4300	6503	SO:0001583	missense	23196					cytoplasm|plasma membrane	RNA binding	g.chr9:96233568G>A	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.620G>A	9.37:g.96233568G>A	ENSP00000277165:p.Arg207Gln					FAM120A_uc004atv.2_Missense_Mutation_p.R207Q|FAM120A_uc004atx.2_5'UTR|FAM120A_uc004aty.2_5'UTR	p.R207Q	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN			2	645	+			207					A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	ENST00000277165.6	37	c.620G>A	CCDS6706.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.8|24.8	4.571620|4.571620	0.86542|0.86542	.|.	.|.	ENSG00000048828|ENSG00000048828	ENST00000446420|ENST00000375389;ENST00000277165;ENST00000333936;ENST00000340893	.|T;T;T;T	.|0.45276	.|0.9;0.9;0.9;0.9	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.000000	.|0.64402	.|D	.|0.000003	T|T	0.57007|0.57007	0.2024|0.2024	L|L	0.47716|0.47716	1.5|1.5	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.89917	.|1.0;0.999	.|D;P	.|0.65233	.|0.933;0.848	T|T	0.49133|0.49133	-0.8971|-0.8971	5|10	.|0.34782	.|T	.|0.22	-15.4231|-15.4231	19.1568|19.1568	0.93514|0.93514	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|207;207	.|Q9NZB2;Q9NZB2-2	.|F120A_HUMAN;.	R|Q	50|207	.|ENSP00000364538:R207Q;ENSP00000277165:R207Q;ENSP00000334918:R207Q;ENSP00000344698:R207Q	.|ENSP00000277165:R207Q	G|R	+|+	1|2	0|0	FAM120A|FAM120A	95273389|95273389	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.916000|0.916000	0.54674|0.54674	7.568000|7.568000	0.82369|0.82369	2.832000|2.832000	0.97577|0.97577	0.655000|0.655000	0.94253|0.94253	GGA|CGG		0.458	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053160.2	NM_014612		11	75	0	0	0	0.010729	0	11	75				
OR1Q1	158131	broad.mit.edu	37	9	125377261	125377261	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr9:125377261T>A	ENST00000297913.2	+	1	314	c.245T>A	c.(244-246)cTg>cAg	p.L82Q	RP11-64P14.7_ENST00000431442.1_RNA	NM_012364.1	NP_036496.1	Q15612	OR1Q1_HUMAN	olfactory receptor, family 1, subfamily Q, member 1	82					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	17						CCCAAGATGCTGCAGATTATT	0.473																																							uc011lyy.1		NA																	0				ovary(1)	1						c.(244-246)CTG>CAG		olfactory receptor, family 1, subfamily Q,							183.0	176.0	179.0					9																	125377261		2203	4300	6503	SO:0001583	missense	158131				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125377261T>A		CCDS35125.1	9q33.2	2013-09-20			ENSG00000165202	ENSG00000165202		"""GPCR / Class A : Olfactory receptors"""	8223	protein-coding gene	gene with protein product				OR1Q2, OR1Q3			Standard	NM_012364		Approved	OST226, OR9-A, HSTPCR106, OST226OR9-A, TPCR106	uc011lyy.2	Q15612	OTTHUMG00000020615	ENST00000297913.2:c.245T>A	9.37:g.125377261T>A	ENSP00000297913:p.Leu82Gln						p.L82Q	NM_012364	NP_036496	Q15612	OR1Q1_HUMAN			1	245	+			82			Extracellular (Potential).		Q6IFN4|Q8NGR7|Q96R82	Missense_Mutation	SNP	ENST00000297913.2	37	c.245T>A	CCDS35125.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.065364	0.76187	.	.	ENSG00000165202	ENST00000297913	T	0.00433	7.43	5.34	5.34	0.76211	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38548	N	0.001646	T	0.02304	0.0071	H	0.97465	4.01	0.41278	D	0.986897	D	0.89917	1.0	D	0.76575	0.988	T	0.03374	-1.1043	10	0.87932	D	0	-23.4814	14.4451	0.67345	0.0:0.0:0.0:1.0	.	82	Q15612	OR1Q1_HUMAN	Q	82	ENSP00000297913:L82Q	ENSP00000297913:L82Q	L	+	2	0	OR1Q1	124417082	0.476000	0.25901	0.730000	0.30809	0.889000	0.51656	3.998000	0.57024	2.253000	0.74438	0.533000	0.62120	CTG		0.473	OR1Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053946.1			41	180	0	0	0	0.006999	0	41	180				
SLC27A4	10999	broad.mit.edu	37	9	131118034	131118034	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr9:131118034G>T	ENST00000300456.4	+	12	1850	c.1733G>T	c.(1732-1734)cGc>cTc	p.R578L	SLC27A4_ENST00000372870.1_Missense_Mutation_p.R172L	NM_005094.3	NP_005085.2	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid transporter), member 4	578					fatty acid transport (GO:0015908)|lipid metabolic process (GO:0006629)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|response to nutrient (GO:0007584)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)|very long-chain fatty acid catabolic process (GO:0042760)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)	13						CTGTATGCGCGCCCCATCTTC	0.637																																					Pancreas(107;1554 2241 10946 12953)	Pancreas(107;1554 2241 10946 12953)	uc004but.2		NA																	0					0						c.(1732-1734)CGC>CTC		solute carrier family 27 (fatty acid							93.0	81.0	85.0					9																	131118034		2203	4300	6503	SO:0001583	missense	10999				long-chain fatty acid transport|transmembrane transport	integral to membrane	fatty acid transporter activity|nucleotide binding|protein binding	g.chr9:131118034G>T	AF055899	CCDS6899.1	9q34.13	2013-05-22			ENSG00000167114	ENSG00000167114		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10998	protein-coding gene	gene with protein product		604194				9878842	Standard	NM_005094		Approved	FATP4, ACSVL4	uc004but.3	Q6P1M0	OTTHUMG00000020746	ENST00000300456.4:c.1733G>T	9.37:g.131118034G>T	ENSP00000300456:p.Arg578Leu					SLC27A4_uc004buu.2_Missense_Mutation_p.R172L	p.R578L	NM_005094	NP_005085	Q6P1M0	S27A4_HUMAN			12	2017	+			578					A8K2F7|O95186|Q96G53	Missense_Mutation	SNP	ENST00000300456.4	37	c.1733G>T	CCDS6899.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.532393	0.64972	.	.	ENSG00000167114	ENST00000372870;ENST00000300456	T;T	0.47869	0.83;0.83	4.95	4.06	0.47325	.	0.117696	0.56097	D	0.000021	T	0.61627	0.2362	M	0.73962	2.25	0.58432	D	0.999997	D;P	0.76494	0.999;0.935	D;P	0.69654	0.965;0.727	T	0.59862	-0.7374	10	0.27082	T	0.32	-29.5317	8.1944	0.31387	0.2463:0.0:0.7537:0.0	.	172;578	Q96G53;Q6P1M0	.;S27A4_HUMAN	L	172;578	ENSP00000361961:R172L;ENSP00000300456:R578L	ENSP00000300456:R578L	R	+	2	0	SLC27A4	130157855	0.991000	0.36638	1.000000	0.80357	0.555000	0.35460	3.736000	0.55052	1.312000	0.45043	0.563000	0.77884	CGC		0.637	SLC27A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054432.2			26	82	1	0	9.65021e-13	0.010818	1.40304e-12	26	82				
SHOX	6473	broad.mit.edu	37	X	591804	591804	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chrX:591804G>C	ENST00000554971.1	+	1	263	c.172G>C	c.(172-174)Gac>Cac	p.D58H	SHOX_ENST00000381578.1_Missense_Mutation_p.D58H|SHOX_ENST00000381575.1_Missense_Mutation_p.D58H|SHOX_ENST00000334060.3_Missense_Mutation_p.D58H			O15266	SHOX_HUMAN	short stature homeobox	58					skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|lung(9)|prostate(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAGCCTCCAGGACATCACGGA	0.602																																					Ovarian(95;18 1419 12424 14056 28266)	Ovarian(95;18 1419 12424 14056 28266)	uc004cph.1		NA																	0					0						c.(172-174)GAC>CAC		short stature homeobox isoform SHOXa							86.0	104.0	98.0					X																	591804		2203	4296	6499	SO:0001583	missense	6473				skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:591804G>C	U82668	CCDS14106.1, CCDS14107.1	Xp22.33 and Yp11.32	2014-07-16			ENSG00000185960	ENSG00000185960		"""Pseudoautosomal regions / PAR1"", ""Homeoboxes / PRD class"""	10853	protein-coding gene	gene with protein product		312865, 400020				9259282, 9140395	Standard	XR_247282		Approved	PHOG, GCFX, SS, SHOXY	uc004cph.1	O15266	OTTHUMG00000021053	ENST00000554971.1:c.172G>C	X.37:g.591804G>C	ENSP00000452016:p.Asp58His					SHOX_uc004cpi.2_Missense_Mutation_p.D58H	p.D58H	NM_000451	NP_000442	O15266	SHOX_HUMAN			2	863	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	58					O00412|O00413|O15267	Missense_Mutation	SNP	ENST00000554971.1	37	c.172G>C	CCDS14107.1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.724776	0.30593	.	.	ENSG00000185960	ENST00000334060;ENST00000381578;ENST00000554971;ENST00000381575	D;D;D;D	0.94497	-3.44;-3.32;-3.32;-3.44	1.73	1.73	0.24493	.	1.387420	0.04836	U	0.439540	D	0.95516	0.8543	L	0.51422	1.61	0.09310	N	1	D;B	0.53885	0.963;0.38	P;B	0.57620	0.824;0.191	D	0.86947	0.2083	10	0.56958	D	0.05	.	11.6658	0.51372	0.0:0.0:1.0:0.0	.	58;58	O15266-2;O15266	.;SHOX_HUMAN	H	58	ENSP00000335505:D58H;ENSP00000370990:D58H;ENSP00000452016:D58H;ENSP00000370987:D58H	ENSP00000335505:D58H	D	+	1	0	SHOX	511804	1.000000	0.71417	0.663000	0.29738	0.623000	0.37688	7.046000	0.76592	0.764000	0.33197	0.275000	0.19346	GAC		0.602	SHOX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411999.3	NM_000451		20	83	0	0	0	0.012319	0	20	83				
ASMT	438	broad.mit.edu	37	X	1746629	1746629	+	Silent	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chrX:1746629C>A	ENST00000381229.4	+	4	444	c.408C>A	c.(406-408)ggC>ggA	p.G136G	ASMT_ENST00000381241.3_Silent_p.G136G|ASMT_ENST00000381233.3_Silent_p.G136G			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	136					cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	AGACGTTTGGCGTTCCCGCTG	0.378																																							uc004cqd.2		NA																	0				skin(1)	1						c.(406-408)GGC>GGA		acetylserotonin O-methyltransferase							256.0	243.0	247.0					X																	1746629		2203	4296	6499	SO:0001819	synonymous_variant	438				melatonin biosynthetic process|translation	cytosol	acetylserotonin O-methyltransferase activity|S-methyltransferase activity	g.chrX:1746629C>A	M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.408C>A	X.37:g.1746629C>A						ASMT_uc010ncy.2_Silent_p.G136G|ASMT_uc004cqe.2_Silent_p.G136G	p.G136G	NM_004043	NP_004034	P46597	HIOM_HUMAN			5	553	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	136					B2RC33|Q16598|Q5JQ72|Q5JQ73	Silent	SNP	ENST00000381229.4	37	c.408C>A																																																																																					0.378	ASMT-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055612.1	NM_004043		22	169	1	0	4.7796e-09	0.004656	6.24088e-09	22	169				
FAM47B	170062	broad.mit.edu	37	X	34961245	34961245	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chrX:34961245G>T	ENST00000329357.5	+	1	333	c.297G>T	c.(295-297)aaG>aaT	p.K99N		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	99										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AGCTGCTCAAGAAAGCGGCCC	0.527																																							uc004ddi.1		NA																	0				ovary(3)|breast(1)	4						c.(295-297)AAG>AAT		hypothetical protein LOC170062							91.0	84.0	86.0					X																	34961245		2202	4300	6502	SO:0001583	missense	170062							g.chrX:34961245G>T	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.297G>T	X.37:g.34961245G>T	ENSP00000328307:p.Lys99Asn						p.K99N	NM_152631	NP_689844	Q8NA70	FA47B_HUMAN			1	315	+			99					Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	c.297G>T	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	g	5.663	0.306931	0.10733	.	.	ENSG00000189132	ENST00000329357	T	0.20200	2.09	0.834	-1.67	0.08238	.	.	.	.	.	T	0.21022	0.0506	M	0.78049	2.395	0.09310	N	1	B	0.14805	0.011	B	0.16289	0.015	T	0.34054	-0.9844	9	0.52906	T	0.07	.	2.9415	0.05831	0.2086:0.0:0.5329:0.2585	.	99	Q8NA70	FA47B_HUMAN	N	99	ENSP00000328307:K99N	ENSP00000328307:K99N	K	+	3	2	FAM47B	34871166	0.143000	0.22626	0.002000	0.10522	0.010000	0.07245	-0.487000	0.06505	-0.804000	0.04410	-0.753000	0.03488	AAG		0.527	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		13	29	1	0	0.00244969	0.00245	0.00268549	13	29				
UBA1	7317	broad.mit.edu	37	X	47060987	47060987	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chrX:47060987G>T	ENST00000335972.6	+	8	972	c.789G>T	c.(787-789)caG>caT	p.Q263H	UBA1_ENST00000377351.4_Missense_Mutation_p.Q263H	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	263	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ACGGAAATCAGCCCATGGAGA	0.552																																							uc004dhj.3		NA																	0				ovary(1)	1						c.(787-789)CAG>CAT		ubiquitin-activating enzyme E1							34.0	30.0	31.0					X																	47060987		2203	4300	6503	SO:0001583	missense	7317				cell death|protein modification process		ATP binding|ligase activity|protein binding|small protein activating enzyme activity	g.chrX:47060987G>T	AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.789G>T	X.37:g.47060987G>T	ENSP00000338413:p.Gln263His					UBA1_uc004dhk.3_Missense_Mutation_p.Q263H	p.Q263H	NM_153280	NP_695012	P22314	UBA1_HUMAN			8	940	+			263			2 approximate repeats.		Q5JRR8|Q96E13	Missense_Mutation	SNP	ENST00000335972.6	37	c.789G>T	CCDS14275.1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.754927	0.31046	.	.	ENSG00000130985	ENST00000377351;ENST00000412206;ENST00000442035;ENST00000335972	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	4.74	0.895	0.19247	Molybdenum cofactor biosynthesis, MoeB (1);	0.390390	0.28566	N	0.014894	T	0.16514	0.0397	N	0.21097	0.63	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.05954	-1.0854	10	0.56958	D	0.05	-3.4157	4.2708	0.10785	0.3463:0.0:0.4939:0.1598	.	263	P22314	UBA1_HUMAN	H	263;263;277;263	ENSP00000366568:Q263H;ENSP00000415033:Q263H;ENSP00000389583:Q277H;ENSP00000338413:Q263H	ENSP00000338413:Q263H	Q	+	3	2	UBA1	46945931	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.065000	0.30592	0.156000	0.19299	0.509000	0.49947	CAG		0.552	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056389.1	NM_003334		14	9	1	0	1.37285e-15	0.004007	2.06937e-15	14	9				
HEPH	9843	broad.mit.edu	37	X	65480099	65480099	+	Missense_Mutation	SNP	G	G	C	rs187860440		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chrX:65480099G>C	ENST00000343002.2	+	18	3858	c.3194G>C	c.(3193-3195)cGa>cCa	p.R1065P	HEPH_ENST00000519389.1_Missense_Mutation_p.R1119P|HEPH_ENST00000441993.2_Missense_Mutation_p.R1068P|HEPH_ENST00000374727.3_Missense_Mutation_p.R1068P|HEPH_ENST00000419594.1_Missense_Mutation_p.R876P|HEPH_ENST00000336279.5_Missense_Mutation_p.R798P			Q9BQS7	HEPH_HUMAN	hephaestin	1065	Plastocyanin-like 6.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						GTTTTTTCTCGAACAGGTAAG	0.473																																							uc011moz.1		NA																	0				lung(5)|ovary(4)	9						c.(3202-3204)CGA>CCA		hephaestin isoform a							92.0	74.0	80.0					X																	65480099		2203	4300	6503	SO:0001583	missense	9843				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity	g.chrX:65480099G>C	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.3194G>C	X.37:g.65480099G>C	ENSP00000343939:p.Arg1065Pro					HEPH_uc004dwn.2_Missense_Mutation_p.R1068P|HEPH_uc004dwo.2_Missense_Mutation_p.R798P|HEPH_uc010nkr.2_Missense_Mutation_p.R876P|HEPH_uc011mpa.1_Missense_Mutation_p.R1068P	p.R1068P	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN			19	3263	+			1065			Extracellular (Potential).|Plastocyanin-like 6.		B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37	c.3203G>C		.	.	.	.	.	.	.	.	.	.	G	11.33	1.608072	0.28623	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002	D;D;D;D;D;D	0.99277	-5.67;-5.66;-5.66;-5.66;-5.67;-5.66	4.57	-4.96	0.03038	Cupredoxin (2);	0.840351	0.10393	N	0.680154	D	0.97695	0.9244	L	0.52573	1.65	0.09310	N	1	P;P;P	0.42827	0.723;0.791;0.484	P;P;P	0.48654	0.546;0.507;0.585	D	0.96257	0.9188	10	0.30854	T	0.27	.	5.7234	0.18000	0.4237:0.2502:0.3261:0.0	.	1119;876;1065	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	P	1119;1068;798;1068;876;1065	ENSP00000430620:R1119P;ENSP00000363859:R1068P;ENSP00000337418:R798P;ENSP00000411687:R1068P;ENSP00000413211:R876P;ENSP00000343939:R1065P	ENSP00000337418:R798P	R	+	2	0	HEPH	65396824	0.000000	0.05858	0.000000	0.03702	0.132000	0.20833	-0.729000	0.04920	-0.893000	0.03930	-1.202000	0.01658	CGA		0.473	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737		16	11	0	0	0	0.004007	0	16	11				
AWAT1	158833	broad.mit.edu	37	X	69455988	69455988	+	Splice_Site	SNP	C	C	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chrX:69455988C>A	ENST00000374521.3	+	3	295	c.254C>A	c.(253-255)aCg>aAg	p.T85K	AWAT1_ENST00000480702.1_3'UTR	NM_001013579.2	NP_001013597.1	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	85					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)	p.T165M(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(3)|ovary(4)|skin(1)	15						TTCCCCATTACGGTAAGTATC	0.483																																							uc004dxy.2		NA																	1	Substitution - Missense(1)	p.T165M(1)	ovary(1)	ovary(3)	3						c.(253-255)ACG>AAG		wax synthase 1							135.0	113.0	121.0					X																	69455988		2203	4300	6503	SO:0001630	splice_region_variant	158833				lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	long-chain-alcohol O-fatty-acyltransferase activity	g.chrX:69455988C>A	BC039181	CCDS35321.1	Xq13.1	2010-01-25	2009-02-23	2009-02-23	ENSG00000204195	ENSG00000204195			23252	protein-coding gene	gene with protein product		300924	"""diacylglycerol O-acyltransferase 2-like 3"""	DGAT2L3		14970677, 15671038	Standard	NM_001013579		Approved		uc004dxy.3	Q58HT5	OTTHUMG00000021773	ENST00000374521.3:c.255+1C>A	X.37:g.69455988C>A							p.T85K	NM_001013579	NP_001013597	Q58HT5	AWAT1_HUMAN			3	295	+			85					Q5JT21|Q6IEE4	Missense_Mutation	SNP	ENST00000374521.3	37	c.254C>A	CCDS35321.1	.	.	.	.	.	.	.	.	.	.	c	0.007	-1.983992	0.00443	.	.	ENSG00000204195	ENST00000374521	T	0.11712	2.75	5.25	2.17	0.27698	.	0.262350	0.31909	N	0.006875	T	0.03871	0.0109	N	0.12961	0.28	0.09310	N	0.999999	B	0.06786	0.001	B	0.09377	0.004	T	0.42982	-0.9419	10	0.02654	T	1	-0.7886	2.7563	0.05294	0.3799:0.3822:0.1446:0.0932	.	85	Q58HT5	AWAT1_HUMAN	K	85	ENSP00000363645:T85K	ENSP00000363645:T85K	T	+	2	0	AWAT1	69372713	0.348000	0.24861	0.253000	0.24343	0.121000	0.20230	-0.111000	0.10807	0.442000	0.26555	0.591000	0.81541	ACG		0.483	AWAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057066.3	NM_001013579	Missense_Mutation	17	26	1	0	1.96292e-10	0.010504	2.63006e-10	17	26				
DPF2	5977	broad.mit.edu	37	11	65119159	65119173	+	In_Frame_Del	DEL	TGGAGCTGCCACCTG	TGGAGCTGCCACCTG	-			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	TGGAGCTGCCACCTG	TGGAGCTGCCACCTG	-	-	TGGAGCTGCCACCTG	TGGAGCTGCCACCTG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr11:65119159_65119173delTGGAGCTGCCACCTG	ENST00000528416.1	+	11	1238_1252	c.1105_1119delTGGAGCTGCCACCTG	c.(1105-1119)tggagctgccacctgdel	p.WSCHL369del	DPF2_ENST00000415073.2_In_Frame_Del_p.WSCHL185del|DPF2_ENST00000252268.4_In_Frame_Del_p.WSCHL383del	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	369					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)	p.C371S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						TGCAGGAAGTTGGAGCTGCCACCTGTGTCTGGACC	0.521																																							uc001odm.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)	1						c.(1105-1119)TGGAGCTGCCACCTGdel		D4, zinc and double PHD fingers family 2																																				SO:0001651	inframe_deletion	5977				apoptosis|induction of apoptosis by extracellular signals|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	nucleic acid binding|zinc ion binding	g.chr11:65119159_65119173delTGGAGCTGCCACCTG	U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.1105_1119delTGGAGCTGCCACCTG	11.37:g.65119159_65119173delTGGAGCTGCCACCTG	ENSP00000436901:p.Trp369_Leu373del					DPF2_uc001odn.2_In_Frame_Del_p.WSCHL383del|DPF2_uc010roe.1_In_Frame_Del_p.WSCHL185del	p.WSCHL369del	NM_006268	NP_006259	Q92785	REQU_HUMAN			11	1117_1131	+			369_373			PHD-type 2.		A8K7C9|B4DT58	In_Frame_Del	DEL	ENST00000528416.1	37	c.1105_1119delTGGAGCTGCCACCTG	CCDS8100.1																																																																																				0.521	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268		8	123	NA	NA	NA	NA	NA	8	123	---	---	---	---
IGHV7-27	28383	broad.mit.edu	37	14	106774086	106774087	+	IGR	INS	-	-	AGTAATACACGGCA	rs376590598		TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr14:106774086_106774087insAGTAATACACGGCA								IGHV2-26 (15970 upstream) : IGHV4-28 (6425 downstream)																							GCCTCTTGCACGTGTCCTCAGC	0.55																																							uc010tyt.1		NA																	0					0						c.e430+1		Parts of antibodies, mostly variable regions.																																				SO:0001628	intergenic_variant	8755							g.chr14:106774086_106774087insAGTAATACACGGCA																													14.37:g.106774086_106774087insAGTAATACACGGCA														430		-									Splice_Site	INS		37	c.15674_splice																																																																																				0	0.550									3	6	NA	NA	NA	NA	NA	3	6	---	---	---	---
RASAL3	64926	broad.mit.edu	37	19	15572382	15572382	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:15572382delG	ENST00000343625.7	-	3	450	c.365delC	c.(364-366)ccafs	p.P122fs		NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	122	Pro-rich.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						AGGGATCTGTGGGGTAGGGGG	0.617																																							uc002nbe.2		NA																	0					0						c.(364-366)CCAfs		RAS protein activator like 3							10.0	13.0	12.0					19																	15572382		1927	4119	6046	SO:0001589	frameshift_variant	64926				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity	g.chr19:15572382delG		CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.365delC	19.37:g.15572382delG	ENSP00000341905:p.Pro122fs						p.P122fs	NM_022904	NP_075055	Q86YV0	RASL3_HUMAN			3	451	-			122			Pro-rich.		Q8N2T9|Q9H735	Frame_Shift_Del	DEL	ENST00000343625.7	37	c.365delC	CCDS46006.1																																																																																				0.617	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461331.3	NM_022904		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
TMC4	147798	broad.mit.edu	37	19	54675747	54675749	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	TCC	TCC	-	-	TCC	TCC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr19:54675747_54675749delTCC	ENST00000376591.4	-	2	332_334	c.201_203delGGA	c.(199-204)gaggat>gat	p.E67del	TMC4_ENST00000476013.2_5'Flank|TMC4_ENST00000301187.4_In_Frame_Del_p.E61del	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	67	Poly-Glu.				ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CCTTCCTCCATCCTCCTCCTCCT	0.645																																							uc010erf.2		NA																	0				pancreas(1)	1						c.(199-204)GAGGAT>GAT		transmembrane channel-like 4 isoform 1			,	38,3,4223		14,0,10,0,3,2105					,	-8.3	0.0			104	37,2,8215		15,0,7,0,2,4103	no	codingComplex,codingComplex	TMC4	NM_144686.2,NM_001145303.1	,	29,0,17,0,5,6208	A1A1,A1A2,A1R,A2A2,A2R,RR		0.4725,0.9615,0.6391	,	,		75,5,12438				SO:0001651	inframe_deletion	147798					integral to membrane		g.chr19:54675747_54675749delTCC	AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.201_203delGGA	19.37:g.54675756_54675758delTCC	ENSP00000365776:p.Glu67del					TMC4_uc002qdo.2_In_Frame_Del_p.E61del	p.E67del	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN			2	333_335	-	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		67			Poly-Glu.|Extracellular (Potential).		Q7Z5M3|Q8N5E4|Q8TBS7	In_Frame_Del	DEL	ENST00000376591.4	37	c.201_203delGGA	CCDS46174.1																																																																																				0.645	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000156164.2			7	104	NA	NA	NA	NA	NA	7	104	---	---	---	---
TATDN1	83940	broad.mit.edu	37	8	125500846	125500847	+	Frame_Shift_Ins	INS	-	-	A			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chr8:125500846_125500847insA	ENST00000276692.6	-	12	919_920	c.882_883insT	c.(880-885)tttcctfs	p.P295fs	RP11-158K1.3_ENST00000518639.1_RNA|TATDN1_ENST00000519548.1_Frame_Shift_Ins_p.P248fs	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1	295					DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TATATTCCAGGAAAAAATACTT	0.292																																							uc003yrd.2		NA																	0					0						c.(880-885)TTTCCTfs		TatD DNase domain containing 1 isoform a			,,	4,4242		0,4,2119					,,	4.6	1.0			43	0,8190		0,0,4095	no	frameshift,utr-3,frameshift	RNF139,TATDN1	NM_032026.3,NM_007218.3,NM_001146160.1	,,	0,4,6214	A1A1,A1R,RR		0.0,0.0942,0.0322	,,	,,		4,12432				SO:0001589	frameshift_variant	83940					nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding	g.chr8:125500846_125500847insA	AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068	ENST00000276692.6:c.883dupT	8.37:g.125500852_125500852dupA	ENSP00000276692:p.Pro295fs					RNF139_uc003yrc.2_3'UTR|TATDN1_uc003yre.2_RNA|TATDN1_uc010mdm.2_Frame_Shift_Ins_p.F247fs|TATDN1_uc003yrf.2_Frame_Shift_Ins_p.F330fs	p.F294fs	NM_032026	NP_114415	Q6P1N9	TATD1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		12	924_925	-	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		294_295					B2R5J0|Q8TD02|Q9BY40	Frame_Shift_Ins	INS	ENST00000276692.6	37	c.882_883insT	CCDS6351.1																																																																																				0.292	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381655.1	NM_032026		7	73	NA	NA	NA	NA	NA	7	73	---	---	---	---
RBM10	8241	broad.mit.edu	37	X	47041360	47041364	+	Frame_Shift_Del	DEL	CGTCT	CGTCT	-			TCGA-55-7815-01A-11D-2167-08	TCGA-55-7815-10A-01D-2167-08	CGTCT	CGTCT	-	-	CGTCT	CGTCT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	4e4d9dd0-a990-4ec5-841b-7d443b86b059	29aa803b-8c42-444f-8c78-6349908d88e9	g.chrX:47041360_47041364delCGTCT	ENST00000377604.3	+	16	2446_2450	c.1704_1708delCGTCT	c.(1702-1710)gacgtctctfs	p.VS569fs	RBM10_ENST00000329236.7_Frame_Shift_Del_p.VS491fs|RBM10_ENST00000345781.6_Frame_Shift_Del_p.VS492fs	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	569	Tyr-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						CTGTTCCCGACGTCTCTACCTACCA	0.58																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	0				ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.(1702-1710)GACGTCTCTfs		RNA binding motif protein 10 isoform 1																																				SO:0001589	frameshift_variant	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47041360_47041364delCGTCT	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.1704_1708delCGTCT	X.37:g.47041360_47041364delCGTCT	ENSP00000366829:p.Val569fs					RBM10_uc004dhg.2_Frame_Shift_Del_p.D490fs|RBM10_uc004dhh.2_Frame_Shift_Del_p.D567fs|RBM10_uc010nhq.2_Frame_Shift_Del_p.D491fs|RBM10_uc004dhi.2_Frame_Shift_Del_p.D633fs	p.D568fs	NM_005676	NP_005667	P98175	RBM10_HUMAN			16	2083_2087	+			568_570			Tyr-rich.		C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Frame_Shift_Del	DEL	ENST00000377604.3	37	c.1704_1708delCGTCT	CCDS14274.1																																																																																				0.580	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676		15	21	NA	NA	NA	NA	NA	15	21	---	---	---	---
