#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PER3	8863	broad.mit.edu	37	1	7887411	7887411	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:7887411C>T	ENST00000361923.2	+	17	2573	c.2398C>T	c.(2398-2400)Cca>Tca	p.P800S	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.P808S	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	800	Pro-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		TTACCTCGTCCCAGCTTTTCC	0.697																																							uc001aoo.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(2398-2400)CCA>TCA		period 3							48.0	50.0	49.0					1																	7887411		2203	4300	6503	SO:0001583	missense	8863				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity	g.chr1:7887411C>T	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2398C>T	1.37:g.7887411C>T	ENSP00000355031:p.Pro800Ser					PER3_uc009vmg.1_Missense_Mutation_p.P808S|PER3_uc009vmh.1_Missense_Mutation_p.P801S|PER3_uc001aop.2_Missense_Mutation_p.P808S|PER3_uc010nzw.1_Missense_Mutation_p.P489S	p.P800S	NM_016831	NP_058515	P56645	PER3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)	17	2573	+	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)	800			Pro-rich.		Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	c.2398C>T	CCDS89.1	.	.	.	.	.	.	.	.	.	.	C	12.11	1.838756	0.32513	.	.	ENSG00000049246	ENST00000377532;ENST00000361923;ENST00000539773	T;T	0.14640	2.49;2.56	4.33	1.13	0.20643	.	2.169720	0.01999	N	0.046162	T	0.09730	0.0239	L	0.31065	0.9	0.09310	N	1	P;B;B;P	0.34864	0.473;0.184;0.28;0.473	B;B;B;B	0.27715	0.056;0.038;0.082;0.056	T	0.22068	-1.0227	10	0.40728	T	0.16	.	3.5258	0.07759	0.1753:0.518:0.0:0.3068	.	800;808;808;800	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	S	808;800;11	ENSP00000366755:P808S;ENSP00000355031:P800S	ENSP00000355031:P800S	P	+	1	0	PER3	7809998	0.000000	0.05858	0.001000	0.08648	0.269000	0.26545	0.033000	0.13754	0.437000	0.26423	0.561000	0.74099	CCA		0.697	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831		19	73	0	0	0	0.007413	0	19	73				
UBE4B	10277	broad.mit.edu	37	1	10228257	10228257	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:10228257G>T	ENST00000253251.8	+	23	3714	c.2875G>T	c.(2875-2877)Gcc>Tcc	p.A959S	UBE4B_ENST00000343090.6_Missense_Mutation_p.A1088S|UBE4B_ENST00000377157.3_Missense_Mutation_p.A843S					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CTCTTACCTCGCCCTGGCCAC	0.582																																							uc001aqs.3		NA																	0				ovary(2)|skin(2)	4						c.(3262-3264)GCC>TCC		ubiquitination factor E4B isoform 1							104.0	81.0	89.0					1																	10228257		2203	4300	6503	SO:0001583	missense	10277				apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding	g.chr1:10228257G>T	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.2875G>T	1.37:g.10228257G>T	ENSP00000253251:p.Ala959Ser					UBE4B_uc001aqr.3_Missense_Mutation_p.A959S|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_Missense_Mutation_p.A543S|UBE4B_uc001aqu.2_5'Flank	p.A1088S	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)	24	3975	+		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	1088						Missense_Mutation	SNP	ENST00000253251.8	37	c.3262G>T	CCDS110.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.798187	0.70567	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.41065	1.01;1.01;1.01	5.2	5.2	0.72013	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.33206	0.0855	N	0.12746	0.255	0.58432	D	0.999999	P;P	0.49447	0.924;0.792	P;B	0.48815	0.591;0.361	T	0.06534	-1.0821	10	0.08599	T	0.76	-18.8345	18.7638	0.91864	0.0:0.0:1.0:0.0	.	1088;959	O95155;O95155-2	UBE4B_HUMAN;.	S	959;843;1088	ENSP00000253251:A959S;ENSP00000366362:A843S;ENSP00000343001:A1088S	ENSP00000253251:A959S	A	+	1	0	UBE4B	10150844	1.000000	0.71417	0.949000	0.38748	0.683000	0.39861	8.054000	0.89451	2.426000	0.82243	0.563000	0.77884	GCC		0.582	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048		6	37	1	0	5.9392e-07	0.001168	8.31245e-07	6	37				
PLOD1	5351	broad.mit.edu	37	1	12024297	12024297	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:12024297G>T	ENST00000196061.4	+	12	1295	c.1268G>T	c.(1267-1269)aGt>aTt	p.S423I	PLOD1_ENST00000376369.3_Missense_Mutation_p.S470I	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	423					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	GGGGCTCTCAGTGCAGATGGC	0.632																																							uc001atm.2		NA																	0				ovary(2)|breast(1)	3						c.(1267-1269)AGT>ATT		lysyl hydroxylase 1 precursor	Minoxidil(DB00350)|Succinic acid(DB00139)|Vitamin C(DB00126)						154.0	152.0	153.0					1																	12024297		2203	4300	6503	SO:0001583	missense	5351				epidermis development|hydroxylysine biosynthetic process|protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein homodimerization activity	g.chr1:12024297G>T	BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.1268G>T	1.37:g.12024297G>T	ENSP00000196061:p.Ser423Ile					PLOD1_uc010obb.1_Missense_Mutation_p.S470I	p.S423I	NM_000302	NP_000293	Q02809	PLOD1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	12	1359	+	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	423					B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	ENST00000196061.4	37	c.1268G>T	CCDS142.1	.	.	.	.	.	.	.	.	.	.	G	33	5.269002	0.95429	.	.	ENSG00000083444	ENST00000376369;ENST00000196061	D;D	0.83837	-1.77;-1.77	5.36	5.36	0.76844	.	0.086760	0.85682	D	0.000000	D	0.90259	0.6954	M	0.84082	2.675	0.80722	D	1	D;D	0.62365	0.988;0.991	P;P	0.57502	0.806;0.822	D	0.91740	0.5403	10	0.87932	D	0	.	17.6594	0.88188	0.0:0.0:1.0:0.0	.	470;423	B4DR87;Q02809	.;PLOD1_HUMAN	I	470;423	ENSP00000365548:S470I;ENSP00000196061:S423I	ENSP00000196061:S423I	S	+	2	0	PLOD1	11946884	1.000000	0.71417	0.997000	0.53966	0.943000	0.58893	9.732000	0.98816	2.506000	0.84524	0.655000	0.94253	AGT		0.632	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006865.1	NM_000302		37	159	1	0	4.01765e-15	0.009718	7.31749e-15	37	159				
PADI3	51702	broad.mit.edu	37	1	17575706	17575706	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:17575706C>A	ENST00000375460.3	+	1	114	c.74C>A	c.(73-75)aCc>aAc	p.T25N		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	25					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GGCGTGGAGACCCTCGTGGAC	0.612																																							uc001bai.2		NA																	0				ovary(1)|breast(1)	2						c.(73-75)ACC>AAC		peptidyl arginine deiminase, type III	L-Citrulline(DB00155)						150.0	128.0	135.0					1																	17575706		2203	4300	6503	SO:0001583	missense	51702				peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity	g.chr1:17575706C>A	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.74C>A	1.37:g.17575706C>A	ENSP00000364609:p.Thr25Asn						p.T25N	NM_016233	NP_057317	Q9ULW8	PADI3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	1	114	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)	25					Q58EY7|Q70SX5	Missense_Mutation	SNP	ENST00000375460.3	37	c.74C>A	CCDS179.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.231917	0.79688	.	.	ENSG00000142619	ENST00000375460	T	0.11277	2.79	5.56	5.56	0.83823	Cupredoxin (1);Protein-arginine deiminase (PAD) N-terminal (1);	0.237456	0.36101	N	0.002784	T	0.28830	0.0715	L	0.54323	1.7	0.38893	D	0.957163	D	0.76494	0.999	D	0.85130	0.997	T	0.00829	-1.1549	10	0.56958	D	0.05	-33.7316	15.0247	0.71659	0.0:1.0:0.0:0.0	.	25	Q9ULW8	PADI3_HUMAN	N	25	ENSP00000364609:T25N	ENSP00000364609:T25N	T	+	2	0	PADI3	17448293	0.964000	0.33143	0.997000	0.53966	0.979000	0.70002	1.782000	0.38654	2.627000	0.88993	0.561000	0.74099	ACC		0.612	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1			13	47	1	0	9.31168e-06	0.001855	1.22305e-05	13	47				
UBR4	23352	broad.mit.edu	37	1	19525396	19525396	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:19525396G>A	ENST00000375254.3	-	4	432	c.405C>T	c.(403-405)ggC>ggT	p.G135G	UBR4_ENST00000375217.2_Silent_p.G135G|UBR4_ENST00000375226.2_Silent_p.G135G|UBR4_ENST00000375267.2_Silent_p.G135G	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	135					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CAGTGCACAGGCCCTTGATTA	0.373																																							uc001bbi.2		NA																	0				kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25						c.(403-405)GGC>GGT		retinoblastoma-associated factor 600							90.0	89.0	90.0					1																	19525396		2203	4300	6503	SO:0001819	synonymous_variant	23352				interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:19525396G>A	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.405C>T	1.37:g.19525396G>A							p.G135G	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)	4	409	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)	135					A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	37	c.405C>T	CCDS189.1																																																																																				0.373	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765		19	58	0	0	0	0.006122	0	19	58				
DNAJC8	22826	broad.mit.edu	37	1	28559490	28559490	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:28559490C>A	ENST00000263697.4	-	1	46	c.20G>T	c.(19-21)aGc>aTc	p.S7I	DNAJC8_ENST00000489277.1_5'UTR	NM_014280.2	NP_055095.2	O75937	DNJC8_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 8	7					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)				kidney(1)|large_intestine(3)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;4.08e-05)|all_lung(284;4.29e-05)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.0105)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		OV - Ovarian serous cystadenocarcinoma(117;2.81e-22)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00275)|BRCA - Breast invasive adenocarcinoma(304;0.0059)|STAD - Stomach adenocarcinoma(196;0.00671)|READ - Rectum adenocarcinoma(331;0.0649)		TGAAGTCCCGCTCTCTCCTGA	0.632																																							uc001bpn.2		NA																	0					0						c.(19-21)AGC>ATC		DnaJ (Hsp40) homolog, subfamily C, member 8							37.0	47.0	44.0					1																	28559490		2091	4205	6296	SO:0001583	missense	22826				nuclear mRNA splicing, via spliceosome|protein folding	nucleoplasm	heat shock protein binding|unfolded protein binding	g.chr1:28559490C>A	AF083190	CCDS41292.1	1p35	2011-09-02			ENSG00000126698	ENSG00000126698		"""Heat shock proteins / DNAJ (HSP40)"""	15470	protein-coding gene	gene with protein product						11147971	Standard	NM_014280		Approved	SPF31	uc001bpn.3	O75937	OTTHUMG00000003538	ENST00000263697.4:c.20G>T	1.37:g.28559490C>A	ENSP00000263697:p.Ser7Ile					DNAJC8_uc001bpo.2_RNA	p.S7I	NM_014280	NP_055095	O75937	DNJC8_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;2.81e-22)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00275)|BRCA - Breast invasive adenocarcinoma(304;0.0059)|STAD - Stomach adenocarcinoma(196;0.00671)|READ - Rectum adenocarcinoma(331;0.0649)	1	53	-		Colorectal(325;3.46e-05)|Lung NSC(340;4.08e-05)|all_lung(284;4.29e-05)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.0105)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)	7					B4DUU4|D3DPM0|Q6IBA4|Q8N4Z5|Q9P051|Q9P067	Missense_Mutation	SNP	ENST00000263697.4	37	c.20G>T	CCDS41292.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719003	0.68844	.	.	ENSG00000126698	ENST00000263697	T	0.64991	-0.13	4.66	4.66	0.58398	.	0.287960	0.41294	D	0.000915	T	0.55641	0.1933	L	0.39898	1.24	0.46317	D	0.998981	B	0.18166	0.026	B	0.25291	0.059	T	0.55661	-0.8106	10	0.52906	T	0.07	-12.8418	14.9192	0.70822	0.0:1.0:0.0:0.0	.	7	O75937	DNJC8_HUMAN	I	7	ENSP00000263697:S7I	ENSP00000263697:S7I	S	-	2	0	DNAJC8	28432077	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.383000	0.44354	2.585000	0.87301	0.655000	0.94253	AGC		0.632	DNAJC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009860.1	NM_014280		5	32	1	0	0.00116845	0.001168	0.00134126	5	32				
THRAP3	9967	broad.mit.edu	37	1	36752298	36752298	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:36752298G>C	ENST00000354618.5	+	4	691	c.467G>C	c.(466-468)cGc>cCc	p.R156P	THRAP3_ENST00000469141.2_Missense_Mutation_p.R156P	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	156	Arg-rich.|Required for mRNA splicing activation.|Ser-rich.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGGTCAAGGCGCTCCTCATCC	0.527			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)	Pancreas(129;785 1795 20938 23278 32581)	uc001cae.3		NA		Dom	yes		1	1p34.3	9967	T	thyroid hormone receptor associated protein 3 (TRAP150)			M	USP6		aneurysmal bone cysts		0				ovary(5)|lung(3)|breast(1)	9						c.(466-468)CGC>CCC		thyroid hormone receptor associated protein 3							204.0	213.0	210.0					1																	36752298		2203	4300	6503	SO:0001583	missense	9967				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr1:36752298G>C	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.467G>C	1.37:g.36752298G>C	ENSP00000346634:p.Arg156Pro					THRAP3_uc001caf.3_Missense_Mutation_p.R156P|THRAP3_uc001cag.1_Missense_Mutation_p.R156P	p.R156P	NM_005119	NP_005110	Q9Y2W1	TR150_HUMAN			4	691	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	156			Arg-rich.|Ser-rich.		D3DPS5|Q5VTK6	Missense_Mutation	SNP	ENST00000354618.5	37	c.467G>C	CCDS405.1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240974	0.39598	.	.	ENSG00000054118	ENST00000354618;ENST00000469141	T;T	0.15256	2.44;2.44	5.65	4.73	0.59995	.	0.000000	0.64402	D	0.000003	T	0.25457	0.0619	M	0.65498	2.005	0.40985	D	0.984803	P	0.36249	0.545	B	0.40329	0.326	T	0.06427	-1.0827	10	0.87932	D	0	-0.1811	14.0186	0.64539	0.0:0.1511:0.8489:0.0	.	156	Q9Y2W1	TR150_HUMAN	P	156	ENSP00000346634:R156P;ENSP00000433825:R156P	ENSP00000346634:R156P	R	+	2	0	THRAP3	36524885	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.723000	0.54955	1.371000	0.46172	0.655000	0.94253	CGC		0.527	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119		60	240	0	0	0	0.00361	0	60	240				
PTCH2	8643	broad.mit.edu	37	1	45294011	45294011	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:45294011G>A	ENST00000372192.3	-	13	1796	c.1666C>T	c.(1666-1668)Cgg>Tgg	p.R556W	PTCH2_ENST00000447098.2_Missense_Mutation_p.R556W	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	556					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)	p.R556W(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					CAGTGGCGCCGCCGTAGGTCC	0.657									Basal Cell Nevus syndrome																														uc010olf.1		NA																	1	Substitution - Missense(1)		endometrium(1)	lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18						c.(1666-1668)CGG>TGG		patched 2							52.0	56.0	54.0					1																	45294011		2203	4300	6503	SO:0001583	missense	8643	Basal_Cell_Nevus_syndrome	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity	g.chr1:45294011G>A	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.1666C>T	1.37:g.45294011G>A	ENSP00000361266:p.Arg556Trp					PTCH2_uc010olg.1_Missense_Mutation_p.R254W	p.R556W	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN			13	1678	-	Acute lymphoblastic leukemia(166;0.155)		556			Cytoplasmic (Potential).		O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	37	c.1666C>T	CCDS516.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959758	0.74016	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.97430	-4.38;-4.38	4.93	4.0	0.46444	.	0.000000	0.49305	D	0.000147	D	0.98664	0.9552	M	0.93594	3.435	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.989;0.999	D	0.99120	1.0849	10	0.87932	D	0	-13.8247	12.0484	0.53493	0.0:0.0:0.6869:0.3131	.	556;556	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	W	556	ENSP00000389703:R556W;ENSP00000361266:R556W	ENSP00000361266:R556W	R	-	1	2	PTCH2	45066598	1.000000	0.71417	0.949000	0.38748	0.955000	0.61496	4.836000	0.62789	1.026000	0.39733	0.313000	0.20887	CGG		0.657	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	NM_003738		10	30	0	0	0	0.001368	0	10	30				
DMBX1	127343	broad.mit.edu	37	1	46977793	46977793	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:46977793C>A	ENST00000360032.3	+	4	775	c.761C>A	c.(760-762)tCc>tAc	p.S254Y	DMBX1_ENST00000371956.4_Missense_Mutation_p.S259Y	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1											endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					TATTCCTCGTCCCCGCTGAGC	0.637																																							uc001cpx.2		NA																	0				ovary(1)	1						c.(775-777)TCC>TAC		diencephalon/mesencephalon homeobox 1 isoform b							81.0	85.0	83.0					1																	46977793		2203	4300	6503	SO:0001583	missense	127343				brain development|developmental growth|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:46977793C>A	AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.761C>A	1.37:g.46977793C>A	ENSP00000353132:p.Ser254Tyr					DMBX1_uc001cpw.2_Missense_Mutation_p.S254Y	p.S259Y	NM_147192	NP_671725	Q8NFW5	DMBX1_HUMAN			4	791	+	Acute lymphoblastic leukemia(166;0.155)		259						Missense_Mutation	SNP	ENST00000360032.3	37	c.776C>A	CCDS536.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701652	0.88924	.	.	ENSG00000197587	ENST00000371956;ENST00000360032	D;D	0.95724	-3.75;-3.79	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.96778	0.8948	L	0.49126	1.545	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.74348	0.962;0.983	D	0.97450	1.0027	10	0.87932	D	0	.	17.6836	0.88250	0.0:1.0:0.0:0.0	.	259;254	Q8NFW5;Q8NFW5-2	DMBX1_HUMAN;.	Y	259;254	ENSP00000361024:S259Y;ENSP00000353132:S254Y	ENSP00000353132:S254Y	S	+	2	0	DMBX1	46750380	1.000000	0.71417	0.988000	0.46212	0.983000	0.72400	7.706000	0.84615	2.502000	0.84385	0.655000	0.94253	TCC		0.637	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021895.1			33	124	1	0	2.09667e-21	0.003755	4.16286e-21	33	124				
EFCAB14	9813	broad.mit.edu	37	1	47183662	47183662	+	Missense_Mutation	SNP	C	C	A	rs200133048		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:47183662C>A	ENST00000371933.3	-	1	1074	c.98G>T	c.(97-99)cGc>cTc	p.R33L	EFCAB14_ENST00000544071.1_Missense_Mutation_p.R33L	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	33							calcium ion binding (GO:0005509)										AGGCTCAGTGCGAAGCAGGCG	0.537																																							uc001cqk.3		NA																	0					0						c.(97-99)CGC>CTC		hypothetical protein LOC9813		C	LEU/ARG	0,4406		0,0,2203	81.0	78.0	79.0		98	5.2	1.0	1		79	4,8596	3.7+/-12.6	0,4,4296	no	missense	KIAA0494	NM_014774.2	102	0,4,6499	AA,AC,CC		0.0465,0.0,0.0308	probably-damaging	33/496	47183662	4,13002	2203	4300	6503	SO:0001583	missense	9813						calcium ion binding	g.chr1:47183662C>A	AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.98G>T	1.37:g.47183662C>A	ENSP00000361001:p.Arg33Leu					KIAA0494_uc010omh.1_Missense_Mutation_p.R33L|KIAA0494_uc001cql.1_Missense_Mutation_p.R33L	p.R33L	NM_014774	NP_055589	O75071	K0494_HUMAN			1	1075	-	Acute lymphoblastic leukemia(166;0.155)		33					D3DQ23|Q5SXB8	Missense_Mutation	SNP	ENST00000371933.3	37	c.98G>T	CCDS30706.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768693	0.90020	0.0	4.65E-4	ENSG00000159658	ENST00000544071;ENST00000371933	T;T	0.51574	0.7;1.59	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.66317	0.2777	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.993;0.993;0.997	T	0.67225	-0.5724	10	0.72032	D	0.01	-2.8666	19.1736	0.93590	0.0:1.0:0.0:0.0	.	33;33;33	F5H7K3;B7Z444;O75071	.;.;K0494_HUMAN	L	33	ENSP00000442465:R33L;ENSP00000361001:R33L	ENSP00000361001:R33L	R	-	2	0	KIAA0494	46956249	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.304000	0.72800	2.836000	0.97738	0.655000	0.94253	CGC		0.537	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021931.1	NM_014774		7	34	1	0	8.12818e-05	0.001984	9.89581e-05	7	34				
TAL1	6886	broad.mit.edu	37	1	47685528	47685528	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:47685528G>T	ENST00000294339.3	-	4	1436	c.860C>A	c.(859-861)cCc>cAc	p.P287H	TAL1_ENST00000459729.1_5'UTR|TAL1_ENST00000371883.3_Missense_Mutation_p.P289H|TAL1_ENST00000371884.2_Missense_Mutation_p.P287H	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	287					angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						GCTGGAGTTGGGGGAAAGCAC	0.711			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																		uc001cqx.2		NA		Dom	yes		1	1p32	6886	T	T-cell acute lymphocytic leukemia 1 (SCL)			L	TRD@|SIL		lymphoblastic leukemia/biphasic		0				lung(1)	1						c.(859-861)CCC>CAC		T-cell acute lymphocytic leukemia 1							25.0	30.0	28.0					1																	47685528		2186	4276	6462	SO:0001583	missense	6886				basophil differentiation|cell fate commitment|cell proliferation|embryonic hemopoiesis|erythrocyte differentiation|megakaryocyte differentiation|positive regulation of cell division|positive regulation of chromatin assembly or disassembly|positive regulation of erythrocyte differentiation|positive regulation of mitotic cell cycle|positive regulation of protein complex assembly|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	E-box binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity	g.chr1:47685528G>T	M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.860C>A	1.37:g.47685528G>T	ENSP00000294339:p.Pro287His					TAL1_uc009vyq.2_Missense_Mutation_p.P44T|TAL1_uc001cqy.2_Missense_Mutation_p.P287H	p.P287H	NM_003189	NP_003180	P17542	TAL1_HUMAN			4	1437	-			287					D3DQ24	Missense_Mutation	SNP	ENST00000294339.3	37	c.860C>A	CCDS547.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.757588	0.89843	.	.	ENSG00000162367	ENST00000371884;ENST00000371883;ENST00000294339	D;D;D	0.98666	-5.04;-5.06;-5.04	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.98460	0.9487	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99933	1.1335	10	0.72032	D	0.01	.	18.406	0.90536	0.0:0.0:1.0:0.0	.	287	P17542	TAL1_HUMAN	H	287;289;287	ENSP00000360951:P287H;ENSP00000360950:P289H;ENSP00000294339:P287H	ENSP00000294339:P287H	P	-	2	0	TAL1	47458115	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.400000	0.97290	2.363000	0.80096	0.478000	0.44815	CCC		0.711	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021640.1	NM_003189		5	32	1	0	1.23904e-05	0.000602	1.59673e-05	5	32				
ELAVL4	1996	broad.mit.edu	37	1	50610738	50610738	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:50610738C>A	ENST00000371823.4	+	2	343	c.119C>A	c.(118-120)aCc>aAc	p.T40N	ELAVL4_ENST00000371821.1_Missense_Mutation_p.T45N|ELAVL4_ENST00000371827.1_Missense_Mutation_p.T40N|ELAVL4_ENST00000371824.1_Missense_Mutation_p.T40N|ELAVL4_ENST00000492299.1_3'UTR|ELAVL4_ENST00000448907.2_Missense_Mutation_p.T43N|ELAVL4_ENST00000371819.1_Missense_Mutation_p.T45N|ELAVL4_ENST00000357083.4_Missense_Mutation_p.T57N	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4	40					mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						ACAGGGGCAACCACAGATGAC	0.473																																							uc001csb.2		NA																	0				ovary(1)|pancreas(1)	2						c.(118-120)ACC>AAC		ELAV-like 4 isoform 1							112.0	98.0	103.0					1																	50610738		2203	4300	6503	SO:0001583	missense	1996				mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding	g.chr1:50610738C>A	AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.119C>A	1.37:g.50610738C>A	ENSP00000360888:p.Thr40Asn					ELAVL4_uc001cry.3_Missense_Mutation_p.T43N|ELAVL4_uc001crz.3_Missense_Mutation_p.T40N|ELAVL4_uc001csa.3_Missense_Mutation_p.T57N|ELAVL4_uc001csc.3_Missense_Mutation_p.T40N|ELAVL4_uc009vyu.2_Missense_Mutation_p.T45N|ELAVL4_uc010omz.1_Missense_Mutation_p.T45N	p.T40N	NM_021952	NP_068771	P26378	ELAV4_HUMAN			2	387	+			40					B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Missense_Mutation	SNP	ENST00000371823.4	37	c.119C>A	CCDS553.1	.	.	.	.	.	.	.	.	.	.	C	8.012	0.757730	0.15846	.	.	ENSG00000162374	ENST00000448907;ENST00000371827;ENST00000357083;ENST00000371824;ENST00000371823;ENST00000371821;ENST00000371819	T;T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31;1.31	6.16	6.16	0.99307	Nucleotide-binding, alpha-beta plait (1);	0.332825	0.35407	N	0.003239	T	0.22704	0.0548	N	0.03608	-0.345	0.42832	D	0.99402	B;B;B;B;B;B;B	0.19583	0.002;0.0;0.003;0.0;0.003;0.003;0.037	B;B;B;B;B;B;B	0.20184	0.007;0.002;0.016;0.004;0.016;0.016;0.028	T	0.10497	-1.0627	10	0.33141	T	0.24	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	45;45;40;40;57;40;43	B1APY9;B1APY8;P26378-2;P26378;P26378-3;P26378-4;B7Z4G7	.;.;.;ELAV4_HUMAN;.;.;.	N	43;40;57;40;40;45;45	ENSP00000399939:T43N;ENSP00000360892:T40N;ENSP00000349594:T57N;ENSP00000360889:T40N;ENSP00000360888:T40N;ENSP00000360886:T45N;ENSP00000360884:T45N	ENSP00000349594:T57N	T	+	2	0	ELAVL4	50383325	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.629000	0.83207	2.937000	0.99478	0.650000	0.86243	ACC		0.473	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000021712.1	NM_021952		13	63	1	0	0.000219431	0.00245	0.000259743	13	63				
ZCCHC11	23318	broad.mit.edu	37	1	52981709	52981709	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:52981709C>A	ENST00000371544.3	-	3	998	c.736G>T	c.(736-738)Gaa>Taa	p.E246*	ZCCHC11_ENST00000355809.4_Nonsense_Mutation_p.E246*|ZCCHC11_ENST00000371541.1_5'UTR|ZCCHC11_ENST00000257177.4_Nonsense_Mutation_p.E246*	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	246					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						TTATTAGATTCATCATTCTTC	0.318																																							uc001ctx.2		NA																	0				ovary(2)|skin(1)	3						c.(736-738)GAA>TAA		zinc finger, CCHC domain containing 11 isoform							66.0	64.0	65.0					1																	52981709		2202	4300	6502	SO:0001587	stop_gained	23318				miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding	g.chr1:52981709C>A	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.736G>T	1.37:g.52981709C>A	ENSP00000360599:p.Glu246*					ZCCHC11_uc001cty.2_Nonsense_Mutation_p.E246*|ZCCHC11_uc001ctz.2_Nonsense_Mutation_p.E246*|ZCCHC11_uc009vze.1_Nonsense_Mutation_p.E246*|ZCCHC11_uc009vzf.1_Nonsense_Mutation_p.E5*|ZCCHC11_uc001cub.2_Nonsense_Mutation_p.E246*|ZCCHC11_uc001cuc.2_RNA|ZCCHC11_uc001cud.2_Nonsense_Mutation_p.E246*	p.E246*	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN			3	970	-			246					A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Nonsense_Mutation	SNP	ENST00000371544.3	37	c.736G>T	CCDS30716.1	.	.	.	.	.	.	.	.	.	.	C	36	5.837402	0.97009	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000484723;ENST00000355809	.	.	.	5.26	5.26	0.73747	.	0.299670	0.28442	N	0.015335	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	17.0499	0.86516	0.0:1.0:0.0:0.0	.	.	.	.	X	246;246;246;5;246	.	ENSP00000257177:E246X	E	-	1	0	ZCCHC11	52754297	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.868000	0.63021	2.474000	0.83562	0.655000	0.94253	GAA		0.318	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288		9	35	1	0	0.00448238	0.004482	0.00499424	9	35				
PODN	127435	broad.mit.edu	37	1	53544622	53544622	+	Silent	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:53544622G>C	ENST00000312553.5	+	8	1591	c.1584G>C	c.(1582-1584)ctG>ctC	p.L528L	PODN_ENST00000395871.2_Silent_p.L386L|PODN_ENST00000371500.3_Silent_p.L509L|RP11-334A14.5_ENST00000447867.1_RNA	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	480					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TGCGTGAGCTGTACCTCACCA	0.662																																							uc001cuv.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1582-1584)CTG>CTC		podocan							12.0	10.0	11.0					1																	53544622		2185	4278	6463	SO:0001819	synonymous_variant	127435				negative regulation of cell migration|negative regulation of cell proliferation	cytoplasm|extracellular space|proteinaceous extracellular matrix	collagen binding	g.chr1:53544622G>C	AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.1584G>C	1.37:g.53544622G>C						PODN_uc001cuw.2_Silent_p.L509L|PODN_uc010onr.1_Silent_p.L509L|PODN_uc010ons.1_Silent_p.L386L	p.L528L	NM_153703	NP_714914	Q7Z5L7	PODN_HUMAN			8	1591	+			480			LRR 16.		B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Silent	SNP	ENST00000312553.5	37	c.1584G>C	CCDS573.1																																																																																				0.662	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024735.1	NM_153703		3	5	0	0	0	0.004672	0	3	5				
NDC1	55706	broad.mit.edu	37	1	54252918	54252918	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:54252918T>A	ENST00000371429.3	-	16	2311	c.1713A>T	c.(1711-1713)ttA>ttT	p.L571F	NDC1_ENST00000537333.1_Missense_Mutation_p.L236F|NDC1_ENST00000234725.8_Missense_Mutation_p.L456F|NDC1_ENST00000540001.1_Missense_Mutation_p.S535C	NM_001168551.1|NM_018087.4	NP_001162023.1|NP_060557.3	Q9BTX1	NDC1_HUMAN	NDC1 transmembrane nucleoporin	571					mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore distribution (GO:0031081)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)										ATGCTGCTACTAAGTGCGACA	0.343																																						Ovarian(178;223 2720 6667 9715)	uc001cvs.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1711-1713)TTA>TTT		transmembrane protein 48							140.0	142.0	141.0					1																	54252918		2203	4300	6503	SO:0001583	missense	55706				mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore	g.chr1:54252918T>A	AL354613	CCDS583.1	1p32.3	2014-01-28	2013-05-23	2013-05-23	ENSG00000058804	ENSG00000058804			25525	protein-coding gene	gene with protein product	"""nuclear division cycle 1 homolog (S. cerevisiae)"""	610115	"""transmembrane protein 48"""	TMEM48		16779818, 12958361	Standard	NR_033142		Approved	FLJ10407, NET3		Q9BTX1	OTTHUMG00000008073	ENST00000371429.3:c.1713A>T	1.37:g.54252918T>A	ENSP00000360483:p.Leu571Phe					TMEM48_uc010onu.1_Missense_Mutation_p.L531F|TMEM48_uc001cvt.2_Missense_Mutation_p.L448F|TMEM48_uc009vzk.2_RNA|TMEM48_uc010onv.1_Missense_Mutation_p.L236F	p.L571F	NM_018087	NP_060557	Q9BTX1	NDC1_HUMAN			16	1954	-			571			Cytoplasmic (Potential).		B4DHA3|B4DQQ5|G3XA81|Q8NB76|Q9H9T6|Q9NSG3|Q9NSG4|Q9NVZ7	Missense_Mutation	SNP	ENST00000371429.3	37	c.1713A>T	CCDS583.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.06|18.06	3.539648|3.539648	0.65085|0.65085	.|.	.|.	ENSG00000058804|ENSG00000058804	ENST00000371429;ENST00000360494;ENST00000537333;ENST00000234725|ENST00000540001	T;T;T|T	0.70749|0.50548	-0.51;-0.51;-0.51|0.74	4.33|4.33	-0.877|-0.877	0.10621|0.10621	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.49712|0.49712	0.1573|0.1573	M|M	0.75777|0.75777	2.31|2.31	0.21184|0.21184	N|N	0.999763|0.999763	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.50866|0.50866	-0.8777|-0.8777	10|7	0.46703|0.87932	T|D	0.11|0	.|.	3.2416|3.2416	0.06783|0.06783	0.3462:0.3664:0.0:0.2874|0.3462:0.3664:0.0:0.2874	.|.	531;571|.	B4DHA3;Q9BTX1|.	.;NDC1_HUMAN|.	F|C	571;454;236;456|535	ENSP00000360483:L571F;ENSP00000439947:L236F;ENSP00000234725:L456F|ENSP00000440873:S535C	ENSP00000234725:L456F|ENSP00000440873:S535C	L|S	-|-	3|1	2|0	TMEM48|TMEM48	54025506|54025506	0.980000|0.980000	0.34600|0.34600	0.998000|0.998000	0.56505|0.56505	0.990000|0.990000	0.78478|0.78478	0.009000|0.009000	0.13219|0.13219	-0.069000|-0.069000	0.12931|0.12931	0.482000|0.482000	0.46254|0.46254	TTA|AGT		0.343	NDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022101.1	NM_018087		25	135	0	0	0	0.003954	0	25	135				
YIPF1	54432	broad.mit.edu	37	1	54337113	54337113	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:54337113C>A	ENST00000072644.1	-	7	749	c.413G>T	c.(412-414)gGg>gTg	p.G138V	YIPF1_ENST00000539954.1_Missense_Mutation_p.G163V|YIPF1_ENST00000469457.1_5'UTR|YIPF1_ENST00000371399.1_5'UTR	NM_018982.4	NP_061855.1	Q9Y548	YIPF1_HUMAN	Yip1 domain family, member 1	138						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|skin(1)|urinary_tract(2)	19						GGAAAGATTCCCACTAATTGC	0.423																																							uc001cvu.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(412-414)GGG>GTG		Yip1 domain family, member 1							125.0	120.0	122.0					1																	54337113		2203	4300	6503	SO:0001583	missense	54432					integral to membrane|transport vesicle		g.chr1:54337113C>A	BC009674	CCDS584.1	1p33-p32.1	2008-02-05			ENSG00000058799	ENSG00000058799		"""Yip1 domain family"""	25231	protein-coding gene	gene with protein product						12477932	Standard	NM_018982		Approved	DJ167A19.1, FinGER1	uc001cvu.3	Q9Y548	OTTHUMG00000008074	ENST00000072644.1:c.413G>T	1.37:g.54337113C>A	ENSP00000072644:p.Gly138Val					YIPF1_uc001cvv.2_RNA|YIPF1_uc001cvw.2_RNA|YIPF1_uc001cvx.2_RNA|YIPF1_uc001cvy.2_RNA	p.G138V	NM_018982	NP_061855	Q9Y548	YIPF1_HUMAN			7	750	-			138			Helical; (Potential).		B2RCM7|D3DQ40|Q9NWJ1	Missense_Mutation	SNP	ENST00000072644.1	37	c.413G>T	CCDS584.1	.	.	.	.	.	.	.	.	.	.	C	31	5.061455	0.93846	.	.	ENSG00000058799	ENST00000072644;ENST00000539954;ENST00000412288	T;T;T	0.45276	0.9;0.9;0.9	5.66	5.66	0.87406	Yip1 domain (1);	0.000000	0.85682	D	0.000000	T	0.72906	0.3519	M	0.89840	3.065	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.77349	-0.2621	10	0.59425	D	0.04	-39.5206	19.76	0.96311	0.0:1.0:0.0:0.0	.	138	Q9Y548	YIPF1_HUMAN	V	138;163;138	ENSP00000072644:G138V;ENSP00000439926:G163V;ENSP00000416507:G138V	ENSP00000072644:G138V	G	-	2	0	YIPF1	54109701	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.707000	0.84623	2.666000	0.90696	0.655000	0.94253	GGG		0.423	YIPF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022103.5	NM_018982		27	86	1	0	9.39395e-14	0.00632	1.66651e-13	27	86				
FAM151A	338094	broad.mit.edu	37	1	55077354	55077354	+	Silent	SNP	G	G	T	rs200003486		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:55077354G>T	ENST00000302250.2	-	6	1025	c.865C>A	c.(865-867)Cgg>Agg	p.R289R	FAM151A_ENST00000371304.2_Silent_p.R289R|ACOT11_ENST00000371316.3_Intron	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A	289						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						GTGTTATCCCGGACGTAGAGC	0.577																																							uc001cxn.2		NA																	0					0						c.(865-867)CGG>AGG		hypothetical protein LOC338094							148.0	128.0	135.0					1																	55077354		2203	4300	6503	SO:0001819	synonymous_variant	338094					integral to membrane		g.chr1:55077354G>T	AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.865C>A	1.37:g.55077354G>T						ACOT11_uc001cxm.1_Intron	p.R289R	NM_176782	NP_788954	Q8WW52	F151A_HUMAN			6	997	-			289					Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Silent	SNP	ENST00000302250.2	37	c.865C>A	CCDS594.1																																																																																				0.577	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027342.1	NM_176782		18	85	1	0	1.99824e-07	0.00499	2.83741e-07	18	85				
MROH7	374977	broad.mit.edu	37	1	55158101	55158101	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:55158101G>C	ENST00000421030.2	+	16	3001	c.2716G>C	c.(2716-2718)Gtg>Ctg	p.V906L	MROH7_ENST00000454855.2_Missense_Mutation_p.V424L|MROH7_ENST00000409996.1_Missense_Mutation_p.V474L|MROH7_ENST00000545244.1_Missense_Mutation_p.V474L|MROH7_ENST00000339553.5_Missense_Mutation_p.V906L|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.V906L|MROH7_ENST00000395690.2_Missense_Mutation_p.V906L	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	906						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											TGGCAGCTGGGTGGTGAAAGT	0.597																																							uc010ooe.1		NA																	0					0						c.(2716-2718)GTG>CTG		hypothetical protein LOC374977							104.0	110.0	108.0					1																	55158101		2093	4220	6313	SO:0001583	missense	374977					integral to membrane	binding	g.chr1:55158101G>C	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.2716G>C	1.37:g.55158101G>C	ENSP00000396622:p.Val906Leu					C1orf175_uc001cxq.2_RNA|C1orf175_uc010ooc.1_Missense_Mutation_p.V474L|C1orf175_uc001cxs.2_RNA|C1orf175_uc010ood.1_Missense_Mutation_p.V424L|C1orf175_uc010oof.1_RNA|C1orf175_uc001cxr.1_RNA|C1orf175_uc010oog.1_Missense_Mutation_p.V906L|C1orf175_uc010ooh.1_RNA|C1orf175_uc009vzq.1_RNA|C1orf175_uc001cxt.1_RNA|C1orf175_uc009vzr.1_Missense_Mutation_p.V108L|C1orf175_uc001cxu.2_Missense_Mutation_p.V52L	p.V906L	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN			16	3040	+			906					A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	ENST00000421030.2	37	c.2716G>C	CCDS41342.2	.	.	.	.	.	.	.	.	.	.	G	13.17	2.156459	0.38119	.	.	ENSG00000184313	ENST00000421030;ENST00000545244;ENST00000414867;ENST00000339553;ENST00000409996;ENST00000454855;ENST00000395690	T;T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22;0.22	4.58	1.66	0.24008	Armadillo-type fold (1);	0.704536	0.12669	N	0.448975	T	0.49490	0.1560	L	0.60455	1.87	0.21822	N	0.999528	P;B;B;P;P	0.52316	0.952;0.328;0.186;0.707;0.551	B;B;B;B;B	0.41571	0.36;0.146;0.029;0.243;0.117	T	0.39702	-0.9601	10	0.51188	T	0.08	-13.1228	6.3189	0.21206	0.3243:0.0:0.6757:0.0	.	906;906;474;906;61	F8W8P2;Q68CQ1;F5H7R4;Q68CQ1-9;Q69YY0	.;HEAT8_HUMAN;.;.;.	L	906;474;935;906;474;424;906	ENSP00000396622:V906L;ENSP00000442333:V474L;ENSP00000343211:V906L;ENSP00000387048:V474L;ENSP00000401130:V424L;ENSP00000379044:V906L	ENSP00000343211:V906L	V	+	1	0	HEATR8	54930689	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	1.644000	0.37228	0.174000	0.19809	-0.369000	0.07265	GTG		0.597	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547		23	87	0	0	0	0.004656	0	23	87				
SERBP1	26135	broad.mit.edu	37	1	67889914	67889914	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:67889914C>T	ENST00000370995.2	-	5	872	c.787G>A	c.(787-789)Gaa>Aaa	p.E263K	SERBP1_ENST00000361219.6_Missense_Mutation_p.E248K|SERBP1_ENST00000370994.4_Missense_Mutation_p.E242K|SERBP1_ENST00000484880.1_5'UTR|SERBP1_ENST00000370990.5_Missense_Mutation_p.E257K			Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1	263					regulation of apoptotic process (GO:0042981)|regulation of mRNA stability (GO:0043488)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	13						GGATGATGTTCTTCACCTTCA	0.368																																							uc001ddv.2		NA																	0				skin(1)	1						c.(787-789)GAA>AAA		SERPINE1 mRNA binding protein 1 isoform 1							121.0	114.0	116.0					1																	67889914		2203	4300	6503	SO:0001583	missense	26135				regulation of mRNA stability	nucleus|perinuclear region of cytoplasm	mRNA 3'-UTR binding|protein binding	g.chr1:67889914C>T	AF151813	CCDS639.1, CCDS30746.1, CCDS30747.1, CCDS30748.1	1p31	2009-12-17			ENSG00000142864	ENSG00000142864			17860	protein-coding gene	gene with protein product		607378				11001948, 10810093, 18440126, 17698176	Standard	NM_001018067		Approved	PAI-RBP1, DKFZP564M2423, CGI-55, HABP4L, PAIRBP1, CHD3IP	uc001ddv.3	Q8NC51	OTTHUMG00000009372	ENST00000370995.2:c.787G>A	1.37:g.67889914C>T	ENSP00000360034:p.Glu263Lys					SERBP1_uc001ddx.2_Missense_Mutation_p.E257K|SERBP1_uc001ddy.2_Missense_Mutation_p.E242K|SERBP1_uc001ddw.2_Missense_Mutation_p.E248K	p.E263K	NM_001018067	NP_001018077	Q8NC51	PAIRB_HUMAN			5	927	-			263					Q5VU19|Q5VU20|Q5VU22|Q8WUH0|Q96SE2|Q9BTY3|Q9BUM4|Q9Y367|Q9Y4S3	Missense_Mutation	SNP	ENST00000370995.2	37	c.787G>A	CCDS30746.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.736859	0.89482	.	.	ENSG00000142864	ENST00000370994;ENST00000370995;ENST00000361219;ENST00000370990	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	5.33	5.33	0.75918	Hyaluronan/mRNA-binding protein (1);	0.000000	0.85682	D	0.000000	T	0.75481	0.3855	M	0.85462	2.755	0.80722	D	1	B;D;B;B	0.67145	0.206;0.996;0.423;0.394	B;D;B;B	0.64595	0.137;0.927;0.079;0.247	T	0.72301	-0.4334	10	0.23302	T	0.38	-1.0032	19.3847	0.94551	0.0:1.0:0.0:0.0	.	305;320;248;263	D3DQ69;D3DQ70;Q8NC51-3;Q8NC51	.;.;.;PAIRB_HUMAN	K	242;263;248;257	ENSP00000360033:E242K;ENSP00000360034:E263K;ENSP00000354591:E248K;ENSP00000360029:E257K	ENSP00000354591:E248K	E	-	1	0	SERBP1	67662502	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.356000	0.79445	2.642000	0.89623	0.557000	0.71058	GAA		0.368	SERBP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025984.2	NM_001018067		19	102	0	0	0	0.00333	0	19	102				
FPGT	8790	broad.mit.edu	37	1	74671407	74671407	+	Missense_Mutation	SNP	A	A	G	rs372383046		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:74671407A>G	ENST00000609362.1	+	4	1713	c.1676A>G	c.(1675-1677)tAt>tGt	p.Y559C	FPGT-TNNI3K_ENST00000557284.2_Intron|FPGT_ENST00000370894.5_3'UTR|FPGT-TNNI3K_ENST00000533006.1_Intron|TNNI3K_ENST00000370891.2_Intron|FPGT_ENST00000534056.1_Missense_Mutation_p.Y305C|FPGT_ENST00000370898.3_Missense_Mutation_p.Y572C|FPGT_ENST00000524915.1_Intron|FPGT-TNNI3K_ENST00000370895.1_Intron|FPGT-TNNI3K_ENST00000370899.3_Intron|FPGT-TNNI3K_ENST00000370893.1_Intron	NM_003838.4	NP_003829.3	O14772	FPGT_HUMAN	fucose-1-phosphate guanylyltransferase	559					fucose metabolic process (GO:0006004)	cytoplasm (GO:0005737)	catalytic activity (GO:0003824)|fucose-1-phosphate guanylyltransferase activity (GO:0047341)|GTP binding (GO:0005525)			breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	39						CTGAATAGCTATAAGTTGCTG	0.338													A|||	1	0.000199681	0.0	0.0	5008	,	,		19160	0.001		0.0	False		,,,				2504	0.0						uc001dgb.1		NA																	0				skin(1)	1						c.(1675-1677)TAT>TGT		fucose-1-phosphate guanyltransferase							84.0	77.0	79.0					1																	74671407		2203	4300	6503	SO:0001583	missense	8790				fucose metabolic process	cytoplasm	fucose-1-phosphate guanylyltransferase activity|GTP binding	g.chr1:74671407A>G	AF017445	CCDS663.1, CCDS663.2	1p31.1	2013-09-24			ENSG00000254685	ENSG00000254685	2.7.7.30		3825	protein-coding gene	gene with protein product		603609				9804772	Standard	NM_003838		Approved	GFPP		O14772	OTTHUMG00000009571	ENST00000609362.1:c.1676A>G	1.37:g.74671407A>G	ENSP00000476680:p.Tyr559Cys					TNNI3K_uc001dgc.1_Intron|TNNI3K_uc001dgd.2_Intron|TNNI3K_uc001dge.1_Intron|FPGT_uc010oqt.1_Missense_Mutation_p.Y184C|FPGT_uc010oqu.1_Missense_Mutation_p.Y305C|FPGT_uc010oqv.1_Intron	p.Y559C	NM_003838	NP_003829	O14772	FPGT_HUMAN			4	1713	+			559					A6NMH3|B4DRX2|B4E2Y7|E9PNQ2|Q8N5J7	Missense_Mutation	SNP	ENST00000609362.1	37	c.1676A>G	CCDS663.1	.	.	.	.	.	.	.	.	.	.	A	9.828	1.187732	0.21954	.	.	ENSG00000254685	ENST00000370898;ENST00000534056	T;T	0.44881	1.51;0.91	4.83	3.58	0.41010	.	.	.	.	.	T	0.34221	0.0890	L	0.51422	1.61	0.21579	N	0.999632	D;D;P	0.76494	0.999;0.998;0.932	P;P;P	0.58820	0.846;0.818;0.525	T	0.11966	-1.0566	9	0.38643	T	0.18	.	9.4007	0.38431	0.4118:0.0:0.0:0.5882	.	305;184;559	E9PNQ2;B4E2Y7;O14772	.;.;FPGT_HUMAN	C	559;305	ENSP00000359935:Y559C;ENSP00000432819:Y305C	ENSP00000359935:Y559C	Y	+	2	0	TNNI3K	74443995	0.034000	0.19679	0.012000	0.15200	0.759000	0.43091	1.810000	0.38932	0.525000	0.28522	0.460000	0.39030	TAT		0.338	FPGT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				15	61	0	0	0	0.004007	0	15	61				
FPGT-TNNI3K	100526835	broad.mit.edu	37	1	74834759	74834759	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:74834759C>A	ENST00000370899.3	+	16	1715	c.1678C>A	c.(1678-1680)Cag>Aag	p.Q560K	FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.Q573K|TNNI3K_ENST00000326637.3_Missense_Mutation_p.Q459K|TNNI3K_ENST00000370891.2_Missense_Mutation_p.Q560K|RP11-439H8.4_ENST00000415549.2_RNA|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.Q560K	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		TTTCCATCTTCAGCTCTCAGA	0.338																																							uc001dgf.1		NA																	0				large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						c.(1375-1377)CAG>AAG		TNNI3 interacting kinase isoform b							45.0	46.0	46.0					1																	74834759		2202	4299	6501	SO:0001583	missense	51086					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding	g.chr1:74834759C>A			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1678C>A	1.37:g.74834759C>A	ENSP00000359936:p.Gln560Lys					TNNI3K_uc001dgc.1_Missense_Mutation_p.Q560K|TNNI3K_uc001dgd.2_Missense_Mutation_p.Q560K|TNNI3K_uc001dge.1_Missense_Mutation_p.Q560K	p.Q459K	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN			14	1426	+			459						Missense_Mutation	SNP	ENST00000370899.3	37	c.1375C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.2|25.2	4.613941|4.613941	0.87359|0.87359	.|.	.|.	ENSG00000116783|ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000526236|ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	.|T;T;T;T;T	.|0.33438	.|1.41;1.41;1.41;1.41;1.41	5.41|5.41	5.41|5.41	0.78517|0.78517	.|Protein kinase-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.16685|0.16685	0.0401|0.0401	N|N	0.24115|0.24115	0.695|0.695	0.58432|0.58432	D|D	0.999999|0.999999	.|P;P;P;D	.|0.57257	.|0.801;0.874;0.874;0.979	.|B;B;B;P	.|0.50405	.|0.201;0.443;0.365;0.64	T|T	0.01748|0.01748	-1.1282|-1.1282	5|10	.|0.07030	.|T	.|0.85	.|.	19.1989|19.1989	0.93701|0.93701	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|459;560;560;560	.|Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	.|TNI3K_HUMAN;.;.;.	L|K	5|560;560;560;560;459	.|ENSP00000359936:Q560K;ENSP00000359932:Q560K;ENSP00000450895:Q560K;ENSP00000359928:Q560K;ENSP00000322251:Q459K	.|ENSP00000322251:Q459K	F|Q	+|+	3|1	2|0	AC093158.1|RP11-653A5.2;AC093158.1	74607347|74607347	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.988000|0.988000	0.76386|0.76386	7.359000|7.359000	0.79477|0.79477	2.538000|2.538000	0.85594|0.85594	0.650000|0.650000	0.86243|0.86243	TTC|CAG		0.338	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3			15	33	1	0	1.3612e-06	0.003163	1.86687e-06	15	33				
ERICH3	127254	broad.mit.edu	37	1	75038906	75038906	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:75038906C>A	ENST00000326665.5	-	14	2706	c.2488G>T	c.(2488-2490)Gag>Tag	p.E830*	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		830	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GGAGGGATCTCCCTTTTTTCT	0.572																																							uc001dgg.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(2488-2490)GAG>TAG		hypothetical protein LOC127254							91.0	86.0	88.0					1																	75038906		2203	4300	6503	SO:0001587	stop_gained	127254							g.chr1:75038906C>A																												ENST00000326665.5:c.2488G>T	1.37:g.75038906C>A	ENSP00000322609:p.Glu830*						p.E830*	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN			14	2707	-			830			Glu-rich.		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Nonsense_Mutation	SNP	ENST00000326665.5	37	c.2488G>T	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	C	39	7.369580	0.98241	.	.	ENSG00000178965	ENST00000326665	.	.	.	5.34	2.35	0.29111	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-1.8504	8.699	0.34314	0.0:0.731:0.1235:0.1455	.	.	.	.	X	830	.	ENSP00000322609:E830X	E	-	1	0	C1orf173	74811494	0.005000	0.15991	0.000000	0.03702	0.001000	0.01503	0.937000	0.28951	0.612000	0.30071	0.561000	0.74099	GAG		0.572	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			23	78	1	0	7.87624e-14	0.00278	1.40456e-13	23	78				
FAM73A	374986	broad.mit.edu	37	1	78324681	78324681	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:78324681C>T	ENST00000370791.3	+	9	1087	c.1055C>T	c.(1054-1056)cCa>cTa	p.P352L	FAM73A_ENST00000443751.2_Missense_Mutation_p.P314L	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	352						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		TGTCACTGCCCATTTTACGAG	0.423																																							uc001dhx.2		NA																	0				ovary(1)	1						c.(1054-1056)CCA>CTA		hypothetical protein LOC374986							127.0	107.0	113.0					1																	78324681		2203	4300	6503	SO:0001583	missense	374986					integral to membrane		g.chr1:78324681C>T		CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.1055C>T	1.37:g.78324681C>T	ENSP00000359827:p.Pro352Leu					FAM73A_uc010ork.1_Missense_Mutation_p.P352L|FAM73A_uc010orl.1_Missense_Mutation_p.P314L|FAM73A_uc001dhy.1_Missense_Mutation_p.P141L	p.P352L	NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN		Colorectal(170;0.226)	9	1087	+			352					Q6MZG0	Missense_Mutation	SNP	ENST00000370791.3	37	c.1055C>T	CCDS681.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.776109	0.31411	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	T;T	0.24538	1.85;1.85	5.56	5.56	0.83823	.	0.173018	0.51477	D	0.000090	T	0.18841	0.0452	L	0.52126	1.63	0.80722	D	1	B;B;B;B	0.29552	0.11;0.248;0.208;0.248	B;B;B;B	0.29524	0.028;0.103;0.063;0.103	T	0.03503	-1.1030	10	0.87932	D	0	-17.5785	19.5172	0.95169	0.0:1.0:0.0:0.0	.	314;352;352;352	F8W7S1;B7ZLZ8;Q8NAN2-2;Q8NAN2	.;.;.;FA73A_HUMAN	L	352;314	ENSP00000359827:P352L;ENSP00000393675:P314L	ENSP00000359827:P352L	P	+	2	0	FAM73A	78097269	1.000000	0.71417	1.000000	0.80357	0.188000	0.23474	5.094000	0.64523	2.616000	0.88540	0.655000	0.94253	CCA		0.423	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549		15	73	0	0	0	0.00245	0	15	73				
IFI44	10561	broad.mit.edu	37	1	79120844	79120844	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:79120844G>T	ENST00000370747.4	+	4	725	c.640G>T	c.(640-642)Gta>Tta	p.V214L	IFI44_ENST00000495254.1_3'UTR|IFI44_ENST00000545124.1_5'UTR	NM_006417.4	NP_006408.3	Q8TCB0	IFI44_HUMAN	interferon-induced protein 44	214					response to virus (GO:0009615)	cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21						CCAAGGGCATGTAACGCATCA	0.463																																							uc001dip.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(640-642)GTA>TTA		interferon-induced, hepatitis C-associated							135.0	128.0	131.0					1																	79120844		2203	4300	6503	SO:0001583	missense	10561				response to virus	cytoplasm		g.chr1:79120844G>T	D28915	CCDS688.1	1p31.1	2013-03-14			ENSG00000137965	ENSG00000137965			16938	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 5"""	610468				7925411	Standard	NM_006417		Approved	MTAP44, p44, TLDC5	uc001dip.4	Q8TCB0	OTTHUMG00000009723	ENST00000370747.4:c.640G>T	1.37:g.79120844G>T	ENSP00000359783:p.Val214Leu					IFI44_uc010orr.1_Missense_Mutation_p.V214L|IFI44_uc010ors.1_5'UTR	p.V214L	NM_006417	NP_006408	Q8TCB0	IFI44_HUMAN			4	764	+			214					B7ZAG3|D3DQ80|Q14496	Missense_Mutation	SNP	ENST00000370747.4	37	c.640G>T	CCDS688.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298123	0.40694	.	.	ENSG00000137965	ENST00000370747;ENST00000438486	T;T	0.26223	2.86;1.75	3.85	1.94	0.25998	.	0.589185	0.16590	N	0.207798	T	0.10423	0.0255	L	0.56340	1.77	0.23468	N	0.99762	P;P	0.47350	0.894;0.894	B;B	0.43950	0.437;0.437	T	0.12941	-1.0528	10	0.24483	T	0.36	.	7.2159	0.25959	0.2267:0.0:0.7733:0.0	.	214;214	B7ZB11;Q8TCB0	.;IFI44_HUMAN	L	214;90	ENSP00000359783:V214L;ENSP00000399477:V90L	ENSP00000359783:V214L	V	+	1	0	IFI44	78893432	0.541000	0.26417	0.001000	0.08648	0.380000	0.30137	1.423000	0.34837	0.572000	0.29383	0.563000	0.77884	GTA		0.463	IFI44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026825.1	NM_006417		26	105	1	0	2.48779e-11	0.005443	4.08453e-11	26	105				
LMO4	8543	broad.mit.edu	37	1	87805252	87805252	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:87805252C>A	ENST00000370544.5	+	3	1050	c.270C>A	c.(268-270)tgC>tgA	p.C90*	LMO4_ENST00000370542.1_Nonsense_Mutation_p.C90*|LMO4_ENST00000489303.1_3'UTR	NM_006769.3	NP_006760.1	P61968	LMO4_HUMAN	LIM domain only 4	90	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of protein complex assembly (GO:0031333)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell activation (GO:0050865)|regulation of cell fate specification (GO:0042659)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron differentiation (GO:0021522)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)|ventral spinal cord interneuron differentiation (GO:0021514)|ventricular septum development (GO:0003281)	transcription factor complex (GO:0005667)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(1)	9		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)		GCAGCGCTTGCGGACAGTCGA	0.388																																							uc001dmi.2		NA																	0					0						c.(268-270)TGC>TGA		LIM domain only 4							89.0	89.0	89.0					1																	87805252		2203	4300	6503	SO:0001587	stop_gained	8543				neural tube closure|transcription from RNA polymerase II promoter	transcription factor complex	sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding	g.chr1:87805252C>A	U24576	CCDS713.1	1p22.3	2008-02-05			ENSG00000143013	ENSG00000143013			6644	protein-coding gene	gene with protein product		603129					Standard	NM_006769		Approved		uc001dmi.3	P61968	OTTHUMG00000010248	ENST00000370544.5:c.270C>A	1.37:g.87805252C>A	ENSP00000359575:p.Cys90*					LMO4_uc001dmj.2_Nonsense_Mutation_p.C90*	p.C90*	NM_006769	NP_006760	P61968	LMO4_HUMAN		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)	3	1050	+		Lung NSC(277;0.179)	90			LIM zinc-binding 2.		D3DT23|O00158|O88894	Nonsense_Mutation	SNP	ENST00000370544.5	37	c.270C>A	CCDS713.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230514	0.79688	.	.	ENSG00000143013	ENST00000370544;ENST00000370542	.	.	.	5.93	-7.13	0.01532	.	0.083716	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.7512	0.88434	0.0:0.4961:0.0:0.5039	.	.	.	.	X	90	.	ENSP00000359573:C90X	C	+	3	2	LMO4	87577840	0.058000	0.20735	0.850000	0.33497	0.926000	0.56050	-0.670000	0.05256	-1.055000	0.03209	-1.119000	0.02030	TGC		0.388	LMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028264.2	NM_006769		13	24	1	0	4.7546e-09	0.004007	7.29752e-09	13	24				
RBMXL1	494115	broad.mit.edu	37	1	89448560	89448560	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:89448560C>G	ENST00000321792.5	-	2	1377	c.950G>C	c.(949-951)cGt>cCt	p.R317P	CCBL2_ENST00000370491.3_Intron|RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000370485.2_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.R317P|CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000446900.2_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	317	Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										ATATCCATCACGTGAGCTGCT	0.498																																							uc009wcx.2		NA																	0					0						c.(949-951)CGT>CCT		RNA binding motif protein, X-linked-like 1							185.0	184.0	184.0					1																	89448560		2203	4300	6503	SO:0001583	missense	494115						nucleotide binding|RNA binding	g.chr1:89448560C>G	BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.950G>C	1.37:g.89448560C>G	ENSP00000318415:p.Arg317Pro					CCBL2_uc001dmp.2_Intron|CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron|RBMXL1_uc001dms.2_Missense_Mutation_p.R317P	p.R317P	NM_001162536	NP_001156008	Q96E39	RBMXL_HUMAN			3	1666	-			317			Ser-rich.			Missense_Mutation	SNP	ENST00000321792.5	37	c.950G>C	CCDS716.1	.	.	.	.	.	.	.	.	.	.	C	7.658	0.684397	0.14907	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.76316	-1.01;-1.01	1.89	0.895	0.19247	.	0.000000	0.85682	D	0.000000	T	0.41442	0.1159	L	0.35593	1.075	0.34676	D	0.724253	B	0.13145	0.007	B	0.08055	0.003	T	0.04752	-1.0929	10	0.20519	T	0.43	-4.7791	6.12	0.20148	0.0:0.8158:0.0:0.1842	.	317	Q96E39	RBMXL_HUMAN	P	317	ENSP00000318415:R317P;ENSP00000446099:R317P	ENSP00000318415:R317P	R	-	2	0	RBMXL1	89221148	1.000000	0.71417	0.976000	0.42696	0.730000	0.41778	4.795000	0.62489	0.128000	0.18479	0.306000	0.20318	CGT		0.498	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610		58	235	0	0	0	0.00361	0	58	235				
GBP4	115361	broad.mit.edu	37	1	89657124	89657124	+	Silent	SNP	G	G	T	rs141089744		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:89657124G>T	ENST00000355754.6	-	6	833	c.736C>A	c.(736-738)Cgg>Agg	p.R246R		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	246	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		AAGCACTTCCGTTTTCGGAAG	0.393																																							uc001dnb.2		NA																	0					0						c.(736-738)CGG>AGG		guanylate binding protein 4							82.0	81.0	81.0					1																	89657124		2203	4300	6503	SO:0001819	synonymous_variant	115361					cytoplasm	GTP binding|GTPase activity	g.chr1:89657124G>T	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.736C>A	1.37:g.89657124G>T							p.R246R	NM_052941	NP_443173	Q96PP9	GBP4_HUMAN		all cancers(265;0.00723)|Epithelial(280;0.0291)	6	852	-			246					B2R630|Q05D63|Q6NSL0|Q86T99	Silent	SNP	ENST00000355754.6	37	c.736C>A	CCDS721.1																																																																																				0.393	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941		18	74	1	0	1.67942e-08	0.006122	2.51544e-08	18	74				
ABCA4	24	broad.mit.edu	37	1	94473843	94473843	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:94473843C>A	ENST00000370225.3	-	42	5932	c.5846G>T	c.(5845-5847)gGc>gTc	p.G1949V	ABCA4_ENST00000535881.1_Missense_Mutation_p.G68V|ABCA4_ENST00000465352.1_5'UTR|ABCA4_ENST00000536513.1_Missense_Mutation_p.G219V	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1949	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GCTGGAGGTGCCTGGATAAAT	0.542																																							uc001dqh.2		NA																	0				ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12						c.(5845-5847)GGC>GTC		ATP-binding cassette, sub-family A member 4							71.0	72.0	72.0					1																	94473843		2203	4300	6503	SO:0001583	missense	24				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr1:94473843C>A	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.5846G>T	1.37:g.94473843C>A	ENSP00000359245:p.Gly1949Val					ABCA4_uc001dqi.1_Missense_Mutation_p.G68V	p.G1949V	NM_000350	NP_000341	P78363	ABCA4_HUMAN		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)	42	5950	-		all_lung(203;0.000757)|Lung NSC(277;0.00335)	1949			ABC transporter 2.|Cytoplasmic.		O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	c.5846G>T	CCDS747.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.037385	0.54896	.	.	ENSG00000198691	ENST00000546054;ENST00000370225;ENST00000536513;ENST00000535881	D;D;D	0.96619	-4.07;-4.07;-4.07	5.35	5.35	0.76521	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.96361	0.8813	L	0.57536	1.79	0.80722	D	1	B;D	0.58268	0.205;0.982	B;P	0.57101	0.035;0.813	D	0.95562	0.8630	10	0.49607	T	0.09	.	15.9374	0.79723	0.0:0.8652:0.1348:0.0	.	68;1949	B4DX12;P78363	.;ABCA4_HUMAN	V	741;1949;219;68	ENSP00000359245:G1949V;ENSP00000439707:G219V;ENSP00000443203:G68V	ENSP00000359245:G1949V	G	-	2	0	ABCA4	94246431	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.252000	0.58785	2.941000	0.99782	0.655000	0.94253	GGC		0.542	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350		12	39	1	0	5.50884e-06	0.001368	7.29174e-06	12	39				
DBT	1629	broad.mit.edu	37	1	100671808	100671808	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:100671808A>T	ENST00000370132.4	-	10	1272	c.1259T>A	c.(1258-1260)aTt>aAt	p.I420N		NM_001918.3	NP_001909.3	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase E2	420					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity (GO:0043754)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(1)	19		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		AAGGGCCCCAATGGCTACTTC	0.333																																							uc001dta.2		NA																	0				pancreas(1)	1						c.(1258-1260)ATT>AAT		dihydrolipoamide branched chain transacylase							84.0	87.0	86.0					1																	100671808		2203	4300	6503	SO:0001583	missense	1629				branched chain family amino acid catabolic process|fatty-acyl-CoA biosynthetic process	microtubule cytoskeleton|mitochondrial alpha-ketoglutarate dehydrogenase complex|mitochondrial nucleoid	acyltransferase activity|cofactor binding|dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity|protein binding	g.chr1:100671808A>T	BC016675	CCDS767.1	1p31	2008-02-05	2004-11-15		ENSG00000137992	ENSG00000137992			2698	protein-coding gene	gene with protein product		248610	"""dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)"""			1420314, 1429740	Standard	NM_001918		Approved		uc001dta.3	P11182	OTTHUMG00000010921	ENST00000370132.4:c.1259T>A	1.37:g.100671808A>T	ENSP00000359151:p.Ile420Asn					DBT_uc010oug.1_Missense_Mutation_p.I239N	p.I420N	NM_001918	NP_001909	P11182	ODB2_HUMAN		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)	10	1292	-		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)	420					B2R811|Q5VVL8	Missense_Mutation	SNP	ENST00000370132.4	37	c.1259T>A	CCDS767.1	.	.	.	.	.	.	.	.	.	.	A	19.11	3.763301	0.69763	.	.	ENSG00000137992	ENST00000543138;ENST00000370132	T	0.68765	-0.35	5.97	4.84	0.62591	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.88020	0.6325	H	0.99834	4.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91973	0.5588	10	0.87932	D	0	-19.6204	12.1669	0.54135	0.9334:0.0:0.0666:0.0	.	239;420	F5H1F9;P11182	.;ODB2_HUMAN	N	239;420	ENSP00000359151:I420N	ENSP00000359151:I420N	I	-	2	0	DBT	100444396	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	8.962000	0.93254	1.075000	0.40932	0.533000	0.62120	ATT		0.333	DBT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030101.2	NM_001918		16	58	0	0	0	0.007413	0	16	58				
NTNG1	22854	broad.mit.edu	37	1	107866972	107866972	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:107866972G>T	ENST00000370068.1	+	3	1161	c.315G>T	c.(313-315)ctG>ctT	p.L105L	NTNG1_ENST00000370067.1_Silent_p.L105L|NTNG1_ENST00000370065.1_Silent_p.L105L|NTNG1_ENST00000370061.3_Silent_p.L105L|NTNG1_ENST00000370070.2_Silent_p.L105L|NTNG1_ENST00000370073.2_Silent_p.L105L|NTNG1_ENST00000542803.1_Silent_p.L105L|NTNG1_ENST00000370066.1_Silent_p.L105L|NTNG1_ENST00000370071.2_Silent_p.L105L|NTNG1_ENST00000370072.3_Silent_p.L105L|NTNG1_ENST00000477948.1_3'UTR|NTNG1_ENST00000370074.4_Silent_p.L105L			Q9Y2I2	NTNG1_HUMAN	netrin G1	105	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CCCCTGAGCTGATGTTTGATT	0.488																																							uc001dvh.3		NA																	0				large_intestine(2)|ovary(2)|skin(2)	6						c.(313-315)CTG>CTT		netrin G1 isoform 1							184.0	185.0	184.0					1																	107866972		2203	4300	6503	SO:0001819	synonymous_variant	22854				axonogenesis	anchored to plasma membrane	protein binding	g.chr1:107866972G>T	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.315G>T	1.37:g.107866972G>T						NTNG1_uc001dvf.3_Silent_p.L105L|NTNG1_uc010out.1_Silent_p.L105L|NTNG1_uc001dvc.3_Silent_p.L105L|NTNG1_uc001dvd.1_Silent_p.L105L	p.L105L	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)	3	1033	+		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)	105			Laminin N-terminal.		Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Silent	SNP	ENST00000370068.1	37	c.315G>T	CCDS44180.1																																																																																				0.488	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917		50	194	1	0	4.01344e-20	0.00361	7.89965e-20	50	194				
SLC6A17	388662	broad.mit.edu	37	1	110714731	110714731	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:110714731C>A	ENST00000331565.4	+	3	821	c.336C>A	c.(334-336)ccC>ccA	p.P112P	RP5-1028L10.1_ENST00000443008.1_RNA	NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	112					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		TCGGGATCCCCCTCTTCTTCC	0.627																																							uc009wfq.2		NA																	0				ovary(1)|pancreas(1)	2						c.(334-336)CCC>CCA		solute carrier family 6, member 17							80.0	58.0	66.0					1																	110714731		2203	4300	6503	SO:0001819	synonymous_variant	388662				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity	g.chr1:110714731C>A		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.336C>A	1.37:g.110714731C>A							p.P112P	NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)	3	797	+		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)	112			Helical; Name=2; (Potential).		A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Silent	SNP	ENST00000331565.4	37	c.336C>A	CCDS30799.1																																																																																				0.627	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280		3	31	1	0	0.00024832	0.009096	0.000291915	3	31				
CTTNBP2NL	55917	broad.mit.edu	37	1	112997080	112997080	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:112997080G>T	ENST00000271277.6	+	5	565	c.340G>T	c.(340-342)Gac>Tac	p.D114Y		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	114					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGTGATCCTAGACCTTGAGGA	0.398																																							uc001ebx.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(340-342)GAC>TAC		CTTNBP2 N-terminal like							90.0	87.0	88.0					1																	112997080		2203	4300	6503	SO:0001583	missense	55917					actin cytoskeleton	protein binding	g.chr1:112997080G>T	AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.340G>T	1.37:g.112997080G>T	ENSP00000271277:p.Asp114Tyr					CTTNBP2NL_uc001ebz.2_5'Flank	p.D114Y	NM_018704	NP_061174	Q9P2B4	CT2NL_HUMAN		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	5	568	+		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)	114			Potential.		B3KMS5|Q96B40	Missense_Mutation	SNP	ENST00000271277.6	37	c.340G>T	CCDS845.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.041535	0.93685	.	.	ENSG00000143079	ENST00000271277;ENST00000441739	T;T	0.43688	0.94;0.94	6.04	6.04	0.98038	Cortactin-binding protein-2, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.56232	0.1971	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55547	-0.8124	10	0.87932	D	0	-31.2831	20.1899	0.98228	0.0:0.0:1.0:0.0	.	114	Q9P2B4	CT2NL_HUMAN	Y	114	ENSP00000271277:D114Y;ENSP00000390976:D114Y	ENSP00000271277:D114Y	D	+	1	0	CTTNBP2NL	112798603	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.389000	0.97243	2.873000	0.98535	0.563000	0.77884	GAC		0.398	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030686.1	NM_018704		7	54	1	0	0.00307968	0.00308	0.00347099	7	54				
CASQ2	845	broad.mit.edu	37	1	116269693	116269693	+	Silent	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:116269693T>C	ENST00000261448.5	-	6	896	c.657A>G	c.(655-657)ccA>ccG	p.P219P	CASQ2_ENST00000488931.1_5'UTR|CASQ2_ENST00000456138.2_Silent_p.P148P	NM_001232.3	NP_001223.2	O14958	CASQ2_HUMAN	calsequestrin 2 (cardiac muscle)	219					cardiac muscle contraction (GO:0060048)|cellular response to caffeine (GO:0071313)|detection of calcium ion (GO:0005513)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|protein polymerization (GO:0051258)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of heart rate (GO:0002027)|regulation of membrane repolarization (GO:0060306)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|sequestering of calcium ion (GO:0051208)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|junctional sarcoplasmic reticulum membrane (GO:0014701)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	18	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CATCCATAAATGGCTCATAGA	0.403																																							uc001efx.3		NA																	0				skin(1)	1						c.(655-657)CCA>CCG		cardiac calsequestrin 2 precursor							77.0	70.0	72.0					1																	116269693		2203	4300	6503	SO:0001819	synonymous_variant	845				heart development|striated muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding	g.chr1:116269693T>C	BC022288	CCDS884.1	1p13.1	2014-09-17			ENSG00000118729	ENSG00000118729		"""Protein disulfide isomerases"""	1513	protein-coding gene	gene with protein product		114251				8406504	Standard	NM_001232		Approved	PDIB2	uc001efx.4	O14958	OTTHUMG00000011970	ENST00000261448.5:c.657A>G	1.37:g.116269693T>C						CASQ2_uc010owu.1_Silent_p.P148P	p.P219P	NM_001232	NP_001223	O14958	CASQ2_HUMAN		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)	6	921	-	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)	219					B2R7M6|B4DIB0|Q5T1D2|Q8TBW8	Silent	SNP	ENST00000261448.5	37	c.657A>G	CCDS884.1																																																																																				0.403	CASQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033091.1	NM_001232		6	37	0	0	0	0.001168	0	6	37				
IGSF3	3321	broad.mit.edu	37	1	117158899	117158899	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:117158899A>G	ENST00000369486.3	-	3	989	c.224T>C	c.(223-225)aTg>aCg	p.M75T	IGSF3_ENST00000318837.6_Missense_Mutation_p.M75T|IGSF3_ENST00000369483.1_Missense_Mutation_p.M75T	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	75	Ig-like C2-type 1.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.M75T(3)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GGAAGAGTCCATGGTGCTGAC	0.542																																							uc001egr.1		NA																	3	Substitution - Missense(3)		skin(2)|NS(1)	ovary(2)	2						c.(223-225)ATG>ACG		immunoglobulin superfamily, member 3 isoform 2							9.0	9.0	9.0					1																	117158899		2172	4230	6402	SO:0001583	missense	3321					integral to membrane		g.chr1:117158899A>G	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.224T>C	1.37:g.117158899A>G	ENSP00000358498:p.Met75Thr					IGSF3_uc001egq.1_Missense_Mutation_p.M75T	p.M75T	NM_001007237	NP_001007238	O75054	IGSF3_HUMAN		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)	3	929	-	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)	75			Ig-like C2-type 1.|Extracellular (Potential).		A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	c.224T>C	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	A	3.341	-0.134508	0.06711	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.64260	-0.09;-0.09;-0.09	4.79	2.35	0.29111	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.238710	0.05491	N	0.556554	T	0.18676	0.0448	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.11916	-1.0568	10	0.22109	T	0.4	-0.6305	3.687	0.08332	0.5706:0.0:0.0933:0.3361	.	75;75	O75054;A6NJZ6	IGSF3_HUMAN;.	T	75	ENSP00000358498:M75T;ENSP00000358495:M75T;ENSP00000321184:M75T	ENSP00000321184:M75T	M	-	2	0	IGSF3	116960422	0.001000	0.12720	0.632000	0.29296	0.982000	0.71751	0.222000	0.17699	0.282000	0.22254	0.454000	0.30748	ATG		0.542	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542		3	37	0	0	0	0.006214	0	3	37				
ZNF697	90874	broad.mit.edu	37	1	120168693	120168693	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:120168693C>A	ENST00000421812.2	-	2	150	c.31G>T	c.(31-33)Gca>Tca	p.A11S		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	11					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		TCCTGGTGTGCACAGACACCC	0.483																																							uc001ehy.1		NA																	0				ovary(1)	1						c.(31-33)GCA>TCA		zinc finger protein 697							178.0	173.0	175.0					1																	120168693		1898	4119	6017	SO:0001583	missense	90874				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:120168693C>A	AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.31G>T	1.37:g.120168693C>A	ENSP00000396857:p.Ala11Ser						p.A11S	NM_001080470	NP_001073939	Q5TEC3	ZN697_HUMAN		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)	2	145	-	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)	11					Q96IT2	Missense_Mutation	SNP	ENST00000421812.2	37	c.31G>T	CCDS44202.1	.	.	.	.	.	.	.	.	.	.	C	6.070	0.381169	0.11466	.	.	ENSG00000143067	ENST00000421812	T	0.07688	3.17	4.32	2.41	0.29592	.	.	.	.	.	T	0.01353	0.0044	N	0.19112	0.55	0.09310	N	0.999998	B	0.13594	0.008	B	0.14578	0.011	T	0.47535	-0.9110	9	0.10377	T	0.69	.	7.8	0.29168	0.0:0.7414:0.1654:0.0932	.	11	Q5TEC3	ZN697_HUMAN	S	11	ENSP00000396857:A11S	ENSP00000396857:A11S	A	-	1	0	ZNF697	119970216	0.003000	0.15002	0.074000	0.20217	0.047000	0.14425	0.588000	0.23924	0.752000	0.32923	0.561000	0.74099	GCA		0.483	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036349.3	XM_371286		36	150	1	0	4.00102e-26	0.00623	8.30606e-26	36	150				
PDE4DIP	9659	broad.mit.edu	37	1	144882495	144882495	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:144882495C>A	ENST00000369354.3	-	24	3713	c.3524G>T	c.(3523-3525)aGa>aTa	p.R1175I	PDE4DIP_ENST00000369356.4_Missense_Mutation_p.R1175I|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.R1312I|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.R1312I			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1175					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GCTCTGGGGTCTGGGGAAAGG	0.512			T	PDGFRB	MPD																																		uc001elw.3		NA		Dom	yes		1	1q12	9659	T	phosphodiesterase 4D interacting protein (myomegalin)			L	PDGFRB		MPD		0				ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5						c.(3523-3525)AGA>ATA		phosphodiesterase 4D interacting protein isoform							102.0	94.0	97.0					1																	144882495		2203	4296	6499	SO:0001583	missense	9659				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding	g.chr1:144882495C>A	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.3524G>T	1.37:g.144882495C>A	ENSP00000358360:p.Arg1175Ile					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Missense_Mutation_p.R182I	p.R1175I	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN		Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)	24	3815	-			1175					A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	c.3524G>T	CCDS30824.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.49|16.49	3.137792|3.137792	0.56936|0.56936	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000530592|ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	.|T;T;T;T	.|0.01560	.|4.77;4.77;4.77;4.77	5.99|5.99	5.99|5.99	0.97316|0.97316	.|.	.|.	.|.	.|.	.|.	T|T	0.04182|0.04182	0.0116|0.0116	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	.|D	.|0.71674	.|0.998	.|P	.|0.61940	.|0.896	T|T	0.40515|0.40515	-0.9559|-0.9559	5|9	.|0.72032	.|D	.|0.01	.|.	15.9758|15.9758	0.80063|0.80063	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1175	.|Q5VU43	.|MYOME_HUMAN	H|I	69|1175;1175;1312;1312	.|ENSP00000358360:R1175I;ENSP00000358363:R1175I;ENSP00000435654:R1312I;ENSP00000358366:R1312I	.|ENSP00000358360:R1175I	Q|R	-|-	3|2	2|0	PDE4DIP|PDE4DIP	143593852|143593852	0.634000|0.634000	0.27190|0.27190	0.383000|0.383000	0.26132|0.26132	0.089000|0.089000	0.18198|0.18198	2.300000|2.300000	0.43620|0.43620	2.847000|2.847000	0.97988|0.97988	0.655000|0.655000	0.94253|0.94253	CAG|AGA		0.512	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359		10	94	1	0	1.58986e-06	0.008291	2.1588e-06	10	94				
FLG	2312	broad.mit.edu	37	1	152277708	152277708	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:152277708G>C	ENST00000368799.1	-	3	9689	c.9654C>G	c.(9652-9654)gaC>gaG	p.D3218E	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3218	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CACTGTCACTGTCCTGGCTCA	0.567									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(9652-9654)GAC>GAG		filaggrin							118.0	144.0	135.0					1																	152277708		2203	4295	6498	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152277708G>C	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9654C>G	1.37:g.152277708G>C	ENSP00000357789:p.Asp3218Glu						p.D3218E	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	9690	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		3218			Filaggrin 19.|Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.9654C>G	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.460120	0.26248	.	.	ENSG00000143631	ENST00000368799	T	0.05649	3.41	3.67	-4.33	0.03677	.	.	.	.	.	T	0.01029	0.0034	L	0.51422	1.61	0.09310	N	1	B	0.14805	0.011	B	0.14023	0.01	T	0.48681	-0.9014	9	0.02654	T	1	0.0021	3.0277	0.06096	0.0974:0.4129:0.2115:0.2782	.	3218	P20930	FILA_HUMAN	E	3218	ENSP00000357789:D3218E	ENSP00000357789:D3218E	D	-	3	2	FLG	150544332	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-1.409000	0.02483	-0.608000	0.05731	-0.507000	0.04495	GAC		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		60	246	0	0	0	0.00361	0	60	246				
FLG	2312	broad.mit.edu	37	1	152284877	152284877	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:152284877A>G	ENST00000368799.1	-	3	2520	c.2485T>C	c.(2485-2487)Tcc>Ccc	p.S829P	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	829	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGTGCCTGGAGTTGTCTCGT	0.577									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(2485-2487)TCC>CCC		filaggrin							313.0	302.0	305.0					1																	152284877		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152284877A>G	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2485T>C	1.37:g.152284877A>G	ENSP00000357789:p.Ser829Pro					uc001ezv.2_5'Flank	p.S829P	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	2521	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		829			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.2485T>C	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	7.801	0.713597	0.15306	.	.	ENSG00000143631	ENST00000368799	T	0.03772	3.81	3.57	-3.31	0.04988	.	.	.	.	.	T	0.06005	0.0156	M	0.82323	2.585	0.09310	N	1	D	0.69078	0.997	P	0.60789	0.879	T	0.14364	-1.0475	9	0.32370	T	0.25	.	5.7703	0.18249	0.3253:0.4985:0.0:0.1762	.	829	P20930	FILA_HUMAN	P	829	ENSP00000357789:S829P	ENSP00000357789:S829P	S	-	1	0	FLG	150551501	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.752000	0.04797	-0.332000	0.08489	0.392000	0.25879	TCC		0.577	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		9	372	0	0	0	0.004482	0	9	372				
FLG2	388698	broad.mit.edu	37	1	152325965	152325965	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:152325965G>T	ENST00000388718.5	-	3	4369	c.4297C>A	c.(4297-4299)Cac>Aac	p.H1433N	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1433					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H1433Y(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCCCTGAGTGCACTTCACTG	0.542																																							uc001ezw.3		NA																	1	Substitution - Missense(1)		endometrium(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(4297-4299)CAC>AAC		filaggrin family member 2							333.0	306.0	315.0					1																	152325965		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152325965G>T	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.4297C>A	1.37:g.152325965G>T	ENSP00000373370:p.His1433Asn					uc001ezv.2_Intron	p.H1433N	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	4370	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1433					Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.4297C>A	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	10.86	1.468501	0.26335	.	.	ENSG00000143520	ENST00000388718	T	0.29142	1.58	3.59	2.66	0.31614	.	.	.	.	.	T	0.12305	0.0299	M	0.70595	2.14	0.09310	N	1	P	0.47409	0.895	B	0.40602	0.334	T	0.12528	-1.0544	9	0.14656	T	0.56	-5.2964	6.7988	0.23740	0.1334:0.0:0.8666:0.0	.	1433	Q5D862	FILA2_HUMAN	N	1433	ENSP00000373370:H1433N	ENSP00000373370:H1433N	H	-	1	0	FLG2	150592589	0.000000	0.05858	0.002000	0.10522	0.051000	0.14879	0.000000	0.12993	0.848000	0.35191	0.306000	0.20318	CAC		0.542	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		71	341	1	0	2.26907e-38	0.00361	4.8735e-38	71	341				
LCE3D	84648	broad.mit.edu	37	1	152552337	152552337	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:152552337G>T	ENST00000368787.3	-	2	132	c.76C>A	c.(76-78)Cca>Aca	p.P26T		NM_032563.1	NP_115952.1	Q9BYE3	LCE3D_HUMAN	late cornified envelope 3D	26					keratinization (GO:0031424)					breast(1)|endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|stomach(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)		CACTGTACTGGGCTCTTTGGG	0.632																																							uc001fab.2		NA																	0					0						c.(76-78)CCA>ACA		late cornified envelope 3D							97.0	105.0	102.0					1																	152552337		2203	4300	6503	SO:0001583	missense	84648				keratinization			g.chr1:152552337G>T	BI670519	CCDS1014.1	1q21	2008-02-05	2004-05-21	2004-10-15	ENSG00000163202	ENSG00000163202		"""Late cornified envelopes"""	16615	protein-coding gene	gene with protein product		612616	"""small proline rich-like (epidermal differentiation complex) 6B"""	SPRL6B, SPRL6A		11698679	Standard	NM_032563		Approved	LEP16	uc001fab.3	Q9BYE3	OTTHUMG00000012384	ENST00000368787.3:c.76C>A	1.37:g.152552337G>T	ENSP00000357776:p.Pro26Thr						p.P26T	NM_032563	NP_115952	Q9BYE3	LCE3D_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)	2	133	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		26					Q3MIL1	Missense_Mutation	SNP	ENST00000368787.3	37	c.76C>A	CCDS1014.1	.	.	.	.	.	.	.	.	.	.	G	9.789	1.177369	0.21787	.	.	ENSG00000163202	ENST00000368787	T	0.03920	3.76	3.9	2.93	0.34026	.	.	.	.	.	T	0.01592	0.0051	.	.	.	0.27887	N	0.93945	B	0.16603	0.018	B	0.18263	0.021	T	0.43909	-0.9362	8	0.59425	D	0.04	.	8.4336	0.32773	0.0:0.0:0.7555:0.2445	.	26	Q9BYE3	LCE3D_HUMAN	T	26	ENSP00000357776:P26T	ENSP00000357776:P26T	P	-	1	0	LCE3D	150818961	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.400000	0.34577	0.906000	0.36621	0.655000	0.94253	CCA		0.632	LCE3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034504.1	NM_032563		23	95	1	0	2.89027e-11	0.002299	4.70013e-11	23	95				
FCRL5	83416	broad.mit.edu	37	1	157497526	157497526	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:157497526G>T	ENST00000361835.3	-	9	1998	c.1841C>A	c.(1840-1842)tCt>tAt	p.S614Y	FCRL5_ENST00000368190.3_Missense_Mutation_p.S614Y|FCRL5_ENST00000368191.3_Missense_Mutation_p.S529Y|FCRL5_ENST00000356953.4_Missense_Mutation_p.S614Y	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	614	Ig-like C2-type 6.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				TTCTCCTCCAGAGGGGGCTGA	0.552																																							uc001fqu.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)	6						c.(1840-1842)TCT>TAT		Fc receptor-like 5							80.0	81.0	81.0					1																	157497526		2203	4300	6503	SO:0001583	missense	83416					integral to membrane|plasma membrane	receptor activity	g.chr1:157497526G>T	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1841C>A	1.37:g.157497526G>T	ENSP00000354691:p.Ser614Tyr					FCRL5_uc009wsm.2_Missense_Mutation_p.S614Y|FCRL5_uc010phv.1_Missense_Mutation_p.S614Y|FCRL5_uc010phw.1_Missense_Mutation_p.S529Y	p.S614Y	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN			9	1999	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)	614			Extracellular (Potential).|Ig-like C2-type 6.		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	c.1841C>A	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	G	8.494	0.862656	0.17178	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191	T;T;T;T	0.03386	3.95;3.95;3.95;3.95	3.53	-4.52	0.03472	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.029240	0.07787	N	0.954237	T	0.04679	0.0127	M	0.89968	3.075	0.09310	N	1	D;D;D;D	0.71674	0.976;0.998;0.972;0.972	P;D;P;P	0.76071	0.891;0.987;0.86;0.815	T	0.39313	-0.9620	10	0.11182	T	0.66	.	1.0419	0.01561	0.1883:0.1383:0.2519:0.4214	.	529;614;614;614	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9	.;.;.;FCRL5_HUMAN	Y	614;614;614;529	ENSP00000354691:S614Y;ENSP00000349434:S614Y;ENSP00000357173:S614Y;ENSP00000357174:S529Y	ENSP00000349434:S614Y	S	-	2	0	FCRL5	155764150	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.073000	0.11468	-1.174000	0.02754	-0.188000	0.12872	TCT		0.552	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281		30	103	1	0	1.08312e-15	0.009535	2.01572e-15	30	103				
FCRL3	115352	broad.mit.edu	37	1	157665243	157665243	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:157665243G>T	ENST00000368184.3	-	8	1578	c.1287C>A	c.(1285-1287)gcC>gcA	p.A429A	FCRL3_ENST00000368186.5_Silent_p.A429A|RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000473231.1_5'UTR	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	429	Ig-like C2-type 5.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CTCCAGAGGGGGCTGAGCTGT	0.577																																							uc001frb.2		NA																	0				ovary(3)|breast(1)	4						c.(1285-1287)GCC>GCA		Fc receptor-like 3 precursor							111.0	111.0	111.0					1																	157665243		2203	4300	6503	SO:0001819	synonymous_variant	115352					integral to membrane|plasma membrane	receptor activity	g.chr1:157665243G>T	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.1287C>A	1.37:g.157665243G>T						FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Silent_p.A429A|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_Silent_p.A155A|FCRL3_uc001frc.1_Silent_p.A429A	p.A429A	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN			8	1579	-	all_hematologic(112;0.0378)		429			Ig-like C2-type 5.|Extracellular (Potential).		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	ENST00000368184.3	37	c.1287C>A	CCDS1167.1																																																																																				0.577	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939		28	134	1	0	3.73808e-20	0.005443	7.37893e-20	28	134				
CD5L	922	broad.mit.edu	37	1	157809178	157809178	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:157809178G>T	ENST00000368174.4	-	2	147	c.51C>A	c.(49-51)ttC>ttA	p.F17L	CD5L_ENST00000484609.1_5'UTR	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	17					apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCTTACCTAGGAATCCAGGTC	0.443																																							uc001frk.3		NA																	0				ovary(1)	1						c.(49-51)TTC>TTA		CD5 molecule-like precursor							77.0	80.0	79.0					1																	157809178		2203	4300	6503	SO:0001583	missense	922				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity	g.chr1:157809178G>T	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.51C>A	1.37:g.157809178G>T	ENSP00000357156:p.Phe17Leu						p.F17L	NM_005894	NP_005885	O43866	CD5L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		2	194	-	all_hematologic(112;0.0378)		17					A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	c.51C>A	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948925	0.53186	.	.	ENSG00000073754	ENST00000368174	T	0.01359	4.98	4.96	-1.47	0.08772	.	.	.	.	.	T	0.00384	0.0012	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42344	-0.9457	9	0.11794	T	0.64	.	4.8205	0.13389	0.3506:0.0:0.5146:0.1348	.	17	O43866	CD5L_HUMAN	L	17	ENSP00000357156:F17L	ENSP00000357156:F17L	F	-	3	2	CD5L	156075802	0.000000	0.05858	0.000000	0.03702	0.669000	0.39330	-0.246000	0.08878	-0.481000	0.06792	0.655000	0.94253	TTC		0.443	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894		11	67	1	0	7.03913e-09	0.001368	1.06838e-08	11	67				
OR10K2	391107	broad.mit.edu	37	1	158390349	158390349	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:158390349G>T	ENST00000314902.2	-	1	307	c.308C>A	c.(307-309)tCc>tAc	p.S103Y		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					GAAGAGGAAGGAAAACATTTG	0.483																																							uc010pii.1		NA																	0				pancreas(1)	1						c.(307-309)TCC>TAC		olfactory receptor, family 10, subfamily K,							179.0	177.0	178.0					1																	158390349		2203	4300	6503	SO:0001583	missense	391107				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158390349G>T	AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.308C>A	1.37:g.158390349G>T	ENSP00000324251:p.Ser103Tyr						p.S103Y	NM_001004476	NP_001004476	Q6IF99	O10K2_HUMAN			1	308	-	all_hematologic(112;0.0378)		103			Helical; Name=3; (Potential).			Missense_Mutation	SNP	ENST00000314902.2	37	c.308C>A	CCDS30896.1	.	.	.	.	.	.	.	.	.	.	G	8.240	0.806590	0.16467	.	.	ENSG00000180708	ENST00000314902	T	0.00241	8.46	4.1	3.17	0.36434	GPCR, rhodopsin-like superfamily (1);	0.444320	0.18976	N	0.126005	T	0.00039	0.0001	L	0.41492	1.28	0.09310	N	1	P	0.36392	0.551	B	0.33042	0.157	T	0.00660	-1.1622	10	0.87932	D	0	.	5.8992	0.18957	0.3113:0.0:0.6887:0.0	.	103	Q6IF99	O10K2_HUMAN	Y	103	ENSP00000324251:S103Y	ENSP00000324251:S103Y	S	-	2	0	OR10K2	156656973	0.002000	0.14202	0.452000	0.26994	0.561000	0.35649	1.492000	0.35594	1.049000	0.40321	0.467000	0.42956	TCC		0.483	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	NM_001004476		32	125	1	0	1.45844e-13	0.002836	2.5411e-13	32	125				
OR6N2	81442	broad.mit.edu	37	1	158746645	158746645	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:158746645G>T	ENST00000339258.1	-	1	780	c.781C>A	c.(781-783)Cgg>Agg	p.R261R		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					TTCTTTAGCCGCACATACATG	0.433																																							uc010pir.1		NA																	0					0						c.(781-783)CGG>AGG		olfactory receptor, family 6, subfamily N,							102.0	97.0	98.0					1																	158746645		2203	4300	6503	SO:0001819	synonymous_variant	81442				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158746645G>T	BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.781C>A	1.37:g.158746645G>T							p.R261R	NM_001005278	NP_001005278	Q8NGY6	OR6N2_HUMAN			1	781	-	all_hematologic(112;0.0378)		261			Extracellular (Potential).		Q6IFR2	Silent	SNP	ENST00000339258.1	37	c.781C>A	CCDS30906.1																																																																																				0.433	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059068.1			18	72	1	0	8.28177e-16	0.007413	1.55397e-15	18	72				
CASQ1	844	broad.mit.edu	37	1	160162662	160162662	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:160162662T>A	ENST00000368078.3	+	2	546	c.350T>A	c.(349-351)gTg>gAg	p.V117E	CASQ1_ENST00000368079.3_Missense_Mutation_p.V111E			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	117					endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GATGCAGCTGTGGCCAAGAAA	0.552											OREG0013927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010pja.1		NA																	0				central_nervous_system(1)	1						c.(349-351)GTG>GAG		calsequestrin 1							101.0	106.0	104.0					1																	160162662		2203	4300	6503	SO:0001583	missense	844					mitochondrial matrix|sarcoplasmic reticulum lumen|smooth endoplasmic reticulum	calcium ion binding	g.chr1:160162662T>A	S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.350T>A	1.37:g.160162662T>A	ENSP00000357057:p.Val117Glu		OREG0013927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1806		p.V117E	NM_001231	NP_001222	P31415	CASQ1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		2	607	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		117					B1AKZ2|B2R863|Q8TBW7	Missense_Mutation	SNP	ENST00000368078.3	37	c.350T>A	CCDS1198.2	.	.	.	.	.	.	.	.	.	.	T	22.2	4.252004	0.80135	.	.	ENSG00000143318	ENST00000368079;ENST00000368078	T;T	0.77750	-1.12;-1.12	4.54	4.54	0.55810	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	D	0.84982	0.5593	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.87548	0.2463	10	0.87932	D	0	.	13.0432	0.58913	0.0:0.0:0.0:1.0	.	117	P31415	CASQ1_HUMAN	E	111;117	ENSP00000357058:V111E;ENSP00000357057:V117E	ENSP00000357057:V117E	V	+	2	0	CASQ1	158429286	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.314000	0.78988	1.911000	0.55334	0.369000	0.22263	GTG		0.552	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077412.1	NM_001231		26	92	0	0	0	0.00333	0	26	92				
F5	2153	broad.mit.edu	37	1	169524505	169524505	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:169524505G>A	ENST00000367797.3	-	7	1234	c.1033C>T	c.(1033-1035)Cgg>Tgg	p.R345W	F5_ENST00000546081.1_Missense_Mutation_p.R208W|F5_ENST00000367796.3_Missense_Mutation_p.R345W	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	345					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TTCATGTGCCGCCTCTGCTCA	0.448																																							uc001ggg.1		NA																	0				ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(1033-1035)CGG>TGG		coagulation factor V precursor	Drotrecogin alfa(DB00055)						153.0	141.0	145.0					1																	169524505		2203	4300	6503	SO:0001583	missense	2153				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity	g.chr1:169524505G>A	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.1033C>T	1.37:g.169524505G>A	ENSP00000356771:p.Arg345Trp					F5_uc010plr.1_RNA	p.R345W	NM_000130	NP_000121	P12259	FA5_HUMAN			7	1178	-	all_hematologic(923;0.208)		345					A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	c.1033C>T	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.677156	0.68042	.	.	ENSG00000198734	ENST00000367797;ENST00000367796;ENST00000546081	D;D;D	0.98901	-5.22;-5.22;-5.22	5.69	3.79	0.43588	Cupredoxin (1);	0.287735	0.32190	N	0.006452	D	0.98510	0.9503	M	0.79475	2.455	0.34219	D	0.675172	D	0.89917	1.0	D	0.75484	0.986	D	0.99548	1.0965	9	0.87932	D	0	-19.1525	9.0834	0.36565	0.0684:0.0:0.6683:0.2632	.	345	P12259	FA5_HUMAN	W	345;345;208	ENSP00000356771:R345W;ENSP00000356770:R345W;ENSP00000439664:R208W	ENSP00000356770:R345W	R	-	1	2	F5	167791129	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	3.779000	0.55379	0.743000	0.32719	0.644000	0.83932	CGG		0.448	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		13	105	0	0	0	0.001855	0	13	105				
PRRC2C	23215	broad.mit.edu	37	1	171510839	171510839	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:171510839G>T	ENST00000338920.4	+	16	4465	c.4228G>T	c.(4228-4230)Gag>Tag	p.E1410*	PRRC2C_ENST00000367742.3_Nonsense_Mutation_p.E1412*|PRRC2C_ENST00000392078.3_Nonsense_Mutation_p.E1412*|PRRC2C_ENST00000426496.2_Nonsense_Mutation_p.E1410*	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1410	Arg-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TCCAAAATTTGAGCGAAAATT	0.493																																							uc010pmg.1		NA																	0					0						c.(4228-4230)GAG>TAG		HBxAg transactivated protein 2							41.0	40.0	40.0					1																	171510839		2203	4300	6503	SO:0001587	stop_gained	23215						protein C-terminus binding	g.chr1:171510839G>T	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.4228G>T	1.37:g.171510839G>T	ENSP00000343629:p.Glu1410*					BAT2L2_uc010pmh.1_Nonsense_Mutation_p.E387*	p.E1410*	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN			16	4494	+			1410			Arg-rich.		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Nonsense_Mutation	SNP	ENST00000338920.4	37	c.4228G>T	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	G	46	12.446683	0.99668	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	.	.	.	4.93	4.93	0.64822	.	0.137909	0.32503	N	0.006018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	18.5894	0.91204	0.0:0.0:1.0:0.0	.	.	.	.	X	1412;1411;1410;1412;1410;1167	.	ENSP00000343629:E1410X	E	+	1	0	PRRC2C	169777463	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.011000	0.93618	2.436000	0.82500	0.650000	0.86243	GAG		0.493	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172		7	26	1	0	1.12685e-05	0.004482	1.46598e-05	7	26				
ABL2	27	broad.mit.edu	37	1	179079530	179079530	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:179079530C>A	ENST00000502732.1	-	11	1915	c.1712G>T	c.(1711-1713)cGg>cTg	p.R571L	ABL2_ENST00000344730.3_Missense_Mutation_p.R556L|ABL2_ENST00000504405.1_Missense_Mutation_p.R535L|ABL2_ENST00000408940.3_Missense_Mutation_p.R535L|ABL2_ENST00000367623.4_Missense_Mutation_p.R550L|ABL2_ENST00000511413.1_Missense_Mutation_p.R571L|ABL2_ENST00000507173.1_Missense_Mutation_p.R550L|ABL2_ENST00000512653.1_Missense_Mutation_p.R556L	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	571					actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TATAGGTAGCCGGGGCAGGTA	0.498			T	ETV6	AML																																		uc001gmj.3		NA		Dom	yes		1	1q24-q25	27	T	v-abl Abelson murine leukemia viral oncogene homolog 2			L	ETV6		AML		0				lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14						c.(1711-1713)CGG>CTG		arg tyrosine kinase isoform b	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)						148.0	148.0	148.0					1																	179079530		2203	4300	6503	SO:0001583	missense	27				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr1:179079530C>A	M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.1712G>T	1.37:g.179079530C>A	ENSP00000427562:p.Arg571Leu					ABL2_uc010pnf.1_Missense_Mutation_p.R571L|ABL2_uc010png.1_Missense_Mutation_p.R550L|ABL2_uc010pnh.1_Missense_Mutation_p.R550L|ABL2_uc001gmg.3_Missense_Mutation_p.R556L|ABL2_uc001gmi.3_Missense_Mutation_p.R556L|ABL2_uc001gmh.3_Missense_Mutation_p.R535L|ABL2_uc010pne.1_Missense_Mutation_p.R535L	p.R571L	NM_007314	NP_009298	P42684	ABL2_HUMAN			11	1999	-			571					A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	37	c.1712G>T	CCDS30947.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.642232	0.87859	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413	T;T;T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27	5.91	5.91	0.95273	.	0.155823	0.29924	N	0.010859	T	0.31263	0.0791	L	0.40543	1.245	0.54753	D	0.999987	P;P;P;B;P;P;B;D	0.54397	0.915;0.943;0.943;0.244;0.623;0.943;0.262;0.966	P;P;P;B;B;P;B;P	0.56865	0.477;0.722;0.722;0.059;0.258;0.51;0.074;0.808	T	0.00345	-1.1801	10	0.62326	D	0.03	.	19.2867	0.94077	0.0:1.0:0.0:0.0	.	550;550;571;535;571;556;535;556	P42684-6;P42684-7;P42684-5;P42684-4;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;ABL2_HUMAN;.;.;.	L	571;535;556;556;535;550;550;571	ENSP00000427562:R571L;ENSP00000386152:R535L;ENSP00000339209:R556L;ENSP00000423578:R556L;ENSP00000426831:R535L;ENSP00000356595:R550L;ENSP00000423413:R550L;ENSP00000424697:R571L	ENSP00000339209:R556L	R	-	2	0	ABL2	177346153	0.998000	0.40836	0.944000	0.38274	0.789000	0.44602	3.365000	0.52335	2.793000	0.96121	0.655000	0.94253	CGG		0.498	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158		31	96	1	0	5.77227e-19	0.008361	1.12002e-18	31	96				
ACBD6	84320	broad.mit.edu	37	1	180257516	180257516	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:180257516G>A	ENST00000367595.3	-	8	1518	c.831C>T	c.(829-831)caC>caT	p.H277H	ACBD6_ENST00000475338.2_5'UTR	NM_032360.3	NP_115736.1	Q9BR61	ACBD6_HUMAN	acyl-CoA binding domain containing 6	277						cytoplasm (GO:0005737)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)		ACBD6/RRP15(2)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	7						TGCCAGTTGTGTGCCGCTGCA	0.473																																							uc001gog.2		NA																	0				ovary(1)	1						c.(829-831)CAC>CAT		acyl-coenzyme A binding domain containing 6							56.0	56.0	56.0					1																	180257516		2203	4300	6503	SO:0001819	synonymous_variant	84320					cytoplasm|nucleus	fatty-acyl-CoA binding	g.chr1:180257516G>A	BC006505	CCDS1339.1	1q25.1	2013-10-11	2010-04-30		ENSG00000135847			"""Ankyrin repeat domain containing"""	23339	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 6"""			18268358	Standard	NM_032360		Approved	MGC2404	uc001gog.3	Q9BR61	OTTHUMG00000035117	ENST00000367595.3:c.831C>T	1.37:g.180257516G>A							p.H277H	NM_032360	NP_115736	Q9BR61	ACBD6_HUMAN			8	1452	-			277						Silent	SNP	ENST00000367595.3	37	c.831C>T	CCDS1339.1																																																																																				0.473	ACBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084998.1	NM_032360		9	45	0	0	0	0.008291	0	9	45				
IER5	51278	broad.mit.edu	37	1	181058374	181058374	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:181058374G>T	ENST00000367577.4	+	1	737	c.336G>T	c.(334-336)cgG>cgT	p.R112R	RP11-309G3.3_ENST00000606938.1_lincRNA	NM_016545.4	NP_057629.2	Q5VY09	IER5_HUMAN	immediate early response 5	112										lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	4						ACGCGCCGCGGGTAGGGGACG	0.751																																							uc001got.3		NA																	0				pancreas(1)	1						c.(334-336)CGG>CGT		immediate early response 5							14.0	16.0	15.0					1																	181058374		2158	4240	6398	SO:0001819	synonymous_variant	51278							g.chr1:181058374G>T	BC000128	CCDS1343.1	1q25.3	2008-02-05			ENSG00000162783	ENSG00000162783			5393	protein-coding gene	gene with protein product		607177				10049588, 11102586	Standard	NM_016545		Approved		uc001got.4	Q5VY09	OTTHUMG00000035178	ENST00000367577.4:c.336G>T	1.37:g.181058374G>T							p.R112R	NM_016545	NP_057629	Q5VY09	IER5_HUMAN			1	737	+			112					B2RBV3|Q8WY68|Q9NY49|Q9NZP9	Silent	SNP	ENST00000367577.4	37	c.336G>T	CCDS1343.1																																																																																				0.751	IER5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085142.1	NM_016545		4	8	1	0	0.000157383	0.00308	0.000188254	4	8				
RGS8	85397	broad.mit.edu	37	1	182615976	182615976	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:182615976G>T	ENST00000483095.2	-	7	694	c.437C>A	c.(436-438)gCc>gAc	p.A146D	RGS8_ENST00000367557.4_Missense_Mutation_p.A146D|RGS8_ENST00000367556.1_Missense_Mutation_p.A146D|RGS8_ENST00000258302.4_Missense_Mutation_p.A164D			P57771	RGS8_HUMAN	regulator of G-protein signaling 8	146	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			haematopoietic_and_lymphoid_tissue(1)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	5						TTTTCCTTGGGCTTGGTCAAA	0.502																																					Ovarian(189;1262 3804 41973)	Ovarian(189;1262 3804 41973)	uc010pnw.1		NA																	0				ovary(1)	1						c.(436-438)GCC>GAC		regulator of G-protein signalling 8 isoform 2							215.0	210.0	212.0					1																	182615976		2203	4300	6503	SO:0001583	missense	85397				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:182615976G>T	AF297015	CCDS1349.1, CCDS41443.1	1q25	2008-07-18	2007-08-14		ENSG00000135824	ENSG00000135824		"""Regulators of G-protein signaling"""	16810	protein-coding gene	gene with protein product		607189	"""regulator of G-protein signalling 8"""			11318611	Standard	NM_001102450		Approved	MGC119067, MGC119068, MGC119069	uc001gpm.1	P57771	OTTHUMG00000035219	ENST00000483095.2:c.437C>A	1.37:g.182615976G>T	ENSP00000426289:p.Ala146Asp					RGS8_uc001gpn.1_Missense_Mutation_p.A146D|RGS8_uc001gpm.1_Missense_Mutation_p.A164D	p.A146D	NM_001102450	NP_001095920	P57771	RGS8_HUMAN			7	695	-			146			RGS.		B4DGL9|Q3SYD2	Missense_Mutation	SNP	ENST00000483095.2	37	c.437C>A	CCDS41443.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058868	0.76074	.	.	ENSG00000135824	ENST00000483095;ENST00000258302;ENST00000367557;ENST00000367556	T;T;T;T	0.02709	4.19;4.19;4.19;4.19	5.13	4.18	0.49190	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.051023	0.85682	D	0.000000	T	0.25344	0.0616	H	0.97103	3.94	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.87578	0.992;0.998	T	0.43686	-0.9376	10	0.87932	D	0	.	15.3572	0.74437	0.0:0.1397:0.8603:0.0	.	146;164	P57771;P57771-2	RGS8_HUMAN;.	D	146;164;146;146	ENSP00000426289:A146D;ENSP00000258302:A164D;ENSP00000356528:A146D;ENSP00000356527:A146D	ENSP00000258302:A164D	A	-	2	0	RGS8	180882599	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.125000	0.71627	2.381000	0.81170	0.485000	0.47835	GCC		0.502	RGS8-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358979.1	NM_033345		32	135	1	0	1.06801e-11	0.009535	1.77915e-11	32	135				
COLGALT2	23127	broad.mit.edu	37	1	183933123	183933123	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:183933123G>T	ENST00000361927.4	-	6	1235	c.864C>A	c.(862-864)caC>caA	p.H288Q	COLGALT2_ENST00000546159.1_Missense_Mutation_p.H288Q|COLGALT2_ENST00000367520.3_Missense_Mutation_p.H25Q	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	288					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										GGTAGCCATAGTGCTCTCTGT	0.512																																						Esophageal Squamous(10;42 606 18489 38825)	uc001gqr.2		NA																	0				ovary(1)|breast(1)	2						c.(862-864)CAC>CAA		glycosyltransferase 25 domain containing 2							141.0	114.0	123.0					1																	183933123		2203	4300	6503	SO:0001583	missense	23127				lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity	g.chr1:183933123G>T	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.864C>A	1.37:g.183933123G>T	ENSP00000354960:p.His288Gln					GLT25D2_uc010poj.1_Missense_Mutation_p.H288Q|GLT25D2_uc001gqq.2_Missense_Mutation_p.H25Q|GLT25D2_uc001gqs.2_Missense_Mutation_p.H168Q	p.H288Q	NM_015101	NP_055916	Q8IYK4	GT252_HUMAN			6	1236	-			288					O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	37	c.864C>A	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.777617	0.31502	.	.	ENSG00000198756	ENST00000546159;ENST00000361927;ENST00000367520	T;T	0.25414	1.8;1.8	5.74	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.30198	0.0757	L	0.43757	1.38	0.58432	D	0.999997	D;P;P	0.60575	0.988;0.67;0.69	P;B;B	0.54889	0.763;0.296;0.157	T	0.04551	-1.0943	10	0.20519	T	0.43	.	8.8072	0.34945	0.2227:0.0:0.7773:0.0	.	288;288;25	F5H3T5;Q8IYK4;Q5SXQ3	.;GT252_HUMAN;.	Q	288;288;25	ENSP00000439112:H288Q;ENSP00000354960:H288Q	ENSP00000354960:H288Q	H	-	3	2	GLT25D2	182199746	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.477000	0.35431	1.422000	0.47177	0.655000	0.94253	CAC		0.512	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101		9	38	1	0	3.09899e-07	0.004482	4.38221e-07	9	38				
CFHR1	3078	broad.mit.edu	37	1	196801077	196801077	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:196801077G>T	ENST00000320493.5	+	6	1029	c.941G>T	c.(940-942)cGa>cTa	p.R314L	CFHR1_ENST00000367424.4_Missense_Mutation_p.R255L|CFHR2_ENST00000367421.3_Intron	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	314	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						CACACATTGCGAACAACATGT	0.383																																							uc001gtn.2		NA																	0					0						c.(940-942)CGA>CTA		complement factor H-related 1 precursor							76.0	81.0	80.0					1																	196801077		1878	4125	6003	SO:0001583	missense	3078				complement activation	extracellular space		g.chr1:196801077G>T	M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.941G>T	1.37:g.196801077G>T	ENSP00000314299:p.Arg314Leu					CFHR1_uc001gtm.2_Missense_Mutation_p.R218L	p.R314L	NM_002113	NP_002104	Q03591	FHR1_HUMAN			6	1055	+			314			Sushi 5.		A8K465|Q3B774|Q9UJ17	Missense_Mutation	SNP	ENST00000320493.5	37	c.941G>T	CCDS1386.1	.	.	.	.	.	.	.	.	.	.	.	11.86	1.763425	0.31228	.	.	ENSG00000244414	ENST00000367424;ENST00000320493	D;D	0.84370	-1.84;-1.84	2.47	1.52	0.23074	Complement control module (1);Sushi/SCR/CCP (3);	.	.	.	.	D	0.91246	0.7241	M	0.86805	2.84	0.09310	N	1	D;D	0.71674	0.998;0.983	D;D	0.68765	0.96;0.946	T	0.80752	-0.1242	9	0.72032	D	0.01	.	7.1663	0.25693	0.0:0.2804:0.7196:0.0	.	314;1215	Q03591;A8K5T0	FHR1_HUMAN;.	L	255;314	ENSP00000356394:R255L;ENSP00000314299:R314L	ENSP00000314299:R314L	R	+	2	0	CFHR1	195067700	0.056000	0.20664	0.004000	0.12327	0.008000	0.06430	1.291000	0.33330	0.572000	0.29383	0.186000	0.17326	CGA		0.383	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088251.2	NM_002113		17	57	1	0	8.24728e-16	0.004656	1.55397e-15	17	57				
F13B	2165	broad.mit.edu	37	1	197032028	197032028	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:197032028G>A	ENST00000367412.1	-	2	267	c.224C>T	c.(223-225)aCg>aTg	p.T75M		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	75	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						TGTTGTACACGTGGTTTGCTC	0.373																																							uc001gtt.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(223-225)ACG>ATG		coagulation factor XIII B subunit precursor							172.0	181.0	178.0					1																	197032028		2203	4300	6503	SO:0001583	missense	2165				blood coagulation	extracellular region		g.chr1:197032028G>A	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.224C>T	1.37:g.197032028G>A	ENSP00000356382:p.Thr75Met						p.T75M	NM_001994	NP_001985	P05160	F13B_HUMAN			2	268	-			75			Sushi 1.		A8K3E5|Q5VYL5	Missense_Mutation	SNP	ENST00000367412.1	37	c.224C>T	CCDS1388.1	.	.	.	.	.	.	.	.	.	.	G	6.990	0.552737	0.13374	.	.	ENSG00000143278	ENST00000367412	T	0.70045	-0.45	5.58	-2.36	0.06663	Complement control module (2);Sushi/SCR/CCP (2);	0.246893	0.21274	N	0.077272	T	0.55337	0.1914	L	0.61218	1.895	0.09310	N	1	D	0.56035	0.974	B	0.42995	0.404	T	0.53788	-0.8389	10	0.46703	T	0.11	.	5.3369	0.15963	0.0629:0.3784:0.2294:0.3293	.	75	P05160	F13B_HUMAN	M	75	ENSP00000356382:T75M	ENSP00000356382:T75M	T	-	2	0	F13B	195298651	0.001000	0.12720	0.000000	0.03702	0.025000	0.11179	0.095000	0.15127	-0.499000	0.06623	0.655000	0.94253	ACG		0.373	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994		14	182	0	0	0	0.003163	0	14	182				
KIF14	9928	broad.mit.edu	37	1	200559401	200559401	+	Splice_Site	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:200559401C>T	ENST00000367350.4	-	17	3252		c.e17-1			NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14						ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TGCTTCAAGTCTACAATGTAG	0.338																																							uc010ppk.1		NA																	0				breast(3)|ovary(2)|skin(2)	7						c.e17-1		kinesin family member 14							171.0	169.0	170.0					1																	200559401		2203	4300	6503	SO:0001630	splice_region_variant	9928				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding	g.chr1:200559401C>T	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.2814-1G>A	1.37:g.200559401C>T						KIF14_uc010ppj.1_Splice_Site_p.Q447_splice	p.Q938_splice	NM_014875	NP_055690	Q15058	KIF14_HUMAN			17	3253	-								Q14CI8|Q4G0A5|Q5T1W3	Splice_Site	SNP	ENST00000367350.4	37	c.2814_splice	CCDS30963.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.512842	0.64522	.	.	ENSG00000118193	ENST00000367350	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.346	0.94362	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIF14	198826024	1.000000	0.71417	0.941000	0.38009	0.551000	0.35334	7.481000	0.81124	2.560000	0.86352	0.563000	0.77884	.		0.338	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	Intron	5	150	0	0	0	0.001168	0	5	150				
PPFIA4	8497	broad.mit.edu	37	1	203025516	203025516	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:203025516G>T	ENST00000447715.2	+	23	2495	c.2054G>T	c.(2053-2055)cGg>cTg	p.R685L	PPFIA4_ENST00000295706.4_Missense_Mutation_p.R201L|PPFIA4_ENST00000599966.1_Missense_Mutation_p.R201L|PPFIA4_ENST00000414050.2_Missense_Mutation_p.R414L|PPFIA4_ENST00000367240.2_Missense_Mutation_p.R686L|PPFIA4_ENST00000272198.6_Missense_Mutation_p.R201L			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	685					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						CCAGTGTCTCGGGAAGAGAAC	0.592																																							uc001gyz.2		NA																	0				ovary(4)|skin(1)	5						c.(601-603)CGG>CTG		protein tyrosine phosphatase, receptor type, f							49.0	55.0	53.0					1																	203025516		1955	4151	6106	SO:0001583	missense	8497				cell communication	cell surface|cytoplasm	protein binding	g.chr1:203025516G>T	AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.2054G>T	1.37:g.203025516G>T	ENSP00000402576:p.Arg685Leu					PPFIA4_uc009xaj.2_Missense_Mutation_p.R832L|PPFIA4_uc010pqf.1_Missense_Mutation_p.R414L|PPFIA4_uc001gza.2_Missense_Mutation_p.R201L|PPFIA4_uc001gzb.1_5'Flank	p.R201L	NM_015053	NP_055868	O75335	LIPA4_HUMAN			5	1195	+			201					A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Missense_Mutation	SNP	ENST00000447715.2	37	c.602G>T		.	.	.	.	.	.	.	.	.	.	g	17.53	3.413511	0.62511	.	.	ENSG00000143847	ENST00000367240;ENST00000447715;ENST00000295706;ENST00000414050;ENST00000272198	T;T;T;T;T	0.34859	2.22;1.9;1.88;1.34;1.34	4.78	4.78	0.61160	.	0.172599	0.27539	N	0.018910	T	0.42426	0.1202	L	0.52573	1.65	0.44871	D	0.997887	B;B;B;B	0.25390	0.0;0.056;0.125;0.076	B;B;B;B	0.36666	0.002;0.051;0.23;0.115	T	0.37502	-0.9703	10	0.46703	T	0.11	-21.994	18.0072	0.89213	0.0:0.0:1.0:0.0	.	414;685;201;201	B4DIS5;B1N949;O75335-2;O75335	.;.;.;LIPA4_HUMAN	L	686;685;201;414;201	ENSP00000356209:R686L;ENSP00000402576:R685L;ENSP00000295706:R201L;ENSP00000400379:R414L;ENSP00000272198:R201L	ENSP00000272198:R201L	R	+	2	0	PPFIA4	201292139	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.422000	0.73357	2.489000	0.83994	0.457000	0.33378	CGG		0.592	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1	NM_015053		10	39	1	0	5.16669e-11	0.000978	8.34243e-11	10	39				
PLEKHA6	22874	broad.mit.edu	37	1	204230557	204230557	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:204230557C>A	ENST00000272203.3	-	7	717	c.401G>T	c.(400-402)cGc>cTc	p.R134L	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.R154L|PLEKHA6_ENST00000485632.1_5'UTR	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	134	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.									breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GAAGTAGGTGCGGACCCCGGC	0.637																																							uc001hau.2		NA																	0				ovary(3)|pancreas(1)	4						c.(400-402)CGC>CTC		phosphoinositol 3-phosphate-binding protein-3							41.0	41.0	41.0					1																	204230557		2203	4300	6503	SO:0001583	missense	22874							g.chr1:204230557C>A	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.401G>T	1.37:g.204230557C>A	ENSP00000272203:p.Arg134Leu						p.R134L	NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)		7	718	-	all_cancers(21;0.0222)|Breast(84;0.179)		134			PH.		A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	c.401G>T	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	C	35	5.460752	0.96240	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.18016	2.24;2.24	5.56	5.56	0.83823	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.100249	0.64402	D	0.000003	T	0.49167	0.1541	M	0.85859	2.78	0.80722	D	1	D	0.59357	0.985	D	0.74674	0.984	T	0.54268	-0.8319	10	0.87932	D	0	-26.2646	19.1294	0.93399	0.0:1.0:0.0:0.0	.	134	Q9Y2H5	PKHA6_HUMAN	L	134;154	ENSP00000272203:R134L;ENSP00000402046:R154L	ENSP00000272203:R134L	R	-	2	0	PLEKHA6	202497180	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.139000	0.77314	2.601000	0.87937	0.655000	0.94253	CGC		0.637	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935		14	33	1	0	6.72482e-11	0.003163	1.08072e-10	14	33				
CR2	1380	broad.mit.edu	37	1	207647210	207647210	+	Silent	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:207647210T>C	ENST00000367058.3	+	11	2232	c.2043T>C	c.(2041-2043)gtT>gtC	p.V681V	CR2_ENST00000458541.2_Silent_p.V654V|CR2_ENST00000367059.3_Silent_p.V681V|CR2_ENST00000367057.3_Silent_p.V740V	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	681	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TGGAGCTAGTTAATACGTCCT	0.428																																							uc001hfw.2		NA																	0				upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						c.(2041-2043)GTT>GTC		complement component (3d/Epstein Barr virus)							108.0	103.0	105.0					1																	207647210		2203	4300	6503	SO:0001819	synonymous_variant	1380				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity	g.chr1:207647210T>C	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2043T>C	1.37:g.207647210T>C						CR2_uc001hfv.2_Silent_p.V740V|CR2_uc009xch.2_Silent_p.V681V	p.V681V	NM_001877	NP_001868	P20023	CR2_HUMAN			11	2137	+			681			Sushi 11.|Extracellular (Potential).		C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	ENST00000367058.3	37	c.2043T>C	CCDS1478.1																																																																																				0.428	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877		19	65	0	0	0	0.007413	0	19	65				
DIEXF	27042	broad.mit.edu	37	1	210004186	210004186	+	Silent	SNP	A	A	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:210004186A>G	ENST00000491415.2	+	3	243	c.186A>G	c.(184-186)tcA>tcG	p.S62S		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	62					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						AAAGCGACTCAGAGAGTGAAC	0.378																																							uc001hhr.1		NA																	0					0						c.(184-186)TCA>TCG		digestive-organ expansion factor homolog							70.0	68.0	69.0					1																	210004186		2203	4300	6503	SO:0001819	synonymous_variant	27042				multicellular organismal development	nucleus		g.chr1:210004186A>G	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.186A>G	1.37:g.210004186A>G						C1orf107_uc009xcu.1_5'UTR	p.S62S	NM_014388	NP_055203	Q68CQ4	DIEXF_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0367)	3	262	+			62					O75992|Q4VY00|Q63HL9	Silent	SNP	ENST00000491415.2	37	c.186A>G	CCDS1493.1																																																																																				0.378	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388		16	55	0	0	0	0.006122	0	16	55				
Unknown	0	broad.mit.edu	37	1	211380632	211380632	+	IGR	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:211380632G>C								RP11-543B16.3 (24186 upstream) : AC092017.1 (3698 downstream)																							CTGGGACCAAGTGTTCGCCGC	0.617																																							uc001hid.2		NA																	0					NA						c.(52-54)GTG>CTG		SubName: Full=Px19-like protein, isoform CRA_c; SubName: Full=cDNA, FLJ92457, Homo sapiens px19-like protein (PX19), mRNA;																																				SO:0001628	intergenic_variant	0							g.chr1:211380632G>C																													1.37:g.211380632G>C							p.V18L							1	244	+									Missense_Mutation	SNP		37	c.52G>C																																																																																				0	0.617									7	21	0	0	0	0.004482	0	7	21				
CENPF	1063	broad.mit.edu	37	1	214818608	214818608	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:214818608G>C	ENST00000366955.3	+	13	5863	c.5695G>C	c.(5695-5697)Gat>Cat	p.D1899H		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1995					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GAGATTTCTTGATGTGGAAAA	0.428																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	0				ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(5695-5697)GAT>CAT		centromere protein F							74.0	72.0	73.0					1																	214818608		2203	4300	6503	SO:0001583	missense	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214818608G>C	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5695G>C	1.37:g.214818608G>C	ENSP00000355922:p.Asp1899His						p.D1899H	NM_016343	NP_057427	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	13	5869	+			1995			Potential.		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	c.5695G>C	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	G	4.267	0.048620	0.08243	.	.	ENSG00000117724	ENST00000366955	T	0.22336	1.96	5.45	-0.0672	0.13761	.	0.624682	0.13297	N	0.398502	T	0.19366	0.0465	L	0.56769	1.78	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.21280	-1.0250	10	0.59425	D	0.04	.	7.4265	0.27102	0.0626:0.3344:0.4878:0.1152	.	1995	P49454	CENPF_HUMAN	H	1899	ENSP00000355922:D1899H	ENSP00000355922:D1899H	D	+	1	0	CENPF	212885231	0.215000	0.23574	0.000000	0.03702	0.127000	0.20565	0.530000	0.23036	-0.259000	0.09432	0.609000	0.83330	GAT		0.428	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		17	66	0	0	0	0.006122	0	17	66				
USH2A	7399	broad.mit.edu	37	1	215972262	215972262	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:215972262G>T	ENST00000307340.3	-	50	10331	c.9945C>A	c.(9943-9945)taC>taA	p.Y3315*	USH2A_ENST00000366943.2_Nonsense_Mutation_p.Y3315*	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3315					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GAAGGCGATTGTACACCACTC	0.483										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(9943-9945)TAC>TAA		usherin isoform B							160.0	136.0	144.0					1																	215972262		2203	4300	6503	SO:0001587	stop_gained	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215972262G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9945C>A	1.37:g.215972262G>T	ENSP00000305941:p.Tyr3315*	HNSCC(13;0.011)					p.Y3315*	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	50	10332	-			3315			Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	ENST00000307340.3	37	c.9945C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	51	18.134800	0.99900	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	.	.	.	5.8	4.7	0.59300	.	0.188310	0.25845	N	0.027926	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4879	0.61377	0.1276:0.0:0.8724:0.0	.	.	.	.	X	3315	.	ENSP00000305941:Y3315X	Y	-	3	2	USH2A	214038885	0.926000	0.31397	0.058000	0.19502	0.014000	0.08584	1.510000	0.35790	2.732000	0.93576	0.650000	0.86243	TAC		0.483	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		15	67	1	0	7.93312e-07	0.00245	1.09461e-06	15	67				
USH2A	7399	broad.mit.edu	37	1	216465670	216465670	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:216465670G>T	ENST00000307340.3	-	10	2073	c.1687C>A	c.(1687-1689)Caa>Aaa	p.Q563K	USH2A_ENST00000366943.2_Missense_Mutation_p.Q563K|USH2A_ENST00000366942.3_Missense_Mutation_p.Q563K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	563	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGATCACCTTGGCGGAAAGGC	0.368										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(1687-1689)CAA>AAA		usherin isoform B							93.0	87.0	89.0					1																	216465670		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216465670G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1687C>A	1.37:g.216465670G>T	ENSP00000305941:p.Gln563Lys	HNSCC(13;0.011)				USH2A_uc001hkv.2_Missense_Mutation_p.Q563K	p.Q563K	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	10	2074	-			563			Laminin EGF-like 1.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.1687C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	2.986	-0.209156	0.06140	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.62639	0.01;0.01;0.01	4.81	1.55	0.23275	EGF-like, laminin (2);	0.705718	0.11796	U	0.528681	T	0.60117	0.2244	M	0.79258	2.445	0.22317	N	0.999202	B;B	0.25007	0.003;0.116	B;B	0.25614	0.026;0.062	T	0.50224	-0.8853	10	0.25751	T	0.34	.	9.7178	0.40284	0.0:0.1242:0.5514:0.3244	.	563;563	O75445-2;O75445	.;USH2A_HUMAN	K	563	ENSP00000305941:Q563K;ENSP00000355910:Q563K;ENSP00000355909:Q563K	ENSP00000305941:Q563K	Q	-	1	0	USH2A	214532293	0.996000	0.38824	0.644000	0.29465	0.995000	0.86356	2.476000	0.45171	0.361000	0.24292	0.467000	0.42956	CAA		0.368	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		16	56	1	0	8.60227e-14	0.004007	1.53004e-13	16	56				
PGBD5	79605	broad.mit.edu	37	1	230492930	230492930	+	Nonsense_Mutation	SNP	C	C	A	rs534189007		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:230492930C>A	ENST00000525115.1	-	2	285	c.262G>T	c.(262-264)Gga>Tga	p.G88*	PGBD5_ENST00000321327.2_Nonsense_Mutation_p.G187*|PGBD5_ENST00000391860.1_Nonsense_Mutation_p.G42*			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	88						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		ACCCAGGCTCCGTCGCTCCCA	0.567																																							uc010pwb.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(262-264)GGA>TGA		piggyBac transposable element derived 5							103.0	90.0	95.0					1																	230492930		2203	4300	6503	SO:0001587	stop_gained	79605					integral to membrane		g.chr1:230492930C>A	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.262G>T	1.37:g.230492930C>A	ENSP00000431404:p.Gly88*					PGBD5_uc001htv.2_Nonsense_Mutation_p.G187*	p.G88*	NM_024554	NP_078830	Q8N414	PGBD5_HUMAN		GBM - Glioblastoma multiforme(131;0.201)	2	262	-	Breast(184;0.0397)	Prostate(94;0.167)	88					A0PJF3|B9EK58|Q5SR37|Q6PJN2	Nonsense_Mutation	SNP	ENST00000525115.1	37	c.262G>T		.	.	.	.	.	.	.	.	.	.	C	36	5.788225	0.96945	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	.	.	.	5.79	2.61	0.31194	.	0.288241	0.40554	N	0.001064	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-21.9089	9.7249	0.40326	0.0:0.754:0.0:0.246	.	.	.	.	X	42;187;88	.	ENSP00000322530:G187X	G	-	1	0	PGBD5	228559553	0.968000	0.33430	0.991000	0.47740	0.992000	0.81027	2.671000	0.46842	0.249000	0.21456	0.655000	0.94253	GGA		0.567	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554		11	50	1	0	0.00010058	0.001368	0.000121802	11	50				
RYR2	6262	broad.mit.edu	37	1	237923132	237923132	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:237923132C>T	ENST00000366574.2	+	83	11699	c.11382C>T	c.(11380-11382)gcC>gcT	p.A3794A	RYR2_ENST00000360064.6_Silent_p.A3800A|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Silent_p.A3778A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3794					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGAGCCTGGCCGGCCTGATGC	0.433																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(11380-11382)GCC>GCT		cardiac muscle ryanodine receptor							119.0	116.0	117.0					1																	237923132		1852	4087	5939	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237923132C>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11382C>T	1.37:g.237923132C>T						RYR2_uc010pya.1_Silent_p.A209A	p.A3794A	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		83	11502	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	3794					Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.11382C>T	CCDS55691.1																																																																																				0.433	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		18	71	0	0	0	0.001882	0	18	71				
FMN2	56776	broad.mit.edu	37	1	240256625	240256625	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:240256625C>G	ENST00000319653.9	+	1	1446	c.1216C>G	c.(1216-1218)Cgc>Ggc	p.R406G		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	406					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GCCTAGCCAGCGCTGTTTCAA	0.692																																							uc010pyd.1		NA																	0				ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(1216-1218)CGC>GGC		formin 2							29.0	36.0	34.0					1																	240256625		2202	4299	6501	SO:0001583	missense	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240256625C>G	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.1216C>G	1.37:g.240256625C>G	ENSP00000318884:p.Arg406Gly					FMN2_uc010pye.1_Missense_Mutation_p.R406G	p.R406G	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		1	1441	+	Ovarian(103;0.127)	all_cancers(173;0.013)	406					B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	c.1216C>G	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	11.04	1.522814	0.27211	.	.	ENSG00000155816	ENST00000319653	D	0.90385	-2.66	4.15	4.15	0.48705	.	0.214259	0.32987	N	0.005420	D	0.86573	0.5965	L	0.29908	0.895	0.80722	D	1	D	0.58268	0.982	P	0.46479	0.518	D	0.87780	0.2611	10	0.59425	D	0.04	.	12.6007	0.56494	0.1664:0.8336:0.0:0.0	.	406	Q9NZ56	FMN2_HUMAN	G	406	ENSP00000318884:R406G	ENSP00000318884:R406G	R	+	1	0	FMN2	238323248	0.999000	0.42202	0.998000	0.56505	0.838000	0.47535	4.314000	0.59166	2.130000	0.65690	0.462000	0.41574	CGC		0.692	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		13	56	0	0	0	0.001855	0	13	56				
KMO	8564	broad.mit.edu	37	1	241752098	241752098	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:241752098C>A	ENST00000366559.4	+	12	1375	c.1064C>A	c.(1063-1065)gCg>gAg	p.A355E	KMO_ENST00000366557.4_Missense_Mutation_p.A355E|KMO_ENST00000366558.3_Missense_Mutation_p.A355E	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)									p.A355G(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			GATGATCACGCGATTTCAGAC	0.363																																							uc009xgp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1063-1065)GCG>GAG		kynurenine 3-monooxygenase							184.0	170.0	175.0					1																	241752098		2203	4300	6503	SO:0001583	missense	8564				pyridine nucleotide biosynthetic process|response to salt stress	cytosol|integral to membrane|mitochondrial outer membrane	electron carrier activity|flavin adenine dinucleotide binding|kynurenine 3-monooxygenase activity|NAD(P)H oxidase activity	g.chr1:241752098C>A	AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.1064C>A	1.37:g.241752098C>A	ENSP00000355517:p.Ala355Glu					KMO_uc001hyy.2_Missense_Mutation_p.A355E|KMO_uc009xgo.1_Missense_Mutation_p.A355E	p.A355E	NM_003679	NP_003670	O15229	KMO_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0176)		12	1129	+	Ovarian(103;0.103)|all_lung(81;0.23)		355						Missense_Mutation	SNP	ENST00000366559.4	37	c.1064C>A	CCDS1618.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.590016	0.66105	.	.	ENSG00000117009	ENST00000366559;ENST00000366558;ENST00000366557	T;T;T	0.44482	0.92;0.92;0.92	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.72309	0.3444	M	0.91406	3.205	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.994;1.0	T	0.77651	-0.2508	10	0.87932	D	0	.	16.1399	0.81515	0.0:1.0:0.0:0.0	.	355;355;355	O15229;A8K693;O15229-2	KMO_HUMAN;.;.	E	355	ENSP00000355517:A355E;ENSP00000355516:A355E;ENSP00000355515:A355E	ENSP00000355515:A355E	A	+	2	0	KMO	239818721	1.000000	0.71417	0.979000	0.43373	0.052000	0.14988	6.616000	0.74205	2.880000	0.98712	0.650000	0.86243	GCG		0.363	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095612.1	NM_003679		11	40	1	0	0.000219431	0.00245	0.000259743	11	40				
WDR64	128025	broad.mit.edu	37	1	241886722	241886722	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:241886722G>T	ENST00000366552.2	+	9	1355	c.1148G>T	c.(1147-1149)aGc>aTc	p.S383I	WDR64_ENST00000437684.2_Missense_Mutation_p.S383I	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	383										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			CATGTCGTCAGCCTTTCCTCT	0.393																																							uc001hze.1		NA																	0				skin(1)	1						c.(1147-1149)AGC>ATC		RecName: Full=WD repeat-containing protein 64;							79.0	74.0	76.0					1																	241886722		2203	4300	6503	SO:0001583	missense	128025							g.chr1:241886722G>T	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1148G>T	1.37:g.241886722G>T	ENSP00000355510:p.Ser383Ile					WDR64_uc001hzf.1_Missense_Mutation_p.S103I	p.S383I			B1ANS9	WDR64_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0116)		9	1355	+	Ovarian(103;0.103)	all_cancers(173;0.0121)	383			WD 4.		B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	ENST00000366552.2	37	c.1148G>T		.	.	.	.	.	.	.	.	.	.	G	15.74	2.923939	0.52653	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.51574	1.73;0.7;4.66	4.7	4.7	0.59300	.	0.000000	0.64402	D	0.000002	T	0.70378	0.3217	M	0.83223	2.63	0.38043	D	0.93551	D	0.71674	0.998	D	0.78314	0.991	T	0.78262	-0.2272	10	0.87932	D	0	-21.5644	14.9266	0.70884	0.0:0.0:1.0:0.0	.	103	D1MPS4	.	I	383;383;154	ENSP00000355510:S383I;ENSP00000402446:S383I;ENSP00000406656:S154I	ENSP00000355510:S383I	S	+	2	0	WDR64	239953345	1.000000	0.71417	1.000000	0.80357	0.335000	0.28730	5.541000	0.67212	2.308000	0.77769	0.563000	0.77884	AGC		0.393	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625		13	40	1	0	1.41608e-15	0.001855	2.62821e-15	13	40				
CNST	163882	broad.mit.edu	37	1	246823556	246823556	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:246823556G>C	ENST00000366513.4	+	10	2161	c.1892G>C	c.(1891-1893)gGa>gCa	p.G631A		NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	631					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						GATACTGTAGGAGATCATCCT	0.403																																							uc001ibp.2		NA																	0					0						c.(1891-1893)GGA>GCA		hypothetical protein LOC163882 isoform 1							167.0	158.0	161.0					1																	246823556		2203	4300	6503	SO:0001583	missense	163882				positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding	g.chr1:246823556G>C	AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1892G>C	1.37:g.246823556G>C	ENSP00000355470:p.Gly631Ala						p.G631A	NM_152609	NP_689822	Q6PJW8	CNST_HUMAN			10	2270	+			631					Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	ENST00000366513.4	37	c.1892G>C	CCDS1628.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163235	0.78226	.	.	ENSG00000162852	ENST00000366513	T	0.25414	1.8	5.44	4.51	0.55191	.	0.055575	0.64402	D	0.000001	T	0.51958	0.1705	M	0.78801	2.425	0.80722	D	1	D	0.76494	0.999	D	0.70227	0.968	T	0.59397	-0.7462	10	0.72032	D	0.01	-7.5195	15.7108	0.77626	0.0:0.0:0.8621:0.1379	.	631	Q6PJW8	CNST_HUMAN	A	631	ENSP00000355470:G631A	ENSP00000355470:G631A	G	+	2	0	CNST	244890179	1.000000	0.71417	0.885000	0.34714	0.997000	0.91878	4.101000	0.57769	1.397000	0.46682	0.655000	0.94253	GGA		0.403	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609		31	106	0	0	0	0.002096	0	31	106				
NLRP3	114548	broad.mit.edu	37	1	247587867	247587867	+	Silent	SNP	C	C	A	rs374056197		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:247587867C>A	ENST00000336119.3	+	3	1868	c.1122C>A	c.(1120-1122)tcC>tcA	p.S374S	NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391827.2_Silent_p.S374S|NLRP3_ENST00000366497.2_Silent_p.S374S|NLRP3_ENST00000391828.3_Silent_p.S374S|NLRP3_ENST00000348069.2_Silent_p.S374S|NLRP3_ENST00000366496.2_Silent_p.S374S	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	374	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			TGGGTTTCTCCGAGGCCAAAA	0.552																																							uc001icr.2		NA																	0				lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(1120-1122)TCC>TCA		NLR family, pyrin domain containing 3 isoform a							61.0	61.0	61.0					1																	247587867		2203	4300	6503	SO:0001819	synonymous_variant	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247587867C>A	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1122C>A	1.37:g.247587867C>A						NLRP3_uc001ics.2_Silent_p.S374S|NLRP3_uc001icu.2_Silent_p.S374S|NLRP3_uc001icw.2_Silent_p.S374S|NLRP3_uc001icv.2_Silent_p.S374S|NLRP3_uc010pyw.1_Silent_p.S372S|NLRP3_uc001ict.1_Silent_p.S372S	p.S374S	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	1260	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	374			NACHT.		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Silent	SNP	ENST00000336119.3	37	c.1122C>A	CCDS1632.1																																																																																				0.552	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		21	61	1	0	4.96729e-08	0.008871	7.26479e-08	21	61				
FAM171A1	221061	broad.mit.edu	37	10	15255469	15255469	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:15255469C>A	ENST00000378116.4	-	8	2124	c.2118G>T	c.(2116-2118)cgG>cgT	p.R706R	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	706						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CGAACCACGCCCGGGGGTGCG	0.557																																							uc001iob.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(2116-2118)CGG>CGT		hypothetical protein LOC221061 precursor							61.0	65.0	64.0					10																	15255469		2203	4300	6503	SO:0001819	synonymous_variant	221061					integral to membrane		g.chr10:15255469C>A	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.2118G>T	10.37:g.15255469C>A							p.R706R	NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN			8	2125	-			706			Cytoplasmic (Potential).		D3DRT9|Q32M49|Q8N4I0	Silent	SNP	ENST00000378116.4	37	c.2118G>T	CCDS31154.1																																																																																				0.557	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		24	66	1	0	3.08376e-08	0.00333	4.5589e-08	24	66				
SLC39A12	221074	broad.mit.edu	37	10	18266980	18266980	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:18266980G>T	ENST00000377369.2	+	5	1174	c.901G>T	c.(901-903)Gat>Tat	p.D301Y	SLC39A12_ENST00000539911.1_Missense_Mutation_p.D167Y|SLC39A12_ENST00000377371.3_Missense_Mutation_p.D301Y|SLC39A12_ENST00000377374.4_Missense_Mutation_p.D301Y	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	301					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						AGAGTCTGAGGATGGTCCAGT	0.368																																							uc001ipo.2		NA																	0				ovary(1)|breast(1)	2						c.(901-903)GAT>TAT		solute carrier family 39 (zinc transporter),							81.0	81.0	81.0					10																	18266980		2203	4299	6502	SO:0001583	missense	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18266980G>T		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.901G>T	10.37:g.18266980G>T	ENSP00000366586:p.Asp301Tyr					SLC39A12_uc001ipn.2_Missense_Mutation_p.D301Y|SLC39A12_uc001ipp.2_Missense_Mutation_p.D301Y|SLC39A12_uc010qck.1_Missense_Mutation_p.D167Y	p.D301Y	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN			5	1174	+			301			Cytoplasmic (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	c.901G>T	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	G	10.80	1.452431	0.26074	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.62941	0.12;-0.01;0.12;0.02	4.72	1.77	0.24775	.	2.232620	0.01155	N	0.006518	T	0.67970	0.2950	M	0.63428	1.95	0.09310	N	1	P;B;P	0.39520	0.676;0.35;0.676	P;B;P	0.47827	0.558;0.267;0.506	T	0.46925	-0.9156	10	0.66056	D	0.02	-0.3097	3.6141	0.08071	0.2787:0.0:0.5459:0.1754	.	301;301;301	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	Y	301;301;301;167;221	ENSP00000366586:D301Y;ENSP00000366591:D301Y;ENSP00000366588:D301Y;ENSP00000440445:D167Y	ENSP00000366586:D301Y	D	+	1	0	SLC39A12	18306986	0.008000	0.16893	0.000000	0.03702	0.005000	0.04900	1.656000	0.37355	0.287000	0.22375	0.650000	0.86243	GAT		0.368	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		18	54	1	0	1.99824e-07	0.00499	2.83741e-07	18	54				
PLXDC2	84898	broad.mit.edu	37	10	20465966	20465966	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:20465966G>T	ENST00000377252.4	+	8	1763	c.922G>T	c.(922-924)Gag>Tag	p.E308*	PLXDC2_ENST00000377242.3_Nonsense_Mutation_p.E259*|PLXDC2_ENST00000377238.2_3'UTR	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	308					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						CCACCGAGTAGAGCTACAAAT	0.343																																							uc001iqg.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(922-924)GAG>TAG		plexin domain containing 2 precursor							98.0	99.0	99.0					10																	20465966		2203	4300	6503	SO:0001587	stop_gained	84898					integral to membrane		g.chr10:20465966G>T	AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.922G>T	10.37:g.20465966G>T	ENSP00000366460:p.Glu308*					PLXDC2_uc001iqh.1_Nonsense_Mutation_p.E259*|PLXDC2_uc009xkc.1_RNA	p.E308*	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN			8	1559	+			308			Extracellular (Potential).		Q96E59|Q96PD9|Q96SU9	Nonsense_Mutation	SNP	ENST00000377252.4	37	c.922G>T	CCDS7132.1	.	.	.	.	.	.	.	.	.	.	G	46	12.347311	0.99659	.	.	ENSG00000120594	ENST00000377252;ENST00000377242;ENST00000377238;ENST00000536022	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	18.7065	0.91640	0.0:0.0:1.0:0.0	.	.	.	.	X	308;259;171;294	.	ENSP00000366446:E171X	E	+	1	0	PLXDC2	20505972	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.042000	0.93793	2.703000	0.92315	0.655000	0.94253	GAG		0.343	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812		9	107	1	0	0.000978159	0.000978	0.00113619	9	107				
MYO3A	53904	broad.mit.edu	37	10	26455006	26455006	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:26455006C>A	ENST00000265944.5	+	27	3176	c.3010C>A	c.(3010-3012)Ctc>Atc	p.L1004I	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1004	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GTACTACCTTCTCTGCTACAA	0.493																																							uc001isn.2		NA																	0				ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						c.(3010-3012)CTC>ATC		myosin IIIA							167.0	178.0	174.0					10																	26455006		2203	4300	6503	SO:0001583	missense	53904				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity	g.chr10:26455006C>A	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3010C>A	10.37:g.26455006C>A	ENSP00000265944:p.Leu1004Ile					MYO3A_uc009xko.1_Missense_Mutation_p.L1004I|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Intron	p.L1004I	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN			27	3370	+			1004			Myosin head-like.		Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	c.3010C>A	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184784	0.38609	.	.	ENSG00000095777	ENST00000265944	D	0.92149	-2.98	6.07	6.07	0.98685	Myosin head, motor domain (2);	0.126305	0.51477	D	0.000098	D	0.92708	0.7682	L	0.60845	1.875	0.80722	D	1	D	0.53462	0.96	P	0.54924	0.764	D	0.91783	0.5437	10	0.52906	T	0.07	.	9.6485	0.39883	0.1508:0.7776:0.0:0.0716	.	1004	Q8NEV4	MYO3A_HUMAN	I	1004	ENSP00000265944:L1004I	ENSP00000265944:L1004I	L	+	1	0	MYO3A	26495012	0.944000	0.32072	0.993000	0.49108	0.071000	0.16799	1.307000	0.33516	2.890000	0.99128	0.650000	0.86243	CTC		0.493	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433		11	233	1	0	0.000151284	0.001855	0.000182557	11	233				
GAD2	2572	broad.mit.edu	37	10	26581395	26581395	+	Splice_Site	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:26581395G>A	ENST00000376261.3	+	14	1891	c.1388G>A	c.(1387-1389)gGg>gAg	p.G463E	GAD2_ENST00000259271.3_Splice_Site_p.G463E	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	463					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CTTACCTAGGGGACTACCGGG	0.463																																							uc001isp.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1387-1389)GGG>GAG		glutamate decarboxylase 2	L-Glutamic Acid(DB00142)						104.0	96.0	99.0					10																	26581395		2203	4300	6503	SO:0001630	splice_region_variant	2572				glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding	g.chr10:26581395G>A	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.1387-1G>A	10.37:g.26581395G>A						GAD2_uc001isq.2_Missense_Mutation_p.G463E	p.G463E	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN			14	1891	+			463					Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	37	c.1388G>A	CCDS7149.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.492000	0.84962	.	.	ENSG00000136750	ENST00000376261;ENST00000259271	T;T	0.78481	-1.18;-1.18	5.59	5.59	0.84812	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.93432	0.7905	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95418	0.8504	10	0.87932	D	0	-18.8063	19.9651	0.97262	0.0:0.0:1.0:0.0	.	463	Q05329	DCE2_HUMAN	E	463	ENSP00000365437:G463E;ENSP00000259271:G463E	ENSP00000259271:G463E	G	+	2	0	GAD2	26621401	1.000000	0.71417	0.990000	0.47175	0.628000	0.37860	9.420000	0.97426	2.793000	0.96121	0.655000	0.94253	GGG		0.463	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	Missense_Mutation	7	74	0	0	0	0.004482	0	7	74				
ANKRD30A	91074	broad.mit.edu	37	10	37490239	37490239	+	Missense_Mutation	SNP	G	G	A	rs137903346	byFrequency	TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:37490239G>A	ENST00000602533.1	+	31	2786	c.2687G>A	c.(2686-2688)aGt>aAt	p.S896N	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.S1015N|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.S896N			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	952					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GATAAAATAAGTGGAAAATTA	0.328													.|||	14	0.00279553	0.0106	0.0	5008	,	,		16094	0.0		0.0	False		,,,				2504	0.0						uc001iza.1		NA																	0				ovary(7)|breast(1)|skin(1)	9						c.(2686-2688)AGT>AAT		ankyrin repeat domain 30A		G	ASN/SER	30,3582		0,30,1776	77.0	73.0	74.0		2687	-2.8	0.0	10	dbSNP_134	74	0,8126		0,0,4063	no	missense	ANKRD30A	NM_052997.2	46	0,30,5839	AA,AG,GG		0.0,0.8306,0.2556	benign	896/1342	37490239	30,11708	1806	4063	5869	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37490239G>A	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2687G>A	10.37:g.37490239G>A	ENSP00000473551:p.Ser896Asn						p.S896N	NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN			31	2786	+			952					Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.2687G>A		2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	g	0.083	-1.180528	0.01633	0.008306	0.0	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.04406	3.63;3.63	1.38	-2.76	0.05896	.	.	.	.	.	T	0.01287	0.0042	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.45041	-0.9288	9	0.02654	T	1	.	6.0585	0.19824	0.4613:0.0:0.5387:0.0	.	952	Q9BXX3	AN30A_HUMAN	N	896;1015	ENSP00000354432:S896N;ENSP00000363792:S1015N	ENSP00000354432:S896N	S	+	2	0	ANKRD30A	37530245	0.044000	0.20184	0.000000	0.03702	0.002000	0.02628	-0.221000	0.09202	-1.079000	0.03113	-0.516000	0.04426	AGT		0.328	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		10	37	0	0	0	0.000978	0	10	37				
DNAJC12	56521	broad.mit.edu	37	10	69571290	69571290	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:69571290C>A	ENST00000225171.2	-	3	441	c.289G>T	c.(289-291)Gtg>Ttg	p.V97L	RNU6-1250P_ENST00000391218.1_RNA|DNAJC12_ENST00000483798.2_Missense_Mutation_p.V127L|DNAJC12_ENST00000339758.7_Missense_Mutation_p.V97L	NM_021800.2	NP_068572.1	Q9UKB3	DJC12_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 12	97										breast(2)|kidney(2)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	12						ACCGTCTTCACTGAGTCATTC	0.507																																							uc001jnb.2		NA																	0				breast(1)	1						c.(289-291)GTG>TTG		J domain containing protein 1 isoform a							189.0	151.0	164.0					10																	69571290		2203	4300	6503	SO:0001583	missense	56521				protein folding		heat shock protein binding|unfolded protein binding	g.chr10:69571290C>A	AF176012	CCDS7271.1, CCDS7272.1	10q21.3	2011-09-02			ENSG00000108176	ENSG00000108176		"""Heat shock proteins / DNAJ (HSP40)"""	28908	protein-coding gene	gene with protein product	"""J domain protein 1"""	606060				10760603	Standard	NM_021800		Approved	JDP1	uc001jnb.3	Q9UKB3	OTTHUMG00000018339	ENST00000225171.2:c.289G>T	10.37:g.69571290C>A	ENSP00000225171:p.Val97Leu					DNAJC12_uc001jnc.2_Missense_Mutation_p.V97L	p.V97L	NM_021800	NP_068572	Q9UKB3	DJC12_HUMAN			3	457	-			97					Q5JVQ1|Q9UKB2	Missense_Mutation	SNP	ENST00000225171.2	37	c.289G>T	CCDS7271.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163837	0.38217	.	.	ENSG00000108176	ENST00000225171;ENST00000339758	T;T	0.29397	1.59;1.57	6.07	4.25	0.50352	.	0.059399	0.64402	D	0.000002	T	0.31734	0.0806	M	0.71581	2.175	0.58432	D	0.999993	B;B	0.06786	0.001;0.001	B;B	0.12837	0.008;0.005	T	0.07751	-1.0756	10	0.33940	T	0.23	-11.5362	9.6928	0.40139	0.0:0.7786:0.0:0.2214	.	97;97	Q9UKB3-2;Q9UKB3	.;DJC12_HUMAN	L	97	ENSP00000225171:V97L;ENSP00000343575:V97L	ENSP00000225171:V97L	V	-	1	0	DNAJC12	69241296	0.897000	0.30589	0.751000	0.31187	0.185000	0.23345	1.728000	0.38105	0.912000	0.36772	0.655000	0.94253	GTG		0.507	DNAJC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048291.1	NM_021800		45	101	1	0	1.23103e-26	0.003214	2.57123e-26	45	101				
MAT1A	4143	broad.mit.edu	37	10	82036222	82036222	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:82036222G>T	ENST00000372213.3	-	6	938	c.678C>A	c.(676-678)gtC>gtA	p.V226V	MAT1A_ENST00000485270.1_5'Flank	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	226					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CGGCCCTGATGACTTGCTCCT	0.607																																							uc001kbw.2		NA																	0					0						c.(676-678)GTC>GTA		methionine adenosyltransferase I, alpha	L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)						137.0	115.0	122.0					10																	82036222		2203	4300	6503	SO:0001819	synonymous_variant	4143				methylation|S-adenosylmethionine biosynthetic process|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity	g.chr10:82036222G>T		CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.678C>A	10.37:g.82036222G>T							p.V226V	NM_000429	NP_000420	Q00266	METK1_HUMAN	Colorectal(32;0.229)		6	933	-			226					D3DWD5|Q5QP09	Silent	SNP	ENST00000372213.3	37	c.678C>A	CCDS7365.1																																																																																				0.607	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049070.1	NM_000429		21	78	1	0	4.96729e-08	0.008871	7.26479e-08	21	78				
TLL2	7093	broad.mit.edu	37	10	98129868	98129868	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:98129868C>A	ENST00000357947.3	-	20	3092	c.2867G>T	c.(2866-2868)gGc>gTc	p.G956V		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	956	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GCTGTCGTAGCCGTCGTAGGC	0.637																																							uc001kml.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(2866-2868)GGC>GTC		tolloid-like 2 precursor							56.0	50.0	52.0					10																	98129868		2203	4300	6503	SO:0001583	missense	7093				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr10:98129868C>A	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.2867G>T	10.37:g.98129868C>A	ENSP00000350630:p.Gly956Val						p.G956V	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)	20	3093	-		Colorectal(252;0.0846)	956			CUB 5.		A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	c.2867G>T	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760074	0.89932	.	.	ENSG00000095587	ENST00000357947	T	0.27104	1.69	4.33	4.33	0.51752	CUB (5);	0.000000	0.46758	D	0.000280	T	0.64472	0.2601	H	0.95884	3.735	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77547	-0.2547	10	0.66056	D	0.02	.	16.3731	0.83371	0.0:1.0:0.0:0.0	.	956	Q9Y6L7	TLL2_HUMAN	V	956	ENSP00000350630:G956V	ENSP00000350630:G956V	G	-	2	0	TLL2	98119858	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.591000	0.82666	2.412000	0.81896	0.511000	0.50034	GGC		0.637	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1			9	40	1	0	2.17888e-05	0.006214	2.75588e-05	9	40				
ABCC2	1244	broad.mit.edu	37	10	101595910	101595910	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:101595910C>A	ENST00000370449.4	+	25	3590	c.3477C>A	c.(3475-3477)atC>atA	p.I1159I		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1159	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	GGTCCCCAATCTACTCTCACT	0.507																																							uc001kqf.2		NA																	0				ovary(1)	1						c.(3475-3477)ATC>ATA		ATP-binding cassette, sub-family C (CFTR/MRP),	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)						146.0	132.0	137.0					10																	101595910		2203	4300	6503	SO:0001819	synonymous_variant	1244					apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity	g.chr10:101595910C>A	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.3477C>A	10.37:g.101595910C>A							p.I1159I	NM_000392	NP_000383	Q92887	MRP2_HUMAN		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	25	3616	+		Colorectal(252;0.234)	1159			ABC transmembrane type-1 2.|Cytoplasmic (By similarity).		B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Silent	SNP	ENST00000370449.4	37	c.3477C>A	CCDS7484.1																																																																																				0.507	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392		8	78	1	0	0.000157383	0.00308	0.000188254	8	78				
SORCS3	22986	broad.mit.edu	37	10	106675691	106675691	+	Splice_Site	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:106675691G>A	ENST00000369701.3	+	3	1022		c.e3+1			NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3						learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CAAAAGGAAGGTAAGAGACTG	0.448																																					NSCLC(116;1497 1690 7108 13108 14106)	NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	0				ovary(6)|skin(3)|central_nervous_system(1)	10						c.e3+1		VPS10 domain receptor protein SORCS 3 precursor							115.0	98.0	104.0					10																	106675691		2203	4300	6503	SO:0001630	splice_region_variant	22986					integral to membrane	neuropeptide receptor activity	g.chr10:106675691G>A	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.795+1G>A	10.37:g.106675691G>A							p.K265_splice	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	3	1022	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)						Q5VXF9|Q9NQJ2	Splice_Site	SNP	ENST00000369701.3	37	c.795_splice	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828221	0.90955	.	.	ENSG00000156395	ENST00000369701	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0019	0.92837	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SORCS3	106665681	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.471000	0.97696	2.491000	0.84063	0.655000	0.94253	.		0.448	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	Intron	8	50	0	0	0	0.004482	0	8	50				
SORCS1	114815	broad.mit.edu	37	10	108412220	108412220	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:108412220C>T	ENST00000263054.6	-	18	2402	c.2395G>A	c.(2395-2397)Ggg>Agg	p.G799R	SORCS1_ENST00000344440.6_Missense_Mutation_p.G799R|SORCS1_ENST00000369698.1_Missense_Mutation_p.G334R	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	799					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		ATCCGCAGCCCCCGCGGGGCT	0.522																																							uc001kym.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(2395-2397)GGG>AGG		SORCS receptor 1 isoform a							101.0	97.0	99.0					10																	108412220		2203	4300	6503	SO:0001583	missense	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108412220C>T	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2395G>A	10.37:g.108412220C>T	ENSP00000263054:p.Gly799Arg					SORCS1_uc001kyl.2_Missense_Mutation_p.G799R|SORCS1_uc009xxs.2_Missense_Mutation_p.G799R|SORCS1_uc001kyn.1_Missense_Mutation_p.G799R|SORCS1_uc001kyo.2_Missense_Mutation_p.G799R	p.G799R	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	18	2403	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	799			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	c.2395G>A	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.250100	0.80024	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.68903	-0.36;-0.36;-0.36	5.74	5.74	0.90152	PKD/Chitinase domain (1);PKD domain (1);	0.000000	0.85682	D	0.000000	D	0.84584	0.5504	M	0.84846	2.72	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.85092	0.0952	9	.	.	.	-20.7613	19.9145	0.97053	0.0:1.0:0.0:0.0	.	799;799;799;799;799	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	R	334;799;799	ENSP00000358712:G334R;ENSP00000263054:G799R;ENSP00000345964:G799R	.	G	-	1	0	SORCS1	108402210	1.000000	0.71417	0.999000	0.59377	0.333000	0.28666	7.337000	0.79256	2.709000	0.92574	0.655000	0.94253	GGG		0.522	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		17	67	0	0	0	0.00499	0	17	67				
SHOC2	8036	broad.mit.edu	37	10	112745436	112745436	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:112745436C>T	ENST00000369452.4	+	3	1099	c.754C>T	c.(754-756)Cac>Tac	p.H252Y	SHOC2_ENST00000489390.1_Intron|SHOC2_ENST00000265277.5_Intron	NM_007373.3	NP_031399.2	Q9UQ13	SHOC2_HUMAN	soc-2 suppressor of clear homolog (C. elegans)	252					fibroblast growth factor receptor signaling pathway (GO:0008543)|positive regulation of Ras protein signal transduction (GO:0046579)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase binding (GO:0019903)|protein phosphatase regulator activity (GO:0019888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(2)	17				Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)		TCAACTTGAACACCTTCCAAA	0.378																																							uc001kzl.3		NA																	0				ovary(1)|skin(1)	2						c.(754-756)CAC>TAC		soc-2 suppressor of clear homolog							95.0	82.0	86.0					10																	112745436		2203	4300	6503	SO:0001583	missense	8036				fibroblast growth factor receptor signaling pathway|positive regulation of Ras protein signal transduction|Ras protein signal transduction	nucleus|protein phosphatase type 1 complex	protein phosphatase binding|protein phosphatase regulator activity	g.chr10:112745436C>T	AB020669	CCDS7568.1, CCDS58095.1	10q25	2014-09-17	2001-11-28		ENSG00000108061	ENSG00000108061			15454	protein-coding gene	gene with protein product		602775	"""soc-2 (suppressor of clear, C.elegans) homolog"""			9618511, 9674433, 10783161	Standard	NM_007373		Approved	KIAA0862, SOC2, SUR-8, SOC-2, SUR8	uc001kzl.4	Q9UQ13	OTTHUMG00000019047	ENST00000369452.4:c.754C>T	10.37:g.112745436C>T	ENSP00000358464:p.His252Tyr					SHOC2_uc009xxx.2_Missense_Mutation_p.H252Y|SHOC2_uc010qrg.1_5'UTR|SHOC2_uc001kzn.2_Intron	p.H252Y	NM_007373	NP_031399	Q9UQ13	SHOC2_HUMAN		Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)	3	1103	+			252			LRR 7.		A8K9W8|B3KR23|O76063|Q5VZS8|Q5VZS9	Missense_Mutation	SNP	ENST00000369452.4	37	c.754C>T	CCDS7568.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715208	0.89112	.	.	ENSG00000108061	ENST00000369452	T	0.58358	0.34	5.98	5.07	0.68467	.	0.041485	0.85682	D	0.000000	T	0.61060	0.2317	L	0.28694	0.88	0.80722	D	1	D	0.69078	0.997	D	0.65874	0.939	T	0.64622	-0.6364	10	0.56958	D	0.05	.	16.5608	0.84565	0.1317:0.8683:0.0:0.0	.	252	Q9UQ13	SHOC2_HUMAN	Y	252	ENSP00000358464:H252Y	ENSP00000358464:H252Y	H	+	1	0	SHOC2	112735426	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	1.512000	0.48834	0.591000	0.81541	CAC		0.378	SHOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050355.1	NM_007373		6	70	0	0	0	0.001984	0	6	70				
GFRA1	2674	broad.mit.edu	37	10	117884798	117884798	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:117884798T>C	ENST00000355422.6	-	6	1254	c.704A>G	c.(703-705)tAt>tGt	p.Y235C	GFRA1_ENST00000439649.3_Missense_Mutation_p.Y230C|GFRA1_ENST00000369236.1_Missense_Mutation_p.Y230C|GFRA1_ENST00000544592.1_Missense_Mutation_p.Y114C	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	235					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		CCTCTCTTCATAGGAGCACAC	0.557																																					Ovarian(128;329 1725 45498 46808 50759)	Ovarian(128;329 1725 45498 46808 50759)	uc001lcj.2		NA																	0				ovary(1)|pancreas(1)	2						c.(703-705)TAT>TGT		GDNF family receptor alpha 1 isoform a							72.0	63.0	66.0					10																	117884798		2203	4300	6503	SO:0001583	missense	2674				axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity	g.chr10:117884798T>C	AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.704A>G	10.37:g.117884798T>C	ENSP00000347591:p.Tyr235Cys					GFRA1_uc001lci.2_Missense_Mutation_p.Y230C|GFRA1_uc009xyr.2_Missense_Mutation_p.Y230C	p.Y235C	NM_005264	NP_005255	P56159	GFRA1_HUMAN		all cancers(201;0.0337)	6	1402	-		Lung NSC(174;0.21)	235			2.		A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	c.704A>G	CCDS44481.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.545045	0.86022	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.50813	1.33;0.73	5.75	5.75	0.90469	.	0.122495	0.56097	D	0.000022	T	0.69735	0.3144	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.972;0.983	T	0.73836	-0.3857	10	0.72032	D	0.01	-8.0233	16.0664	0.80878	0.0:0.0:0.0:1.0	.	235;230	P56159;P56159-2	GFRA1_HUMAN;.	C	235;230;230;114;230	ENSP00000358239:Y230C;ENSP00000442179:Y114C	ENSP00000347591:Y230C	Y	-	2	0	GFRA1	117874788	1.000000	0.71417	0.981000	0.43875	0.994000	0.84299	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	TAT		0.557	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793		7	48	0	0	0	0.006214	0	7	48				
GPR26	2849	broad.mit.edu	37	10	125426472	125426472	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:125426472C>A	ENST00000284674.1	+	1	602	c.549C>A	c.(547-549)ctC>ctA	p.L183L		NM_153442.3	NP_703143.1	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	183					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	20		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				GCTTCCTGCTCTCCTTCGTCG	0.642																																							uc001lhh.2		NA																	0				skin(1)	1						c.(547-549)CTC>CTA		G protein-coupled receptor 26							36.0	27.0	30.0					10																	125426472		2203	4299	6502	SO:0001819	synonymous_variant	2849				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:125426472C>A		CCDS7636.1	10q26.2-q26.3	2012-08-21			ENSG00000154478	ENSG00000154478		"""GPCR / Class A : Orphans"""	4481	protein-coding gene	gene with protein product		604847					Standard	NM_153442		Approved		uc001lhh.3	Q8NDV2	OTTHUMG00000019204	ENST00000284674.1:c.549C>A	10.37:g.125426472C>A							p.L183L	NM_153442	NP_703143	Q8NDV2	GPR26_HUMAN			1	602	+		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)	183			Helical; Name=5; (Potential).		Q2M2E2	Silent	SNP	ENST00000284674.1	37	c.549C>A	CCDS7636.1																																																																																				0.642	GPR26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050850.1			3	20	1	0	0.00024832	0.009096	0.000291915	3	20				
ECHS1	1892	broad.mit.edu	37	10	135184202	135184202	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr10:135184202T>A	ENST00000368547.3	-	2	503	c.148A>T	c.(148-150)Atc>Ttc	p.I50F	MIR3944_ENST00000581277.1_RNA	NM_004092.3	NP_004083.3	P30084	ECHM_HUMAN	enoyl CoA hydratase, short chain, 1, mitochondrial	50					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enoyl-CoA hydratase activity (GO:0004300)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)	10		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;1.62e-06)|OV - Ovarian serous cystadenocarcinoma(35;5.75e-06)|Epithelial(32;7.58e-06)		TTCAGTTGGATCAACCCCACG	0.532																																					GBM(132;1720 1771 5373 10277 21402)	GBM(132;1720 1771 5373 10277 21402)	uc001lmu.2		NA																	0					0						c.(148-150)ATC>TTC		mitochondrial short-chain enoyl-coenzyme A							141.0	116.0	124.0					10																	135184202		2201	4298	6499	SO:0001583	missense	1892				fatty acid beta-oxidation	mitochondrial matrix	enoyl-CoA hydratase activity|protein binding	g.chr10:135184202T>A		CCDS7681.1	10q26.2-q26.3	2010-05-04	2010-04-30		ENSG00000127884	ENSG00000127884	4.2.1.17		3151	protein-coding gene	gene with protein product		602292	"""enoyl Coenzyme A hydratase, short chain, 1, mitochondrial"""			8012501	Standard	NM_004092		Approved	SCEH	uc001lmu.3	P30084	OTTHUMG00000019320	ENST00000368547.3:c.148A>T	10.37:g.135184202T>A	ENSP00000357535:p.Ile50Phe						p.I50F	NM_004092	NP_004083	P30084	ECHM_HUMAN		all cancers(32;1.62e-06)|OV - Ovarian serous cystadenocarcinoma(35;5.75e-06)|Epithelial(32;7.58e-06)	2	219	-		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)	50					O00739|Q5VWY1|Q96H54	Missense_Mutation	SNP	ENST00000368547.3	37	c.148A>T	CCDS7681.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.489693	0.84962	.	.	ENSG00000127884	ENST00000368547	T	0.56444	0.46	5.76	4.61	0.57282	Crotonase, core (1);	0.000000	0.85682	D	0.000000	T	0.74574	0.3734	M	0.90759	3.145	0.80722	D	1	D	0.67145	0.996	D	0.70016	0.967	T	0.78109	-0.2332	10	0.87932	D	0	.	10.2899	0.43590	0.0:0.0783:0.0:0.9217	.	50	P30084	ECHM_HUMAN	F	50	ENSP00000357535:I50F	ENSP00000357535:I50F	I	-	1	0	ECHS1	135034192	1.000000	0.71417	0.876000	0.34364	0.859000	0.49053	3.587000	0.53957	0.995000	0.38917	0.529000	0.55759	ATC		0.532	ECHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051156.1			10	28	0	0	0	0.008291	0	10	28				
OR52K2	119774	broad.mit.edu	37	11	4471034	4471034	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:4471034G>T	ENST00000325719.4	+	1	510	c.465G>T	c.(463-465)gtG>gtT	p.V155V		NM_001005172.2	NP_001005172.2	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K, member 2	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|skin(6)	25		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCCGGGCTGTGACACTAATGA	0.567																																							uc001lyz.1		NA																	0				skin(2)	2						c.(463-465)GTG>GTT		olfactory receptor, family 52, subfamily K,							114.0	101.0	105.0					11																	4471034		2201	4295	6496	SO:0001819	synonymous_variant	119774				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4471034G>T	AB065791	CCDS31351.1	11p15.4	2012-08-09			ENSG00000181963	ENSG00000181963		"""GPCR / Class A : Olfactory receptors"""	15223	protein-coding gene	gene with protein product							Standard	NM_001005172		Approved		uc001lyz.2	Q8NGK3	OTTHUMG00000165703	ENST00000325719.4:c.465G>T	11.37:g.4471034G>T							p.V155V	NM_001005172	NP_001005172	Q8NGK3	O52K2_HUMAN		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	465	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	155			Helical; Name=4; (Potential).		A8MUY8|B2RP35|Q6IFK4	Silent	SNP	ENST00000325719.4	37	c.465G>T	CCDS31351.1																																																																																				0.567	OR52K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385844.1	NM_001005172		39	63	1	0	1.66425e-11	0.004878	2.74561e-11	39	63				
OR51E2	81285	broad.mit.edu	37	11	4703209	4703209	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:4703209C>T	ENST00000396950.3	-	2	972	c.733G>A	c.(733-735)Ggt>Agt	p.G245S		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	245					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		AGTACCACACCAATGTGTGAC	0.498																																							uc001lzk.2		NA																	0				lung(3)|ovary(2)	5						c.(733-735)GGT>AGT		olfactory receptor, family 51, subfamily E,							139.0	110.0	120.0					11																	4703209		2201	4298	6499	SO:0001583	missense	81285				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4703209C>T	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.733G>A	11.37:g.4703209C>T	ENSP00000380153:p.Gly245Ser						p.G245S	NM_030774	NP_110401	Q9H255	O51E2_HUMAN		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)	2	977	-		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	245			Helical; Name=6; (Potential).		B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	37	c.733G>A	CCDS7751.1	.	.	.	.	.	.	.	.	.	.	C	8.677	0.904108	0.17760	.	.	ENSG00000167332	ENST00000396950	T	0.36878	1.23	4.97	-7.58	0.01313	GPCR, rhodopsin-like superfamily (1);	0.443885	0.19170	N	0.120957	T	0.14830	0.0358	L	0.28014	0.82	0.09310	N	1	B	0.02656	0.0	B	0.11329	0.006	T	0.05835	-1.0861	10	0.41790	T	0.15	.	1.0323	0.01540	0.1791:0.2882:0.1591:0.3737	.	245	Q9H255	O51E2_HUMAN	S	245	ENSP00000380153:G245S	ENSP00000380153:G245S	G	-	1	0	OR51E2	4659785	0.000000	0.05858	0.009000	0.14445	0.341000	0.28922	-1.738000	0.01842	-1.248000	0.02503	-0.136000	0.14681	GGT		0.498	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774		21	49	0	0	0	0.002299	0	21	49				
HBD	3045	broad.mit.edu	37	11	5255616	5255616	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:5255616C>A	ENST00000380299.3	-	1	262	c.48G>T	c.(46-48)tgG>tgT	p.W16C	HBD_ENST00000292901.3_Missense_Mutation_p.W16C	NM_000519.3	NP_000510.1	P02042	HBD_HUMAN	hemoglobin, delta	16					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	16		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCACTTTGCCCCACAGGGCAT	0.502																																							uc001maf.1		NA																	0				ovary(1)	1						c.(46-48)TGG>TGT		delta globin							180.0	150.0	160.0					11																	5255616		2201	4298	6499	SO:0001583	missense	3045				blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity	g.chr11:5255616C>A	AY034468	CCDS31376.1	11p15.5	2012-10-02			ENSG00000223609	ENSG00000223609			4829	protein-coding gene	gene with protein product		142000				2649166	Standard	NM_000519		Approved		uc001maf.1	P02042	OTTHUMG00000066674	ENST00000380299.3:c.48G>T	11.37:g.5255616C>A	ENSP00000369654:p.Trp16Cys						p.W16C	NM_000519	NP_000510	P02042	HBD_HUMAN		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	243	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	16					Q3Y5H3|Q8WXT7	Missense_Mutation	SNP	ENST00000380299.3	37	c.48G>T	CCDS31376.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901202	0.52227	.	.	ENSG00000223609	ENST00000292901;ENST00000380299;ENST00000417377;ENST00000429817	D;D;D;D	0.95918	-3.85;-3.85;-2.45;-3.85	4.61	3.67	0.42095	Globin-like (1);Globin, structural domain (1);	0.167297	0.56097	D	0.000027	D	0.98317	0.9442	H	0.97465	4.01	0.80722	D	1	D	0.67145	0.996	D	0.65443	0.935	D	0.98982	1.0805	10	0.87932	D	0	-0.1944	12.9775	0.58546	0.163:0.837:0.0:0.0	.	16	P02042	HBD_HUMAN	C	16	ENSP00000292901:W16C;ENSP00000369654:W16C;ENSP00000414741:W16C;ENSP00000393810:W16C	ENSP00000292901:W16C	W	-	3	0	HBD	5212192	0.936000	0.31750	0.330000	0.25442	0.041000	0.13682	2.872000	0.48467	1.238000	0.43771	0.591000	0.81541	TGG		0.502	HBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142970.1	NM_000519		28	38	1	0	2.47511e-08	0.008361	3.66702e-08	28	38				
NLRP14	338323	broad.mit.edu	37	11	7070936	7070936	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:7070936G>A	ENST00000299481.4	+	6	2504	c.2158G>A	c.(2158-2160)Gat>Aat	p.D720N		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	720					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TGGTTGTCAGGATATCTCTAC	0.378																																							uc001mfb.1		NA																	0				ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(2158-2160)GAT>AAT		NLR family, pyrin domain containing 14							170.0	165.0	167.0					11																	7070936		2201	4296	6497	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7070936G>A	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2158G>A	11.37:g.7070936G>A	ENSP00000299481:p.Asp720Asn						p.D720N	NM_176822	NP_789792	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	6	2481	+			720					Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.2158G>A	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	G	7.002	0.555060	0.13436	.	.	ENSG00000158077	ENST00000299481	T	0.41065	1.01	5.2	2.0	0.26442	.	0.734425	0.12179	N	0.492290	T	0.26629	0.0651	L	0.33293	1	0.09310	N	1	B	0.20887	0.049	B	0.17433	0.018	T	0.21449	-1.0245	10	0.20046	T	0.44	.	4.7339	0.12979	0.2112:0.0:0.6185:0.1703	.	720	Q86W24	NAL14_HUMAN	N	720	ENSP00000299481:D720N	ENSP00000299481:D720N	D	+	1	0	NLRP14	7027512	0.002000	0.14202	0.001000	0.08648	0.143000	0.21401	1.118000	0.31246	0.585000	0.29608	0.573000	0.79308	GAT		0.378	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		38	85	0	0	0	0.004878	0	38	85				
QSER1	79832	broad.mit.edu	37	11	32953390	32953390	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:32953390T>A	ENST00000399302.2	+	4	534	c.199T>A	c.(199-201)Ttc>Atc	p.F67I	QSER1_ENST00000527250.1_3'UTR|QSER1_ENST00000527788.1_Missense_Mutation_p.F67I	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	67										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					TCCCACCACCTTCAGCAATAG	0.443																																							uc001mty.2		NA																	0				ovary(3)|central_nervous_system(2)|skin(1)	6						c.(199-201)TTC>ATC		glutamine and serine rich 1							169.0	166.0	167.0					11																	32953390		1999	4172	6171	SO:0001583	missense	79832							g.chr11:32953390T>A	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.199T>A	11.37:g.32953390T>A	ENSP00000382241:p.Phe67Ile					QSER1_uc001mtz.1_Missense_Mutation_p.F67I|QSER1_uc001mua.2_5'Flank	p.F67I	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN			4	466	+	Breast(20;0.158)		67					Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	37	c.199T>A	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	T	19.55	3.848039	0.71603	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.40225	1.3;1.04	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000003	T	0.60157	0.2247	M	0.70275	2.135	0.24037	N	0.996094	D;D	0.89917	1.0;1.0	D;P	0.66351	0.943;0.879	T	0.56208	-0.8017	10	0.20046	T	0.44	.	15.5188	0.75846	0.0:0.0:0.0:1.0	.	67;67	Q2KHR3-2;Q2KHR3	.;QSER1_HUMAN	I	67	ENSP00000382241:F67I;ENSP00000432766:F67I	ENSP00000078652:F67I	F	+	1	0	QSER1	32909966	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	7.698000	0.84413	2.078000	0.62432	0.533000	0.62120	TTC		0.443	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774		42	62	0	0	0	0.002852	0	42	62				
CD44	960	broad.mit.edu	37	11	35223312	35223312	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:35223312G>A	ENST00000428726.2	+	9	1254	c.1131G>A	c.(1129-1131)gaG>gaA	p.E377E	CD44_ENST00000278386.6_Intron|CD44_ENST00000437706.2_Silent_p.E377E|CD44_ENST00000433892.2_Intron|CD44_ENST00000415148.2_Silent_p.E334E|CD44_ENST00000433354.2_Silent_p.E378E|CD44_ENST00000449691.2_Silent_p.E377E|CD44_ENST00000526669.2_Intron|CD44_ENST00000263398.6_Intron|CD44_ENST00000352818.4_Intron|CD44_ENST00000360158.4_Intron|CD44_ENST00000434472.2_Intron	NM_000610.3	NP_000601.3	P16070	CD44_HUMAN	CD44 molecule (Indian blood group)	377	Stem.				blood coagulation (GO:0007596)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|monocyte aggregation (GO:0070487)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|Wnt signaling pathway (GO:0016055)|wound healing involved in inflammatory response (GO:0002246)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|skin(1)	23	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronan(DB08818)	AGGAAGAAGAGACCCCACATT	0.458																																							uc001mvu.2		NA																	0				pancreas(1)	1						c.(1129-1131)GAG>GAA		CD44 antigen isoform 1 precursor	Hyaluronidase(DB00070)						150.0	127.0	135.0					11																	35223312		2202	4298	6500	SO:0001819	synonymous_variant	960				cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity	g.chr11:35223312G>A	M59040	CCDS7897.1, CCDS31455.1, CCDS31456.1, CCDS31457.1, CCDS31458.1, CCDS55754.1, CCDS55755.1	11p13	2014-07-18	2006-03-28		ENSG00000026508	ENSG00000026508		"""CD molecules"", ""Blood group antigens"", ""Proteoglycans / Cell surface : Other"""	1681	protein-coding gene	gene with protein product	"""hematopoietic cell E- and L-selectin ligand"", ""chondroitin sulfate proteoglycan 8"""	107269	"""CD44 antigen (homing function and Indian blood group system)"""	MIC4, MDU2, MDU3		2454887	Standard	NM_001202555		Approved	IN, MC56, Pgp1, CD44R, HCELL, CSPG8	uc001mvu.3	P16070	OTTHUMG00000044388	ENST00000428726.2:c.1131G>A	11.37:g.35223312G>A						CD44_uc001mvv.2_Silent_p.E334E|CD44_uc001mvw.2_Intron|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Intron|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron|CD44_uc010res.1_Intron|CD44_uc010ret.1_Intron|CD44_uc010reu.1_Intron	p.E377E	NM_000610	NP_000601	P16070	CD44_HUMAN	STAD - Stomach adenocarcinoma(6;0.00731)		9	1565	+	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	377			Extracellular (Potential).|Stem.		A5YRN9|B6EAT9|D3DR12|D3DR13|O95370|P22511|Q04858|Q13419|Q13957|Q13958|Q13959|Q13960|Q13961|Q13967|Q13968|Q13980|Q15861|Q16064|Q16065|Q16066|Q16208|Q16522|Q86T72|Q86Z27|Q8N694|Q92493|Q96J24|Q9H5A5|Q9UC28|Q9UC29|Q9UC30|Q9UCB0|Q9UJ36	Silent	SNP	ENST00000428726.2	37	c.1131G>A	CCDS7897.1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.323972	0.01309	.	.	ENSG00000026508	ENST00000528455	.	.	.	5.4	-2.67	0.06059	.	.	.	.	.	T	0.19005	0.0456	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27297	-1.0078	4	.	.	.	-9.9774	2.3599	0.04305	0.1457:0.1108:0.3781:0.3654	.	.	.	.	N	229	.	.	D	+	1	0	CD44	35179888	0.200000	0.23398	0.417000	0.26559	0.010000	0.07245	0.180000	0.16860	-0.259000	0.09432	0.561000	0.74099	GAC		0.458	CD44-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388927.1	NM_000610		21	38	0	0	0	0.008871	0	21	38				
TTC17	55761	broad.mit.edu	37	11	43465675	43465675	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:43465675G>C	ENST00000039989.4	+	18	2595	c.2581G>C	c.(2581-2583)Gaa>Caa	p.E861Q	TTC17_ENST00000299240.6_Missense_Mutation_p.E918Q|TTC17_ENST00000526774.1_3'UTR	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	861					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						GAAAAAAGTAGAAACAGGTCA	0.418																																							uc001mxi.2		NA																	0				ovary(5)	5						c.(2581-2583)GAA>CAA		tetratricopeptide repeat domain 17							80.0	79.0	79.0					11																	43465675		2203	4300	6503	SO:0001583	missense	55761						binding	g.chr11:43465675G>C	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.2581G>C	11.37:g.43465675G>C	ENSP00000039989:p.Glu861Gln					TTC17_uc001mxh.2_Missense_Mutation_p.E918Q|TTC17_uc010rfj.1_Missense_Mutation_p.E861Q|TTC17_uc001mxj.2_Missense_Mutation_p.E688Q	p.E861Q	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN			18	2595	+			861					G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	c.2581G>C	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333783	0.41297	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.35421	1.31;1.33	5.9	5.9	0.94986	.	0.134765	0.64402	N	0.000003	T	0.45875	0.1364	L	0.29908	0.895	0.34341	D	0.6888	D;B;D	0.67145	0.992;0.156;0.996	P;B;D	0.64042	0.835;0.016;0.921	T	0.41627	-0.9498	10	0.17832	T	0.49	-21.6962	18.4592	0.90732	0.0:0.0:1.0:0.0	.	918;861;918	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	Q	918;861	ENSP00000299240:E918Q;ENSP00000039989:E861Q	ENSP00000039989:E861Q	E	+	1	0	TTC17	43422251	1.000000	0.71417	0.328000	0.25416	0.722000	0.41435	7.711000	0.84669	2.798000	0.96311	0.650000	0.86243	GAA		0.418	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259		15	29	0	0	0	0.003163	0	15	29				
ZNF408	79797	broad.mit.edu	37	11	46727337	46727337	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:46727337C>A	ENST00000311764.2	+	5	2317	c.2087C>A	c.(2086-2088)cCc>cAc	p.P696H		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	696					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GATGCCGCCCCCAGCCTGGTG	0.592																																					Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	uc001nde.1		NA																	0					0						c.(2086-2088)CCC>CAC		zinc finger protein 408							34.0	31.0	32.0					11																	46727337		2201	4299	6500	SO:0001583	missense	79797				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding	g.chr11:46727337C>A	AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.2087C>A	11.37:g.46727337C>A	ENSP00000309606:p.Pro696His					ZNF408_uc010rgw.1_Missense_Mutation_p.P688H	p.P696H	NM_024741	NP_079017	Q9H9D4	ZN408_HUMAN			5	2317	+			696						Missense_Mutation	SNP	ENST00000311764.2	37	c.2087C>A	CCDS7923.1	.	.	.	.	.	.	.	.	.	.	C	4.651	0.120975	0.08881	.	.	ENSG00000175213	ENST00000311764	T	0.11277	2.79	5.21	2.86	0.33363	.	1.029470	0.07771	N	0.951729	T	0.06416	0.0165	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.34875	-0.9811	10	0.42905	T	0.14	-0.4453	3.3829	0.07261	0.2733:0.4807:0.1578:0.0883	.	688;696	B4DXY4;Q9H9D4	.;ZN408_HUMAN	H	696	ENSP00000309606:P696H	ENSP00000309606:P696H	P	+	2	0	ZNF408	46683913	0.000000	0.05858	0.711000	0.30485	0.294000	0.27393	0.198000	0.17217	1.151000	0.42436	0.557000	0.71058	CCC		0.592	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741		6	9	1	0	8.12818e-05	0.001984	9.89581e-05	6	9				
OR4A15	81328	broad.mit.edu	37	11	55135827	55135827	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:55135827G>T	ENST00000314706.3	+	1	468	c.468G>T	c.(466-468)aaG>aaT	p.K156N		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						CCATCTGTAAGCCTCTTCATG	0.433																																							uc010rif.1		NA																	0				ovary(1)|skin(1)	2						c.(466-468)AAG>AAT		olfactory receptor, family 4, subfamily A,							215.0	198.0	204.0					11																	55135827		2201	4296	6497	SO:0001583	missense	81328				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55135827G>T	AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.468G>T	11.37:g.55135827G>T	ENSP00000325065:p.Lys156Asn						p.K156N	NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN			1	468	+			156			Cytoplasmic (Potential).		Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	37	c.468G>T	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	g	11.34	1.610200	0.28712	.	.	ENSG00000181958	ENST00000314706	T	0.00392	7.58	3.48	-2.05	0.07321	GPCR, rhodopsin-like superfamily (1);	0.118236	0.37393	N	0.002103	T	0.00440	0.0014	L	0.39566	1.225	0.27539	N	0.95084	D	0.67145	0.996	D	0.69307	0.963	T	0.49826	-0.8898	10	0.72032	D	0.01	.	8.4274	0.32737	0.5018:0.0:0.4982:0.0	.	156	Q8NGL6	O4A15_HUMAN	N	156	ENSP00000325065:K156N	ENSP00000325065:K156N	K	+	3	2	OR4A15	54892403	0.000000	0.05858	0.271000	0.24616	0.288000	0.27193	-4.476000	0.00228	-0.284000	0.09102	-0.467000	0.05162	AAG		0.433	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275		73	134	1	0	2.23852e-25	0.00361	4.60516e-25	73	134				
GLYAT	10249	broad.mit.edu	37	11	58482866	58482866	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:58482866C>A	ENST00000344743.3	-	3	253	c.112G>T	c.(112-114)Gga>Tga	p.G38*	GLYAT_ENST00000278400.3_Nonsense_Mutation_p.G38*|GLYAT_ENST00000529732.1_Nonsense_Mutation_p.G38*	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	38					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	AATGGATTTCCATGGTTTATG	0.398																																							uc001nnb.2		NA																	0					0						c.(112-114)GGA>TGA		glycine-N-acyltransferase isoform a	Glycine(DB00145)						101.0	87.0	92.0					11																	58482866		2201	4295	6496	SO:0001587	stop_gained	10249				acyl-CoA metabolic process|response to toxin|xenobiotic metabolic process	mitochondrial matrix	glycine N-acyltransferase activity|glycine N-benzoyltransferase activity	g.chr11:58482866C>A	AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.112G>T	11.37:g.58482866C>A	ENSP00000340200:p.Gly38*					GLYAT_uc001nnc.2_Nonsense_Mutation_p.G38*	p.G38*	NM_201648	NP_964011	Q6IB77	GLYAT_HUMAN			3	267	-		Breast(21;0.0044)|all_epithelial(135;0.0157)	38					O14833|Q96QK7	Nonsense_Mutation	SNP	ENST00000344743.3	37	c.112G>T	CCDS7970.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.583735	0.46006	.	.	ENSG00000149124	ENST00000344743;ENST00000529732;ENST00000278400	.	.	.	5.55	3.65	0.41850	.	0.157274	0.42053	D	0.000772	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.513	8.4595	0.32919	0.0:0.822:0.0:0.178	.	.	.	.	X	38	.	ENSP00000278400:G38X	G	-	1	0	GLYAT	58239442	0.947000	0.32204	0.920000	0.36463	0.010000	0.07245	2.002000	0.40835	1.586000	0.49944	0.585000	0.79938	GGA		0.398	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394593.1			16	48	1	0	3.45872e-05	0.004007	4.3345e-05	16	48				
OR10V1	390201	broad.mit.edu	37	11	59481200	59481200	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:59481200C>A	ENST00000307552.2	-	1	137	c.119G>T	c.(118-120)gGt>gTt	p.G40V	STX3_ENST00000300150.7_5'UTR	NM_001005324.1	NP_001005324.1	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V, member 1	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|liver(1)|lung(10)|skin(1)	16						AGCATTTCCACCGAGGCTGGT	0.443																																							uc001nof.1		NA																	0					0						c.(118-120)GGT>GTT		olfactory receptor, family 10, subfamily V,							72.0	69.0	70.0					11																	59481200		2201	4295	6496	SO:0001583	missense	390201				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59481200C>A	AB065807	CCDS31565.1	11q12.1	2012-08-09			ENSG00000172289	ENSG00000172289		"""GPCR / Class A : Olfactory receptors"""	15136	protein-coding gene	gene with protein product							Standard	NM_001005324		Approved		uc001nof.1	Q8NGI7	OTTHUMG00000167406	ENST00000307552.2:c.119G>T	11.37:g.59481200C>A	ENSP00000302199:p.Gly40Val						p.G40V	NM_001005324	NP_001005324	Q8NGI7	O10V1_HUMAN			1	119	-			40			Helical; Name=1; (Potential).		Q6IFD9|Q96R50	Missense_Mutation	SNP	ENST00000307552.2	37	c.119G>T	CCDS31565.1	.	.	.	.	.	.	.	.	.	.	C	6.869	0.529787	0.13127	.	.	ENSG00000172289	ENST00000307552	T	0.00428	7.44	4.35	3.42	0.39159	.	0.688314	0.13740	N	0.366059	T	0.00178	0.0005	N	0.04162	-0.26	0.29369	N	0.86411	B	0.09022	0.002	B	0.06405	0.002	T	0.02184	-1.1199	10	0.14656	T	0.56	.	7.6484	0.28334	0.1883:0.6296:0.1821:0.0	.	40	Q8NGI7	O10V1_HUMAN	V	40	ENSP00000302199:G40V	ENSP00000302199:G40V	G	-	2	0	OR10V1	59237776	0.000000	0.05858	0.129000	0.21949	0.887000	0.51463	0.240000	0.18042	1.196000	0.43129	0.543000	0.68304	GGT		0.443	OR10V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394517.1	NM_001005324		16	24	1	0	9.16793e-09	0.00499	1.38533e-08	16	24				
INCENP	3619	broad.mit.edu	37	11	61897761	61897761	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:61897761G>T	ENST00000394818.3	+	4	964	c.762G>T	c.(760-762)gcG>gcT	p.A254A	INCENP_ENST00000278849.4_Silent_p.A254A	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	254					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GGCGGTCTGCGTCTAAGCTCA	0.647																																							uc001nsw.1		NA																	0				lung(1)	1						c.(760-762)GCG>GCT		inner centromere protein antigens 135/155kDa							63.0	62.0	62.0					11																	61897761		2202	4299	6501	SO:0001819	synonymous_variant	3619				chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding	g.chr11:61897761G>T	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.762G>T	11.37:g.61897761G>T						INCENP_uc009ynv.2_Silent_p.A254A|INCENP_uc009ynw.1_Silent_p.A254A|INCENP_uc001nsx.1_Silent_p.A254A	p.A254A	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN			4	964	+			254					A8MQD2|Q5Y192	Silent	SNP	ENST00000394818.3	37	c.762G>T	CCDS44624.1																																																																																				0.647	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238		26	39	1	0	3.6726e-16	0.003954	6.94844e-16	26	39				
AHNAK	79026	broad.mit.edu	37	11	62299271	62299271	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:62299271C>A	ENST00000378024.4	-	5	2892	c.2618G>T	c.(2617-2619)tGg>tTg	p.W873L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	873					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTTCAGGTGCCAGTCTGGGCC	0.483																																							uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(2617-2619)TGG>TTG		AHNAK nucleoprotein isoform 1							222.0	232.0	229.0					11																	62299271		2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62299271C>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.2618G>T	11.37:g.62299271C>A	ENSP00000367263:p.Trp873Leu					AHNAK_uc001ntk.1_Intron	p.W873L	NM_001620	NP_001611	Q09666	AHNK_HUMAN			5	2918	-		Melanoma(852;0.155)	873					A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.2618G>T	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	c	0.940	-0.709860	0.03230	.	.	ENSG00000124942	ENST00000378024	T	0.00864	5.6	5.46	4.52	0.55395	.	0.400118	0.18626	N	0.135707	T	0.02342	0.0072	L	0.49256	1.55	0.23645	N	0.997216	D	0.63880	0.993	P	0.59115	0.852	T	0.45381	-0.9265	10	0.10636	T	0.68	-2.1944	11.014	0.47679	0.3508:0.6492:0.0:0.0	.	873	Q09666	AHNK_HUMAN	L	873	ENSP00000367263:W873L	ENSP00000367263:W873L	W	-	2	0	AHNAK	62055847	0.006000	0.16342	1.000000	0.80357	0.972000	0.66771	1.181000	0.32017	1.256000	0.44068	0.455000	0.32223	TGG		0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		122	262	1	0	7.54917e-67	0.00361	1.64206e-66	122	262				
MAP4K2	5871	broad.mit.edu	37	11	64564575	64564575	+	Splice_Site	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:64564575C>T	ENST00000294066.2	-	19	1457		c.e19+1		MAP4K2_ENST00000377350.3_Splice_Site	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2						activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						CACCCTCTTACCTCAGGATCC	0.652																																							uc001obh.2		NA																	0				ovary(1)|pancreas(1)	2						c.e19+1		mitogen-activated protein kinase kinase kinase							61.0	57.0	58.0					11																	64564575		2201	4297	6498	SO:0001630	splice_region_variant	5871				activation of JUN kinase activity|immune response|positive regulation of JNK cascade|vesicle targeting	basolateral plasma membrane|Golgi membrane|soluble fraction	ATP binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr11:64564575C>T	BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.1365+1G>A	11.37:g.64564575C>T						MAP4K2_uc001obg.2_5'Flank|MAP4K2_uc001obi.2_Splice_Site_p.E447_splice	p.E455_splice	NM_004579	NP_004570	Q12851	M4K2_HUMAN			19	1457	-								Q86VU3	Splice_Site	SNP	ENST00000294066.2	37	c.1365_splice	CCDS8082.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.121028	0.56613	.	.	ENSG00000168067	ENST00000294066;ENST00000377350	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8401	0.57797	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAP4K2	64321151	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	3.732000	0.55021	2.177000	0.69029	0.456000	0.33151	.		0.652	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105239.1	NM_004579	Intron	13	31	0	0	0	0.001855	0	13	31				
CST6	1474	broad.mit.edu	37	11	65780862	65780862	+	Silent	SNP	G	G	T	rs202231090		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:65780862G>T	ENST00000312134.2	+	3	645	c.441G>T	c.(439-441)gtG>gtT	p.V147V		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	147					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			large_intestine(1)|lung(1)|ovary(1)	3						ACAACTGTGTGCAGATGTGAT	0.562																																							uc001ogr.2		NA																	0				ovary(1)	1						c.(439-441)GTG>GTT		cystatin M precursor							153.0	124.0	134.0					11																	65780862		2201	4296	6497	SO:0001819	synonymous_variant	1474				anatomical structure morphogenesis	extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr11:65780862G>T	U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.441G>T	11.37:g.65780862G>T						CST6_uc001ogs.1_3'UTR	p.V147V	NM_001323	NP_001314	Q15828	CYTM_HUMAN			3	495	+			147					Q540N7	Silent	SNP	ENST00000312134.2	37	c.441G>T	CCDS8126.1																																																																																				0.562	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323		29	61	1	0	1.75199e-13	0.007291	3.03707e-13	29	61				
INTS4	92105	broad.mit.edu	37	11	77639510	77639510	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:77639510C>G	ENST00000534064.1	-	11	1283	c.1249G>C	c.(1249-1251)Gtt>Ctt	p.V417L	INTS4_ENST00000525931.1_5'UTR|INTS4_ENST00000529807.1_Missense_Mutation_p.V417L	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	417					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			AACATGTCAACTAGGAAATCA	0.438																																							uc001oys.2		NA																	0				ovary(2)	2						c.(1249-1251)GTT>CTT		integrator complex subunit 4							34.0	31.0	32.0					11																	77639510		2199	4289	6488	SO:0001583	missense	92105				snRNA processing	integrator complex	protein binding	g.chr11:77639510C>G	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.1249G>C	11.37:g.77639510C>G	ENSP00000434466:p.Val417Leu					INTS4_uc001oyt.2_RNA|INTS4_uc001oyu.1_Missense_Mutation_p.V417L	p.V417L	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)		11	1277	-	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		417			HEAT 7.		Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	37	c.1249G>C	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516663	0.85495	.	.	ENSG00000149262	ENST00000534064;ENST00000354849;ENST00000529807	T;T	0.40476	1.03;1.03	3.88	3.88	0.44766	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59905	0.2228	L	0.58669	1.825	0.80722	D	1	D	0.63046	0.992	D	0.74348	0.983	T	0.62530	-0.6835	10	0.48119	T	0.1	-19.0245	16.3613	0.83269	0.0:1.0:0.0:0.0	.	417	Q96HW7	INT4_HUMAN	L	417;268;417	ENSP00000434466:V417L;ENSP00000433644:V417L	ENSP00000346913:V268L	V	-	1	0	INTS4	77317158	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.149000	0.77396	2.153000	0.67306	0.471000	0.43371	GTT		0.438	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547		10	21	0	0	0	0.008291	0	10	21				
GRM5	2915	broad.mit.edu	37	11	88780894	88780894	+	Silent	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:88780894C>G	ENST00000305447.4	-	1	296	c.147G>C	c.(145-147)gtG>gtC	p.V49V	GRM5_ENST00000455756.2_Silent_p.V49V|GRM5_ENST00000393297.1_Silent_p.V49V|GRM5_ENST00000305432.5_Silent_p.V49V|GRM5_ENST00000418177.2_Silent_p.V49V|GRM5_ENST00000393294.3_Silent_p.V49V	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	49					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	GAACTTTGTCCACAGTAGGCT	0.532																																							uc001pcq.2		NA																	0				central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9						c.(145-147)GTG>GTC		glutamate receptor, metabotropic 5 isoform a	Acamprosate(DB00659)						68.0	62.0	64.0					11																	88780894		2201	4299	6500	SO:0001819	synonymous_variant	2915				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr11:88780894C>G	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.147G>C	11.37:g.88780894C>G						GRM5_uc009yvm.2_Silent_p.V49V|GRM5_uc009yvn.1_Silent_p.V49V	p.V49V	NM_001143831	NP_001137303	P41594	GRM5_HUMAN			1	347	-		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)	49			Extracellular (Potential).		Q6J164	Silent	SNP	ENST00000305447.4	37	c.147G>C	CCDS44694.1																																																																																				0.532	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		6	39	0	0	0	0.001168	0	6	39				
FAT3	120114	broad.mit.edu	37	11	92531099	92531099	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:92531099C>T	ENST00000298047.6	+	9	4937	c.4920C>T	c.(4918-4920)tcC>tcT	p.S1640S	FAT3_ENST00000525166.1_Silent_p.S1490S|FAT3_ENST00000409404.2_Silent_p.S1640S			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1640	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTGTCCTATCCATCAAAGTCA	0.478										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(4918-4920)TCC>TCT		FAT tumor suppressor homolog 3							104.0	104.0	104.0					11																	92531099		1999	4161	6160	SO:0001819	synonymous_variant	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92531099C>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4920C>T	11.37:g.92531099C>T		TCGA Ovarian(4;0.039)					p.S1640S	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			9	4937	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	1640			Cadherin 15.|Extracellular (Potential).		B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37	c.4920C>T																																																																																					0.478	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		19	51	0	0	0	0.007413	0	19	51				
DDI1	414301	broad.mit.edu	37	11	103908369	103908369	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:103908369C>A	ENST00000302259.3	+	1	1062	c.819C>A	c.(817-819)gcC>gcA	p.A273A	PDGFD_ENST00000393158.2_Intron|PDGFD_ENST00000302251.5_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	273							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		AGGCTTGTGCCGAGCGATGTA	0.517																																							uc001phr.2		NA																	0				large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5						c.(817-819)GCC>GCA		DDI1, DNA-damage inducible 1, homolog 1							95.0	94.0	95.0					11																	103908369		2202	4299	6501	SO:0001819	synonymous_variant	414301				proteolysis		aspartic-type endopeptidase activity	g.chr11:103908369C>A		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.819C>A	11.37:g.103908369C>A						PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	p.A273A	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)	1	1062	+		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)	273					Q7Z4U6|Q8WTS3	Silent	SNP	ENST00000302259.3	37	c.819C>A	CCDS31660.1																																																																																				0.517	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711		32	69	1	0	1.45844e-13	0.002836	2.5411e-13	32	69				
APOA5	116519	broad.mit.edu	37	11	116661395	116661395	+	Missense_Mutation	SNP	T	T	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:116661395T>G	ENST00000227665.4	-	3	584	c.550A>C	c.(550-552)Acc>Ccc	p.T184P	APOA5_ENST00000542499.1_Missense_Mutation_p.T184P|ZNF259_ENST00000227322.3_5'Flank			Q6Q788	APOA5_HUMAN	apolipoprotein A-V	184					acylglycerol homeostasis (GO:0055090)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|organ regeneration (GO:0031100)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)	chylomicron (GO:0042627)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|lipase activator activity (GO:0060229)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|lipoprotein particle receptor binding (GO:0070325)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylcholine binding (GO:0031210)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	14	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		AAGCGGCCGGTGTGGTGCACC	0.682																																							uc001ppr.2		NA																	0					0						c.(550-552)ACC>CCC		apolipoprotein AV precursor							29.0	32.0	31.0					11																	116661395		2200	4296	6496	SO:0001583	missense	116519				acylglycerol homeostasis|cholesterol homeostasis|lipid transport|lipoprotein metabolic process|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor-mediated endocytosis|positive regulation of triglyceride catabolic process|positive regulation of very-low-density lipoprotein particle remodeling|tissue regeneration|triglyceride catabolic process|triglyceride homeostasis	chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	enzyme binding|heparin binding|lipoprotein lipase activator activity|low-density lipoprotein particle receptor binding|phosphatidylcholine binding	g.chr11:116661395T>G	AF202889	CCDS8376.2	11q23	2013-01-24			ENSG00000110243	ENSG00000110243		"""Apolipoproteins"""	17288	protein-coding gene	gene with protein product		606368				11588264, 11577099	Standard	NM_001166598		Approved	RAP3, APOA-V	uc009yzf.3	Q6Q788	OTTHUMG00000046116	ENST00000227665.4:c.550A>C	11.37:g.116661395T>G	ENSP00000227665:p.Thr184Pro					ZNF259_uc001ppp.2_5'Flank|ZNF259_uc009yzd.2_5'Flank|ZNF259_uc001ppq.2_5'Flank|APOA5_uc009yze.2_Missense_Mutation_p.T184P|APOA5_uc009yzf.2_Missense_Mutation_p.T184P|APOA5_uc009yzg.2_Missense_Mutation_p.T210P	p.T184P	NM_052968	NP_443200	Q6Q788	APOA5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)	3	558	-	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)	184					B0YIV9|Q3MIK6|Q6UWK9|Q9UBJ3	Missense_Mutation	SNP	ENST00000227665.4	37	c.550A>C	CCDS8376.2	.	.	.	.	.	.	.	.	.	.	T	13.44	2.238979	0.39598	.	.	ENSG00000110243	ENST00000227665;ENST00000542499	T;T	0.74526	-0.85;-0.85	4.98	3.86	0.44501	Apolipoprotein/apolipophorin (1);	0.000000	0.64402	D	0.000016	D	0.82926	0.5143	M	0.80982	2.52	0.39879	D	0.973619	D;D	0.63046	0.992;0.977	D;P	0.65443	0.935;0.9	T	0.81491	-0.0909	10	0.30854	T	0.27	-18.2362	9.1468	0.36937	0.0:0.0837:0.0:0.9163	.	181;184	B0YIW1;Q6Q788	.;APOA5_HUMAN	P	184	ENSP00000227665:T184P;ENSP00000445002:T184P	ENSP00000227665:T184P	T	-	1	0	APOA5	116166605	0.995000	0.38212	0.966000	0.40874	0.019000	0.09904	2.473000	0.45145	0.916000	0.36871	0.528000	0.53228	ACC		0.682	APOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106285.2			10	37	0	0	0	0.006214	0	10	37				
OR10G8	219869	broad.mit.edu	37	11	123900680	123900680	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:123900680G>T	ENST00000431524.1	+	1	384	c.351G>T	c.(349-351)atG>atT	p.M117I		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		ACAGGGTCATGTCCTGTGATC	0.557																																							uc001pzp.1		NA																	0				ovary(1)|skin(1)	2						c.(349-351)ATG>ATT		olfactory receptor, family 10, subfamily G,							152.0	143.0	146.0					11																	123900680		2201	4299	6500	SO:0001583	missense	219869				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123900680G>T	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.351G>T	11.37:g.123900680G>T	ENSP00000389072:p.Met117Ile						p.M117I	NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	351	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	117			Helical; Name=3; (Potential).		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	c.351G>T	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998597	0.54147	.	.	ENSG00000234560	ENST00000431524	T	0.35789	1.29	3.04	2.11	0.27256	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000019	T	0.66607	0.2806	H	0.95402	3.665	0.39057	D	0.960447	D	0.62365	0.991	D	0.77004	0.989	T	0.73036	-0.4109	10	0.87932	D	0	.	9.3393	0.38069	0.1142:0.0:0.8858:0.0	.	117	Q8NGN5	O10G8_HUMAN	I	117	ENSP00000389072:M117I	ENSP00000389072:M117I	M	+	3	0	OR10G8	123405890	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	8.527000	0.90594	0.593000	0.29745	-0.157000	0.13467	ATG		0.557	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464		57	85	1	0	1.46156e-29	0.00361	3.081e-29	57	85				
Unknown	0	broad.mit.edu	37	11	124095657	124095657	+	IGR	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:124095657C>A								OR10D3 (38705 upstream) : OR8G1 (24765 downstream)																							ATCTGCCATTCCACTATCATT	0.443																																							uc010saf.1		NA																	0					0						c.(259-261)TCC>TAC		olfactory receptor, family 8, subfamily G,							158.0	157.0	157.0					11																	124095657		2144	4284	6428	SO:0001628	intergenic_variant	26492					integral to membrane	olfactory receptor activity	g.chr11:124095657C>A																													11.37:g.124095657C>A							p.S87Y	NM_001007249	NP_001007250	Q15614	OR8G2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.91e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)	1	260	+		Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	87						Missense_Mutation	SNP		37	c.260C>A																																																																																				0	0.443									57	89	1	0	9.72345e-25	0.00361	1.98836e-24	57	89				
PANX3	116337	broad.mit.edu	37	11	124487256	124487256	+	Missense_Mutation	SNP	C	C	A	rs144166888		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:124487256C>A	ENST00000284288.2	+	3	478	c.411C>A	c.(409-411)agC>agA	p.S137R		NM_052959.2	NP_443191.1	Q96QZ0	PANX3_HUMAN	pannexin 3	137					cell-cell signaling (GO:0007267)|ion transport (GO:0006811)|protein hexamerization (GO:0034214)|transmembrane transport (GO:0055085)	gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|urinary_tract(1)	26	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		CAGCCCTCAGCTCCGATCTGC	0.597																																							uc001qah.2		NA																	0					0						c.(409-411)AGC>AGA		pannexin 3							78.0	63.0	68.0					11																	124487256		2201	4299	6500	SO:0001583	missense	116337				protein hexamerization	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity	g.chr11:124487256C>A	AF406650	CCDS8447.1	11q24.2	2011-12-02			ENSG00000154143	ENSG00000154143		"""Ion channels / Pannexins"""	20573	protein-coding gene	gene with protein product		608422					Standard	NM_052959		Approved	Px3	uc001qah.3	Q96QZ0	OTTHUMG00000165925	ENST00000284288.2:c.411C>A	11.37:g.124487256C>A	ENSP00000284288:p.Ser137Arg						p.S137R	NM_052959	NP_443191	Q96QZ0	PANX3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)	3	411	+	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	137			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000284288.2	37	c.411C>A	CCDS8447.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.503106	0.44558	.	.	ENSG00000154143	ENST00000284288	T	0.29142	1.58	4.92	4.01	0.46588	.	0.279462	0.45126	D	0.000382	T	0.33527	0.0866	L	0.50333	1.59	0.37930	D	0.93196	P	0.38677	0.642	P	0.45829	0.494	T	0.13522	-1.0506	10	0.13470	T	0.59	-10.292	13.0389	0.58887	0.0:0.9213:0.0:0.0787	.	137	Q96QZ0	PANX3_HUMAN	R	137	ENSP00000284288:S137R	ENSP00000284288:S137R	S	+	3	2	PANX3	123992466	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	1.275000	0.33144	1.066000	0.40716	0.455000	0.32223	AGC		0.597	PANX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387064.1			23	25	1	0	1.10513e-12	0.002299	1.88231e-12	23	25				
KCNJ5	3762	broad.mit.edu	37	11	128781592	128781592	+	Missense_Mutation	SNP	T	T	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:128781592T>G	ENST00000338350.4	+	3	776	c.424T>G	c.(424-426)Ttc>Gtc	p.F142V	KCNJ5_ENST00000529694.1_Missense_Mutation_p.F142V|KCNJ5_ENST00000533599.1_Missense_Mutation_p.F142V			P48544	KCNJ5_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 5	142					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			NS(1)|breast(1)|endometrium(4)|large_intestine(4)|liver(2)|lung(9)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glyburide(DB01016)	CGCTTTCCTGTTCTCCATTGA	0.522																																					Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)	Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)	uc001qet.2		NA																	0				skin(1)	1						c.(424-426)TTC>GTC		potassium inwardly-rectifying channel J5	Glibenclamide(DB01016)						154.0	150.0	151.0					11																	128781592		2201	4297	6498	SO:0001583	missense	3762				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr11:128781592T>G	D50134	CCDS8479.1	11q24	2014-09-17				ENSG00000120457		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6266	protein-coding gene	gene with protein product		600734				16382105	Standard	NM_000890		Approved	Kir3.4, CIR, KATP1, GIRK4, LQT13	uc001qet.3	P48544		ENST00000338350.4:c.424T>G	11.37:g.128781592T>G	ENSP00000339960:p.Phe142Val					KCNJ5_uc009zck.2_Missense_Mutation_p.F142V|KCNJ5_uc001qew.2_Missense_Mutation_p.F142V	p.F142V	NM_000890	NP_000881	P48544	IRK5_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	2	738	+	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	142					B2R744|Q6DK13|Q6DK14|Q92807	Missense_Mutation	SNP	ENST00000338350.4	37	c.424T>G	CCDS8479.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.324870	0.81580	.	.	ENSG00000120457	ENST00000529694;ENST00000338350;ENST00000533599	D;D;D	0.98192	-4.78;-4.78;-4.78	5.46	5.46	0.80206	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.99269	0.9745	H	0.95224	3.64	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98900	1.0776	10	0.87932	D	0	.	15.5352	0.75996	0.0:0.0:0.0:1.0	.	142	P48544	IRK5_HUMAN	V	142	ENSP00000433295:F142V;ENSP00000339960:F142V;ENSP00000434266:F142V	ENSP00000339960:F142V	F	+	1	0	KCNJ5	128286802	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.040000	0.89188	2.068000	0.61886	0.459000	0.35465	TTC		0.522	KCNJ5-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386239.1	NM_000890		50	85	0	0	0	0.00361	0	50	85				
ARHGAP32	9743	broad.mit.edu	37	11	128839708	128839708	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr11:128839708C>A	ENST00000310343.9	-	22	5357	c.5358G>T	c.(5356-5358)ggG>ggT	p.G1786G	ARHGAP32_ENST00000527272.1_Silent_p.G1437G|ARHGAP32_ENST00000392657.3_Silent_p.G1437G|ARHGAP32_ENST00000524655.1_3'UTR	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1786	Interaction with FYN.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						TGACATAGATCCCACCCAAGT	0.547																																							uc009zcp.2		NA																	0				lung(3)|ovary(2)	5						c.(5356-5358)GGG>GGT		Rho GTPase-activating protein isoform 1							93.0	91.0	92.0					11																	128839708		2201	4297	6498	SO:0001819	synonymous_variant	9743				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding	g.chr11:128839708C>A	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.5358G>T	11.37:g.128839708C>A						ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_Silent_p.G745G|ARHGAP32_uc001qez.2_Silent_p.G1437G	p.G1786G	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN			22	5358	-			1786			Interaction with FYN.		I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	ENST00000310343.9	37	c.5358G>T	CCDS44769.1																																																																																				0.547	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715		39	63	1	0	7.53189e-24	0.007835	1.52198e-23	39	63				
CACNA1C	775	broad.mit.edu	37	12	2742805	2742805	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:2742805G>T	ENST00000347598.4	+	31	3899	c.3899G>T	c.(3898-3900)aGt>aTt	p.S1300I	CACNA1C_ENST00000406454.3_Missense_Mutation_p.S1280I|CACNA1C_ENST00000399649.1_Intron|CACNA1C_ENST00000399603.1_Missense_Mutation_p.S1280I|CACNA1C_ENST00000399637.1_Intron|CACNA1C_ENST00000344100.3_Intron|CACNA1C_ENST00000399641.1_Intron|CACNA1C_ENST00000327702.7_Intron|CACNA1C_ENST00000399595.1_Intron|CACNA1C_ENST00000399634.1_Intron|CACNA1C_ENST00000399601.1_Intron|CACNA1C_ENST00000335762.5_Intron|CACNA1C_ENST00000399617.1_Missense_Mutation_p.S1280I|CACNA1C_ENST00000399597.1_Missense_Mutation_p.S1280I|CACNA1C_ENST00000399655.1_Intron|CACNA1C_ENST00000399606.1_Intron|CACNA1C_ENST00000399644.1_Missense_Mutation_p.S1280I|CACNA1C_ENST00000399621.1_Intron|CACNA1C_ENST00000399591.1_Intron|CACNA1C_ENST00000399629.1_Missense_Mutation_p.S1280I|CACNA1C_ENST00000399638.1_Missense_Mutation_p.S1280I|CACNA1C_ENST00000402845.3_Missense_Mutation_p.S1280I	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1300					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGTTACTTTAGTGATCCCTGG	0.443																																							uc009zdu.1		NA																	0				ovary(10)|central_nervous_system(1)	11						c.(3898-3900)AGT>ATT		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						207.0	175.0	185.0					12																	2742805		1568	3582	5150	SO:0001583	missense	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2742805G>T	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3899G>T	12.37:g.2742805G>T	ENSP00000266376:p.Ser1300Ile					CACNA1C_uc009zdv.1_Missense_Mutation_p.S1277I|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Missense_Mutation_p.S1300I|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Missense_Mutation_p.S1280I|CACNA1C_uc001qkr.2_Missense_Mutation_p.S1280I|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Missense_Mutation_p.S1280I|CACNA1C_uc001qks.2_Missense_Mutation_p.S1280I|CACNA1C_uc001qkt.2_Missense_Mutation_p.S1280I|CACNA1C_uc001qki.1_Missense_Mutation_p.S1016I|CACNA1C_uc001qkj.1_Missense_Mutation_p.S1016I|CACNA1C_uc001qkk.1_Missense_Mutation_p.S1016I|CACNA1C_uc001qkm.1_Intron	p.S1300I	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	31	4212	+			1300			Cytoplasmic (Potential).|IV.		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	c.3899G>T	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002246	0.35320	.	.	ENSG00000151067	ENST00000399644;ENST00000399638;ENST00000399597;ENST00000347598;ENST00000399629;ENST00000402845;ENST00000399603;ENST00000399617;ENST00000406454	D;D;D;D;D;D;D;D;D	0.98550	-4.99;-4.28;-4.99;-4.28;-4.28;-4.99;-4.99;-4.99;-4.99	5.16	4.21	0.49690	.	.	.	.	.	D	0.95956	0.8683	L	0.39085	1.19	0.58432	D	0.999997	B;B;B;B;B;B;B;B;B;B;B	0.27416	0.026;0.178;0.008;0.015;0.008;0.008;0.003;0.008;0.012;0.01;0.004	B;B;B;B;B;B;B;B;B;B;B	0.28385	0.022;0.089;0.041;0.022;0.054;0.048;0.005;0.054;0.017;0.061;0.008	D	0.95133	0.8257	9	0.66056	D	0.02	.	14.4234	0.67200	0.0:0.0:0.8519:0.1481	.	1277;1300;1280;1280;1280;1280;1280;1300;1280;1280;1280	Q13936-35;Q13936;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-11;E9PDJ1;E9PDJ0;F5GY28	.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.	I	1280;1280;1280;1300;1280;1280;1280;1280;1280	ENSP00000382552:S1280I;ENSP00000382547:S1280I;ENSP00000382506:S1280I;ENSP00000266376:S1300I;ENSP00000382537:S1280I;ENSP00000385724:S1280I;ENSP00000382512:S1280I;ENSP00000382526:S1280I;ENSP00000385896:S1280I	ENSP00000266376:S1300I	S	+	2	0	CACNA1C	2613066	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.926000	0.87569	2.418000	0.82041	0.561000	0.74099	AGT		0.443	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		9	65	1	0	0.00448238	0.004482	0.00499424	9	65				
CACNA1C	775	broad.mit.edu	37	12	2763057	2763057	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:2763057C>A	ENST00000347598.4	+	35	4275	c.4275C>A	c.(4273-4275)atC>atA	p.I1425I	CACNA1C_ENST00000406454.3_Silent_p.I1377I|CACNA1C_ENST00000399649.1_Silent_p.I1364I|CACNA1C_ENST00000399603.1_Silent_p.I1377I|CACNA1C_ENST00000399637.1_Silent_p.I1377I|CACNA1C_ENST00000344100.3_Silent_p.I1399I|CACNA1C_ENST00000399641.1_Silent_p.I1377I|CACNA1C_ENST00000327702.7_Silent_p.I1377I|CACNA1C_ENST00000399595.1_Silent_p.I1366I|CACNA1C_ENST00000399634.1_Silent_p.I1377I|CACNA1C_ENST00000399601.1_Silent_p.I1377I|CACNA1C_ENST00000335762.5_Silent_p.I1402I|CACNA1C_ENST00000399617.1_Silent_p.I1377I|CACNA1C_ENST00000399597.1_Silent_p.I1377I|CACNA1C_ENST00000399655.1_Silent_p.I1377I|CACNA1C_ENST00000399606.1_Silent_p.I1397I|CACNA1C_ENST00000399644.1_Silent_p.I1377I|CACNA1C_ENST00000399621.1_Silent_p.I1377I|CACNA1C_ENST00000399591.1_Silent_p.I1366I|CACNA1C_ENST00000399629.1_Silent_p.I1394I|CACNA1C_ENST00000399638.1_Silent_p.I1405I|CACNA1C_ENST00000402845.3_Silent_p.I1377I	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1425					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACGCGGTGATCGGGATGCAGG	0.627																																							uc009zdu.1		NA																	0				ovary(10)|central_nervous_system(1)	11						c.(4273-4275)ATC>ATA		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						75.0	78.0	77.0					12																	2763057		2028	4203	6231	SO:0001819	synonymous_variant	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2763057C>A	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4275C>A	12.37:g.2763057C>A						CACNA1C_uc009zdv.1_Silent_p.I1374I|CACNA1C_uc001qkb.2_Silent_p.I1377I|CACNA1C_uc001qkc.2_Silent_p.I1377I|CACNA1C_uc001qke.2_Silent_p.I1366I|CACNA1C_uc001qkf.2_Silent_p.I1366I|CACNA1C_uc001qjz.2_Silent_p.I1377I|CACNA1C_uc001qkd.2_Silent_p.I1377I|CACNA1C_uc001qkg.2_Silent_p.I1364I|CACNA1C_uc009zdw.1_Silent_p.I1399I|CACNA1C_uc001qkh.2_Silent_p.I1366I|CACNA1C_uc001qkl.2_Silent_p.I1425I|CACNA1C_uc001qkn.2_Silent_p.I1377I|CACNA1C_uc001qko.2_Silent_p.I1397I|CACNA1C_uc001qkp.2_Silent_p.I1377I|CACNA1C_uc001qkr.2_Silent_p.I1394I|CACNA1C_uc001qku.2_Silent_p.I1377I|CACNA1C_uc001qkq.2_Silent_p.I1405I|CACNA1C_uc001qks.2_Silent_p.I1377I|CACNA1C_uc001qkt.2_Silent_p.I1377I|CACNA1C_uc001qki.1_Silent_p.I1113I|CACNA1C_uc001qkj.1_Silent_p.I1113I|CACNA1C_uc001qkk.1_Silent_p.I1113I|CACNA1C_uc001qkm.1_Silent_p.I1102I|CACNA1C_uc010sea.1_Silent_p.I68I	p.I1425I	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	35	4588	+			1425			Helical; Name=S5 of repeat IV; (Potential).|IV.		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	c.4275C>A	CCDS44788.1																																																																																				0.627	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		6	23	1	0	8.12818e-05	0.001984	9.89581e-05	6	23				
NTF3	4908	broad.mit.edu	37	12	5603480	5603480	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:5603480C>A	ENST00000331010.6	+	1	183	c.100C>A	c.(100-102)Ctc>Atc	p.L34I	NTF3_ENST00000423158.3_Missense_Mutation_p.L47I|NTF3_ENST00000535299.1_Intron	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	34					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						GCTCAATTCCCTCATTATTAA	0.433																																					GBM(194;1104 2182 8339 9578 18493)	GBM(194;1104 2182 8339 9578 18493)	uc001qnl.3		NA																	0				pancreas(1)	1						c.(100-102)CTC>ATC		neurotrophin 3 isoform 2 preproprotein							101.0	100.0	101.0					12																	5603480		2203	4300	6503	SO:0001583	missense	4908				signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding	g.chr12:5603480C>A		CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.100C>A	12.37:g.5603480C>A	ENSP00000328738:p.Leu34Ile					NTF3_uc001qnk.3_Missense_Mutation_p.L47I	p.L34I	NM_002527	NP_002518	P20783	NTF3_HUMAN			1	183	+			34					B7Z1T5|Q6FH50	Missense_Mutation	SNP	ENST00000331010.6	37	c.100C>A	CCDS8538.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.755151	0.49362	.	.	ENSG00000185652	ENST00000423158;ENST00000331010	T;T	0.46063	0.88;0.88	4.79	4.79	0.61399	.	0.084761	0.48286	D	0.000193	T	0.64011	0.2560	M	0.71036	2.16	0.58432	D	0.999999	D;D	0.63880	0.993;0.993	D;D	0.73708	0.981;0.981	T	0.66881	-0.5811	10	0.59425	D	0.04	-34.1849	17.0016	0.86382	0.0:1.0:0.0:0.0	.	34;47	P20783;B7Z1T5	NTF3_HUMAN;.	I	47;34	ENSP00000397297:L47I;ENSP00000328738:L34I	ENSP00000328738:L34I	L	+	1	0	NTF3	5473741	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.458000	0.80787	2.504000	0.84457	0.591000	0.81541	CTC		0.433	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1			15	78	1	0	2.31682e-05	0.003163	2.91954e-05	15	78				
COPS7A	50813	broad.mit.edu	37	12	6839882	6839882	+	Silent	SNP	C	C	T	rs199950835		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:6839882C>T	ENST00000543155.1	+	7	1166	c.684C>T	c.(682-684)gcC>gcT	p.A228A	COPS7A_ENST00000229251.3_Silent_p.A228A|COPS7A_ENST00000534877.1_Silent_p.A228A|COPS7A_ENST00000534947.1_Silent_p.A228A|COPS7A_ENST00000539735.1_Silent_p.A228A|COPS7A_ENST00000542150.1_3'UTR|COPS7A_ENST00000538410.1_Intron	NM_001164094.1	NP_001157566.1	Q9UBW8	CSN7A_HUMAN	COP9 signalosome subunit 7A	228					cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|urinary_tract(1)	10						CAGCAGCAGCCGCAGCCACAT	0.547													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19005	0.0		0.0	False		,,,				2504	0.0						uc001qqj.2		NA																	0				ovary(1)	1						c.(682-684)GCC>GCT		COP9 complex subunit 7a		C	,,,	1,4405		0,1,2202	34.0	40.0	38.0		684,684,684,684	-7.6	0.0	12		38	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	COPS7A	NM_001164093.1,NM_001164094.1,NM_001164095.1,NM_016319.2	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	228/276,228/276,228/276,228/276	6839882	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	50813				cullin deneddylation	cytoplasm|signalosome		g.chr12:6839882C>T	AF193844	CCDS8558.1	12p13.31	2013-03-14	2013-03-14		ENSG00000111652	ENSG00000111652			16758	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7A"", ""COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)"""				Standard	NM_001164093		Approved	CSN7A	uc001qqh.3	Q9UBW8	OTTHUMG00000169182	ENST00000543155.1:c.684C>T	12.37:g.6839882C>T						COPS7A_uc009zex.2_RNA|COPS7A_uc001qqk.2_Intron|COPS7A_uc001qql.2_RNA|COPS7A_uc001qqh.2_Silent_p.A228A|COPS7A_uc001qqi.2_Silent_p.A228A|COPS7A_uc001qqm.2_RNA|COPS7A_uc001qqn.3_Silent_p.A228A|COPS7A_uc001qqo.2_Silent_p.A228A	p.A228A	NM_001164094	NP_001157566	Q9UBW8	CSN7A_HUMAN			7	923	+			228			Potential.		A8K9A6|Q9NVX3|Q9UJW4	Silent	SNP	ENST00000543155.1	37	c.684C>T	CCDS8558.1																																																																																				0.547	COPS7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402740.1			10	35	0	0	0	0.008291	0	10	35				
TAS2R10	50839	broad.mit.edu	37	12	10978098	10978098	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:10978098C>A	ENST00000240619.2	-	1	859	c.771G>T	c.(769-771)ctG>ctT	p.L257L		NM_023921.1	NP_076410.1	Q9NYW0	T2R10_HUMAN	taste receptor, type 2, member 10	257					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						ACATAAGCAGCAGTTTGTTTT	0.383																																							uc001qyy.1		NA																	0					0						c.(769-771)CTG>CTT		taste receptor, type 2, member 10							111.0	107.0	108.0					12																	10978098		2203	4300	6503	SO:0001819	synonymous_variant	50839				sensory perception of taste	integral to membrane	taste receptor activity	g.chr12:10978098C>A	AF227136	CCDS8634.1	12p13	2012-08-22			ENSG00000121318	ENSG00000121318		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14918	protein-coding gene	gene with protein product		604791				10761934, 10766242	Standard	NM_023921		Approved	T2R10, TRB2	uc001qyy.1	Q9NYW0	OTTHUMG00000168508	ENST00000240619.2:c.771G>T	12.37:g.10978098C>A							p.L257L	NM_023921	NP_076410	Q9NYW0	T2R10_HUMAN			1	771	-			257			Extracellular (Potential).		Q3MIM9|Q6NTD9	Silent	SNP	ENST00000240619.2	37	c.771G>T	CCDS8634.1																																																																																				0.383	TAS2R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399934.1			15	97	1	0	0.000219431	0.00245	0.000259743	15	97				
H3F3C	440093	broad.mit.edu	37	12	31944778	31944778	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:31944778T>A	ENST00000340398.3	-	1	397	c.323A>T	c.(322-324)aAc>aTc	p.N108I		NM_001013699.2	NP_001013721.2	Q6NXT2	H3C_HUMAN	H3 histone, family 3C	108					positive regulation of cell growth (GO:0030307)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	nucleosomal DNA binding (GO:0031492)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	18						GGCACACAGGTTAGTATCTTC	0.552										HNSCC(67;0.2)																													uc001rkr.2		NA																	0					0						c.(322-324)AAC>ATC		histone H3-like							151.0	141.0	144.0					12																	31944778		2203	4300	6503	SO:0001583	missense	440093				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr12:31944778T>A	BC066906	CCDS31769.1	12p11.21	2012-02-15			ENSG00000188375	ENSG00000188375		"""Histones / Replication-independent"""	33164	protein-coding gene	gene with protein product						21274551	Standard	NM_001013699		Approved	H3.5	uc001rkr.3	Q6NXT2	OTTHUMG00000157811	ENST00000340398.3:c.323A>T	12.37:g.31944778T>A	ENSP00000339835:p.Asn108Ile	HNSCC(67;0.2)					p.N108I	NM_001013699	NP_001013721	Q6NXT2	H3C_HUMAN			1	398	-			108					E9P281	Missense_Mutation	SNP	ENST00000340398.3	37	c.323A>T	CCDS31769.1	.	.	.	.	.	.	.	.	.	.	T	9.811	1.183233	0.21870	.	.	ENSG00000188375	ENST00000340398	T	0.69306	-0.39	1.34	1.34	0.21922	Histone-fold (2);Histone core (1);	0.089382	0.38897	U	0.001530	D	0.86997	0.6068	H	0.99368	4.535	0.37185	D	0.903698	D	0.89917	1.0	D	0.87578	0.998	D	0.86387	0.1733	10	0.87932	D	0	.	6.5499	0.22427	0.0:0.0:0.0:1.0	.	108	Q6NXT2	H3C_HUMAN	I	108	ENSP00000339835:N108I	ENSP00000339835:N108I	N	-	2	0	H3F3C	31836045	1.000000	0.71417	0.892000	0.35008	0.218000	0.24690	5.557000	0.67313	0.629000	0.30376	0.338000	0.21704	AAC		0.552	H3F3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349653.1	NM_001013699		28	85	0	0	0	0.00632	0	28	85				
WNT1	7471	broad.mit.edu	37	12	49373341	49373341	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:49373341C>A	ENST00000293549.3	+	2	231	c.195C>A	c.(193-195)agC>agA	p.S65R		NM_005430.3	NP_005421.1	P04628	WNT1_HUMAN	wingless-type MMTV integration site family, member 1	65					bone development (GO:0060348)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to peptide hormone stimulus (GO:0071375)|central nervous system morphogenesis (GO:0021551)|cerebellum formation (GO:0021588)|diencephalon development (GO:0021536)|embryonic axis specification (GO:0000578)|forebrain anterior/posterior pattern specification (GO:0021797)|hematopoietic stem cell proliferation (GO:0071425)|hepatocyte differentiation (GO:0070365)|inner ear morphogenesis (GO:0042472)|midbrain development (GO:0030901)|midbrain-hindbrain boundary maturation during brain development (GO:0022004)|myoblast fusion (GO:0007520)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell aging (GO:0090344)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron differentiation (GO:0030182)|neuron fate determination (GO:0048664)|organ regeneration (GO:0031100)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dermatome development (GO:0061184)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to wounding (GO:0009611)|signal transduction in response to DNA damage (GO:0042770)|Spemann organizer formation (GO:0060061)|spinal cord association neuron differentiation (GO:0021527)|T cell differentiation in thymus (GO:0033077)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(357;0.244)		AGCTGTTGAGCCGCAAACAGC	0.602																																							uc001rsu.2		NA																	0				kidney(1)	1						c.(193-195)AGC>AGA		wingless-type MMTV integration site family,							69.0	68.0	69.0					12																	49373341		2203	4300	6503	SO:0001583	missense	7471				brain segmentation|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|central nervous system morphogenesis|cerebellum formation|dermatome development|diencephalon development|embryonic axis specification|forebrain anterior/posterior pattern formation|fourth ventricle development|hemopoietic stem cell proliferation|hepatocyte differentiation|inner ear morphogenesis|mesoderm morphogenesis|midbrain development|midbrain-hindbrain boundary maturation during brain development|negative regulation of cell-cell adhesion|negative regulation of cell-substrate adhesion|negative regulation of DNA damage checkpoint|negative regulation of fat cell differentiation|neuron fate determination|positive regulation of fibroblast proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of lamellipodium assembly|positive regulation of Notch signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to wounding|signal transduction in response to DNA damage|Spemann organizer formation|T cell differentiation in thymus|Wnt receptor signaling pathway, calcium modulating pathway	early endosome|extracellular space|late endosome|membrane raft|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled-2 binding|transcription regulatory region DNA binding	g.chr12:49373341C>A	X03072	CCDS8776.1	12q13	2013-02-28				ENSG00000125084		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12774	protein-coding gene	gene with protein product		164820		INT1		2998762, 3281802	Standard	NM_005430		Approved		uc001rsu.3	P04628	OTTHUMG00000170403	ENST00000293549.3:c.195C>A	12.37:g.49373341C>A	ENSP00000293549:p.Ser65Arg						p.S65R	NM_005430	NP_005421	P04628	WNT1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.244)	2	393	+			65					Q5U0N2	Missense_Mutation	SNP	ENST00000293549.3	37	c.195C>A	CCDS8776.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.437670	0.62955	.	.	ENSG00000125084	ENST00000293549	T	0.76316	-1.01	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.71736	0.3375	L	0.33137	0.985	0.58432	D	0.999999	P	0.51791	0.948	P	0.48770	0.589	T	0.70245	-0.4925	10	0.35671	T	0.21	.	10.4723	0.44644	0.0:0.9098:0.0:0.0902	.	65	P04628	WNT1_HUMAN	R	65	ENSP00000293549:S65R	ENSP00000293549:S65R	S	+	3	2	WNT1	47659608	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.717000	0.37991	2.501000	0.84356	0.655000	0.94253	AGC		0.602	WNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408937.1			11	74	1	0	0.00829132	0.008291	0.00914858	11	74				
KMT2D	8085	broad.mit.edu	37	12	49433751	49433751	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:49433751G>A	ENST00000301067.7	-	31	7801	c.7802C>T	c.(7801-7803)aCa>aTa	p.T2601I	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2601	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GCTCTCCCCTGTGGACCCGCT	0.662																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(7801-7803)ACA>ATA		myeloid/lymphoid or mixed-lineage leukemia 2							34.0	38.0	37.0					12																	49433751		1941	4139	6080	SO:0001583	missense	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49433751G>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.7802C>T	12.37:g.49433751G>A	ENSP00000301067:p.Thr2601Ile	HNSCC(34;0.089)					p.T2601I	NM_003482	NP_003473	O14686	MLL2_HUMAN			31	7802	-			2601			Pro-rich.		O14687	Missense_Mutation	SNP	ENST00000301067.7	37	c.7802C>T	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	8.318	0.823609	0.16678	.	.	ENSG00000167548	ENST00000301067	T	0.79749	-1.3	5.24	5.24	0.73138	.	0.207154	0.24452	N	0.038402	T	0.69967	0.3170	N	0.14661	0.345	0.26939	N	0.966294	B	0.10296	0.003	B	0.04013	0.001	T	0.64875	-0.6304	10	0.87932	D	0	.	17.9825	0.89146	0.0:0.0:1.0:0.0	.	2601	O14686	MLL2_HUMAN	I	2601	ENSP00000301067:T2601I	ENSP00000301067:T2601I	T	-	2	0	MLL2	47720018	0.913000	0.31002	1.000000	0.80357	0.974000	0.67602	1.568000	0.36418	2.609000	0.88269	0.591000	0.81541	ACA		0.662	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			7	13	0	0	0	0.004482	0	7	13				
TUBA1A	7846	broad.mit.edu	37	12	49580492	49580492	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:49580492C>A	ENST00000295766.5	-	2	607	c.128G>T	c.(127-129)gGg>gTg	p.G43V	TUBA1A_ENST00000301071.7_Missense_Mutation_p.G43V|TUBA1A_ENST00000550767.1_Missense_Mutation_p.G8V|TUBA1A_ENST00000546918.1_Missense_Mutation_p.G43V	NM_001270399.1	NP_001257328.1	Q71U36	TBA1A_HUMAN	tubulin, alpha 1a	43					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			stomach(1)|upper_aerodigestive_tract(1)	2					Albendazole(DB00518)|Mebendazole(DB00643)|Vinblastine(DB00570)	ATCTCCTCCCCCAATGGTCTT	0.577																																					Pancreas(111;782 2307 24613 44561)|NSCLC(165;1667 2752 9496 39006)|Ovarian(19;24 776 10875 37451)	Pancreas(111;782 2307 24613 44561)|NSCLC(165;1667 2752 9496 39006)|Ovarian(19;24 776 10875 37451)	uc009zlf.2		NA																	0					0						c.(127-129)GGG>GTG		tubulin, alpha 1a							124.0	111.0	116.0					12																	49580492		2203	4300	6503	SO:0001583	missense	7846				'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr12:49580492C>A	AF141347	CCDS8781.1, CCDS58226.1, CCDS58227.1	12q13.12	2007-02-07						"""Tubulins"""	20766	protein-coding gene	gene with protein product	"""tubulin, alpha, brain-specific"""	602529				11504633, 3839072	Standard	NM_006009		Approved	TUBA3, B-ALPHA-1, FLJ25113	uc010smg.1	Q71U36	OTTHUMG00000169511	ENST00000295766.5:c.128G>T	12.37:g.49580492C>A	ENSP00000439020:p.Gly43Val					TUBA1B_uc001rto.2_Missense_Mutation_p.G8V|TUBA1A_uc001rtp.2_Missense_Mutation_p.G43V|TUBA1A_uc001rtq.2_5'UTR|TUBA1A_uc001rtr.2_5'UTR|TUBA1A_uc009zlg.2_Intron	p.G43V	NM_006009	NP_006000	Q71U36	TBA1A_HUMAN			2	400	-			43					A8K0B8|G3V1U9|P04687|P05209	Missense_Mutation	SNP	ENST00000295766.5	37	c.128G>T	CCDS58227.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.039117	0.55003	.	.	ENSG00000167552	ENST00000301071;ENST00000552597;ENST00000552250;ENST00000295766;ENST00000550767;ENST00000547939;ENST00000546918;ENST00000552924;ENST00000550811	T;T;T;T;T;T;D	0.85258	-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-1.96	5.29	5.29	0.74685	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.64402	D	0.000001	D	0.87124	0.6099	M	0.80028	2.48	0.80722	D	1	B	0.06786	0.001	B	0.19946	0.027	D	0.84739	0.0750	10	0.72032	D	0.01	.	18.0931	0.89480	0.0:1.0:0.0:0.0	.	43	Q71U36	TBA1A_HUMAN	V	43;43;43;43;8;8;43;8;8	ENSP00000301071:G43V;ENSP00000439020:G43V;ENSP00000446637:G8V;ENSP00000450268:G8V;ENSP00000446613:G43V;ENSP00000448725:G8V;ENSP00000449016:G8V	ENSP00000439020:G43V	G	-	2	0	TUBA1A	47866759	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.980000	0.56895	2.639000	0.89480	0.655000	0.94253	GGG		0.577	TUBA1A-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000404547.2	NM_006009		21	84	1	0	3.5997e-14	0.002299	6.453e-14	21	84				
KRT6B	3854	broad.mit.edu	37	12	52843597	52843597	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:52843597G>C	ENST00000252252.3	-	4	904	c.857C>G	c.(856-858)gCc>gGc	p.A286G		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	286	Coil 1B.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		GTCTGCCTTGGCTTGCAGTTC	0.488																																							uc001sak.2		NA																	0				ovary(2)	2						c.(856-858)GCC>GGC		keratin 6B							159.0	149.0	152.0					12																	52843597		2203	4300	6503	SO:0001583	missense	3854				ectoderm development	keratin filament	structural constituent of cytoskeleton	g.chr12:52843597G>C	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.857C>G	12.37:g.52843597G>C	ENSP00000252252:p.Ala286Gly						p.A286G	NM_005555	NP_005546	P04259	K2C6B_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.083)	4	905	-			286			Coil 1B.|Rod.		P48669	Missense_Mutation	SNP	ENST00000252252.3	37	c.857C>G	CCDS8828.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159607	0.57368	.	.	ENSG00000185479	ENST00000252252	D	0.86865	-2.18	3.05	3.05	0.35203	Filament (1);	0.000000	0.56097	D	0.000032	D	0.85894	0.5803	L	0.60012	1.86	0.47994	D	0.999564	B	0.27380	0.177	B	0.34038	0.174	D	0.86420	0.1754	10	0.52906	T	0.07	.	15.3938	0.74774	0.0:0.0:1.0:0.0	.	286	P04259	K2C6B_HUMAN	G	286	ENSP00000252252:A286G	ENSP00000252252:A286G	A	-	2	0	KRT6B	51129864	1.000000	0.71417	0.908000	0.35775	0.903000	0.53119	4.403000	0.59729	2.042000	0.60477	0.298000	0.19748	GCC		0.488	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555		12	99	0	0	0	0.001368	0	12	99				
KRT73	319101	broad.mit.edu	37	12	53007601	53007601	+	Silent	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:53007601C>G	ENST00000305748.3	-	5	889	c.855G>C	c.(853-855)acG>acC	p.T285T	RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	285	Linker 12.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		GGATGATGGACGTGTCGCTGA	0.557																																							uc001sas.2		NA																	0				large_intestine(2)|ovary(2)|skin(2)	6						c.(853-855)ACG>ACC		keratin 73							176.0	146.0	156.0					12																	53007601		2203	4300	6503	SO:0001819	synonymous_variant	319101					keratin filament	structural molecule activity	g.chr12:53007601C>G	AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.855G>C	12.37:g.53007601C>G							p.T285T	NM_175068	NP_778238	Q86Y46	K2C73_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	5	890	-			285			Rod.|Linker 12.		Q32MB2	Silent	SNP	ENST00000305748.3	37	c.855G>C	CCDS8834.1																																																																																				0.557	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1	NM_175068		18	90	0	0	0	0.008871	0	18	90				
KRT77	374454	broad.mit.edu	37	12	53091651	53091651	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:53091651C>A	ENST00000341809.3	-	2	601	c.573G>T	c.(571-573)gtG>gtT	p.V191V	KRT77_ENST00000537195.1_5'UTR|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	191	Coil 1A.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						TTGTTTGTAGCACCTGGTTCT	0.562																																							uc001saw.2		NA																	0				ovary(1)	1						c.(571-573)GTG>GTT		keratin 77							146.0	133.0	137.0					12																	53091651		2203	4300	6503	SO:0001819	synonymous_variant	374454					keratin filament	structural molecule activity	g.chr12:53091651C>A	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.573G>T	12.37:g.53091651C>A						KRT77_uc009zmi.2_5'UTR	p.V191V	NM_175078	NP_778253	Q7Z794	K2C1B_HUMAN			2	602	-			191			Coil 1A.|Rod.		Q7RTS8	Silent	SNP	ENST00000341809.3	37	c.573G>T	CCDS8837.1																																																																																				0.562	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	NM_175078		24	124	1	0	4.26978e-12	0.00333	7.1829e-12	24	124				
HOXC10	3226	broad.mit.edu	37	12	54379646	54379647	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:54379646_54379647CC>AA	ENST00000303460.4	+	1	677_678	c.603_604CC>AA	c.(601-606)acCCcc>acAAcc	p.P202T	HOXC-AS3_ENST00000514702.1_RNA|HOXC-AS3_ENST00000509870.1_RNA|RP11-834C11.12_ENST00000513209.1_Missense_Mutation_p.P7T|HOXC-AS3_ENST00000513165.1_RNA|HOXC-AS3_ENST00000567780.1_RNA	NM_017409.3	NP_059105.2	Q9NYD6	HXC10_HUMAN	homeobox C10	202					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|neuromuscular process (GO:0050905)|positive regulation of cell proliferation (GO:0008284)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(3)|lung(14)|pancreas(1)	20						TCCCTGAGACCCCCAAGTCCGA	0.634																																							uc001sen.2		NA																	0				pancreas(1)	1						c.(601-606)ACCCCC>ACAACC		homeobox C10																																				SO:0001583	missense	3226				positive regulation of cell proliferation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54379646_54379647CC>AA		CCDS8868.1	12q13.13	2011-06-20	2005-12-22		ENSG00000180818	ENSG00000180818		"""Homeoboxes / ANTP class : HOXL subclass"""	5122	protein-coding gene	gene with protein product		605560	"""homeo box C10"""	HOX3I		1358459	Standard	NM_017409		Approved		uc001sen.3	Q9NYD6	OTTHUMG00000160031	Exception_encountered	12.37:g.54379646_54379647delinsAA	ENSP00000307321:p.Pro202Thr						p.P202T	NM_017409	NP_059105	Q9NYD6	HXC10_HUMAN			1	701_702	+			202					O15219|O15220|Q9BVD5	Missense_Mutation	DNP	ENST00000303460.4	37	c.603_604CC>AA	CCDS8868.1																																																																																				0.634	HOXC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358952.2			12	54	0	0	0	0.004672	0	12	54				
HOXC4	3221	broad.mit.edu	37	12	54447898	54447898	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:54447898G>T	ENST00000430889.2	+	1	238	c.192G>T	c.(190-192)gaG>gaT	p.E64D	HOXC4_ENST00000303406.4_Missense_Mutation_p.E64D|HOXC4_ENST00000609810.1_Missense_Mutation_p.E64D	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	64					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						GCTACCCTGAGCGCCAGTATA	0.652																																							uc001seu.2		NA																	0				ovary(1)	1						c.(190-192)GAG>GAT		homeobox C4							79.0	88.0	85.0					12																	54447898		2203	4300	6503	SO:0001583	missense	3221					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54447898G>T		CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.192G>T	12.37:g.54447898G>T	ENSP00000399808:p.Glu64Asp					HOXC4_uc001sex.2_Missense_Mutation_p.E64D	p.E64D	NM_014620	NP_055435	P09017	HXC4_HUMAN			3	872	+			64						Missense_Mutation	SNP	ENST00000430889.2	37	c.192G>T	CCDS8873.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.773774	0.49786	.	.	ENSG00000198353	ENST00000303406;ENST00000430889	T;T	0.80566	-1.39;-1.39	3.95	3.95	0.45737	.	0.000000	0.85682	D	0.000000	D	0.87489	0.6190	M	0.70842	2.15	0.80722	D	1	D	0.58970	0.984	D	0.65443	0.935	D	0.87438	0.2393	10	0.41790	T	0.15	.	15.2809	0.73784	0.0:0.0:1.0:0.0	.	64	P09017	HXC4_HUMAN	D	64	ENSP00000305973:E64D;ENSP00000399808:E64D	ENSP00000305973:E64D	E	+	3	2	HOXC4	52734165	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.450000	0.35134	2.187000	0.69744	0.462000	0.41574	GAG		0.652	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1			27	116	1	0	2.14196e-07	0.007291	3.03518e-07	27	116				
C12orf66	144577	broad.mit.edu	37	12	64588160	64588160	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:64588160G>C	ENST00000398055.3	-	3	853	c.800C>G	c.(799-801)gCc>gGc	p.A267G	C12orf66_ENST00000311915.8_Missense_Mutation_p.A267G|C12orf66_ENST00000544871.1_Missense_Mutation_p.A214G	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	267										central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						GCTAAACTTGGCAAGAAGCAT	0.458																																							uc001srw.3		NA																	0				ovary(1)	1						c.(799-801)GCC>GGC		hypothetical protein LOC144577							89.0	84.0	85.0					12																	64588160		1902	4111	6013	SO:0001583	missense	144577							g.chr12:64588160G>C		CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.800C>G	12.37:g.64588160G>C	ENSP00000381132:p.Ala267Gly					C12orf66_uc009zql.2_Missense_Mutation_p.A214G	p.A267G	NM_152440	NP_689653	Q96MD2	CL066_HUMAN			3	859	-			267					C9JX54|Q8IYA0	Missense_Mutation	SNP	ENST00000398055.3	37	c.800C>G	CCDS41803.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039026	0.55003	.	.	ENSG00000174206	ENST00000311915;ENST00000544871;ENST00000398055	T;T;T	0.52754	0.65;0.65;0.65	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.65502	0.2697	L	0.52364	1.645	0.80722	D	1	D;B	0.67145	0.996;0.129	D;B	0.75484	0.986;0.066	T	0.59247	-0.7490	9	.	.	.	-21.113	20.3591	0.98849	0.0:0.0:1.0:0.0	.	214;267	F5H2Q3;Q96MD2	.;CL066_HUMAN	G	267;214;267	ENSP00000311486:A267G;ENSP00000445481:A214G;ENSP00000381132:A267G	.	A	-	2	0	C12orf66	62874427	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	9.787000	0.99055	2.816000	0.96949	0.561000	0.74099	GCC		0.458	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400921.1	NM_152440		19	78	0	0	0	0.010504	0	19	78				
LGR5	8549	broad.mit.edu	37	12	71977581	71977581	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:71977581G>T	ENST00000266674.5	+	18	2102	c.1791G>T	c.(1789-1791)ggG>ggT	p.G597G	RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000536515.1_Silent_p.G525G|LGR5_ENST00000540815.2_Silent_p.G573G			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	597					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						TGTTAATTGGGGTCATCGCAG	0.502																																							uc001swl.2		NA																	0				lung(4)|skin(3)|ovary(1)|pancreas(1)	9						c.(1789-1791)GGG>GGT		leucine-rich repeat-containing G protein-coupled							161.0	135.0	144.0					12																	71977581		2203	4300	6503	SO:0001819	synonymous_variant	8549					integral to plasma membrane	protein-hormone receptor activity	g.chr12:71977581G>T	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.1791G>T	12.37:g.71977581G>T						LGR5_uc001swm.2_Silent_p.G573G|LGR5_uc001swn.1_RNA	p.G597G	NM_003667	NP_003658	O75473	LGR5_HUMAN			18	1839	+			597			Helical; Name=2; (Potential).		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Silent	SNP	ENST00000266674.5	37	c.1791G>T	CCDS9000.1																																																																																				0.502	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667		22	90	1	0	1.10513e-12	0.002299	1.88231e-12	22	90				
SLC6A15	55117	broad.mit.edu	37	12	85279265	85279265	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:85279265G>T	ENST00000266682.5	-	4	1064	c.523C>A	c.(523-525)Caa>Aaa	p.Q175K	SLC6A15_ENST00000552192.1_Missense_Mutation_p.Q68K|SLC6A15_ENST00000450363.3_Missense_Mutation_p.Q175K|SLC6A15_ENST00000551388.1_Intron	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	175					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						GGCAGGGGTTGCTGAAAAGAC	0.363																																							uc001szv.2		NA																	0				pancreas(2)|ovary(1)	3						c.(523-525)CAA>AAA		solute carrier family 6, member 15 isoform 1							93.0	92.0	92.0					12																	85279265		2203	4300	6503	SO:0001583	missense	55117				cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity	g.chr12:85279265G>T	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.523C>A	12.37:g.85279265G>T	ENSP00000266682:p.Gln175Lys					SLC6A15_uc010sul.1_Missense_Mutation_p.Q68K|SLC6A15_uc001szy.2_Missense_Mutation_p.Q175K	p.Q175K	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN			4	1016	-			175			Extracellular (Potential).		A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	37	c.523C>A	CCDS9026.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309816	0.40895	.	.	ENSG00000072041	ENST00000266682;ENST00000552192;ENST00000450363	T;T;T	0.73789	-0.78;-0.78;-0.78	5.02	4.13	0.48395	.	0.315963	0.34828	N	0.003651	T	0.56217	0.1970	N	0.08118	0	0.41624	D	0.988987	B;B	0.17465	0.02;0.022	B;B	0.25987	0.065;0.063	T	0.50890	-0.8774	10	0.25751	T	0.34	.	13.7564	0.62940	0.0749:0.0:0.9251:0.0	.	175;175	Q9H9F5;Q9H2J7	.;S6A15_HUMAN	K	175;68;175	ENSP00000266682:Q175K;ENSP00000450145:Q68K;ENSP00000390706:Q175K	ENSP00000266682:Q175K	Q	-	1	0	SLC6A15	83803396	1.000000	0.71417	0.975000	0.42487	0.970000	0.65996	3.131000	0.50515	1.266000	0.44231	0.585000	0.79938	CAA		0.363	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767		9	46	1	0	0.00829132	0.008291	0.00914858	9	46				
SLC17A8	246213	broad.mit.edu	37	12	100784891	100784891	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:100784891C>A	ENST00000323346.5	+	3	780	c.467C>A	c.(466-468)gCt>gAt	p.A156D	SLC17A8_ENST00000392989.3_Missense_Mutation_p.A156D	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	156					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						AAGTTTGCTGCTAACAGGTAA	0.388																																							uc010svi.1		NA																	0				ovary(3)	3						c.(466-468)GCT>GAT		solute carrier family 17 (sodium-dependent							97.0	96.0	96.0					12																	100784891		2203	4300	6503	SO:0001583	missense	246213				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity	g.chr12:100784891C>A	AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.467C>A	12.37:g.100784891C>A	ENSP00000316909:p.Ala156Asp					SLC17A8_uc009ztx.2_Missense_Mutation_p.A156D	p.A156D	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN			3	780	+			156			Helical; (Potential).		B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	ENST00000323346.5	37	c.467C>A	CCDS9077.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743784	0.89663	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.59906	0.23;0.23	5.24	5.24	0.73138	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.83820	0.5337	H	0.95079	3.62	0.80722	D	1	D;D	0.71674	0.983;0.998	D;D	0.76575	0.958;0.988	D	0.88668	0.3193	10	0.87932	D	0	.	19.2121	0.93760	0.0:1.0:0.0:0.0	.	156;156	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	D	156	ENSP00000316909:A156D;ENSP00000376715:A156D	ENSP00000316909:A156D	A	+	2	0	SLC17A8	99309022	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.236000	0.78154	2.610000	0.88304	0.655000	0.94253	GCT		0.388	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319		16	76	1	0	5.01169e-05	0.00499	6.22361e-05	16	76				
STAB2	55576	broad.mit.edu	37	12	104056673	104056673	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:104056673C>A	ENST00000388887.2	+	18	2123	c.1919C>A	c.(1918-1920)gCc>gAc	p.A640D		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GAGATCACTGCCAAAAATGGC	0.423																																							uc001tjw.2		NA																	0				ovary(9)|skin(5)	14						c.(1918-1920)GCC>GAC		stabilin 2 precursor							144.0	136.0	139.0					12																	104056673		2203	4300	6503	SO:0001583	missense	55576				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	g.chr12:104056673C>A	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.1919C>A	12.37:g.104056673C>A	ENSP00000373539:p.Ala640Asp						p.A640D	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN			18	2105	+			640			Extracellular (Potential).|FAS1 2.			Missense_Mutation	SNP	ENST00000388887.2	37	c.1919C>A	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.624121	0.87560	.	.	ENSG00000136011	ENST00000388887	D	0.92249	-3.0	5.31	5.31	0.75309	FAS1 domain (5);	0.000000	0.85682	D	0.000000	D	0.96297	0.8792	M	0.84219	2.685	0.58432	D	0.999996	D	0.89917	1.0	D	0.72338	0.977	D	0.96600	0.9444	10	0.66056	D	0.02	.	18.6129	0.91293	0.0:1.0:0.0:0.0	.	640	Q8WWQ8	STAB2_HUMAN	D	640	ENSP00000373539:A640D	ENSP00000373539:A640D	A	+	2	0	STAB2	102580803	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	4.855000	0.62925	2.478000	0.83669	0.655000	0.94253	GCC		0.423	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			20	92	1	0	1.55795e-14	0.001882	2.8002e-14	20	92				
STAB2	55576	broad.mit.edu	37	12	104089331	104089331	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:104089331C>A	ENST00000388887.2	+	32	3583	c.3379C>A	c.(3379-3381)Ctg>Atg	p.L1127M		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TTTTCAGGTGCTGGTCCCACA	0.468																																							uc001tjw.2		NA																	0				ovary(9)|skin(5)	14						c.(3379-3381)CTG>ATG		stabilin 2 precursor							141.0	138.0	139.0					12																	104089331		2203	4300	6503	SO:0001583	missense	55576				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	g.chr12:104089331C>A	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.3379C>A	12.37:g.104089331C>A	ENSP00000373539:p.Leu1127Met						p.L1127M	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN			32	3565	+			1127			Extracellular (Potential).|FAS1 3.			Missense_Mutation	SNP	ENST00000388887.2	37	c.3379C>A	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.102684	0.56183	.	.	ENSG00000136011	ENST00000388887	D	0.96365	-3.99	6.17	6.17	0.99709	FAS1 domain (5);Growth factor, receptor (1);	0.000000	0.64402	D	0.000002	D	0.98692	0.9561	M	0.93197	3.39	0.45515	D	0.998479	D	0.89917	1.0	D	0.97110	1.0	D	0.98776	1.0730	10	0.54805	T	0.06	.	19.0599	0.93085	0.0:1.0:0.0:0.0	.	1127	Q8WWQ8	STAB2_HUMAN	M	1127	ENSP00000373539:L1127M	ENSP00000373539:L1127M	L	+	1	2	STAB2	102613461	0.999000	0.42202	0.998000	0.56505	0.182000	0.23217	2.957000	0.49137	2.941000	0.99782	0.655000	0.94253	CTG		0.468	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			6	63	1	0	3.59834e-05	0.001168	4.47662e-05	6	63				
FOXN4	121643	broad.mit.edu	37	12	109724509	109724509	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:109724509T>A	ENST00000299162.5	-	7	741	c.637A>T	c.(637-639)Agc>Tgc	p.S213C	FOXN4_ENST00000355216.1_Missense_Mutation_p.S33C	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	213					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(9)|ovary(2)	16						ACAGGCAGGCTGCCTGTCTTG	0.617																																							uc001toe.3		NA																	0				ovary(1)|lung(1)	2						c.(637-639)AGC>TGC		forkhead box N4							96.0	70.0	79.0					12																	109724509		2203	4300	6503	SO:0001583	missense	121643				axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr12:109724509T>A	AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.637A>T	12.37:g.109724509T>A	ENSP00000299162:p.Ser213Cys					FOXN4_uc009zvg.2_Missense_Mutation_p.S10C|FOXN4_uc001tof.3_Missense_Mutation_p.S33C	p.S213C	NM_213596	NP_998761	Q96NZ1	FOXN4_HUMAN			7	742	-			213			Fork-head.		Q6ZMR4|Q96NZ0	Missense_Mutation	SNP	ENST00000299162.5	37	c.637A>T	CCDS9126.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.53|17.53	3.412146|3.412146	0.62511|0.62511	.|.	.|.	ENSG00000139445|ENSG00000139445	ENST00000266856|ENST00000355216;ENST00000299162	.|D;D	.|0.95656	.|-3.77;-3.77	4.4|4.4	4.4|4.4	0.53042|0.53042	.|Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92469|0.92469	0.7609|0.7609	N|N	0.17901|0.17901	0.54|0.54	0.80722|0.80722	D|D	1|1	.|P;P	.|0.34662	.|0.462;0.462	.|B;B	.|0.43536	.|0.423;0.37	D|D	0.92186|0.92186	0.5755|0.5755	6|10	0.87932|0.49607	D|T	0|0.09	-18.553|-18.553	13.13|13.13	0.59375|0.59375	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|213;213	.|A6H901;Q96NZ1	.|.;FOXN4_HUMAN	L|C	171|33;213	.|ENSP00000347354:S33C;ENSP00000299162:S213C	ENSP00000266856:Q171L|ENSP00000299162:S213C	Q|S	-|-	2|1	0|0	FOXN4|FOXN4	108208892|108208892	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	8.004000|8.004000	0.88535|0.88535	1.764000|1.764000	0.52075|0.52075	0.402000|0.402000	0.26972|0.26972	CAG|AGC		0.617	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328306.1	XM_062735		7	17	0	0	0	0.001984	0	7	17				
NOS1	4842	broad.mit.edu	37	12	117662918	117662919	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:117662918_117662919CC>AA	ENST00000338101.4	-	25	3834_3835	c.3830_3831GG>TT	c.(3829-3831)cGG>cTT	p.R1277L	NOS1_ENST00000317775.6_Missense_Mutation_p.R1243L|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	67					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CTTGGGGGTTCCGGGGCAGGTG	0.545																																					Esophageal Squamous(162;1748 2599 51982 52956)	Esophageal Squamous(162;1748 2599 51982 52956)	uc001twm.1		NA																	0				ovary(3)|skin(3)|pancreas(1)	7						c.(3727-3729)CGG>CTT		nitric oxide synthase 1, neuronal	L-Citrulline(DB00155)																																			SO:0001583	missense	4842				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding	g.chr12:117662918_117662919CC>AA		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3830_3831delinsAA	12.37:g.117662918_117662919delinsAA	ENSP00000337459:p.Arg1277Leu						p.R1243L	NM_000620	NP_000611	P29475	NOS1_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0561)	25	4414_4415	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		1243						Missense_Mutation	DNP	ENST00000338101.4	37	c.3728_3729GG>TT	CCDS55890.1																																																																																				0.545	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1			21	99	0	0	0	0.004672	0	21	99				
EP400	57634	broad.mit.edu	37	12	132466659	132466659	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:132466659A>T	ENST00000333577.4	+	6	1782	c.1673A>T	c.(1672-1674)cAg>cTg	p.Q558L	EP400_ENST00000330386.6_Missense_Mutation_p.Q522L|EP400_ENST00000332482.4_Missense_Mutation_p.Q485L|EP400_ENST00000389562.2_Missense_Mutation_p.Q521L|EP400_ENST00000389561.2_Missense_Mutation_p.Q522L			Q96L91	EP400_HUMAN	E1A binding protein p400	558					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CCCACGCCGCAGGCCGCGCAG	0.602																																							uc001ujn.2		NA																	0				central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12						c.(1564-1566)CAG>CTG		E1A binding protein p400							114.0	130.0	124.0					12																	132466659		2187	4263	6450	SO:0001583	missense	57634				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity	g.chr12:132466659A>T	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.1673A>T	12.37:g.132466659A>T	ENSP00000333602:p.Gln558Leu					EP400_uc001ujl.2_Missense_Mutation_p.Q521L|EP400_uc001ujm.2_Missense_Mutation_p.Q522L|EP400_uc001ujj.1_Missense_Mutation_p.Q485L|EP400_uc001ujk.2_Missense_Mutation_p.Q558L	p.Q522L	NM_015409	NP_056224	Q96L91	EP400_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)	4	1600	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)	558					O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37	c.1565A>T		.	.	.	.	.	.	.	.	.	.	A	13.38	2.218446	0.39201	.	.	ENSG00000183495	ENST00000537902;ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000423130;ENST00000541296;ENST00000542457	D;D;D;D;D	0.92595	-3.07;-2.99;-2.99;-2.67;-2.97	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.95284	0.8470	M	0.67953	2.075	0.46609	D	0.999122	P;P;P;D;D	0.69078	0.873;0.873;0.873;0.997;0.959	P;P;P;D;P	0.81914	0.599;0.599;0.599;0.995;0.714	D	0.95640	0.8697	10	0.66056	D	0.02	.	15.3687	0.74545	1.0:0.0:0.0:0.0	.	522;522;521;558;485	Q96L91-2;Q96L91-4;Q96L91-5;F8WCN8;Q96L91-3	.;.;.;.;.	L	485;558;522;521;485;522;558;522;522	ENSP00000333602:Q558L;ENSP00000374212:Q522L;ENSP00000374213:Q521L;ENSP00000331737:Q485L;ENSP00000330620:Q522L	ENSP00000330620:Q522L	Q	+	2	0	EP400	131032612	1.000000	0.71417	0.927000	0.36925	0.430000	0.31655	8.923000	0.92808	2.030000	0.59900	0.383000	0.25322	CAG		0.602	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409		33	184	0	0	0	0.003755	0	33	184				
FREM2	341640	broad.mit.edu	37	13	39343846	39343846	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr13:39343846G>A	ENST00000280481.7	+	4	5758	c.5542G>A	c.(5542-5544)Gag>Aag	p.E1848K		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1848	Calx-beta 1.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGGGGAGCATGAGCAGTCTGA	0.552																																							uc001uwv.2		NA																	0				ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11						c.(5542-5544)GAG>AAG		FRAS1-related extracellular matrix protein 2							147.0	118.0	128.0					13																	39343846		2203	4300	6503	SO:0001583	missense	341640				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr13:39343846G>A	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5542G>A	13.37:g.39343846G>A	ENSP00000280481:p.Glu1848Lys					FREM2_uc001uww.2_5'UTR	p.E1848K	NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)	4	5851	+		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)	1848			Calx-beta 1.|Extracellular (Potential).		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	c.5542G>A	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844739	0.71603	.	.	ENSG00000150893	ENST00000280481	T	0.61274	0.12	5.0	5.0	0.66597	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	D	0.82857	0.5128	H	0.94964	3.605	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.88206	0.2887	10	0.72032	D	0.01	.	18.3219	0.90241	0.0:0.0:1.0:0.0	.	1848	Q5SZK8	FREM2_HUMAN	K	1848	ENSP00000280481:E1848K	ENSP00000280481:E1848K	E	+	1	0	FREM2	38241846	1.000000	0.71417	0.177000	0.23020	0.045000	0.14185	9.869000	0.99810	2.315000	0.78130	0.585000	0.79938	GAG		0.552	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		5	35	0	0	0	0.000602	0	5	35				
NALCN	259232	broad.mit.edu	37	13	101944629	101944630	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr13:101944629_101944630CC>AA	ENST00000251127.6	-	8	968_969	c.887_888GG>TT	c.(886-888)tGG>tTT	p.W296F	NALCN_ENST00000376196.3_Missense_Mutation_p.W296F|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	296					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.W296*(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AGTAGGAACGCCAACGGGGAAA	0.455																																							uc001vox.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(886-888)TGG>TTT		voltage gated channel like 1																																				SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101944629_101944630CC>AA	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.887_888delinsAA	13.37:g.101944629_101944630delinsAA	ENSP00000251127:p.Trp296Phe					NALCN_uc001voy.2_Missense_Mutation_p.W11F|NALCN_uc001voz.2_Missense_Mutation_p.W296F|NALCN_uc001vpa.2_Missense_Mutation_p.W296F	p.W296F	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN			8	1076_1077	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		296			Extracellular (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	DNP	ENST00000251127.6	37	c.887_888GG>TT	CCDS9498.1																																																																																				0.455	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		13	20	0	0	0	0.004672	0	13	20				
SLC10A2	6555	broad.mit.edu	37	13	103705019	103705019	+	Missense_Mutation	SNP	C	C	A	rs143232105		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr13:103705019C>A	ENST00000245312.3	-	3	1132	c.536G>T	c.(535-537)gGa>gTa	p.G179V		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	179					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	AACAAACATTCCAATGGAAAC	0.388																																							uc001vpy.3		NA																	0				ovary(3)|skin(1)	4						c.(535-537)GGA>GTA		solute carrier family 10 (sodium/bile acid							201.0	186.0	191.0					13																	103705019		2203	4300	6503	SO:0001583	missense	6555				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity	g.chr13:103705019C>A	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.536G>T	13.37:g.103705019C>A	ENSP00000245312:p.Gly179Val						p.G179V	NM_000452	NP_000443	Q12908	NTCP2_HUMAN			3	1133	-	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)		179			Extracellular (Potential).		A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	37	c.536G>T	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.033048	0.75504	.	.	ENSG00000125255	ENST00000245312	T	0.76060	-0.99	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.92335	0.7568	H	0.98388	4.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94930	0.8081	10	0.87932	D	0	-8.3567	19.6679	0.95900	0.0:1.0:0.0:0.0	.	179	Q12908	NTCP2_HUMAN	V	179	ENSP00000245312:G179V	ENSP00000245312:G179V	G	-	2	0	SLC10A2	102503020	1.000000	0.71417	0.994000	0.49952	0.613000	0.37349	6.209000	0.72171	2.650000	0.89964	0.563000	0.77884	GGA		0.388	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1			14	48	1	0	1.36491e-13	0.001855	2.40267e-13	14	48				
OR11G2	390439	broad.mit.edu	37	14	20665591	20665591	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:20665591A>T	ENST00000357366.3	+	1	97	c.97A>T	c.(97-99)Agg>Tgg	p.R33W		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TACAATTCACAGGCACATGAA	0.448																																							uc010tlb.1		NA																	0				ovary(1)|skin(1)	2						c.(97-99)AGG>TGG		olfactory receptor, family 11, subfamily G,							50.0	45.0	47.0					14																	20665591		2203	4300	6503	SO:0001583	missense	390439				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20665591A>T		CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.97A>T	14.37:g.20665591A>T	ENSP00000349930:p.Arg33Trp						p.R33W	NM_001005503	NP_001005503	Q8NGC1	O11G2_HUMAN	Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)	1	97	+	all_cancers(95;0.00108)		33			Extracellular (Potential).		Q6IF09|Q96R33	Missense_Mutation	SNP	ENST00000357366.3	37	c.97A>T	CCDS32032.1	.	.	.	.	.	.	.	.	.	.	G	8.867	0.948242	0.18356	.	.	ENSG00000196832	ENST00000357366	T	0.00620	6.17	4.89	2.48	0.30137	.	5.794660	0.01159	U	0.006587	T	0.00637	0.0021	N	0.08118	0	0.09310	N	1	D	0.54047	0.964	B	0.43754	0.43	T	0.46247	-0.9205	10	0.62326	D	0.03	.	4.3437	0.11122	0.6743:0.1269:0.0757:0.1231	.	33	Q8NGC1	O11G2_HUMAN	W	33	ENSP00000349930:R33W	ENSP00000349930:R33W	R	+	1	2	OR11G2	19735431	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.576000	0.23744	0.045000	0.15804	-1.552000	0.00895	AGG		0.448	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395722.1			6	22	0	0	0	0.001984	0	6	22				
OR11G2	390439	broad.mit.edu	37	14	20665719	20665719	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:20665719G>T	ENST00000357366.3	+	1	225	c.225G>T	c.(223-225)ctG>ctT	p.L75L		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TTTACCTCCTGACCCTCATGG	0.562																																							uc010tlb.1		NA																	0				ovary(1)|skin(1)	2						c.(223-225)CTG>CTT		olfactory receptor, family 11, subfamily G,							109.0	89.0	96.0					14																	20665719		2203	4300	6503	SO:0001819	synonymous_variant	390439				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20665719G>T		CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.225G>T	14.37:g.20665719G>T							p.L75L	NM_001005503	NP_001005503	Q8NGC1	O11G2_HUMAN	Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)	1	225	+	all_cancers(95;0.00108)		75			Helical; Name=1; (Potential).		Q6IF09|Q96R33	Silent	SNP	ENST00000357366.3	37	c.225G>T	CCDS32032.1																																																																																				0.562	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395722.1			18	73	1	0	8.00594e-06	0.007413	1.05561e-05	18	73				
TEP1	7011	broad.mit.edu	37	14	20849471	20849471	+	Splice_Site	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:20849471C>A	ENST00000262715.5	-	32	4688		c.e32+1		TEP1_ENST00000556935.1_Splice_Site|TEP1_ENST00000545983.1_Splice_Site	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1						RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TAGGAACTAACCAGGTGGTAA	0.557																																							uc001vxe.2		NA																	0				ovary(5)	5						c.e32+1		telomerase-associated protein 1							193.0	187.0	189.0					14																	20849471		2203	4300	6503	SO:0001630	splice_region_variant	7011				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding	g.chr14:20849471C>A		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.4647+1G>T	14.37:g.20849471C>A						TEP1_uc010ahk.2_Splice_Site_p.L892_splice|TEP1_uc010tlf.1_Splice_Site|TEP1_uc010tlg.1_Splice_Site_p.L1441_splice|TEP1_uc010tlh.1_Splice_Site	p.L1549_splice	NM_007110	NP_009041	Q99973	TEP1_HUMAN	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)	32	4687	-	all_cancers(95;0.00123)	all_lung(585;0.235)						A0AUV9	Splice_Site	SNP	ENST00000262715.5	37	c.4647_splice	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.215976	0.58452	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5264	0.75910	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TEP1	19919311	1.000000	0.71417	0.996000	0.52242	0.598000	0.36846	5.102000	0.64572	2.735000	0.93741	0.655000	0.94253	.		0.557	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	Intron	49	147	1	0	2.73381e-35	0.00361	5.85326e-35	49	147				
ARHGEF40	55701	broad.mit.edu	37	14	21549125	21549125	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:21549125G>T	ENST00000298694.4	+	13	2717	c.2590G>T	c.(2590-2592)Gtt>Ttt	p.V864F	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.V864F			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	864						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						GCTGGAGCAGGTTGAGAGTGG	0.607																																							uc001vzp.2		NA																	0					0						c.(2590-2592)GTT>TTT		hypothetical protein LOC55701							86.0	88.0	87.0					14																	21549125		2203	4300	6503	SO:0001583	missense	55701				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity	g.chr14:21549125G>T		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.2590G>T	14.37:g.21549125G>T	ENSP00000298694:p.Val864Phe					FLJ10357_uc001vzo.1_5'UTR|FLJ10357_uc010aij.2_RNA|FLJ10357_uc010tln.1_Missense_Mutation_p.V150F	p.V864F	NM_018071	NP_060541	Q8TER5	ARH40_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)	13	2619	+	all_cancers(95;0.00185)		864			Potential.		A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	37	c.2590G>T	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.791618	0.50102	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.02258	4.43;4.37	5.62	3.79	0.43588	.	0.284783	0.25164	N	0.032649	T	0.01627	0.0052	N	0.14661	0.345	0.22811	N	0.998709	B;P	0.42039	0.435;0.769	B;B	0.38056	0.264;0.249	T	0.50457	-0.8826	10	0.59425	D	0.04	.	7.6793	0.28505	0.1848:0.0:0.8152:0.0	.	864;864	Q8TER5-4;Q8TER5	.;ARH40_HUMAN	F	864	ENSP00000298694:V864F;ENSP00000298693:V864F	ENSP00000298693:V864F	V	+	1	0	ARHGEF40	20618965	0.923000	0.31300	0.961000	0.40146	0.932000	0.56968	1.350000	0.34010	1.368000	0.46115	0.555000	0.69702	GTT		0.607	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1			21	113	1	0	1.85244e-09	0.00333	2.88204e-09	21	113				
TINF2	26277	broad.mit.edu	37	14	24709508	24709508	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:24709508G>A	ENST00000267415.7	-	7	1431	c.1090C>T	c.(1090-1092)Ctg>Ttg	p.L364L	TINF2_ENST00000540705.1_Silent_p.L329L|TINF2_ENST00000538777.1_3'UTR|TINF2_ENST00000399423.4_3'UTR|TINF2_ENST00000558566.1_3'UTR|TINF2_ENST00000558510.1_5'Flank	NM_001099274.1	NP_001092744.1	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	364					negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of protein ADP-ribosylation (GO:0010836)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of telomere maintenance (GO:0032206)|protein localization to chromosome (GO:0034502)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinucleolar chromocenter (GO:0010370)	telomeric DNA binding (GO:0042162)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|prostate(1)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0185)		GATAGTCTCAGGGGGTCCATG	0.502									Congenital Dyskeratosis;Ataxia Pancytopenia syndrome																														uc001woa.3		NA																	0					0						c.(1090-1092)CTG>TTG		TERF1 (TRF1)-interacting nuclear factor 2							86.0	84.0	85.0					14																	24709508		1936	4153	6089	SO:0001819	synonymous_variant	26277	Ataxia_Pancytopenia_syndrome|Congenital_Dyskeratosis	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita;Myelocerebellar disorder	negative regulation of epithelial cell proliferation|negative regulation of protein ADP-ribosylation|negative regulation of telomere maintenance via telomerase|positive regulation of telomere maintenance|protein localization to chromosome, telomeric region|telomere assembly|telomere maintenance via telomere lengthening	nuclear telomere cap complex|nucleoplasm|perinucleolar chromocenter	protein binding|protein binding|telomeric DNA binding	g.chr14:24709508G>A	AF195512	CCDS41936.1, CCDS41937.1	14q12	2008-07-29				ENSG00000092330			11824	protein-coding gene	gene with protein product		604319				10581025, 18252230	Standard	NM_012461		Approved	TIN2	uc001woa.4	Q9BSI4		ENST00000267415.7:c.1090C>T	14.37:g.24709508G>A						TINF2_uc010alm.2_3'UTR|TINF2_uc001wob.3_3'UTR|TINF2_uc010tof.1_Silent_p.L329L|TINF2_uc001woc.3_3'UTR	p.L364L	NM_001099274	NP_001092744	Q9BSI4	TINF2_HUMAN		GBM - Glioblastoma multiforme(265;0.0185)	7	1432	-			364					B3W5Q7|Q9H904|Q9UHC2	Silent	SNP	ENST00000267415.7	37	c.1090C>T	CCDS41936.1																																																																																				0.502	TINF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415406.2			6	67	0	0	0	0.001984	0	6	67				
TGM1	7051	broad.mit.edu	37	14	24724007	24724007	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:24724007C>A	ENST00000206765.6	-	13	2074	c.1951G>T	c.(1951-1953)Gcc>Tcc	p.A651S	TGM1_ENST00000544573.1_Missense_Mutation_p.A209S	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	651					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	TCCTTGTAGGCCACTGGCATG	0.627																																							uc001wod.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1951-1953)GCC>TCC		transglutaminase 1	L-Glutamine(DB00130)						67.0	59.0	62.0					14																	24724007		2203	4300	6503	SO:0001583	missense	7051				cell envelope organization|keratinization|peptide cross-linking	cornified envelope|intrinsic to membrane	acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity	g.chr14:24724007C>A	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.1951G>T	14.37:g.24724007C>A	ENSP00000206765:p.Ala651Ser					TGM1_uc010tog.1_Missense_Mutation_p.A209S	p.A651S	NM_000359	NP_000350	P22735	TGM1_HUMAN		GBM - Glioblastoma multiforme(265;0.0186)	13	2075	-			651					B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	c.1951G>T	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	C	5.616	0.298469	0.10622	.	.	ENSG00000092295	ENST00000206765;ENST00000544573	T;T	0.65916	-0.18;-0.18	5.17	4.27	0.50696	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.424313	0.27831	N	0.017678	T	0.38108	0.1028	N	0.17474	0.49	0.29105	N	0.881257	B	0.12013	0.005	B	0.12837	0.008	T	0.23833	-1.0177	10	0.08837	T	0.75	-30.135	6.4244	0.21762	0.1827:0.7275:0.0:0.0897	.	651	P22735	TGM1_HUMAN	S	651;209	ENSP00000206765:A651S;ENSP00000439446:A209S	ENSP00000206765:A651S	A	-	1	0	TGM1	23793847	0.145000	0.22656	1.000000	0.80357	0.976000	0.68499	-0.342000	0.07801	1.380000	0.46344	0.655000	0.94253	GCC		0.627	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359		13	40	1	0	7.03913e-09	0.001368	1.06838e-08	13	40				
AKAP6	9472	broad.mit.edu	37	14	33014693	33014693	+	Silent	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:33014693T>A	ENST00000280979.4	+	4	1004	c.834T>A	c.(832-834)gcT>gcA	p.A278A	AKAP6_ENST00000557354.1_Silent_p.A278A|AKAP6_ENST00000557272.1_Silent_p.A278A	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	278					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TTACGGTAGCTGCTGACTCTA	0.453																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	0				breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(832-834)GCT>GCA		A-kinase anchor protein 6							135.0	121.0	126.0					14																	33014693		2203	4300	6503	SO:0001819	synonymous_variant	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33014693T>A	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.834T>A	14.37:g.33014693T>A						AKAP6_uc010aml.2_Silent_p.A275A	p.A278A	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	4	1004	+	Breast(36;0.0388)|Prostate(35;0.15)		278					A7E242|A7E2D4|O15028	Silent	SNP	ENST00000280979.4	37	c.834T>A	CCDS9644.1																																																																																				0.453	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		28	84	0	0	0	0.009535	0	28	84				
NPAS3	64067	broad.mit.edu	37	14	33684570	33684570	+	Missense_Mutation	SNP	A	A	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:33684570A>C	ENST00000356141.4	+	3	323	c.323A>C	c.(322-324)aAc>aCc	p.N108T	NPAS3_ENST00000357798.5_Missense_Mutation_p.N78T|NPAS3_ENST00000341321.4_Missense_Mutation_p.N108T|NPAS3_ENST00000346562.2_Missense_Mutation_p.N78T|NPAS3_ENST00000551008.1_Missense_Mutation_p.N6T|NPAS3_ENST00000547068.1_Missense_Mutation_p.N6T|NPAS3_ENST00000548645.1_Missense_Mutation_p.N78T|NPAS3_ENST00000551492.1_Missense_Mutation_p.N115T			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	108					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GACTTTGCTAACCAGGGGGAC	0.478																																							uc001wru.2		NA																	0				ovary(1)|skin(1)	2						c.(322-324)AAC>ACC		neuronal PAS domain protein 3 isoform 3							122.0	120.0	121.0					14																	33684570		2203	4300	6503	SO:0001583	missense	64067				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity	g.chr14:33684570A>C	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.323A>C	14.37:g.33684570A>C	ENSP00000348460:p.Asn108Thr					NPAS3_uc001wrs.2_Missense_Mutation_p.N78T|NPAS3_uc001wrt.2_Missense_Mutation_p.N78T|NPAS3_uc001wrv.2_Missense_Mutation_p.N78T|NPAS3_uc001wrw.2_Missense_Mutation_p.N6T	p.N108T	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)	3	387	+	Breast(36;0.0102)|Hepatocellular(127;0.133)		108					Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	37	c.323A>C	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	A	11.22	1.575196	0.28092	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000341321;ENST00000548645;ENST00000356141;ENST00000357798;ENST00000547068;ENST00000551008;ENST00000546849	T;T;T;T;T;T;T	0.45668	3.51;3.39;3.4;0.89;3.39;3.38;3.26	5.83	5.83	0.93111	Helix-loop-helix DNA-binding (2);	0.155671	0.41294	D	0.000919	T	0.23410	0.0566	N	0.05351	-0.065	0.36847	D	0.887716	B;B;B;B;B	0.17465	0.001;0.012;0.007;0.012;0.022	B;B;B;B;B	0.21917	0.015;0.037;0.017;0.037;0.037	T	0.24119	-1.0169	10	0.23891	T	0.37	.	10.5261	0.44950	0.928:0.0:0.072:0.0	.	6;78;108;78;78	F8W0C2;Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;.;NPAS3_HUMAN;.;.	T	85;115;78;108;78;108;78;6;6;18	ENSP00000448373:N85T;ENSP00000450392:N115T;ENSP00000319610:N78T;ENSP00000344158:N108T;ENSP00000448916:N78T;ENSP00000348460:N108T;ENSP00000350446:N78T	ENSP00000344158:N108T	N	+	2	0	NPAS3	32754321	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.214000	0.65236	2.225000	0.72522	0.460000	0.39030	AAC		0.478	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1			24	67	0	0	0	0.00333	0	24	67				
BAZ1A	11177	broad.mit.edu	37	14	35243648	35243648	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:35243648G>T	ENST00000382422.2	-	18	3209	c.2882C>A	c.(2881-2883)tCc>tAc	p.S961Y	BAZ1A_ENST00000360310.1_Missense_Mutation_p.S961Y|BAZ1A_ENST00000358716.4_Missense_Mutation_p.S929Y			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	961					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		ATATGCATTGGAAGATCTTCC	0.333																																							uc001wsk.2		NA																	0				lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7						c.(2881-2883)TCC>TAC		bromodomain adjacent to zinc finger domain, 1A							130.0	126.0	127.0					14																	35243648		2203	4300	6503	SO:0001583	missense	11177				chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding	g.chr14:35243648G>T	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.2882C>A	14.37:g.35243648G>T	ENSP00000371859:p.Ser961Tyr					BAZ1A_uc001wsl.2_Missense_Mutation_p.S929Y	p.S961Y	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)	19	3450	-	Breast(36;0.0388)|Hepatocellular(127;0.158)		961					Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	ENST00000382422.2	37	c.2882C>A	CCDS9651.1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.796197	0.31777	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	T;T;T	0.73469	-0.75;-0.75;-0.75	5.5	5.5	0.81552	.	0.236274	0.35349	N	0.003279	T	0.67887	0.2941	L	0.50333	1.59	0.20764	N	0.999857	P;P	0.50710	0.923;0.938	B;B	0.43413	0.419;0.328	T	0.67894	-0.5552	10	0.66056	D	0.02	.	7.6038	0.28091	0.0819:0.0:0.7088:0.2093	.	929;961	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	Y	929;961;961;613	ENSP00000351555:S929Y;ENSP00000371859:S961Y;ENSP00000353458:S961Y	ENSP00000351555:S929Y	S	-	2	0	BAZ1A	34313399	0.997000	0.39634	0.992000	0.48379	0.454000	0.32378	1.490000	0.35573	2.596000	0.87737	0.650000	0.86243	TCC		0.333	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1			16	93	1	0	5.03518e-11	0.007413	8.14936e-11	16	93				
RALGAPA1	253959	broad.mit.edu	37	14	36225998	36225998	+	Splice_Site	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:36225998C>A	ENST00000389698.3	-	7	1054		c.e7+1		RALGAPA1_ENST00000382366.3_Splice_Site|RALGAPA1_ENST00000554704.1_Splice_Site|RALGAPA1_ENST00000258840.6_Splice_Site|SNORA31_ENST00000517250.1_RNA|RALGAPA1_ENST00000307138.6_Splice_Site	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)						activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ATAACAAGTACCTGAATGACT	0.373																																							uc001wti.2		NA																	0				ovary(3)|breast(1)	4						c.e7+1		Ral GTPase activating protein, alpha subunit 1							147.0	143.0	144.0					14																	36225998		2203	4300	6503	SO:0001630	splice_region_variant	253959				activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity	g.chr14:36225998C>A	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.663+1G>T	14.37:g.36225998C>A						RALGAPA1_uc001wtj.2_Splice_Site_p.Q221_splice|RALGAPA1_uc010tpv.1_Splice_Site_p.Q221_splice|RALGAPA1_uc010tpw.1_Splice_Site_p.Q221_splice|RALGAPA1_uc001wtk.1_Splice_Site_p.Q72_splice	p.Q221_splice	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN			7	1054	-								A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Splice_Site	SNP	ENST00000389698.3	37	c.663_splice	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.328613	0.81690	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3713	0.94488	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RALGAPA1	35295749	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.629000	0.83207	2.650000	0.89964	0.563000	0.77884	.		0.373	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	Intron	3	53	1	0	0.004672	0.004672	0.00517176	3	53				
MIPOL1	145282	broad.mit.edu	37	14	37754522	37754522	+	Splice_Site	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:37754522G>T	ENST00000327441.7	+	8	959		c.e8-1		MIPOL1_ENST00000556451.1_Splice_Site|MIPOL1_ENST00000536774.1_Splice_Site|MIPOL1_ENST00000537471.1_Splice_Site|MIPOL1_ENST00000396294.2_Splice_Site|MIPOL1_ENST00000545536.1_Splice_Site|MIPOL1_ENST00000539062.2_Splice_Site	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1							nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		TATTTTGGTAGCTCTGGTTGA	0.358																																							uc001wuc.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.e8-1		mirror-image polydactyly 1							192.0	185.0	187.0					14																	37754522		2203	4300	6503	SO:0001630	splice_region_variant	145282							g.chr14:37754522G>T	AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.494-1G>T	14.37:g.37754522G>T						MIPOL1_uc010amr.2_Intron|MIPOL1_uc001wub.3_Splice_Site_p.A134_splice|MIPOL1_uc001wud.2_Splice_Site_p.A165_splice|MIPOL1_uc010ams.2_Splice_Site_p.A165_splice|MIPOL1_uc001wue.2_Splice_Site_p.A134_splice|MIPOL1_uc010amt.2_Splice_Site	p.A165_splice	NM_138731	NP_620059	Q8TD10	MIPO1_HUMAN	Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)	8	997	+	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)							D3DSA4|Q7Z3J0|Q8IV14	Splice_Site	SNP	ENST00000327441.7	37	c.494_splice	CCDS9664.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.594154	0.46214	.	.	ENSG00000151338	ENST00000327441;ENST00000539062;ENST00000556451;ENST00000396294;ENST00000537471;ENST00000545536	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1734	0.93590	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MIPOL1	36824273	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	7.679000	0.84048	2.539000	0.85634	0.561000	0.74099	.		0.358	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276734.1	NM_138731	Intron	28	98	1	0	1.39649e-27	0.002445	2.92577e-27	28	98				
LRFN5	145581	broad.mit.edu	37	14	42355965	42355965	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:42355965C>A	ENST00000298119.4	+	3	1326	c.137C>A	c.(136-138)cCa>cAa	p.P46Q	LRFN5_ENST00000554120.1_Missense_Mutation_p.P46Q|LRFN5_ENST00000554171.1_Missense_Mutation_p.P46Q	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	46	LRRNT.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TTATTTGTTCCACCAAACATT	0.408										HNSCC(30;0.082)																													uc001wvm.2		NA																	0				ovary(5)|pancreas(2)|central_nervous_system(1)	8						c.(136-138)CCA>CAA		leucine rich repeat and fibronectin type III							77.0	68.0	71.0					14																	42355965		2203	4300	6503	SO:0001583	missense	145581					integral to membrane		g.chr14:42355965C>A	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.137C>A	14.37:g.42355965C>A	ENSP00000298119:p.Pro46Gln	HNSCC(30;0.082)				LRFN5_uc010ana.2_Missense_Mutation_p.P46Q	p.P46Q	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	3	1335	+			46			Extracellular (Potential).|LRRNT.		B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	c.137C>A	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.522189	0.64747	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.60171	0.21;0.21;0.21	5.56	5.56	0.83823	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.56097	D	0.000029	T	0.77253	0.4103	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79829	-0.1638	10	0.87932	D	0	.	17.0193	0.86429	0.0:1.0:0.0:0.0	.	46;46	G3V364;Q96NI6	.;LRFN5_HUMAN	Q	46	ENSP00000298119:P46Q;ENSP00000451897:P46Q;ENSP00000451067:P46Q	ENSP00000298119:P46Q	P	+	2	0	LRFN5	41425715	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.595000	0.87683	0.650000	0.86243	CCA		0.408	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		9	35	1	0	0.00448238	0.004482	0.00499424	9	35				
SLC38A6	145389	broad.mit.edu	37	14	61451499	61451499	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:61451499G>T	ENST00000267488.4	+	3	404	c.288G>T	c.(286-288)ctG>ctT	p.L96L	RP11-193F5.1_ENST00000553946.1_RNA|SLC38A6_ENST00000354886.2_Silent_p.L96L|SLC38A6_ENST00000456840.2_Silent_p.L73L|SLC38A6_ENST00000554304.1_3'UTR	NM_153811.2	NP_722518.2	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6	96					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		TCCATCTTCTGCTTAGTATGT	0.383																																							uc001xfg.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(286-288)CTG>CTT		solute carrier family 38, member 6							183.0	168.0	173.0					14																	61451499		2203	4300	6503	SO:0001819	synonymous_variant	145389				amino acid transport|sodium ion transport	integral to membrane		g.chr14:61451499G>T	AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335	ENST00000267488.4:c.288G>T	14.37:g.61451499G>T						SLC38A6_uc001xfh.1_Silent_p.L96L|SLC38A6_uc001xfi.2_RNA|SLC38A6_uc001xfj.1_RNA|SLC38A6_uc001xfk.2_RNA|SLC38A6_uc010trz.1_Silent_p.L73L	p.L96L	NM_153811	NP_722518	Q8IZM9	S38A6_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0981)	3	404	+			96			Helical; (Potential).		C9JWA6|Q86SY5	Silent	SNP	ENST00000267488.4	37	c.288G>T	CCDS9751.1	.	.	.	.	.	.	.	.	.	.	G	9.322	1.058314	0.19987	.	.	ENSG00000139974	ENST00000533744	.	.	.	5.93	2.73	0.32206	.	.	.	.	.	T	0.61426	0.2346	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58137	-0.7689	4	.	.	.	-1.332	11.1311	0.48347	0.0653:0.0:0.6929:0.2418	.	.	.	.	F	45	.	.	C	+	2	0	SLC38A6	60521252	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.297000	0.33400	0.802000	0.34089	-0.148000	0.13756	TGC		0.383	SLC38A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276957.1			20	77	1	0	2.39556e-15	0.00278	4.38652e-15	20	77				
BTBD7	55727	broad.mit.edu	37	14	93712551	93712551	+	Missense_Mutation	SNP	C	C	A	rs190609675	byFrequency	TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:93712551C>A	ENST00000334746.5	-	10	2510	c.2203G>T	c.(2203-2205)Gta>Tta	p.V735L	BTBD7_ENST00000554565.1_Missense_Mutation_p.V384L|BTBD7_ENST00000393170.2_Missense_Mutation_p.V309L	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	735					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GTACTGTTTACGCGACATCTC	0.473																																							uc001ybo.2		NA																	0				pancreas(1)	1						c.(2203-2205)GTA>TTA		BTB (POZ) domain containing 7 isoform 1							125.0	123.0	124.0					14																	93712551		2203	4300	6503	SO:0001583	missense	55727							g.chr14:93712551C>A	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.2203G>T	14.37:g.93712551C>A	ENSP00000335615:p.Val735Leu					BTBD7_uc010aur.2_Missense_Mutation_p.V260L|BTBD7_uc010two.1_Missense_Mutation_p.V555L|BTBD7_uc001ybp.2_Missense_Mutation_p.V384L	p.V735L	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)	10	2529	-		all_cancers(154;0.08)	735					A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Missense_Mutation	SNP	ENST00000334746.5	37	c.2203G>T	CCDS32146.1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.499732	0.44455	.	.	ENSG00000011114	ENST00000334746;ENST00000554565;ENST00000553975;ENST00000393170	T;T	0.56275	0.83;0.47	5.75	2.88	0.33553	.	0.164028	0.53938	D	0.000045	T	0.37571	0.1008	N	0.24115	0.695	0.48975	D	0.999732	B;B;B	0.33198	0.401;0.208;0.056	B;B;B	0.35240	0.198;0.074;0.038	T	0.16424	-1.0403	10	0.54805	T	0.06	.	9.0671	0.36469	0.0:0.7269:0.0:0.2731	.	309;384;735	E7ERI4;Q9P203-5;Q9P203	.;.;BTBD7_HUMAN	L	735;384;350;309	ENSP00000335615:V735L;ENSP00000451010:V384L	ENSP00000335615:V735L	V	-	1	0	BTBD7	92782304	0.975000	0.34042	0.349000	0.25694	0.822000	0.46500	2.385000	0.44371	0.322000	0.23283	-0.312000	0.09012	GTA		0.473	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860		35	102	1	0	1.45844e-13	0.002836	2.5411e-13	35	102				
UNC79	57578	broad.mit.edu	37	14	94089109	94089109	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:94089109G>T	ENST00000393151.2	+	30	5530	c.5530G>T	c.(5530-5532)Gct>Tct	p.A1844S	UNC79_ENST00000553484.1_Missense_Mutation_p.A1866S|UNC79_ENST00000256339.4_Missense_Mutation_p.A1667S|UNC79_ENST00000555664.1_Missense_Mutation_p.A1844S			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1844					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GAGGAAGATTGCTGTCAGTGC	0.468																																							uc001ybv.1		NA																	0				ovary(10)|skin(4)|large_intestine(3)	17						c.(5065-5067)GCT>TCT		hypothetical protein LOC57578							80.0	74.0	76.0					14																	94089109		2203	4300	6503	SO:0001583	missense	57578					integral to membrane		g.chr14:94089109G>T	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.5530G>T	14.37:g.94089109G>T	ENSP00000376858:p.Ala1844Ser					KIAA1409_uc001ybs.1_Missense_Mutation_p.A1667S	p.A1689S	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	28	5148	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	1844					B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37	c.5065G>T		.	.	.	.	.	.	.	.	.	.	G	20.2	3.957418	0.73902	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.28069	1.7;1.63;1.7;1.69	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.45577	0.1349	L	0.32530	0.975	0.53005	D	0.999969	D	0.71674	0.998	D	0.66084	0.941	T	0.22277	-1.0221	10	0.41790	T	0.15	-15.4333	19.535	0.95247	0.0:0.0:1.0:0.0	.	1866	C9JQL1	.	S	1667;1844;1866;1844;1866	ENSP00000256339:A1667S;ENSP00000450868:A1844S;ENSP00000451360:A1866S;ENSP00000376858:A1844S	ENSP00000256339:A1667S	A	+	1	0	KIAA1409	93158862	1.000000	0.71417	0.842000	0.33263	0.970000	0.65996	9.476000	0.97823	2.629000	0.89072	0.484000	0.47621	GCT		0.468	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		10	32	1	0	1.58986e-06	0.008291	2.1588e-06	10	32				
UNC79	57578	broad.mit.edu	37	14	94156483	94156483	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:94156483G>T	ENST00000393151.2	+	46	7223	c.7223G>T	c.(7222-7224)tGt>tTt	p.C2408F	UNC79_ENST00000553484.1_Missense_Mutation_p.C2430F|UNC79_ENST00000256339.4_Missense_Mutation_p.C2231F|UNC79_ENST00000555664.1_Missense_Mutation_p.C2369F			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2408					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TTCATTGAGTGTGTCTCCCAT	0.448																																							uc001ybv.1		NA																	0				ovary(10)|skin(4)|large_intestine(3)	17						c.(6757-6759)TGT>TTT		hypothetical protein LOC57578							176.0	155.0	162.0					14																	94156483		2203	4300	6503	SO:0001583	missense	57578					integral to membrane		g.chr14:94156483G>T	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.7223G>T	14.37:g.94156483G>T	ENSP00000376858:p.Cys2408Phe					KIAA1409_uc001ybs.1_Missense_Mutation_p.C2231F	p.C2253F	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	44	6841	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	2408					B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37	c.6758G>T		.	.	.	.	.	.	.	.	.	.	G	24.0	4.484169	0.84854	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.23348	1.92;1.95;1.91;1.92	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.54078	0.1836	M	0.72118	2.19	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.51919	-0.8644	10	0.87932	D	0	-13.3695	20.5632	0.99335	0.0:0.0:1.0:0.0	.	2430	C9JQL1	.	F	2231;2369;2430;2408;2430	ENSP00000256339:C2231F;ENSP00000450868:C2369F;ENSP00000451360:C2430F;ENSP00000376858:C2408F	ENSP00000256339:C2231F	C	+	2	0	KIAA1409	93226236	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.813000	0.99286	2.937000	0.99478	0.650000	0.86243	TGT		0.448	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		21	61	1	0	3.62473e-10	0.001882	5.73077e-10	21	61				
SYNE3	161176	broad.mit.edu	37	14	95922038	95922038	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:95922038C>A	ENST00000334258.5	-	5	827	c.813G>T	c.(811-813)agG>agT	p.R271S	SYNE3_ENST00000553340.1_Missense_Mutation_p.R271S|SYNE3_ENST00000554873.1_Missense_Mutation_p.R28S|SYNE3_ENST00000557275.1_Missense_Mutation_p.R271S	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	271					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						ACTCCTCGCCCCTGGGAAAAT	0.532																																							uc001yei.3		NA																	0				central_nervous_system(1)	1						c.(811-813)AGG>AGT		nesprin-3							58.0	63.0	61.0					14																	95922038		2203	4300	6503	SO:0001583	missense	161176				cytoskeletal anchoring at nuclear membrane	integral to membrane|nuclear outer membrane|SUN-KASH complex	actin binding	g.chr14:95922038C>A	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.813G>T	14.37:g.95922038C>A	ENSP00000334308:p.Arg271Ser					C14orf49_uc010avi.2_Missense_Mutation_p.R271S|C14orf49_uc001yej.1_Missense_Mutation_p.R271S	p.R271S	NM_152592	NP_689805	Q6ZMZ3	SYNE3_HUMAN		COAD - Colon adenocarcinoma(157;0.245)	5	828	-		all_cancers(154;0.0937)	271			Spectrin 1.|Cytoplasmic (Potential).		A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	37	c.813G>T	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	C	1.067	-0.671116	0.03403	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275;ENST00000553340	T;T;T;T	0.14022	3.59;2.54;3.59;3.0	4.99	-0.395	0.12431	.	0.530375	0.15856	N	0.241257	T	0.07863	0.0197	L	0.42245	1.32	0.27361	N	0.955953	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.08055	0.002;0.003;0.001	T	0.37798	-0.9690	10	0.09084	T	0.74	-10.792	2.9988	0.06007	0.3281:0.2558:0.3297:0.0864	.	271;271;271	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	S	271;28;271;271	ENSP00000334308:R271S;ENSP00000452154:R28S;ENSP00000450562:R271S;ENSP00000450774:R271S	ENSP00000334308:R271S	R	-	3	2	C14orf49	94991791	0.020000	0.18652	0.152000	0.22495	0.019000	0.09904	0.135000	0.15952	0.489000	0.27749	-0.519000	0.04390	AGG		0.532	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592		10	79	1	0	2.17888e-05	0.006214	2.75588e-05	10	79				
CINP	51550	broad.mit.edu	37	14	102829188	102829188	+	Start_Codon_SNP	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:102829188T>C	ENST00000216756.6	-	1	41	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	TECPR2_ENST00000359520.7_5'Flank|CINP_ENST00000541568.2_Start_Codon_SNP_p.M1V|TECPR2_ENST00000558678.1_5'Flank|CINP_ENST00000536961.2_5'Flank	NM_032630.2	NP_116019.1	Q9BW66	CINP_HUMAN	cyclin-dependent kinase 2 interacting protein	1					cell cycle (GO:0007049)|cell division (GO:0051301)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	nucleus (GO:0005634)				large_intestine(2)|lung(2)	4						GCACCTTCCATAAGGTCCACA	0.622																																							uc001ylv.1		NA																	0				large_intestine(1)	1						c.(1-3)ATG>GTG		cyclin-dependent kinase 2-interacting protein							88.0	80.0	83.0					14																	102829188		2203	4300	6503	SO:0001582	initiator_codon_variant	51550				cell cycle|cell division|DNA repair|DNA replication	nucleus	protein binding	g.chr14:102829188T>C	AK056112, AF228148, AF228149	CCDS9972.1	14q32.33	2010-02-17			ENSG00000100865	ENSG00000100865			23789	protein-coding gene	gene with protein product		613362				16082200	Standard	NM_032630		Approved	MGC849	uc021sea.1	Q9BW66		ENST00000216756.6:c.1A>G	14.37:g.102829188T>C	ENSP00000216756:p.Met1Val					TECPR2_uc010txw.1_5'Flank|TECPR2_uc010awl.2_5'Flank|TECPR2_uc001ylw.1_5'Flank|TECPR2_uc010txx.1_5'Flank	p.M1V	NM_032630	NP_116019	Q9BW66	CINP_HUMAN			1	66	-			1					F5H7P3|F5H8A7|Q9NPF9	Missense_Mutation	SNP	ENST00000216756.6	37	c.1A>G	CCDS9972.1	.	.	.	.	.	.	.	.	.	.	T	8.663	0.900944	0.17760	.	.	ENSG00000100865	ENST00000216756;ENST00000541568	T	0.46451	0.87	3.03	3.03	0.35002	.	1.489770	0.04590	N	0.396613	T	0.38161	0.1030	.	.	.	0.80722	D	1	B	0.22146	0.065	B	0.27170	0.077	T	0.38824	-0.9643	9	0.72032	D	0.01	0.5644	7.8657	0.29535	0.0:0.0:0.0:1.0	.	1	Q9BW66	CINP_HUMAN	V	1	ENSP00000216756:M1V	ENSP00000216756:M1V	M	-	1	0	CINP	101898941	.	.	0.944000	0.38274	0.089000	0.18198	.	.	1.623000	0.50342	0.416000	0.27883	ATG		0.622	CINP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415055.1	NM_032630	Missense_Mutation	5	34	0	0	0	0.000602	0	5	34				
TECPR2	9895	broad.mit.edu	37	14	102891368	102891368	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr14:102891368C>G	ENST00000359520.7	+	6	917	c.691C>G	c.(691-693)Cta>Gta	p.L231V	TECPR2_ENST00000561228.1_3'UTR|TECPR2_ENST00000558678.1_Missense_Mutation_p.L231V	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	231					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						GCAAAGTGATCTAACCTTGTA	0.448																																							uc001ylw.1		NA																	0				lung(1)|central_nervous_system(1)|skin(1)	3						c.(691-693)CTA>GTA		tectonin beta-propeller repeat containing 2							105.0	114.0	111.0					14																	102891368		2203	4300	6503	SO:0001583	missense	9895						protein binding	g.chr14:102891368C>G	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.691C>G	14.37:g.102891368C>G	ENSP00000352510:p.Leu231Val					TECPR2_uc010txw.1_3'UTR|TECPR2_uc010awl.2_Missense_Mutation_p.L231V|TECPR2_uc010txx.1_Intron	p.L231V	NM_014844	NP_055659	O15040	TCPR2_HUMAN			6	839	+			231					A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	37	c.691C>G	CCDS32162.1	.	.	.	.	.	.	.	.	.	.	c	17.50	3.405785	0.62288	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	T	0.23552	1.9	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.36358	0.0964	L	0.38175	1.15	0.29312	N	0.867921	P;D	0.89917	0.954;1.0	P;D	0.80764	0.796;0.994	T	0.11036	-1.0604	10	0.10111	T	0.7	.	14.0067	0.64468	0.0:0.9249:0.0:0.0751	.	231;231	A5PKY3;O15040	.;TCPR2_HUMAN	V	231	ENSP00000352510:L231V	ENSP00000352510:L231V	L	+	1	2	TECPR2	101961121	1.000000	0.71417	0.978000	0.43139	0.953000	0.61014	3.240000	0.51368	2.419000	0.82065	0.552000	0.68991	CTA		0.448	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844		29	77	0	0	0	0.003271	0	29	77				
OCA2	4948	broad.mit.edu	37	15	28096612	28096612	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:28096612G>T	ENST00000354638.3	-	22	2409	c.2254C>A	c.(2254-2256)Ctc>Atc	p.L752I	OCA2_ENST00000353809.5_Missense_Mutation_p.L728I	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	752					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		AGGTTCAGGAGCACGGGAATC	0.572									Oculocutaneous Albinism																														uc001zbh.3		NA																	0				ovary(3)|breast(1)|pancreas(1)	5						c.(2254-2256)CTC>ATC		oculocutaneous albinism II							59.0	44.0	49.0					15																	28096612		2200	4300	6500	SO:0001583	missense	4948	Oculocutaneous_Albinism	Familial Cancer Database		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding	g.chr15:28096612G>T		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.2254C>A	15.37:g.28096612G>T	ENSP00000346659:p.Leu752Ile					OCA2_uc010ayv.2_Missense_Mutation_p.L728I	p.L752I	NM_000275	NP_000266	Q04671	P_HUMAN		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)	22	2364	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	752			Cytoplasmic (Potential).		Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	c.2254C>A	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620404	0.46736	.	.	ENSG00000104044	ENST00000354638;ENST00000353809	D;D	0.81579	-1.51;-1.51	4.91	4.91	0.64330	.	0.065669	0.64402	D	0.000007	T	0.62877	0.2464	N	0.03930	-0.32	0.80722	D	1	B;B	0.15473	0.013;0.008	B;B	0.28305	0.036;0.088	T	0.59069	-0.7523	10	0.14252	T	0.57	-11.8046	15.9762	0.80066	0.0:0.0:1.0:0.0	.	728;752	Q04671-2;Q04671	.;P_HUMAN	I	752;728	ENSP00000346659:L752I;ENSP00000261276:L728I	ENSP00000261276:L728I	L	-	1	0	OCA2	25770207	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.117000	0.71577	2.424000	0.82194	0.650000	0.86243	CTC		0.572	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275		4	13	1	0	2.56e-06	0.009096	3.43513e-06	4	13				
PGBD4	161779	broad.mit.edu	37	15	34396468	34396468	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:34396468A>T	ENST00000397766.2	+	1	2195	c.1736A>T	c.(1735-1737)tAc>tTc	p.Y579F	EMC7_ENST00000532113.1_5'Flank|EMC7_ENST00000256545.4_5'Flank	NM_152595.4	NP_689808.2	Q96DM1	PGBD4_HUMAN	piggyBac transposable element derived 4	579										breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)|prostate(1)	16		all_lung(180;1.76e-08)		all cancers(64;1.22e-17)|GBM - Glioblastoma multiforme(113;1.78e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0242)		TTTGAAATTTACCACACGAAA	0.393																																							uc001zho.2		NA																	0					0						c.(1735-1737)TAC>TTC		piggyBac transposable element derived 4							107.0	92.0	97.0					15																	34396468		2201	4298	6499	SO:0001583	missense	161779							g.chr15:34396468A>T	AK057200	CCDS10033.1	15q13.1	2002-10-25			ENSG00000182405	ENSG00000182405			19401	protein-coding gene	gene with protein product							Standard	NM_152595		Approved	FLJ32638, FLJ37497	uc001zho.3	Q96DM1	OTTHUMG00000129370	ENST00000397766.2:c.1736A>T	15.37:g.34396468A>T	ENSP00000380872:p.Tyr579Phe					C15orf24_uc001zhm.2_5'Flank|C15orf24_uc001zhn.2_5'Flank	p.Y579F	NM_152595	NP_689808	Q96DM1	PGBD4_HUMAN		all cancers(64;1.22e-17)|GBM - Glioblastoma multiforme(113;1.78e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0242)	1	2195	+		all_lung(180;1.76e-08)	579					A1L487|A8K0C6|Q8N9E8	Missense_Mutation	SNP	ENST00000397766.2	37	c.1736A>T	CCDS10033.1	.	.	.	.	.	.	.	.	.	.	a	14.60	2.584324	0.46110	.	.	ENSG00000182405	ENST00000397766	T	0.21932	1.98	1.16	-2.1	0.07210	.	0.883647	0.08904	N	0.876810	T	0.29491	0.0735	L	0.51914	1.62	0.20489	N	0.999891	D	0.89917	1.0	D	0.74674	0.984	T	0.21042	-1.0257	10	0.26408	T	0.33	.	2.1287	0.03745	0.5485:0.0:0.1978:0.2537	.	579	Q96DM1	PGBD4_HUMAN	F	579	ENSP00000380872:Y579F	ENSP00000380872:Y579F	Y	+	2	0	PGBD4	32183760	0.972000	0.33761	0.023000	0.16930	0.362000	0.29581	-0.023000	0.12456	-0.625000	0.05604	0.255000	0.18592	TAC		0.393	PGBD4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251522.1			21	50	0	0	0	0.00278	0	21	50				
AQR	9716	broad.mit.edu	37	15	35202392	35202392	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:35202392C>T	ENST00000156471.5	-	17	1832	c.1607G>A	c.(1606-1608)cGt>cAt	p.R536H		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	536					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		AACATCTGCACGAACTCGGGT	0.448																																							uc001ziv.2		NA																	0				large_intestine(1)	1						c.(1606-1608)CGT>CAT		aquarius							167.0	160.0	162.0					15																	35202392		1936	4137	6073	SO:0001583	missense	9716					catalytic step 2 spliceosome	RNA binding	g.chr15:35202392C>T	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1607G>A	15.37:g.35202392C>T	ENSP00000156471:p.Arg536His						p.R536H	NM_014691	NP_055506	O60306	AQR_HUMAN		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)	17	1788	-		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)	536					A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	c.1607G>A	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	C	33	5.201654	0.94997	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.94280	-3.39	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.97745	0.9260	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	D	0.97967	1.0341	10	0.52906	T	0.07	-15.7749	19.5095	0.95135	0.0:1.0:0.0:0.0	.	536	O60306	AQR_HUMAN	H	536	ENSP00000156471:R536H	ENSP00000156471:R536H	R	-	2	0	AQR	32989684	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.725000	0.84808	2.616000	0.88540	0.585000	0.79938	CGT		0.448	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691		26	101	0	0	0	0.008361	0	26	101				
UBR1	197131	broad.mit.edu	37	15	43374882	43374882	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:43374882C>G	ENST00000290650.4	-	3	449	c.371G>C	c.(370-372)tGt>tCt	p.C124S	UBR1_ENST00000382177.2_Missense_Mutation_p.C124S	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	124					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GCAGTCCATACAGAGTACACA	0.378																																							uc001zqq.2		NA																	0				lung(1)	1						c.(370-372)TGT>TCT		ubiquitin protein ligase E3 component n-recognin							134.0	118.0	124.0					15																	43374882		2203	4299	6502	SO:0001583	missense	197131				cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding	g.chr15:43374882C>G		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.371G>C	15.37:g.43374882C>G	ENSP00000290650:p.Cys124Ser					UBR1_uc010udk.1_Missense_Mutation_p.C124S	p.C124S	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)	3	437	-		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)	124			UBR-type.		O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	c.371G>C	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.886634	0.91814	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	D;D	0.97553	-4.43;-4.43	5.15	5.15	0.70609	Zinc finger, N-recognin, metazoa (1);Zinc finger, N-recognin (2);	0.000000	0.85682	D	0.000000	D	0.99121	0.9697	H	0.97340	3.985	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.966	D	0.99078	1.0836	10	0.87932	D	0	-11.3841	19.0482	0.93030	0.0:1.0:0.0:0.0	.	124;124	B4DYL2;Q8IWV7	.;UBR1_HUMAN	S	124	ENSP00000290650:C124S;ENSP00000371612:C124S	ENSP00000290650:C124S	C	-	2	0	UBR1	41162174	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.067000	0.76741	2.592000	0.87571	0.586000	0.80456	TGT		0.378	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916		4	54	0	0	0	0.009096	0	4	54				
SEMA6D	80031	broad.mit.edu	37	15	48053408	48053408	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:48053408C>A	ENST00000316364.5	+	5	775	c.336C>A	c.(334-336)ggC>ggA	p.G112G	SEMA6D_ENST00000536845.2_Silent_p.G112G|SEMA6D_ENST00000354744.4_Silent_p.G112G|SEMA6D_ENST00000389433.2_Silent_p.G112G|SEMA6D_ENST00000358066.4_Silent_p.G112G|SEMA6D_ENST00000558816.1_Silent_p.G112G|SEMA6D_ENST00000389432.2_Silent_p.G112G|SEMA6D_ENST00000389428.3_Silent_p.G112G|SEMA6D_ENST00000558014.1_Silent_p.G112G|SEMA6D_ENST00000355997.3_Silent_p.G112G|SEMA6D_ENST00000537942.1_Silent_p.G112G|SEMA6D_ENST00000389425.3_Silent_p.G112G	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	112	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CTATGAAAGGCAAGCATAAAG	0.373																																							uc010bek.2		NA																	0				skin(3)|breast(1)	4						c.(334-336)GGC>GGA		semaphorin 6D isoform 4 precursor							93.0	89.0	90.0					15																	48053408		2198	4297	6495	SO:0001819	synonymous_variant	80031				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity	g.chr15:48053408C>A	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.336C>A	15.37:g.48053408C>A						SEMA6D_uc001zvw.2_Silent_p.G112G|SEMA6D_uc001zvx.1_Silent_p.G112G|SEMA6D_uc001zvy.2_Silent_p.G112G|SEMA6D_uc001zvz.2_Silent_p.G112G|SEMA6D_uc001zwa.2_Silent_p.G112G|SEMA6D_uc001zwb.2_Silent_p.G112G|SEMA6D_uc001zwc.2_Silent_p.G112G	p.G112G	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)	5	696	+		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)	112			Sema.|Extracellular (Potential).		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	37	c.336C>A	CCDS32225.1																																																																																				0.373	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966		5	42	1	0	3.59834e-05	0.001168	4.47662e-05	5	42				
SLC12A1	6557	broad.mit.edu	37	15	48577447	48577447	+	Splice_Site	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:48577447G>T	ENST00000558405.1	+	20	2643		c.e20+1		SLC12A1_ENST00000380993.3_Splice_Site|SLC12A1_ENST00000396577.3_Splice_Site			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1						cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)	p.?(2)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	CCTAAAAAAGGTAAGAACTTT	0.368																																							uc001zwn.3		NA																	2	Unknown(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.e21+1		sodium potassium chloride cotransporter 2	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)						72.0	79.0	77.0					15																	48577447		2198	4297	6495	SO:0001630	splice_region_variant	6557				potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity	g.chr15:48577447G>T		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.2629+1G>T	15.37:g.48577447G>T						SLC12A1_uc001zwq.3_Splice_Site_p.D648_splice|SLC12A1_uc001zwr.3_Splice_Site_p.D604_splice	p.D877_splice	NM_000338	NP_000329	Q13621	S12A1_HUMAN		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	21	2845	+		all_lung(180;0.00219)						A8JYA2|E9PDW4	Splice_Site	SNP	ENST00000558405.1	37	c.2629_splice	CCDS10129.2	.	.	.	.	.	.	.	.	.	.	G	12.23	1.874372	0.33069	.	.	ENSG00000074803	ENST00000380993;ENST00000396577	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7885	0.96447	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC12A1	46364739	1.000000	0.71417	0.996000	0.52242	0.022000	0.10575	6.797000	0.75150	2.752000	0.94435	0.655000	0.94253	.		0.368	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1		Intron	19	51	1	0	4.96729e-08	0.008871	7.26479e-08	19	51				
CYP19A1	1588	broad.mit.edu	37	15	51514613	51514613	+	Silent	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:51514613C>G	ENST00000396402.1	-	5	714	c.561G>C	c.(559-561)gtG>gtC	p.V187V	RP11-108K3.1_ENST00000559909.1_lincRNA|CYP19A1_ENST00000557858.1_Silent_p.V187V|CYP19A1_ENST00000405913.3_Silent_p.V187V|CYP19A1_ENST00000260433.2_Silent_p.V187V|CYP19A1_ENST00000396404.4_Silent_p.V187V|CYP19A1_ENST00000559878.1_Silent_p.V187V	NM_000103.3	NP_000094.2	P11511	CP19A_HUMAN	cytochrome P450, family 19, subfamily A, polypeptide 1	187					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|prostate gland growth (GO:0060736)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)	aromatase activity (GO:0070330)|electron carrier activity (GO:0009055)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			endometrium(1)|kidney(4)|large_intestine(9)|lung(11)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	33				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)	GAAGGGTCAACACGTCCACAT	0.512																																					Melanoma(142;1016 1807 39614 48966 51721)	Melanoma(142;1016 1807 39614 48966 51721)	uc001zyz.3		NA																	0				skin(3)	3						c.(559-561)GTG>GTC		cytochrome P450, family 19	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)						183.0	137.0	153.0					15																	51514613		2196	4293	6489	SO:0001819	synonymous_variant	1588				estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity	g.chr15:51514613C>G	D14473	CCDS10139.1	15q21	2009-01-26	2003-02-14	2003-02-28	ENSG00000137869	ENSG00000137869		"""Cytochrome P450s"""	2594	protein-coding gene	gene with protein product		107910	"""cytochrome P450, subfamily XIX (aromatization of androgens)"""	CYP19		8477708	Standard	NM_031226		Approved	ARO, P-450AROM, CPV1, ARO1, CYAR, aromatase	uc001zza.4	P11511	OTTHUMG00000131747	ENST00000396402.1:c.561G>C	15.37:g.51514613C>G						CYP19A1_uc001zza.3_Silent_p.V187V|CYP19A1_uc001zzb.2_Silent_p.V187V|CYP19A1_uc001zzd.2_Silent_p.V187V|CYP19A1_uc010bey.1_Silent_p.V187V	p.V187V	NM_031226	NP_112503	P11511	CP19A_HUMAN		all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	6	812	-			187					Q16731|Q3B764|Q58FA0|Q8IYJ7	Silent	SNP	ENST00000396402.1	37	c.561G>C	CCDS10139.1																																																																																				0.512	CYP19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254669.1			10	39	0	0	0	0.000978	0	10	39				
NEDD4	4734	broad.mit.edu	37	15	56208095	56208095	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:56208095C>A	ENST00000508342.1	-	1	1234	c.935G>T	c.(934-936)gGc>gTc	p.G312V	NEDD4_ENST00000338963.2_Missense_Mutation_p.G312V|NEDD4_ENST00000435532.3_Intron|NEDD4_ENST00000506154.1_Missense_Mutation_p.G312V	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	312					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		AGCACTAGTGCCATCCTCATT	0.413																																							uc002adj.2		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(934-936)GGC>GTC		neural precursor cell expressed, developmentally							97.0	102.0	100.0					15																	56208095		2193	4291	6484	SO:0001583	missense	4734				development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity	g.chr15:56208095C>A	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.935G>T	15.37:g.56208095C>A	ENSP00000424827:p.Gly312Val					NEDD4_uc002adl.2_Intron|NEDD4_uc002adi.2_Missense_Mutation_p.G312V|NEDD4_uc010ugj.1_Missense_Mutation_p.G312V|NEDD4_uc010bfm.2_Missense_Mutation_p.G312V|NEDD4_uc002adk.2_RNA	p.G312V	NM_198400	NP_006145	P46934	NEDD4_HUMAN		all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)	1	1235	-			312					A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	ENST00000508342.1	37	c.935G>T		.	.	.	.	.	.	.	.	.	.	C	16.35	3.099704	0.56183	.	.	ENSG00000069869	ENST00000508342;ENST00000338963;ENST00000506154	T;T;T	0.44083	0.93;0.93;0.93	5.25	4.27	0.50696	.	0.453369	0.14155	U	0.337796	T	0.40448	0.1117	L	0.29908	0.895	0.44234	D	0.99707	D;D;D	0.61080	0.989;0.981;0.989	P;P;P	0.55923	0.787;0.617;0.787	T	0.27905	-1.0060	10	0.49607	T	0.09	.	4.5524	0.12120	0.0:0.6226:0.2025:0.1749	.	312;312;312	P46934-2;P46934;P46934-3	.;NEDD4_HUMAN;.	V	312	ENSP00000424827:G312V;ENSP00000345530:G312V;ENSP00000422705:G312V	ENSP00000345530:G312V	G	-	2	0	NEDD4	53995387	0.987000	0.35691	0.946000	0.38457	0.906000	0.53458	2.415000	0.44635	2.466000	0.83321	0.467000	0.42956	GGC		0.413	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400		11	97	1	0	6.40141e-05	0.000978	7.90626e-05	11	97				
CGNL1	84952	broad.mit.edu	37	15	57731566	57731566	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:57731566G>T	ENST00000281282.5	+	2	1447	c.1369G>T	c.(1369-1371)Gcc>Tcc	p.A457S		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	457	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		GGCTTCATGTGCCCACTCCAG	0.622																																							uc002aeg.2		NA																	0				skin(6)|ovary(4)|central_nervous_system(1)	11						c.(1369-1371)GCC>TCC		cingulin-like 1							35.0	35.0	35.0					15																	57731566		2192	4292	6484	SO:0001583	missense	84952					myosin complex|tight junction	motor activity	g.chr15:57731566G>T	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.1369G>T	15.37:g.57731566G>T	ENSP00000281282:p.Ala457Ser					CGNL1_uc010bfw.2_Missense_Mutation_p.A457S	p.A457S	NM_032866	NP_116255	Q0VF96	CGNL1_HUMAN		all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)	2	1445	+			457			Head.		Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	37	c.1369G>T	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	G	4.727	0.135141	0.09032	.	.	ENSG00000128849	ENST00000281282	T	0.08546	3.08	5.34	4.43	0.53597	.	60.414200	0.00166	N	0.000007	T	0.05318	0.0141	N	0.08118	0	0.09310	N	1	B	0.28820	0.224	B	0.24006	0.05	T	0.35847	-0.9772	10	0.16896	T	0.51	-4.3406	6.6264	0.22833	0.3051:0.0:0.6949:0.0	.	457	Q0VF96	CGNL1_HUMAN	S	457	ENSP00000281282:A457S	ENSP00000281282:A457S	A	+	1	0	CGNL1	55518858	0.020000	0.18652	0.002000	0.10522	0.023000	0.10783	2.019000	0.41001	1.256000	0.44068	0.609000	0.83330	GCC		0.622	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866		14	34	1	0	7.93312e-07	0.00245	1.09461e-06	14	34				
VPS13C	54832	broad.mit.edu	37	15	62161820	62161820	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:62161820C>G	ENST00000261517.5	-	80	10700	c.10627G>C	c.(10627-10629)Gcc>Ccc	p.A3543P	VPS13C_ENST00000395898.3_Missense_Mutation_p.A3500P|VPS13C_ENST00000249837.3_Missense_Mutation_p.A3500P|VPS13C_ENST00000395896.4_Missense_Mutation_p.A3543P	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TCCTTTTTGGCACCTTCAGAA	0.443																																							uc002agz.2		NA																	0				ovary(2)	2						c.(10627-10629)GCC>CCC		vacuolar protein sorting 13C protein isoform 2A							120.0	115.0	117.0					15																	62161820		2203	4300	6503	SO:0001583	missense	54832				protein localization			g.chr15:62161820C>G	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.10627G>C	15.37:g.62161820C>G	ENSP00000261517:p.Ala3543Pro					VPS13C_uc002aha.2_Missense_Mutation_p.A3500P|VPS13C_uc002ahb.1_Missense_Mutation_p.A3543P|VPS13C_uc002ahc.1_Missense_Mutation_p.A3500P	p.A3543P	NM_020821	NP_065872	Q709C8	VP13C_HUMAN			80	10701	-			3543						Missense_Mutation	SNP	ENST00000261517.5	37	c.10627G>C	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	C	35	5.528003	0.96446	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.62498	0.03;0.02;0.22	6.07	6.07	0.98685	Autophagy-related, C-terminal (1);	0.053642	0.64402	D	0.000001	D	0.86205	0.5877	H	0.94808	3.585	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.999	D	0.88661	0.3189	10	0.87932	D	0	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	3500;3543;3500;3543	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	P	3500;3543;3543;3543	ENSP00000249837:A3500P;ENSP00000261517:A3543P;ENSP00000379233:A3543P	ENSP00000249837:A3500P	A	-	1	0	VPS13C	59949112	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.811000	0.86092	2.885000	0.99019	0.655000	0.94253	GCC		0.443	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684		11	89	0	0	0	0.001368	0	11	89				
ZWILCH	55055	broad.mit.edu	37	15	66838952	66838952	+	Missense_Mutation	SNP	G	G	T	rs547318979		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:66838952G>T	ENST00000307897.5	+	18	2091	c.1711G>T	c.(1711-1713)Ggt>Tgt	p.G571C	ZWILCH_ENST00000565627.1_Missense_Mutation_p.G457C|ZWILCH_ENST00000535141.2_Missense_Mutation_p.G457C|ZWILCH_ENST00000446801.2_Missense_Mutation_p.G457C	NM_017975.3	NP_060445.3	Q9H900	ZWILC_HUMAN	zwilch kinetochore protein	571					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(1)|lung(6)|ovary(1)	18						AACACTAAACGGTAGCCTGGA	0.373																																							uc002aqb.2		NA																	0				ovary(1)	1						c.(1711-1713)GGT>TGT		Zwilch							103.0	100.0	101.0					15																	66838952		2201	4299	6500	SO:0001583	missense	55055				cell division|mitotic cell cycle checkpoint|mitotic prometaphase	condensed chromosome kinetochore|cytosol	protein binding	g.chr15:66838952G>T	AK023175	CCDS10219.1, CCDS73746.1	15q22.31	2013-01-17	2012-12-13		ENSG00000174442	ENSG00000174442			25468	protein-coding gene	gene with protein product		609984	"""Zwilch, kinetochore associated, homolog (Drosophila)"""			12686595	Standard	NM_017975		Approved	FLJ10036, KNTC1AP	uc002aqb.3	Q9H900	OTTHUMG00000133194	ENST00000307897.5:c.1711G>T	15.37:g.66838952G>T	ENSP00000311429:p.Gly571Cys					ZWILCH_uc010bhu.1_Missense_Mutation_p.G457C|ZWILCH_uc002aqa.2_Missense_Mutation_p.G457C|ZWILCH_uc010bhv.2_Missense_Mutation_p.G457C	p.G571C	NM_017975	NP_060445	Q9H900	ZWILC_HUMAN			18	1957	+			571					B3KVB8|Q6N049|Q8N404|Q96SY7|Q9NWG7	Missense_Mutation	SNP	ENST00000307897.5	37	c.1711G>T	CCDS10219.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780147	0.70222	.	.	ENSG00000174442	ENST00000307897;ENST00000446801;ENST00000535141	T;T;T	0.53857	0.6;0.6;0.6	5.63	-0.601	0.11638	.	0.429308	0.28612	N	0.014740	T	0.43033	0.1229	M	0.69823	2.125	0.22081	N	0.999376	P	0.45044	0.849	B	0.38327	0.271	T	0.38779	-0.9645	10	0.48119	T	0.1	-5.4926	6.1891	0.20513	0.3494:0.0:0.5304:0.1201	.	571	Q9H900	ZWILC_HUMAN	C	571;457;457	ENSP00000311429:G571C;ENSP00000402217:G457C;ENSP00000437749:G457C	ENSP00000311429:G571C	G	+	1	0	ZWILCH	64626006	0.948000	0.32251	0.012000	0.15200	0.941000	0.58515	1.378000	0.34328	0.054000	0.16065	0.555000	0.69702	GGT		0.373	ZWILCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256904.4	NM_017975		7	54	1	0	2.17888e-05	0.006214	2.75588e-05	7	54				
ISLR2	57611	broad.mit.edu	37	15	74427168	74427168	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:74427168G>C	ENST00000361742.3	+	4	2842	c.2073G>C	c.(2071-2073)caG>caC	p.Q691H	ISLR2_ENST00000419208.1_Missense_Mutation_p.Q691H|ISLR2_ENST00000445793.1_Missense_Mutation_p.Q691H|ISLR2_ENST00000453268.2_Missense_Mutation_p.Q691H|ISLR2_ENST00000435464.1_Missense_Mutation_p.Q691H|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000565540.1_Missense_Mutation_p.Q691H|ISLR2_ENST00000565159.1_Missense_Mutation_p.Q691H	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	691					positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						GGGACCTGCAGAGAGAGGAGA	0.687											OREG0023277	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002axd.2		NA																	0					0						c.(2071-2073)CAG>CAC		immunoglobulin superfamily containing							45.0	51.0	49.0					15																	74427168		2198	4297	6495	SO:0001583	missense	57611				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane		g.chr15:74427168G>C		CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.2073G>C	15.37:g.74427168G>C	ENSP00000355402:p.Gln691His		OREG0023277	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1152	ISLR2_uc002axe.2_Missense_Mutation_p.Q691H|ISLR2_uc010bjg.2_Missense_Mutation_p.Q691H|ISLR2_uc010bjf.2_Missense_Mutation_p.Q691H	p.Q691H	NM_001130136	NP_001123608	Q6UXK2	ISLR2_HUMAN			4	2842	+			691			Cytoplasmic (Potential).		A8K352|Q9P263	Missense_Mutation	SNP	ENST00000361742.3	37	c.2073G>C	CCDS10259.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.770841	0.49680	.	.	ENSG00000167178	ENST00000445793;ENST00000361742;ENST00000435464;ENST00000453268;ENST00000395121;ENST00000419208	T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45	4.41	4.41	0.53225	.	0.222331	0.36200	U	0.002740	T	0.33614	0.0869	N	0.19112	0.55	0.39324	D	0.965295	P	0.44877	0.845	B	0.34722	0.188	T	0.43410	-0.9393	10	0.87932	D	0	.	11.6597	0.51339	0.0:0.0:0.8216:0.1784	.	691	Q6UXK2	ISLR2_HUMAN	H	691;691;691;691;280;691	ENSP00000403244:Q691H;ENSP00000355402:Q691H;ENSP00000411443:Q691H;ENSP00000411834:Q691H;ENSP00000408872:Q691H	ENSP00000355402:Q691H	Q	+	3	2	ISLR2	72214221	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	5.031000	0.64134	1.994000	0.58287	0.313000	0.20887	CAG		0.687	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269046.1	NM_020851		3	42	0	0	0	0.004672	0	3	42				
CTSH	1512	broad.mit.edu	37	15	79229742	79229742	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:79229742C>T	ENST00000220166.5	-	3	256	c.147G>A	c.(145-147)gaG>gaA	p.E49E	CTSH_ENST00000534533.1_5'Flank	NM_004390.3	NP_004381.2	P09668	CATH_HUMAN	cathepsin H	49					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|bradykinin catabolic process (GO:0010815)|cellular response to thyroid hormone stimulus (GO:0097067)|dichotomous subdivision of terminal units involved in lung branching (GO:0060448)|ERK1 and ERK2 cascade (GO:0070371)|immune response-regulating signaling pathway (GO:0002764)|membrane protein proteolysis (GO:0033619)|metanephros development (GO:0001656)|negative regulation of apoptotic process (GO:0043066)|neuropeptide catabolic process (GO:0010813)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidase activity (GO:0010952)|protein destabilization (GO:0031648)|proteolysis (GO:0006508)|response to retinoic acid (GO:0032526)|spermatogenesis (GO:0007283)|surfactant homeostasis (GO:0043129)|T cell mediated cytotoxicity (GO:0001913)|zymogen activation (GO:0031638)	acrosomal vesicle (GO:0001669)|alveolar lamellar body (GO:0097208)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|outer dense fiber (GO:0001520)	aminopeptidase activity (GO:0004177)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)|HLA-A specific activating MHC class I receptor activity (GO:0030108)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|thyroid hormone binding (GO:0070324)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)	10						GGTGGTACTCCTCCGTACTGT	0.493																																							uc002ben.2		NA																	0				central_nervous_system(2)|large_intestine(1)	3						c.(109-111)GAG>GAA		cathepsin H isoform b precursor							174.0	147.0	156.0					15																	79229742		2196	4293	6489	SO:0001819	synonymous_variant	1512				protein destabilization|proteolysis	lysosome	cysteine-type endopeptidase activity	g.chr15:79229742C>T	X07549	CCDS10308.1	15q25.1	2014-01-28			ENSG00000103811	ENSG00000103811	3.4.22.16	"""Cathepsins"""	2535	protein-coding gene	gene with protein product		116820		CPSB		2849458	Standard	NM_004390		Approved	ACC-4, ACC-5	uc021srk.1	P09668	OTTHUMG00000144171	ENST00000220166.5:c.147G>A	15.37:g.79229742C>T						CTSH_uc010unf.1_RNA|CTSH_uc010bll.1_Intron|CTSH_uc010ung.1_Silent_p.E49E	p.E37E	NM_148979	NP_683880	P09668	CATH_HUMAN			4	208	-			49					B2RBK0|Q96NY6|Q9BUM7	Silent	SNP	ENST00000220166.5	37	c.111G>A	CCDS10308.1																																																																																				0.493	CTSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291370.1	NM_004390		13	39	0	0	0	0.00245	0	13	39				
RASGRF1	5923	broad.mit.edu	37	15	79294032	79294032	+	Silent	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:79294032G>C	ENST00000419573.3	-	17	2869	c.2595C>G	c.(2593-2595)ccC>ccG	p.P865P	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Silent_p.P849P|RASGRF1_ENST00000394745.3_Silent_p.P81P	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	865					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TGACTGATTTGGGTGTTGTTG	0.408																																							uc002beq.2		NA																	0				skin(4)|ovary(1)|central_nervous_system(1)	6						c.(2593-2595)CCC>CCG		Ras protein-specific guanine							266.0	241.0	249.0					15																	79294032		2196	4293	6489	SO:0001819	synonymous_variant	5923				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity	g.chr15:79294032G>C	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2595C>G	15.37:g.79294032G>C						RASGRF1_uc002bep.2_Silent_p.P849P|RASGRF1_uc010blm.1_Silent_p.P774P|RASGRF1_uc002ber.3_Silent_p.P849P|RASGRF1_uc010unh.1_Silent_p.P260P|RASGRF1_uc002beo.2_Silent_p.P81P	p.P865P	NM_002891	NP_002882	Q13972	RGRF1_HUMAN			17	2970	-			867					F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	ENST00000419573.3	37	c.2595C>G	CCDS10309.1																																																																																				0.408	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891		23	121	0	0	0	0.003954	0	23	121				
TMED3	23423	broad.mit.edu	37	15	79614470	79614470	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:79614470C>T	ENST00000299705.5	+	3	756	c.568C>T	c.(568-570)Ctg>Ttg	p.L190L	TMED3_ENST00000424155.2_Intron|TMED3_ENST00000536821.1_Intron|TMED3_ENST00000558562.1_3'UTR	NM_007364.2	NP_031390.1	Q9Y3Q3	TMED3_HUMAN	transmembrane emp24 protein transport domain containing 3	190					protein transport (GO:0015031)	COPI vesicle coat (GO:0030126)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)|ovary(1)|skin(1)	9						GACGATTGCCCTGTTCGTGGT	0.582																																							uc002beu.2		NA																	0				ovary(1)|skin(1)	2						c.(568-570)CTG>TTG		transmembrane emp24 domain containing 3							99.0	86.0	91.0					15																	79614470		2196	4293	6489	SO:0001819	synonymous_variant	23423				protein transport	ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane		g.chr15:79614470C>T	BC022232	CCDS10310.1, CCDS73768.1	15q24-q25	2011-02-09	2005-08-26	2005-01-07	ENSG00000166557	ENSG00000166557			28889	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 22"", ""transmembrane emp24 domain containing 3"""	C15orf22		12975309	Standard	XM_005254263		Approved	p24B	uc002beu.3	Q9Y3Q3	OTTHUMG00000144170	ENST00000299705.5:c.568C>T	15.37:g.79614470C>T						TMED3_uc010unj.1_Intron|TMED3_uc002bev.2_RNA	p.L190L	NM_007364	NP_031390	Q9Y3Q3	TMED3_HUMAN			3	669	+			190			Helical; (Potential).		A8K069|B4DN05|Q2T9F8	Silent	SNP	ENST00000299705.5	37	c.568C>T	CCDS10310.1																																																																																				0.582	TMED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291369.1	NM_007364		17	66	0	0	0	0.004007	0	17	66				
ADAMTSL3	57188	broad.mit.edu	37	15	84651157	84651157	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:84651157C>A	ENST00000286744.5	+	21	3001	c.2777C>A	c.(2776-2778)cCc>cAc	p.P926H	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.P926H	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	926	Ig-like C2-type 1.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			TATTTGCTGCCCAACACATCC	0.517																																							uc002bjz.3		NA																	0				ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27						c.(2776-2778)CCC>CAC		ADAMTS-like 3 precursor							168.0	150.0	156.0					15																	84651157		2203	4300	6503	SO:0001583	missense	57188					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr15:84651157C>A	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2777C>A	15.37:g.84651157C>A	ENSP00000286744:p.Pro926His					ADAMTSL3_uc010bmt.1_Missense_Mutation_p.P926H|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.P926H	p.P926H	NM_207517	NP_997400	P82987	ATL3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		21	3001	+			926			Ig-like C2-type 1.		A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	c.2777C>A	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144059	0.77888	.	.	ENSG00000156218	ENST00000286744	T	0.77750	-1.12	5.05	4.13	0.48395	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.42964	D	0.000637	D	0.87688	0.6240	M	0.82823	2.61	0.52501	D	0.999954	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.967	D	0.88745	0.3246	10	0.72032	D	0.01	.	12.5006	0.55953	0.0:0.9181:0.0:0.0819	.	926;926	P82987-2;P82987	.;ATL3_HUMAN	H	926	ENSP00000286744:P926H	ENSP00000286744:P926H	P	+	2	0	ADAMTSL3	82442161	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.162000	0.64942	1.092000	0.41356	0.563000	0.77884	CCC		0.517	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517		12	86	1	0	7.03913e-09	0.001368	1.06838e-08	12	86				
ZNF592	9640	broad.mit.edu	37	15	85345402	85345402	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:85345402G>T	ENST00000560079.2	+	11	3870	c.3582G>T	c.(3580-3582)atG>atT	p.M1194I	ZNF592_ENST00000299927.3_Missense_Mutation_p.M1194I	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	1194					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CAGCGGAGATGGCAGTGGAGG	0.622																																							uc002bld.2		NA																	0				ovary(4)|skin(2)	6						c.(3580-3582)ATG>ATT		zinc finger protein 592							11.0	15.0	13.0					15																	85345402		2195	4269	6464	SO:0001583	missense	9640				cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:85345402G>T	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.3582G>T	15.37:g.85345402G>T	ENSP00000452877:p.Met1194Ile					ZNF592_uc010upb.1_RNA	p.M1194I	NM_014630	NP_055445	Q92610	ZN592_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		11	3918	+			1194					Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	c.3582G>T	CCDS32317.1	.	.	.	.	.	.	.	.	.	.	G	1.915	-0.449723	0.04572	.	.	ENSG00000166716	ENST00000299927	T	0.00597	6.31	4.24	2.18	0.27775	.	1.215100	0.06080	N	0.661709	T	0.00468	0.0015	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45086	-0.9285	10	0.31617	T	0.26	-1.6565	7.8516	0.29457	0.2292:0.0:0.7708:0.0	.	1194	Q92610	ZN592_HUMAN	I	1194	ENSP00000299927:M1194I	ENSP00000299927:M1194I	M	+	3	0	ZNF592	83146406	0.243000	0.23878	0.051000	0.19133	0.553000	0.35397	0.390000	0.20768	0.267000	0.21916	0.655000	0.94253	ATG		0.622	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630		5	13	1	0	1.23904e-05	0.000602	1.59673e-05	5	13				
NTRK3	4916	broad.mit.edu	37	15	88680653	88680653	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:88680653T>A	ENST00000360948.2	-	6	765	c.604A>T	c.(604-606)Atg>Ttg	p.M202L	NTRK3_ENST00000557856.1_Missense_Mutation_p.M202L|NTRK3_ENST00000558676.1_Missense_Mutation_p.M202L|NTRK3_ENST00000542733.2_Missense_Mutation_p.M104L|NTRK3_ENST00000317501.3_Missense_Mutation_p.M202L|NTRK3_ENST00000540489.2_Missense_Mutation_p.M202L|NTRK3_ENST00000357724.2_Missense_Mutation_p.M202L|NTRK3_ENST00000355254.2_Missense_Mutation_p.M202L|NTRK3_ENST00000394480.2_Missense_Mutation_p.M202L	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	202	LRRCT.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTGATGTTCATGCGGAAGAGA	0.612			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	0				soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(604-606)ATG>TTG		neurotrophic tyrosine kinase, receptor, type 3							118.0	86.0	97.0					15																	88680653		2201	4299	6500	SO:0001583	missense	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88680653T>A	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.604A>T	15.37:g.88680653T>A	ENSP00000354207:p.Met202Leu	TSP Lung(13;0.10)				NTRK3_uc002bmh.2_Missense_Mutation_p.M202L|NTRK3_uc002bmf.1_Missense_Mutation_p.M202L|NTRK3_uc010upl.1_Missense_Mutation_p.M104L|NTRK3_uc010bnh.1_Missense_Mutation_p.M202L|NTRK3_uc002bmg.2_Missense_Mutation_p.M202L	p.M202L	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		6	766	-			202			Extracellular (Potential).|LRRCT.		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	c.604A>T	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	T	10.85	1.467500	0.26335	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.70986	-0.53;-0.49;-0.51;-0.53;-0.41;0.36;0.36	5.71	5.71	0.89125	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.74435	0.3716	L	0.39633	1.23	0.50813	D	0.999891	P;P;B;P;P;B	0.49090	0.882;0.734;0.002;0.882;0.919;0.002	P;P;B;P;P;B	0.59487	0.858;0.651;0.007;0.858;0.64;0.007	T	0.69468	-0.5137	10	0.16896	T	0.51	.	15.1854	0.72996	0.0:0.0:0.0:1.0	.	104;202;202;202;202;202	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	L	202;202;202;202;104;202;202	ENSP00000377990:M202L;ENSP00000354207:M202L;ENSP00000350356:M202L;ENSP00000347397:M202L;ENSP00000437773:M104L;ENSP00000444673:M202L;ENSP00000318328:M202L	ENSP00000318328:M202L	M	-	1	0	NTRK3	86481657	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.672000	0.68102	2.171000	0.68590	0.528000	0.53228	ATG		0.612	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				6	29	0	0	0	0.001984	0	6	29				
RLBP1	6017	broad.mit.edu	37	15	89761919	89761919	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:89761919G>T	ENST00000268125.5	-	4	457	c.18C>A	c.(16-18)ggC>ggA	p.G6G		NM_000326.4	NP_000317.1	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	6					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	cell body (GO:0044297)|cytosol (GO:0005829)	11-cis retinal binding (GO:0005502)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(1)|prostate(1)|skin(1)	18	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	TGCGGAACGTGCCCACCTGGG	0.582																																							uc002bnl.2		NA																	0				central_nervous_system(1)	1						c.(16-18)GGC>GGA		retinaldehyde binding protein 1	Vitamin A(DB00162)						62.0	57.0	59.0					15																	89761919		2200	4299	6499	SO:0001819	synonymous_variant	6017				response to stimulus|visual perception|vitamin A metabolic process	cytoplasm|soluble fraction	retinol binding|transporter activity	g.chr15:89761919G>T	BC004199	CCDS32324.1	15q26.1	2007-07-16	2001-11-28			ENSG00000140522			10024	protein-coding gene	gene with protein product		180090	"""retinaldehyde-binding protein 1"""			1733864, 9326942	Standard	NM_000326		Approved	CRALBP	uc002bnl.3	P12271		ENST00000268125.5:c.18C>A	15.37:g.89761919G>T							p.G6G	NM_000326	NP_000317	P12271	RLBP1_HUMAN			4	398	-	Lung NSC(78;0.0472)|all_lung(78;0.089)		6					B2R667	Silent	SNP	ENST00000268125.5	37	c.18C>A	CCDS32324.1																																																																																				0.582	RLBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421135.1	NM_000326		11	33	1	0	1.33987e-11	0.008291	2.22119e-11	11	33				
CAPN15	6650	broad.mit.edu	37	16	597502	597502	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:597502G>T	ENST00000219611.2	+	4	1027	c.664G>T	c.(664-666)Gcc>Tcc	p.A222S	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	222					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GGGCCCAGCTGCCGAACCAGA	0.751																																							uc002chi.2		NA																	0				ovary(1)|breast(1)	2						c.(664-666)GCC>TCC		small optic lobes							10.0	16.0	14.0					16																	597502		1943	3942	5885	SO:0001583	missense	6650				proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:597502G>T	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.664G>T	16.37:g.597502G>T	ENSP00000219611:p.Ala222Ser					SOLH_uc002chh.1_Missense_Mutation_p.A222S	p.A222S	NM_005632	NP_005623	O75808	CAN15_HUMAN			4	1027	+		Hepatocellular(780;0.00335)	222					B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	ENST00000219611.2	37	c.664G>T	CCDS10410.1	.	.	.	.	.	.	.	.	.	.	g	0.519	-0.862826	0.02610	.	.	ENSG00000103326	ENST00000219611;ENST00000397687	D	0.88124	-2.34	4.83	-5.34	0.02705	.	2.359650	0.01614	N	0.022693	T	0.68449	0.3002	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.63269	-0.6675	10	0.08599	T	0.76	.	1.3973	0.02264	0.3487:0.1063:0.3316:0.2135	.	222	O75808	CAN15_HUMAN	S	222	ENSP00000219611:A222S	ENSP00000219611:A222S	A	+	1	0	SOLH	537503	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.072000	0.14617	-0.839000	0.04212	0.306000	0.20318	GCC		0.751	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632		6	33	1	0	0.00307968	0.00308	0.00347099	6	33				
ZNF598	90850	broad.mit.edu	37	16	2048807	2048807	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:2048807A>T	ENST00000563630.1	-	11	2334	c.2092T>A	c.(2092-2094)Ttc>Atc	p.F698I	ZNF598_ENST00000431526.1_Missense_Mutation_p.F753I|AC005606.15_ENST00000567515.1_lincRNA|ZNF598_ENST00000562103.1_Missense_Mutation_p.F698I			Q86UK7	ZN598_HUMAN	zinc finger protein 598	753	Pro-rich.						poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						CTCTCCCGGAAGTTCTCGGGG	0.617																																							uc002cof.1		NA																	0				lung(1)|breast(1)	2						c.(2257-2259)TTC>ATC		zinc finger protein 598							27.0	30.0	29.0					16																	2048807		1939	4139	6078	SO:0001583	missense	90850					intracellular	zinc ion binding	g.chr16:2048807A>T	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.2092T>A	16.37:g.2048807A>T	ENSP00000455882:p.Phe698Ile					ZNF598_uc002coe.1_Missense_Mutation_p.F117I	p.F753I	NM_178167	NP_835461	Q86UK7	ZN598_HUMAN			13	2272	-			753					Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000563630.1	37	c.2257T>A		.	.	.	.	.	.	.	.	.	.	.	19.02	3.745730	0.69418	.	.	ENSG00000167962	ENST00000431526	T	0.21031	2.03	5.49	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.41534	0.1163	M	0.62088	1.915	0.58432	D	0.999998	D;D	0.89917	0.997;1.0	D;D	0.87578	0.953;0.998	T	0.30475	-0.9977	10	0.72032	D	0.01	-25.1577	11.5168	0.50526	0.8502:0.1498:0.0:0.0	.	753;745	Q86UK7;Q86UK7-2	ZN598_HUMAN;.	I	753	ENSP00000411409:F753I	ENSP00000411409:F753I	F	-	1	0	ZNF598	1988808	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.786000	0.75094	2.089000	0.63090	0.456000	0.33151	TTC		0.617	ZNF598-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000434439.1	NM_178167		3	6	0	0	0	0.004672	0	3	6				
PGP	283871	broad.mit.edu	37	16	2263992	2263992	+	Nonsense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:2263992T>A	ENST00000333503.7	-	2	732	c.703A>T	c.(703-705)Aag>Tag	p.K235*	RP11-304L19.8_ENST00000561544.1_lincRNA|BRICD5_ENST00000328540.3_5'Flank	NM_001042371.2	NP_001035830.1	A6NDG6	PGP_HUMAN	phosphoglycolate phosphatase	235					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)		magnesium ion binding (GO:0000287)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|phosphoglycolate phosphatase activity (GO:0008967)|protein tyrosine phosphatase activity (GO:0004725)			skin(1)	1						CGGCTGGGCTTCCCGATGATG	0.662																																					GBM(63;906 1080 2092 17773 18795)	GBM(63;906 1080 2092 17773 18795)	uc002cpk.1		NA																	0				skin(1)	1						c.(703-705)AAG>TAG		phosphoglycolate phosphatase							52.0	57.0	55.0					16																	2263992		2015	4174	6189	SO:0001587	stop_gained	283871				carbohydrate metabolic process		phosphoglycolate phosphatase activity	g.chr16:2263992T>A	BC035985	CCDS42104.1	16p13.3	2012-10-02				ENSG00000184207	3.1.3.18		8909	protein-coding gene	gene with protein product		172280					Standard	NM_001042371		Approved		uc002cpk.1	A6NDG6		ENST00000333503.7:c.703A>T	16.37:g.2263992T>A	ENSP00000330918:p.Lys235*					C16orf79_uc002cpi.1_5'Flank|C16orf79_uc010bsh.2_5'Flank|PGP_uc010uvz.1_RNA	p.K235*	NM_001042371	NP_001035830	A6NDG6	PGP_HUMAN			2	747	-			235						Nonsense_Mutation	SNP	ENST00000333503.7	37	c.703A>T	CCDS42104.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.955750	0.92726	.	.	ENSG00000184207	ENST00000333503	.	.	.	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.9143	13.2699	0.60155	0.0:0.0:0.0:1.0	.	.	.	.	X	235	.	ENSP00000330918:K235X	K	-	1	0	PGP	2203993	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.817000	0.86213	2.002000	0.58637	0.533000	0.62120	AAG		0.662	PGP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435095.1	NM_024118		12	83	0	0	0	0.003163	0	12	83				
SRRM2	23524	broad.mit.edu	37	16	2813501	2813501	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:2813501G>T	ENST00000301740.8	+	11	3521	c.2972G>T	c.(2971-2973)gGg>gTg	p.G991V		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	991	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGTCACTCAGGGTCTATTTCA	0.473																																							uc002crk.2		NA																	0				ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(2971-2973)GGG>GTG		splicing coactivator subunit SRm300							139.0	146.0	144.0					16																	2813501		2198	4300	6498	SO:0001583	missense	23524					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding	g.chr16:2813501G>T	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.2972G>T	16.37:g.2813501G>T	ENSP00000301740:p.Gly991Val					SRRM2_uc002crj.1_Missense_Mutation_p.G895V|SRRM2_uc002crl.1_Missense_Mutation_p.G991V|SRRM2_uc010bsu.1_Missense_Mutation_p.G895V	p.G991V	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN			11	3521	+			991			Ser-rich.		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	c.2972G>T	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.108783	0.37242	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933;ENST00000426305	T	0.37584	1.19	5.61	5.61	0.85477	.	0.089829	0.49305	D	0.000156	T	0.54695	0.1874	L	0.55481	1.735	0.58432	D	0.999997	D	0.76494	0.999	D	0.65773	0.938	T	0.50800	-0.8785	10	0.48119	T	0.1	-16.6003	17.1288	0.86721	0.0:0.0:1.0:0.0	.	991	Q9UQ35	SRRM2_HUMAN	V	991;991;243;956	ENSP00000301740:G991V	ENSP00000301740:G991V	G	+	2	0	SRRM2	2753502	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.063000	0.49978	2.656000	0.90262	0.655000	0.94253	GGG		0.473	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			31	156	1	0	9.45814e-24	0.004878	1.90558e-23	31	156				
ZNF205	7755	broad.mit.edu	37	16	3170215	3170215	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:3170215C>T	ENST00000382192.3	+	7	1759	c.1554C>T	c.(1552-1554)aaC>aaT	p.N518N	RP11-473M20.14_ENST00000575139.1_RNA|ZNF205_ENST00000219091.4_Silent_p.N518N|RP11-473M20.14_ENST00000576490.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	518					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						GGCGCTCCAACCTGCACCGGC	0.731																																							uc002cub.2		NA																	0					0						c.(1552-1554)AAC>AAT		zinc finger protein 205							30.0	30.0	30.0					16																	3170215		2197	4298	6495	SO:0001819	synonymous_variant	7755				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr16:3170215C>T	AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.1554C>T	16.37:g.3170215C>T						ZNF205_uc002cua.2_Silent_p.N518N	p.N518N	NM_001042428	NP_001035893	O95201	ZN205_HUMAN			7	1689	+			518			C2H2-type 8.		A8MZK0|D3DUB4|Q9BU95	Silent	SNP	ENST00000382192.3	37	c.1554C>T	CCDS10494.2																																																																																				0.731	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309057.1	NM_003456		9	51	0	0	0	0.006214	0	9	51				
NAGPA	51172	broad.mit.edu	37	16	5078957	5078957	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:5078957C>A	ENST00000312251.3	-	5	863	c.844G>T	c.(844-846)Gcc>Tcc	p.A282S	NAGPA_ENST00000381955.3_Missense_Mutation_p.A282S|NAGPA_ENST00000564922.1_5'Flank|RP11-165E7.1_ENST00000588778.1_RNA	NM_016256.3	NP_057340.2	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	282					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|lysosome organization (GO:0007040)|protein glycosylation (GO:0006486)|protein targeting to lysosome (GO:0006622)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity (GO:0003944)			endometrium(4)|large_intestine(4)|lung(3)|urinary_tract(1)	12					N-Acetyl-D-glucosamine(DB00141)	AGGTTGATGGCGTTGACCACG	0.597																																							uc002cyg.2		NA																	0					0						c.(844-846)GCC>TCC		N-acetylglucosamine-1-phosphodiester	N-Acetyl-D-glucosamine(DB00141)						142.0	123.0	130.0					16																	5078957		2197	4300	6497	SO:0001583	missense	51172				carbohydrate metabolic process|lysosome organization|protein modification process|protein targeting to lysosome	Golgi cisterna membrane|integral to membrane	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity	g.chr16:5078957C>A	AF187072	CCDS10527.1	16p13.3	2008-02-05			ENSG00000103174	ENSG00000103174	3.1.4.45		17378	protein-coding gene	gene with protein product		607985				10551838, 12058031	Standard	NM_016256		Approved	APAA, UCE	uc002cyg.3	Q9UK23	OTTHUMG00000090515	ENST00000312251.3:c.844G>T	16.37:g.5078957C>A	ENSP00000310998:p.Ala282Ser					NAGPA_uc010buc.2_Missense_Mutation_p.A13S|NAGPA_uc002cyf.2_Missense_Mutation_p.A140S|NAGPA_uc002cyh.2_RNA|NAGPA_uc002cyi.2_Missense_Mutation_p.A57S	p.A282S	NM_016256	NP_057340	Q9UK23	NAGPA_HUMAN			5	865	-			282			Lumenal (Potential).		B2RAS1|Q96EJ8	Missense_Mutation	SNP	ENST00000312251.3	37	c.844G>T	CCDS10527.1	.	.	.	.	.	.	.	.	.	.	C	35	5.589843	0.96590	.	.	ENSG00000103174	ENST00000312251;ENST00000381955	T;T	0.65916	-0.18;0.07	5.45	5.45	0.79879	.	0.108387	0.64402	D	0.000007	D	0.85682	0.5753	H	0.94582	3.555	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.89501	0.3764	10	0.87932	D	0	-33.1673	19.2854	0.94067	0.0:1.0:0.0:0.0	.	282;282;282	Q9UK23-3;Q9UK23;Q9UK23-2	.;NAGPA_HUMAN;.	S	282	ENSP00000310998:A282S;ENSP00000371381:A282S	ENSP00000310998:A282S	A	-	1	0	NAGPA	5018958	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	7.712000	0.84684	2.556000	0.86216	0.561000	0.74099	GCC		0.597	NAGPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207003.1	NM_016256		23	122	1	0	1.10923e-09	0.00278	1.73763e-09	23	122				
USP7	7874	broad.mit.edu	37	16	8999094	8999094	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:8999094C>A	ENST00000344836.4	-	14	1721	c.1523G>T	c.(1522-1524)cGa>cTa	p.R508L	USP7_ENST00000535863.1_Missense_Mutation_p.R409L|USP7_ENST00000381886.4_Missense_Mutation_p.R492L	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	508	USP.				maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						AGTGCAGTGTCGAACAGACAG	0.433											OREG0023595	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002czl.2		NA																	0				ovary(3)	3						c.(1522-1524)CGA>CTA		ubiquitin specific peptidase 7							257.0	197.0	217.0					16																	8999094		2197	4300	6497	SO:0001583	missense	7874				interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr16:8999094C>A	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.1523G>T	16.37:g.8999094C>A	ENSP00000343535:p.Arg508Leu		OREG0023595	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	653	USP7_uc010uyk.1_Missense_Mutation_p.R409L|USP7_uc002czj.2_RNA|USP7_uc010uyj.1_Missense_Mutation_p.R409L|USP7_uc002czk.2_Missense_Mutation_p.R492L|USP7_uc010uyl.1_RNA	p.R508L	NM_003470	NP_003461	Q93009	UBP7_HUMAN			14	1722	-			508					A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	37	c.1523G>T	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	C	19.27	3.796081	0.70567	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549;ENST00000542333	T;T;T	0.04970	3.52;3.52;3.52	5.39	5.39	0.77823	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.33498	0.0865	M	0.92219	3.285	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.65010	0.931;0.931	T	0.35475	-0.9787	10	0.42905	T	0.14	.	19.1486	0.93479	0.0:1.0:0.0:0.0	.	508;492	Q93009;B7Z815	UBP7_HUMAN;.	L	508;516;409;409;450	ENSP00000343535:R508L;ENSP00000443646:R409L;ENSP00000439272:R450L	ENSP00000343535:R508L	R	-	2	0	USP7	8906595	1.000000	0.71417	0.951000	0.38953	0.653000	0.38743	7.668000	0.83897	2.517000	0.84864	0.561000	0.74099	CGA		0.433	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2			11	93	1	0	0.00244969	0.00245	0.00278857	11	93				
CIITA	4261	broad.mit.edu	37	16	10997612	10997612	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:10997612T>C	ENST00000324288.8	+	9	930	c.797T>C	c.(796-798)gTa>gCa	p.V266A	CIITA_ENST00000537380.1_3'UTR|CIITA_ENST00000381835.5_Missense_Mutation_p.V217A	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	266					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						GCCAGCCAAGTACCCCCTCCC	0.602			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																		uc002dai.3		NA		Dom	yes		16	16p13	4261	T	"""class II, major histocompatibility complex, transactivator"""			L	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75		PMBL|Hodgkin Lymphona|		0				central_nervous_system(1)	1						c.(796-798)GTA>GCA		class II transactivator							74.0	69.0	71.0					16																	10997612		2197	4300	6497	SO:0001583	missense	4261				interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding	g.chr16:10997612T>C	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.797T>C	16.37:g.10997612T>C	ENSP00000316328:p.Val266Ala					CIITA_uc002daj.3_Missense_Mutation_p.V267A|CIITA_uc002dak.3_Missense_Mutation_p.V217A|CIITA_uc002dag.2_Missense_Mutation_p.V266A|CIITA_uc002dah.2_Missense_Mutation_p.V218A|CIITA_uc010bup.1_Missense_Mutation_p.V266A	p.V266A	NM_000246	NP_000237	P33076	C2TA_HUMAN			9	930	+			266					A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	37	c.797T>C	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	T	2.818	-0.245347	0.05906	.	.	ENSG00000179583	ENST00000324288;ENST00000381835;ENST00000388910;ENST00000537380	T;T	0.71934	-0.61;1.84	4.08	-4.67	0.03319	.	9.810820	0.00357	N	0.000034	T	0.47248	0.1435	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.001;0.0	B;B;B;B;B;B	0.10450	0.005;0.0;0.0;0.001;0.001;0.001	T	0.32188	-0.9916	10	0.24483	T	0.36	.	6.5041	0.22186	0.0:0.2219:0.1498:0.6283	.	266;217;266;266;218;266	F5H2J4;E9PFE0;A0N0N9;P33076;F2Z2G8;Q96KL4	.;.;.;C2TA_HUMAN;.;.	A	266;217;218;266	ENSP00000316328:V266A;ENSP00000371257:V217A	ENSP00000316328:V266A	V	+	2	0	CIITA	10905113	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.941000	0.03925	-0.835000	0.04234	-0.177000	0.13119	GTA		0.602	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246		9	117	0	0	0	0.004482	0	9	117				
UMOD	7369	broad.mit.edu	37	16	20359765	20359765	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:20359765G>T	ENST00000570689.1	-	3	1004	c.858C>A	c.(856-858)taC>taA	p.Y286*	UMOD_ENST00000396134.2_Nonsense_Mutation_p.Y319*|UMOD_ENST00000424589.1_Nonsense_Mutation_p.Y319*|UMOD_ENST00000396142.2_Nonsense_Mutation_p.Y286*|UMOD_ENST00000302509.4_Nonsense_Mutation_p.Y286*|UMOD_ENST00000396138.4_Nonsense_Mutation_p.Y335*			P07911	UROM_HUMAN	uromodulin	286					cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)			endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						GACCTGTGCAGTACGCCAGGT	0.632																																							uc002dgz.2		NA																	0				ovary(1)|skin(1)	2						c.(856-858)TAC>TAA		uromodulin precursor							30.0	32.0	32.0					16																	20359765		2203	4300	6503	SO:0001587	stop_gained	7369				cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding	g.chr16:20359765G>T	M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.858C>A	16.37:g.20359765G>T	ENSP00000460548:p.Tyr286*					UMOD_uc002dha.2_Nonsense_Mutation_p.Y286*|UMOD_uc002dhb.2_Nonsense_Mutation_p.Y319*	p.Y286*	NM_003361	NP_003352	P07911	UROM_HUMAN			3	987	-			286					B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Nonsense_Mutation	SNP	ENST00000570689.1	37	c.858C>A	CCDS10583.1	.	.	.	.	.	.	.	.	.	.	g	35	5.483053	0.96307	.	.	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	.	.	.	4.92	2.98	0.34508	.	0.000000	0.47455	D	0.000240	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-42.3466	6.8422	0.23969	0.2797:0.0:0.7203:0.0	.	.	.	.	X	286;319;319;286;264;286	.	ENSP00000306279:Y286X	Y	-	3	2	UMOD	20267266	1.000000	0.71417	0.997000	0.53966	0.607000	0.37147	1.276000	0.33156	0.672000	0.31204	-0.265000	0.10407	TAC		0.632	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1			10	36	1	0	0.000673444	0.008291	0.00078626	10	36				
OTOA	146183	broad.mit.edu	37	16	21698784	21698784	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:21698784G>T	ENST00000286149.4	+	7	451	c.450G>T	c.(448-450)ttG>ttT	p.L150F	OTOA_ENST00000388958.3_Missense_Mutation_p.L150F|OTOA_ENST00000388956.4_Missense_Mutation_p.L71F			Q7RTW8	OTOAN_HUMAN	otoancorin	150					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		AACGAGCCTTGCAGAGCCCTG	0.522																																							uc002djh.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(448-450)TTG>TTT		otoancorin isoform 1							124.0	116.0	119.0					16																	21698784		2199	4300	6499	SO:0001583	missense	146183				sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix		g.chr16:21698784G>T	AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.450G>T	16.37:g.21698784G>T	ENSP00000286149:p.Leu150Phe					uc002diq.3_Intron|OTOA_uc010vbj.1_Missense_Mutation_p.L71F	p.L150F	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN		GBM - Glioblastoma multiforme(48;0.0414)	7	451	+			150					A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	ENST00000286149.4	37	c.450G>T		.	.	.	.	.	.	.	.	.	.	G	10.21	1.286678	0.23478	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956	T;T;T	0.13089	2.62;2.62;2.62	4.91	1.71	0.24356	.	0.289804	0.27076	N	0.021060	T	0.08044	0.0201	L	0.38838	1.175	0.80722	D	1	B;B	0.21381	0.032;0.055	B;B	0.24848	0.038;0.056	T	0.25710	-1.0124	10	0.15499	T	0.54	-7.042	1.9787	0.03422	0.183:0.1491:0.5044:0.1635	.	71;150	B3KWU3;E9PF51	.;.	F	150;150;71	ENSP00000373610:L150F;ENSP00000286149:L150F;ENSP00000373608:L71F	ENSP00000286149:L150F	L	+	3	2	OTOA	21606285	0.990000	0.36364	0.997000	0.53966	0.957000	0.61999	0.041000	0.13927	0.429000	0.26202	0.650000	0.86243	TTG		0.522	OTOA-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000430021.1			23	103	1	0	2.12542e-12	0.00632	3.61109e-12	23	103				
VWA3A	146177	broad.mit.edu	37	16	22142978	22142978	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:22142978C>G	ENST00000389398.5	+	19	1896	c.1800C>G	c.(1798-1800)gaC>gaG	p.D600E	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	600	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		TGGAAGTAGACTTCAAGGACA	0.607																																							uc010vbq.1		NA																	0				skin(1)	1						c.(1798-1800)GAC>GAG		von Willebrand factor A domain containing 3A							68.0	73.0	71.0					16																	22142978		1994	4164	6158	SO:0001583	missense	146177					extracellular region		g.chr16:22142978C>G	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.1800C>G	16.37:g.22142978C>G	ENSP00000374049:p.Asp600Glu					VWA3A_uc010bxd.2_RNA|VWA3A_uc010bxc.2_Missense_Mutation_p.D608E	p.D600E	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN		GBM - Glioblastoma multiforme(48;0.0439)	19	1896	+			600			VWFA 1.		A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	ENST00000389398.5	37	c.1800C>G	CCDS45441.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.768882	0.49680	.	.	ENSG00000175267	ENST00000389398;ENST00000299840	T	0.21361	2.01	5.25	2.17	0.27698	.	0.000000	0.85682	D	0.000000	T	0.27967	0.0689	M	0.69823	2.125	0.80722	D	1	P;P	0.49635	0.926;0.775	P;P	0.49561	0.615;0.481	T	0.05022	-1.0911	10	0.23891	T	0.37	.	9.2853	0.37753	0.0:0.7528:0.0:0.2472	.	600;224	A6NCI4;A6NCI4-2	VWA3A_HUMAN;.	E	600;223	ENSP00000374049:D600E	ENSP00000299840:D223E	D	+	3	2	VWA3A	22050479	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.528000	0.35985	0.573000	0.29400	0.563000	0.77884	GAC		0.607	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1			11	22	0	0	0	0.001368	0	11	22				
CACNG3	10368	broad.mit.edu	37	16	24372671	24372671	+	Splice_Site	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:24372671A>T	ENST00000005284.3	+	4	1638		c.e4-1			NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3						calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		CCCTTCTCTTAGGGTTAAGCA	0.428																																							uc002dmf.2		NA																	0					0						c.e4-2		voltage-dependent calcium channel gamma-3							101.0	110.0	107.0					16																	24372671		2191	4299	6490	SO:0001630	splice_region_variant	10368				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr16:24372671A>T	AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.437-1A>T	16.37:g.24372671A>T							p.G146_splice	NM_006539	NP_006530	O60359	CCG3_HUMAN		GBM - Glioblastoma multiforme(48;0.0809)	4	1637	+									Splice_Site	SNP	ENST00000005284.3	37	c.437_splice	CCDS10620.1	.	.	.	.	.	.	.	.	.	.	A	16.97	3.267504	0.59540	.	.	ENSG00000006116	ENST00000005284	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4948	0.61419	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CACNG3	24280172	1.000000	0.71417	0.935000	0.37517	0.730000	0.41778	8.962000	0.93254	1.846000	0.53633	0.533000	0.62120	.		0.428	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539	Intron	27	134	0	0	0	0.00632	0	27	134				
C16orf82	162083	broad.mit.edu	37	16	27078574	27078574	+	lincRNA	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:27078574C>G	ENST00000505035.1	+	0	547				RP11-673P17.2_ENST00000565783.1_RNA			Q7Z2V1	TNT_HUMAN	chromosome 16 open reading frame 82																		GCCATGCCAGCCTGAGCAGCG	0.642																																							uc010vcm.1		NA																	0					0						c.(256-258)AGC>AGG		hypothetical protein LOC162083							19.0	28.0	25.0					16																	27078574		2191	4290	6481			162083							g.chr16:27078574C>G	BC031257		16p12.1	2013-01-24			ENSG00000234186	ENSG00000234186			30755	other	unknown						12477932	Standard	NM_001145545		Approved	TNT	uc010vcm.2	Q7Z2V1	OTTHUMG00000161986		16.37:g.27078574C>G							p.S86R	NM_001145545	NP_001139017	Q7Z2V1	TNT_HUMAN			1	356	+			149					B9EGC2|Q8NEF0	Missense_Mutation	SNP	ENST00000505035.1	37	c.258C>G																																																																																					0.642	C16orf82-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000366634.1	NM_001145545		7	19	0	0	0	0.001984	0	7	19				
LAT	27040	broad.mit.edu	37	16	28996747	28996747	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:28996747G>T	ENST00000360872.5	+	1	87	c.9G>T	c.(7-9)gaG>gaT	p.E3D	LAT_ENST00000566177.1_Missense_Mutation_p.E3D|LAT_ENST00000454369.2_Missense_Mutation_p.E3D|LAT_ENST00000563964.1_3'UTR|RP11-264B17.3_ENST00000569969.1_RNA|LAT_ENST00000395461.3_Missense_Mutation_p.E39D|LAT_ENST00000564277.1_Missense_Mutation_p.E3D|LAT_ENST00000354453.4_Missense_Mutation_p.E3D|LAT_ENST00000395456.2_Missense_Mutation_p.E3D			O43561	LAT_HUMAN	linker for activation of T cells	3					blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				AGATGGAGGAGGCCATCCTGG	0.657																																							uc002dsd.2		NA																	0					0						c.(7-9)GAG>GAT		linker for activation of T cells isoform a							60.0	52.0	54.0					16																	28996747		2197	4300	6497	SO:0001583	missense	27040				calcium-mediated signaling|integrin-mediated signaling pathway|mast cell degranulation|platelet activation|Ras protein signal transduction|regulation of T cell activation|T cell receptor signaling pathway	immunological synapse|integral to membrane|intracellular|membrane raft	SH3/SH2 adaptor activity	g.chr16:28996747G>T	AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761	ENST00000360872.5:c.9G>T	16.37:g.28996747G>T	ENSP00000354119:p.Glu3Asp					uc010vct.1_Intron|SPNS1_uc010byq.1_3'UTR|LAT_uc010vdj.1_Missense_Mutation_p.E39D|LAT_uc002dsb.2_Missense_Mutation_p.E3D|LAT_uc002dsc.2_Missense_Mutation_p.E3D|LAT_uc010vdk.1_Missense_Mutation_p.E3D|LAT_uc010vdl.1_Missense_Mutation_p.E3D	p.E3D	NM_014387	NP_055202	O43561	LAT_HUMAN			1	361	+		Hepatocellular(780;0.244)	3			Extracellular (Potential).		B7WPI0|C7C5T6|G5E9K3|O43919	Missense_Mutation	SNP	ENST00000360872.5	37	c.9G>T	CCDS10647.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.708976	0.48517	.	.	ENSG00000213658	ENST00000395461;ENST00000395456;ENST00000454369;ENST00000360872;ENST00000354453	.	.	.	3.98	-4.23	0.03789	.	.	.	.	.	T	0.10165	0.0249	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.31290	0.187;0.187;0.318;0.187;0.187	B;B;B;B;B	0.23574	0.047;0.047;0.047;0.047;0.047	T	0.19549	-1.0302	8	0.44086	T	0.13	-1.1058	0.8338	0.01136	0.322:0.3017:0.2231:0.1531	.	3;3;39;3;3	C7C5T6;O43561-2;B7WPI0;O43561;G5E9K3	.;.;.;LAT_HUMAN;.	D	39;3;3;3;3	.	ENSP00000346441:E3D	E	+	3	2	LAT	28904248	0.000000	0.05858	0.001000	0.08648	0.371000	0.29859	-0.664000	0.05292	-0.359000	0.08150	0.462000	0.41574	GAG		0.657	LAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254688.2			5	64	1	0	1.024e-07	0.000602	1.48491e-07	5	64				
SRCAP	10847	broad.mit.edu	37	16	30749056	30749056	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:30749056G>T	ENST00000262518.4	+	34	8080	c.7695G>T	c.(7693-7695)gaG>gaT	p.E2565D	SRCAP_ENST00000344771.4_Missense_Mutation_p.E2407D|RP11-2C24.4_ENST00000483578.1_lincRNA|SRCAP_ENST00000395059.2_Missense_Mutation_p.E2503D	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2565	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			AGTCCCTGGAGCTGGCTTCTG	0.557																																							uc002dze.1		NA																	0				ovary(3)|skin(1)	4						c.(7693-7695)GAG>GAT		Snf2-related CBP activator protein							69.0	71.0	70.0					16																	30749056		2197	4300	6497	SO:0001583	missense	10847				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity	g.chr16:30749056G>T	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.7695G>T	16.37:g.30749056G>T	ENSP00000262518:p.Glu2565Asp					SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.E2360D	p.E2565D	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Colorectal(24;0.198)		34	8080	+			2565			Pro-rich.		B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	c.7695G>T	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	G	4.679	0.126243	0.08931	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.92647	-3.05;-3.08;-3.07	4.8	2.57	0.30868	.	0.000000	0.45606	D	0.000356	D	0.88522	0.6459	N	0.08118	0	0.23468	N	0.997611	D;D	0.61697	0.99;0.984	D;D	0.70935	0.971;0.935	T	0.79356	-0.1837	10	0.48119	T	0.1	-12.4148	6.2121	0.20636	0.2693:0.0:0.7307:0.0	.	2503;2565	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	D	2565;2503;2407	ENSP00000262518:E2565D;ENSP00000378499:E2503D;ENSP00000343042:E2407D	ENSP00000262518:E2565D	E	+	3	2	SRCAP	30656557	0.995000	0.38212	0.985000	0.45067	0.315000	0.28087	0.155000	0.16362	0.455000	0.26910	-0.444000	0.05651	GAG		0.557	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662		20	78	1	0	0.000958276	0.007413	0.0011169	20	78				
STX1B	112755	broad.mit.edu	37	16	31012463	31012463	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:31012463C>A	ENST00000215095.5	-	3	388	c.157G>T	c.(157-159)Gtg>Ttg	p.V53L	STX1B_ENST00000565419.1_Missense_Mutation_p.V53L	NM_052874.3	NP_443106.1	P61266	STX1B_HUMAN	syntaxin 1B	53					intracellular protein transport (GO:0006886)|neurotransmitter transport (GO:0006836)|regulation of exocytosis (GO:0017157)|regulation of gene expression (GO:0010468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|large_intestine(5)|lung(5)	13						TGTTTTTTCACCTGCTCCACA	0.582																																							uc010cad.2		NA																	0					0						c.(157-159)GTG>TTG		syntaxin 1B							94.0	84.0	87.0					16																	31012463		2197	4300	6497	SO:0001583	missense	112755				intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity	g.chr16:31012463C>A	AY028792	CCDS10699.1	16p12-p11	2008-02-05	2007-06-20	2007-06-20	ENSG00000099365	ENSG00000099365			18539	protein-coding gene	gene with protein product		601485	"""syntaxin 1B1"", ""syntaxin 1B2"""	STX1B1, STX1B2			Standard	NM_052874		Approved		uc010cad.2	P61266	OTTHUMG00000132391	ENST00000215095.5:c.157G>T	16.37:g.31012463C>A	ENSP00000215095:p.Val53Leu					STX1B_uc010vfd.1_Missense_Mutation_p.V53L	p.V53L	NM_052874	NP_443106	P61266	STX1B_HUMAN			3	269	-			53			Potential.|Cytoplasmic (Potential).		Q15531|Q2VPS2	Missense_Mutation	SNP	ENST00000215095.5	37	c.157G>T	CCDS10699.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708880	0.68615	.	.	ENSG00000099365	ENST00000215095	T	0.09255	3.0	4.62	4.62	0.57501	t-SNARE (1);Syntaxin, N-terminal (2);	0.000000	0.64402	D	0.000001	T	0.11922	0.0290	L	0.60455	1.87	0.80722	D	1	P;B	0.36010	0.532;0.186	B;B	0.36719	0.231;0.193	T	0.03278	-1.1053	10	0.02654	T	1	.	16.3745	0.83381	0.0:1.0:0.0:0.0	.	53;53	Q2VPS2;P61266	.;STX1B_HUMAN	L	53	ENSP00000215095:V53L	ENSP00000215095:V53L	V	-	1	0	STX1B	30919964	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.482000	0.81143	2.412000	0.81896	0.561000	0.74099	GTG		0.582	STX1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255521.2			10	70	1	0	1.76689e-08	0.006214	2.62345e-08	10	70				
DRC7	84229	broad.mit.edu	37	16	57760106	57760106	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:57760106G>T	ENST00000360716.3	+	14	2106	c.1885G>T	c.(1885-1887)Gcc>Tcc	p.A629S	CCDC135_ENST00000394337.4_Missense_Mutation_p.A629S|CCDC135_ENST00000336825.8_Missense_Mutation_p.A564S			Q8IY82	CC135_HUMAN		629					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						CCACATCACGGCCTCCAAGCG	0.652																																							uc002emi.2		NA																	0				central_nervous_system(1)	1						c.(1885-1887)GCC>TCC		coiled-coil domain containing 135							68.0	60.0	63.0					16																	57760106		2198	4298	6496	SO:0001583	missense	84229					cytoplasm		g.chr16:57760106G>T																												ENST00000360716.3:c.1885G>T	16.37:g.57760106G>T	ENSP00000353942:p.Ala629Ser					CCDC135_uc002emj.2_Missense_Mutation_p.A629S|CCDC135_uc002emk.2_Missense_Mutation_p.A564S	p.A629S	NM_032269	NP_115645	Q8IY82	CC135_HUMAN			13	1974	+			629					A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	ENST00000360716.3	37	c.1885G>T	CCDS10787.1	.	.	.	.	.	.	.	.	.	.	g	10.01	1.233673	0.22626	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.11063	2.99;2.81;2.99	4.98	1.42	0.22433	.	0.401071	0.28042	N	0.016831	T	0.11324	0.0276	M	0.69358	2.11	0.23602	N	0.997317	B;P	0.36712	0.214;0.566	B;B	0.35470	0.043;0.203	T	0.14090	-1.0485	10	0.33940	T	0.23	-18.4166	8.8124	0.34976	0.3637:0.0:0.6363:0.0	.	564;629	Q8IY82-2;Q8IY82	.;CC135_HUMAN	S	629;564;629	ENSP00000377869:A629S;ENSP00000338938:A564S;ENSP00000353942:A629S	ENSP00000338938:A564S	A	+	1	0	CCDC135	56317607	0.455000	0.25736	0.460000	0.27093	0.591000	0.36615	0.858000	0.27845	0.518000	0.28383	0.655000	0.94253	GCC		0.652	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2			14	39	1	0	4.3838e-07	0.001855	6.16077e-07	14	39				
CMTR2	55783	broad.mit.edu	37	16	71319360	71319360	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:71319360T>A	ENST00000338099.5	-	3	800	c.464A>T	c.(463-465)aAc>aTc	p.N155I	CMTR2_ENST00000434935.2_Missense_Mutation_p.N155I			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	155	Adrift-type SAM-dependent 2'-O-MTase. {ECO:0000255|PROSITE-ProRule:PRU00946}.				7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)										TAAGTAGTGGTTGAGACTAGC	0.413																																							uc010cga.2		NA																	0				skin(1)	1						c.(463-465)AAC>ATC		FtsJ methyltransferase domain containing 1							105.0	102.0	103.0					16																	71319360		2198	4300	6498	SO:0001583	missense	55783					integral to membrane	methyltransferase activity|nucleic acid binding	g.chr16:71319360T>A	BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.464A>T	16.37:g.71319360T>A	ENSP00000337512:p.Asn155Ile					FTSJD1_uc002ezy.3_Missense_Mutation_p.N155I|FTSJD1_uc002ezz.3_Missense_Mutation_p.N155I	p.N155I	NM_001099642	NP_001093112	Q8IYT2	FTSJ1_HUMAN			3	870	-			155					B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Missense_Mutation	SNP	ENST00000338099.5	37	c.464A>T	CCDS10898.1	.	.	.	.	.	.	.	.	.	.	T	17.46	3.395095	0.62066	.	.	ENSG00000180917	ENST00000338099;ENST00000434935	T;T	0.40225	1.04;1.04	5.56	5.56	0.83823	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.000000	0.85682	D	0.000000	T	0.69788	0.3150	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75587	-0.3266	10	0.56958	D	0.05	-30.1227	14.9098	0.70746	0.0:0.0:0.0:1.0	.	155	Q8IYT2	FTSJ1_HUMAN	I	155	ENSP00000337512:N155I;ENSP00000411148:N155I	ENSP00000337512:N155I	N	-	2	0	FTSJD1	69876861	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.040000	0.89188	2.114000	0.64651	0.459000	0.35465	AAC		0.413	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268984.2	NM_018348		27	72	0	0	0	0.00632	0	27	72				
CNTNAP4	85445	broad.mit.edu	37	16	76513435	76513435	+	Splice_Site	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:76513435G>T	ENST00000476707.1	+	11	2030	c.1891G>T	c.(1891-1893)Gaa>Taa	p.E631*	CNTNAP4_ENST00000377504.4_Splice_Site_p.E579*|CNTNAP4_ENST00000478060.1_Splice_Site_p.E555*|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000307431.8_Splice_Site_p.E627*			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	628	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CAATATGACCGGTGAGTTAAT	0.333																																							uc002feu.1		NA																	0				ovary(1)|pancreas(1)	2						c.(1882-1884)GAA>TAA		cell recognition protein CASPR4 isoform 1							80.0	83.0	82.0					16																	76513435		2198	4298	6496	SO:0001630	splice_region_variant	85445				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr16:76513435G>T	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1891+1G>T	16.37:g.76513435G>T						CNTNAP4_uc002fev.1_Nonsense_Mutation_p.E492*|CNTNAP4_uc010chb.1_Nonsense_Mutation_p.E555*|CNTNAP4_uc002fex.1_Nonsense_Mutation_p.E631*|CNTNAP4_uc002few.2_Nonsense_Mutation_p.E603*	p.E628*	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN			14	2267	+			628			Extracellular (Potential).|Fibrinogen C-terminal.		E9PFZ6|Q86YZ7	Nonsense_Mutation	SNP	ENST00000476707.1	37	c.1882G>T		.	.	.	.	.	.	.	.	.	.	G	28.1	4.893554	0.91889	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.3573	0.94420	0.0:0.0:1.0:0.0	.	.	.	.	X	627;579;555;631	.	ENSP00000306893:E627X	E	+	1	0	CNTNAP4	75070936	1.000000	0.71417	0.997000	0.53966	0.059000	0.15707	9.575000	0.98187	2.902000	0.99343	0.650000	0.86243	GAA		0.333	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	Nonsense_Mutation	21	62	1	0	1.00905e-13	0.008871	1.78082e-13	21	62				
CNTNAP4	85445	broad.mit.edu	37	16	76569441	76569441	+	Splice_Site	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr16:76569441G>T	ENST00000476707.1	+	17	2903		c.e17-1		CNTNAP4_ENST00000377504.4_Splice_Site|CNTNAP4_ENST00000478060.1_Splice_Site|CNTNAP4_ENST00000469589.1_Splice_Site|CNTNAP4_ENST00000307431.8_Splice_Site			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4						cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TTCCCTTTTAGGTGGAACGGC	0.463																																							uc002feu.1		NA																	0				ovary(1)|pancreas(1)	2						c.e20-1		cell recognition protein CASPR4 isoform 1							49.0	53.0	52.0					16																	76569441		2190	4299	6489	SO:0001630	splice_region_variant	85445				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr16:76569441G>T	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.2765-1G>T	16.37:g.76569441G>T						CNTNAP4_uc002fev.1_Splice_Site_p.G783_splice|CNTNAP4_uc010chb.1_Splice_Site_p.G846_splice|CNTNAP4_uc002fex.1_Splice_Site_p.G922_splice	p.G919_splice	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN			20	3141	+								E9PFZ6|Q86YZ7	Splice_Site	SNP	ENST00000476707.1	37	c.2756_splice		.	.	.	.	.	.	.	.	.	.	G	25.2	4.611632	0.87258	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8927	0.92412	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTNAP4	75126942	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.687000	0.91594	0.655000	0.94253	.		0.463	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	Intron	13	29	1	0	4.3838e-07	0.001855	6.16077e-07	13	29				
TRPV3	162514	broad.mit.edu	37	17	3448539	3448539	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:3448539C>A	ENST00000576742.1	-	3	467	c.146G>T	c.(145-147)gGg>gTg	p.G49V	TRPV3_ENST00000301365.4_Missense_Mutation_p.G49V|TRPV3_ENST00000572519.1_Missense_Mutation_p.G49V	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	49					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	GGGTTCAAACCCTTCTATCTC	0.597																																							uc002fvt.1		NA																	0				ovary(4)	4						c.(145-147)GGG>GTG		transient receptor potential cation channel,	Menthol(DB00825)						120.0	101.0	108.0					17																	3448539		2203	4300	6503	SO:0001583	missense	162514					integral to membrane	calcium channel activity	g.chr17:3448539C>A	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.146G>T	17.37:g.3448539C>A	ENSP00000461518:p.Gly49Val					TRPV3_uc010vrh.1_Missense_Mutation_p.G33V|TRPV3_uc010vri.1_Missense_Mutation_p.G33V|TRPV3_uc010vrj.1_Missense_Mutation_p.G33V|TRPV3_uc010vrk.1_RNA|TRPV3_uc010vrl.1_Missense_Mutation_p.G33V|TRPV3_uc010vrm.1_RNA|TRPV3_uc002fvr.2_Missense_Mutation_p.G49V|TRPV3_uc002fvu.2_Missense_Mutation_p.G49V	p.G49V	NM_145068	NP_659505	Q8NET8	TRPV3_HUMAN			3	468	-			49			Cytoplasmic (Potential).		Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	ENST00000576742.1	37	c.146G>T	CCDS11029.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.018961	0.75275	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	T	0.42131	0.98	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000003	T	0.50154	0.1599	N	0.24115	0.695	0.80722	D	1	D;D;P;D;D;P;P	0.89917	1.0;1.0;0.912;1.0;1.0;0.802;0.875	D;D;B;D;D;B;P	0.91635	0.999;0.998;0.43;0.998;0.999;0.338;0.54	T	0.40213	-0.9575	10	0.28530	T	0.3	-15.3361	16.4887	0.84193	0.0:1.0:0.0:0.0	.	33;33;49;33;49;49;49	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	V	49;49;33	ENSP00000301365:G49V	ENSP00000301365:G49V	G	-	2	0	TRPV3	3395289	0.996000	0.38824	0.969000	0.41365	0.933000	0.57130	4.257000	0.58816	2.647000	0.89833	0.511000	0.50034	GGG		0.597	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068		16	42	1	0	0.00400662	0.004007	0.00450828	16	42				
ITGAE	3682	broad.mit.edu	37	17	3649152	3649152	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:3649152C>A	ENST00000263087.4	-	18	2323	c.2225G>T	c.(2224-2226)tGt>tTt	p.C742F		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	742					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		TACGTCTGAACACTGCAGCCG	0.587																																					NSCLC(182;635 2928 8995 38788)	NSCLC(182;635 2928 8995 38788)	uc002fwo.3		NA																	0				large_intestine(2)|breast(1)|pancreas(1)	4						c.(2224-2226)TGT>TTT		integrin, alpha E precursor							139.0	110.0	120.0					17																	3649152		2203	4300	6503	SO:0001583	missense	3682				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr17:3649152C>A	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.2225G>T	17.37:g.3649152C>A	ENSP00000263087:p.Cys742Phe						p.C742F	NM_002208	NP_002199	P38570	ITAE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)	18	2324	-			742			Extracellular (Potential).		Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	37	c.2225G>T	CCDS32531.1	.	.	.	.	.	.	.	.	.	.	C	0.616	-0.822964	0.02755	.	.	ENSG00000083457	ENST00000263087	T	0.20738	2.05	4.33	0.92	0.19397	Integrin alpha-2 (1);	.	.	.	.	T	0.12135	0.0295	L	0.42245	1.32	0.27959	N	0.936869	B	0.14438	0.01	B	0.10450	0.005	T	0.40040	-0.9584	9	0.02654	T	1	.	3.3319	0.07087	0.2033:0.5747:0.0:0.222	.	742	P38570	ITAE_HUMAN	F	742	ENSP00000263087:C742F	ENSP00000263087:C742F	C	-	2	0	ITGAE	3595901	0.364000	0.24997	0.539000	0.28077	0.422000	0.31414	0.290000	0.18975	0.543000	0.28864	0.537000	0.68136	TGT		0.587	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208		19	52	1	0	6.49762e-13	0.006122	1.11225e-12	19	52				
ASGR1	432	broad.mit.edu	37	17	7077011	7077011	+	Silent	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:7077011C>G	ENST00000269299.3	-	9	1242	c.843G>C	c.(841-843)ctG>ctC	p.L281L	ASGR1_ENST00000380920.4_Silent_p.L180L|ASGR1_ENST00000574388.1_Silent_p.L242L	NM_001197216.2|NM_001671.4	NP_001184145.1|NP_001662.1	P07306	ASGR1_HUMAN	asialoglycoprotein receptor 1	281					cellular response to extracellular stimulus (GO:0031668)|receptor-mediated endocytosis (GO:0006898)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	asialoglycoprotein receptor activity (GO:0004873)|carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	10						TGGCCTTGTCCAGCTCTGTCT	0.637																																							uc002ges.3		NA																	0				breast(1)|central_nervous_system(1)	2						c.(841-843)CTG>CTC		asialoglycoprotein receptor 1							39.0	41.0	40.0					17																	7077011		2184	4252	6436	SO:0001819	synonymous_variant	432				receptor-mediated endocytosis	integral to plasma membrane	asialoglycoprotein receptor activity|metal ion binding|sugar binding	g.chr17:7077011C>G		CCDS11089.1, CCDS56017.1	17p13-p11	2011-08-30			ENSG00000141505	ENSG00000141505		"""C-type lectin domain containing"""	742	protein-coding gene	gene with protein product		108360					Standard	NM_001671		Approved	CLEC4H1	uc002ges.4	P07306	OTTHUMG00000102159	ENST00000269299.3:c.843G>C	17.37:g.7077011C>G						ASGR1_uc010clx.1_3'UTR	p.L281L	NM_001671	NP_001662	P07306	ASGR1_HUMAN			9	1253	-			281			Extracellular (Probable).		I3L1X1	Silent	SNP	ENST00000269299.3	37	c.843G>C	CCDS11089.1																																																																																				0.637	ASGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220004.3	NM_001671		7	46	0	0	0	0.00308	0	7	46				
TP53	7157	broad.mit.edu	37	17	7577547	7577547	+	Missense_Mutation	SNP	C	C	A	rs121912656|rs397516437		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:7577547C>A	ENST00000269305.4	-	7	923	c.734G>T	c.(733-735)gGc>gTc	p.G245V	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.G245V|TP53_ENST00000420246.2_Missense_Mutation_p.G245V|TP53_ENST00000455263.2_Missense_Mutation_p.G245V|TP53_ENST00000359597.4_Missense_Mutation_p.G245V|TP53_ENST00000445888.2_Missense_Mutation_p.G245V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245D(104)|p.G245V(66)|p.G245A(8)|p.0?(8)|p.?(5)|p.G152V(4)|p.G244_M246>V(3)|p.G152D(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.G245fs*2(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.C238_M246delCNSSCMGGM(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTTCATGCCGCCCATGCA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		219	Substitution - Missense(191)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	p.G245S(274)|p.G245D(93)|p.G245V(50)|p.G245C(47)|p.G245R(10)|p.G245A(8)|p.0?(7)|p.G245G(3)|p.G245fs*2(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245del(1)|p.C242fs*98(1)|p.G245fs*22(1)|p.M243fs*18(1)|p.S241_G245delSCMGG(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)	large_intestine(37)|lung(32)|oesophagus(23)|breast(22)|ovary(18)|upper_aerodigestive_tract(16)|haematopoietic_and_lymphoid_tissue(15)|liver(9)|prostate(7)|stomach(6)|central_nervous_system(6)|skin(6)|biliary_tract(5)|urinary_tract(5)|bone(5)|pancreas(4)|cervix(1)|vulva(1)|endometrium(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM010464|CM900209	TP53	M	rs121912656	c.(733-735)GGC>GTC	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							151.0	113.0	126.0					17																	7577547		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577547C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.734G>T	17.37:g.7577547C>A	ENSP00000269305:p.Gly245Val	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.G245V|TP53_uc002gih.2_Missense_Mutation_p.G245V|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G113V|TP53_uc010cng.1_Missense_Mutation_p.G113V|TP53_uc002gii.1_Missense_Mutation_p.G113V|TP53_uc010cnh.1_Missense_Mutation_p.G245V|TP53_uc010cni.1_Missense_Mutation_p.G245V|TP53_uc002gij.2_Missense_Mutation_p.G245V|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.G152V|TP53_uc002gio.2_Missense_Mutation_p.G113V	p.G245V	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	928	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	245		G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> A (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> E (in a sporadic cancer; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.734G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563102	0.86335	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0;1.0	D	0.96045	0.9027	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	V	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245V;ENSP00000352610:G245V;ENSP00000269305:G245V;ENSP00000398846:G245V;ENSP00000391127:G245V;ENSP00000391478:G245V;ENSP00000425104:G113V;ENSP00000423862:G152V	ENSP00000269305:G245V	G	-	2	0	TP53	7518272	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		8	43	1	0	0.00307968	0.00308	0.00347099	8	43				
MYH13	8735	broad.mit.edu	37	17	10222310	10222310	+	Missense_Mutation	SNP	G	G	T	rs200861648	byFrequency	TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:10222310G>T	ENST00000418404.3	-	26	3698	c.3535C>A	c.(3535-3537)Cgc>Agc	p.R1179S	RP11-401O9.3_ENST00000577743.1_RNA|RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.R1179S			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1179					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						AGGTCCCTGCGCATTTTCTGG	0.582																																							uc002gmk.1		NA																	0				ovary(4)|skin(2)	6						c.(3535-3537)CGC>AGC		myosin, heavy polypeptide 13, skeletal muscle							132.0	135.0	134.0					17																	10222310		2203	4300	6503	SO:0001583	missense	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10222310G>T	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.3535C>A	17.37:g.10222310G>T	ENSP00000404570:p.Arg1179Ser						p.R1179S	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN			27	3625	-			1179			Potential.		O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	c.3535C>A	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531553	0.64972	.	.	ENSG00000006788	ENST00000252172	D	0.83755	-1.76	4.05	4.05	0.47172	Myosin tail (1);	.	.	.	.	D	0.93963	0.8067	H	0.97983	4.12	0.33556	D	0.596708	D	0.76494	0.999	D	0.87578	0.998	D	0.96447	0.9331	9	0.87932	D	0	.	11.9523	0.52962	0.0:0.0:0.8264:0.1735	.	1179	Q9UKX3	MYH13_HUMAN	S	1179	ENSP00000252172:R1179S	ENSP00000252172:R1179S	R	-	1	0	MYH13	10163035	1.000000	0.71417	0.972000	0.41901	0.989000	0.77384	4.380000	0.59581	2.236000	0.73375	0.591000	0.81541	CGC		0.582	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		45	122	1	0	8.01111e-26	0.002522	1.65806e-25	45	122				
MYH2	4620	broad.mit.edu	37	17	10432977	10432977	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:10432977C>A	ENST00000245503.5	-	24	3405	c.3021G>T	c.(3019-3021)gaG>gaT	p.E1007D	MYH2_ENST00000532183.2_Intron|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.E1007D|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1007					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GCTGGTGGGCCTCCTGGAGAG	0.483																																							uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(3019-3021)GAG>GAT		myosin heavy chain IIa							139.0	137.0	138.0					17																	10432977		2202	4281	6483	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10432977C>A		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3021G>T	17.37:g.10432977C>A	ENSP00000245503:p.Glu1007Asp					uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.E1007D|MYH2_uc010coj.2_Intron	p.E1007D	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN			24	3149	-			1007			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.3021G>T	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287177	0.80803	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.89343	-2.5;-2.5	5.24	5.24	0.73138	.	0.000000	0.39687	U	0.001290	D	0.91821	0.7412	M	0.67700	2.07	0.50039	D	0.999848	D	0.54964	0.969	P	0.57846	0.828	D	0.92046	0.5644	10	0.72032	D	0.01	.	12.3516	0.55151	0.0:0.9233:0.0:0.0767	.	1007	Q9UKX2	MYH2_HUMAN	D	1007	ENSP00000245503:E1007D;ENSP00000380367:E1007D	ENSP00000245503:E1007D	E	-	3	2	MYH2	10373702	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.815000	0.38981	2.718000	0.92993	0.591000	0.81541	GAG		0.483	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		34	110	1	0	1.63038e-21	0.00361	3.24649e-21	34	110				
MYH3	4621	broad.mit.edu	37	17	10543408	10543408	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:10543408C>T	ENST00000583535.1	-	22	2674	c.2587G>A	c.(2587-2589)Gaa>Aaa	p.E863K	MYH3_ENST00000226209.7_Missense_Mutation_p.E863K	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	863					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TTGGCGAGTTCATCTTTGGTT	0.478																																							uc002gmq.1		NA																	0				ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(2587-2589)GAA>AAA		myosin, heavy chain 3, skeletal muscle,							153.0	138.0	143.0					17																	10543408		2203	4300	6503	SO:0001583	missense	4621				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10543408C>T		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.2587G>A	17.37:g.10543408C>T	ENSP00000464317:p.Glu863Lys						p.E863K	NM_002470	NP_002461	P11055	MYH3_HUMAN			21	2664	-			863			Potential.		Q15492	Missense_Mutation	SNP	ENST00000583535.1	37	c.2587G>A	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.945863	0.53079	.	.	ENSG00000109063	ENST00000226209	D	0.82255	-1.59	5.54	5.54	0.83059	.	.	.	.	.	T	0.68997	0.3062	N	0.16266	0.395	0.38044	D	0.935547	B	0.15141	0.012	B	0.16289	0.015	T	0.64330	-0.6433	9	0.10377	T	0.69	.	13.108	0.59257	0.0:0.9265:0.0:0.0735	.	863	P11055	MYH3_HUMAN	K	863	ENSP00000226209:E863K	ENSP00000226209:E863K	E	-	1	0	MYH3	10484133	0.782000	0.28689	0.894000	0.35097	0.939000	0.58152	6.088000	0.71371	2.754000	0.94517	0.655000	0.94253	GAA		0.478	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470		21	68	0	0	0	0.002299	0	21	68				
NF1	4763	broad.mit.edu	37	17	29528427	29528427	+	Splice_Site	SNP	A	A	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:29528427A>G	ENST00000358273.4	+	11	1568		c.e11-1		NF1_ENST00000356175.3_Splice_Site|NF1_ENST00000431387.4_Splice_Site	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1						actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CTTTTTCTATAGATCTGCCTG	0.308			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		14	Whole gene deletion(8)|Unknown(6)	p.?(2)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|lung(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330	GRCh37	CS086403	NF1	S		c.e11-2		neurofibromin isoform 1							65.0	73.0	70.0					17																	29528427		2200	4293	6493	SO:0001630	splice_region_variant	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29528427A>G		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1186-1A>G	17.37:g.29528427A>G		TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)				NF1_uc002hge.1_Splice_Site_p.I396_splice|NF1_uc002hgf.1_Splice_Site_p.I396_splice|NF1_uc002hgh.2_Splice_Site_p.I396_splice|NF1_uc010csn.1_Splice_Site_p.I256_splice	p.I396_splice	NM_001042492	NP_001035957	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	11	1519	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)						O00662|Q14284|Q14930|Q14931|Q9UMK3	Splice_Site	SNP	ENST00000358273.4	37	c.1186_splice	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.841954	0.51057	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9965	0.71436	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF1	26552553	1.000000	0.71417	0.978000	0.43139	0.682000	0.39822	8.421000	0.90259	1.953000	0.56701	0.402000	0.26972	.		0.308	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	Intron	58	80	0	0	0	0.00361	0	58	80				
SLFN12	55106	broad.mit.edu	37	17	33738771	33738771	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:33738771G>A	ENST00000394562.1	-	6	1846	c.1323C>T	c.(1321-1323)ctC>ctT	p.L441L	RP11-686D22.8_ENST00000587012.1_RNA|SLFN12_ENST00000452764.3_Silent_p.L441L|SLFN12_ENST00000304905.5_Silent_p.L441L|SLFN12_ENST00000460530.1_5'UTR			Q8IYM2	SLN12_HUMAN	schlafen family member 12	441							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GAGCATCACAGAGGACTTTGT	0.463																																							uc002hji.3		NA																	0				skin(1)	1						c.(1321-1323)CTC>CTT		schlafen family member 12							104.0	104.0	104.0					17																	33738771		2203	4300	6503	SO:0001819	synonymous_variant	55106						ATP binding	g.chr17:33738771G>A	AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.1323C>T	17.37:g.33738771G>A						SLFN12_uc002hjj.3_Silent_p.L441L|SLFN12_uc010cts.2_Silent_p.L441L	p.L441L	NM_018042	NP_060512	Q8IYM2	SLN12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	4	1700	-		Ovarian(249;0.17)	441					A8K711|Q9NP47	Silent	SNP	ENST00000394562.1	37	c.1323C>T	CCDS11295.1																																																																																				0.463	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256491.1	NM_018042		35	62	0	0	0	0.004289	0	35	62				
PIGW	284098	broad.mit.edu	37	17	34893860	34893860	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:34893860G>A	ENST00000592983.1	+	2	1490	c.910G>A	c.(910-912)Gaa>Aaa	p.E304K	PIGW_ENST00000328396.2_Missense_Mutation_p.E304K|MYO19_ENST00000590081.1_Intron			Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class W	304					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TGCCAACCGCGAAGGAATAAT	0.428																																							uc002hmy.1		NA																	0					0						c.(910-912)GAA>AAA		phosphatidylinositol glycan, class W							80.0	78.0	79.0					17																	34893860		2203	4300	6503	SO:0001583	missense	284098				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	O-acyltransferase activity	g.chr17:34893860G>A	AB097818	CCDS11313.1	17q21.1	2014-05-06	2006-06-28		ENSG00000184886	ENSG00000277161		"""Phosphatidylinositol glycan anchor biosynthesis"""	23213	protein-coding gene	gene with protein product		610275	"""phosphatidylinositol glycan, class W"""			14517336, 12714589	Standard	XM_005257238		Approved	Gwt1, FLJ37433	uc002hmz.1	Q7Z7B1	OTTHUMG00000188438	ENST00000592983.1:c.910G>A	17.37:g.34893860G>A	ENSP00000468778:p.Glu304Lys					MYO19_uc010cuu.2_5'Flank|MYO19_uc010wcy.1_5'Flank|MYO19_uc010wcz.1_5'Flank|MYO19_uc010wda.1_5'Flank|MYO19_uc002hmx.2_5'Flank|PIGW_uc002hmz.1_Missense_Mutation_p.E304K	p.E304K	NM_178517	NP_848612	Q7Z7B1	PIGW_HUMAN	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	2	953	+		Breast(25;0.00957)|Ovarian(249;0.17)	304					Q8N9G3	Missense_Mutation	SNP	ENST00000592983.1	37	c.910G>A	CCDS11313.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.638965	0.87760	.	.	ENSG00000184886	ENST00000328396	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.86535	0.5956	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	D	0.89764	0.3949	8	.	.	.	-10.1416	18.2414	0.89968	0.0:0.0:1.0:0.0	.	304	Q7Z7B1	PIGW_HUMAN	K	304	.	.	E	+	1	0	PIGW	31967973	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.120000	0.94369	2.619000	0.88677	0.561000	0.74099	GAA		0.428	PIGW-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451318.1	NM_178517		8	77	0	0	0	0.00308	0	8	77				
CDK12	51755	broad.mit.edu	37	17	37619304	37619304	+	Missense_Mutation	SNP	A	A	G	rs376614675		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:37619304A>G	ENST00000447079.4	+	1	1013	c.980A>G	c.(979-981)tAt>tGt	p.Y327C	CDK12_ENST00000430627.2_Missense_Mutation_p.Y327C	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	327					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						CCCAGTCCCTATGGTCGAAGG	0.562			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																													uc010cvv.2		NA		Rec	yes		17	17q12	51755		cyclin-dependent kinase 12			E					0				ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						c.(979-981)TAT>TGT		Cdc2-related kinase, arginine/serine-rich							65.0	64.0	64.0					17																	37619304		2203	4300	6503	SO:0001583	missense	51755				mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr17:37619304A>G	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.980A>G	17.37:g.37619304A>G	ENSP00000398880:p.Tyr327Cys	TCGA Ovarian(9;0.13)				CDK12_uc010wef.1_Missense_Mutation_p.Y327C|CDK12_uc002hrw.3_Missense_Mutation_p.Y327C	p.Y327C	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN			1	1566	+			327					A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	c.980A>G	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	A	14.45	2.539654	0.45176	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.74315	-0.83;0.99	5.3	5.3	0.74995	.	0.000000	0.42053	D	0.000763	T	0.81569	0.4850	L	0.59436	1.845	0.49582	D	0.999809	D;D;D	0.89917	0.999;0.999;1.0	P;P;D	0.65874	0.87;0.87;0.939	T	0.82841	-0.0258	10	0.62326	D	0.03	-7.2333	11.0802	0.48055	0.8615:0.0:0.0:0.1385	.	327;327;327	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	C	327	ENSP00000407720:Y327C;ENSP00000398880:Y327C	ENSP00000407720:Y327C	Y	+	2	0	CDK12	34872830	1.000000	0.71417	0.978000	0.43139	0.971000	0.66376	6.287000	0.72671	2.016000	0.59253	0.533000	0.62120	TAT		0.562	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507		17	40	0	0	0	0.007413	0	17	40				
KRTAP3-3	85293	broad.mit.edu	37	17	39150184	39150184	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:39150184G>T	ENST00000391586.1	-	1	201	c.166C>A	c.(166-168)Cac>Aac	p.H56N		NM_033185.2	NP_149441.1	Q9BYR6	KRA33_HUMAN	keratin associated protein 3-3	56	3 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			lung(2)|prostate(2)	4		Breast(137;0.00043)				TGAGGAATGTGGCAGGGTGGG	0.617																																							uc002hvr.1		NA																	0					0						c.(166-168)CAC>AAC		keratin associated protein 3-3							112.0	81.0	92.0					17																	39150184		2203	4296	6499	SO:0001583	missense	85293					keratin filament	structural molecule activity	g.chr17:39150184G>T	AJ406933	CCDS32643.1	17q21.2	2013-06-25			ENSG00000212899	ENSG00000212899		"""Keratin associated proteins"""	18890	protein-coding gene	gene with protein product						11279113	Standard	NM_033185		Approved	KAP3.3	uc002hvr.1	Q9BYR6	OTTHUMG00000133591	ENST00000391586.1:c.166C>A	17.37:g.39150184G>T	ENSP00000375428:p.His56Asn						p.H56N	NM_033185	NP_149441	Q9BYR6	KRA33_HUMAN			1	202	-		Breast(137;0.00043)	56			3 X 5 AA repeats of C-C-X(3).		Q52LP0|Q6NTD4	Missense_Mutation	SNP	ENST00000391586.1	37	c.166C>A	CCDS32643.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789366	0.31685	.	.	ENSG00000212899	ENST00000391586	T	0.22743	1.94	5.89	2.88	0.33553	.	0.198011	0.35407	N	0.003233	T	0.25005	0.0607	.	.	.	0.27053	N	0.963742	P	0.39404	0.672	P	0.49752	0.621	T	0.08576	-1.0715	9	0.23302	T	0.38	.	9.3432	0.38093	0.2177:0.0:0.7823:0.0	.	56	Q9BYR6	KRA33_HUMAN	N	56	ENSP00000375428:H56N	ENSP00000375428:H56N	H	-	1	0	KRTAP3-3	36403710	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	1.009000	0.29886	0.405000	0.25532	-2.271000	0.00274	CAC		0.617	KRTAP3-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257695.1			27	46	1	0	3.6726e-16	0.003954	6.94844e-16	27	46				
KRT37	8688	broad.mit.edu	37	17	39577234	39577234	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:39577234G>T	ENST00000225550.3	-	7	1245	c.1246C>A	c.(1246-1248)Ccc>Acc	p.P416T	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	416	Tail.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				GGATTGCAGGGGAGTCTGCAG	0.552																																							uc002hwp.1		NA																	0				skin(1)	1						c.(1246-1248)CCC>ACC		keratin 37							62.0	63.0	63.0					17																	39577234		2203	4300	6503	SO:0001583	missense	8688					intermediate filament	structural molecule activity	g.chr17:39577234G>T	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.1246C>A	17.37:g.39577234G>T	ENSP00000225550:p.Pro416Thr					uc002hwo.1_Intron	p.P416T	NM_003770	NP_003761	O76014	KRT37_HUMAN			7	1293	-		Breast(137;0.000496)	416			Tail.			Missense_Mutation	SNP	ENST00000225550.3	37	c.1246C>A	CCDS32653.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230915	0.58777	.	.	ENSG00000108417	ENST00000225550	D	0.81821	-1.54	5.27	5.27	0.74061	.	0.000000	0.49305	D	0.000155	T	0.69305	0.3096	N	0.08118	0	0.30350	N	0.784831	D	0.58268	0.982	P	0.47118	0.538	T	0.71991	-0.4425	10	0.48119	T	0.1	.	14.3832	0.66926	0.0:0.0:1.0:0.0	.	416	O76014	KRT37_HUMAN	T	416	ENSP00000225550:P416T	ENSP00000225550:P416T	P	-	1	0	KRT37	36830760	1.000000	0.71417	0.786000	0.31890	0.535000	0.34838	4.504000	0.60414	2.460000	0.83146	0.655000	0.94253	CCC		0.552	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770		15	31	1	0	0.000219431	0.00245	0.000259743	15	31				
HAP1	9001	broad.mit.edu	37	17	39881192	39881192	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:39881192C>T	ENST00000310778.5	-	12	1786	c.1777G>A	c.(1777-1779)Gag>Aag	p.E593K	JUP_ENST00000540235.1_Intron|HAP1_ENST00000341193.5_Missense_Mutation_p.E524K|HAP1_ENST00000347901.4_Missense_Mutation_p.E541K|HAP1_ENST00000393939.2_Missense_Mutation_p.E516K			P54257	HAP1_HUMAN	huntingtin-associated protein 1	593	Glu-rich.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			TCCACCTCCTCCCAGCCCTCG	0.627																																							uc002hxm.1		NA																	0				ovary(2)	2						c.(1777-1779)GAG>AAG		huntingtin-associated protein 1 isoform 2							294.0	262.0	272.0					17																	39881192		2203	4300	6503	SO:0001583	missense	9001				brain development|protein localization|synaptic transmission	actin cytoskeleton	protein binding	g.chr17:39881192C>T	AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1777G>A	17.37:g.39881192C>T	ENSP00000309392:p.Glu593Lys					JUP_uc010wfs.1_Intron|HAP1_uc002hxn.1_Missense_Mutation_p.E541K|HAP1_uc002hxo.1_Missense_Mutation_p.E524K|HAP1_uc002hxp.1_Missense_Mutation_p.E516K	p.E593K	NM_177977	NP_817084	P54257	HAP1_HUMAN	BRCA - Breast invasive adenocarcinoma(4;0.0677)		12	1789	-		Breast(137;0.000162)	593			Glu-rich.		A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	ENST00000310778.5	37	c.1777G>A		.	.	.	.	.	.	.	.	.	.	C	14.81	2.647965	0.47258	.	.	ENSG00000173805	ENST00000458656;ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T;T	0.43688	0.94;2.54;2.94;2.63;2.57	4.14	2.15	0.27550	.	0.000000	0.42420	D	0.000701	T	0.46619	0.1402	L	0.29908	0.895	0.25132	N	0.990563	P;P;D;D	0.67145	0.703;0.703;0.996;0.993	B;B;D;D	0.76071	0.391;0.299;0.987;0.971	T	0.17410	-1.0370	10	0.87932	D	0	-18.7147	8.0938	0.30816	0.0:0.7927:0.0:0.2073	.	516;524;541;593	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	K	48;516;593;541;524	ENSP00000404640:E48K;ENSP00000377513:E516K;ENSP00000309392:E593K;ENSP00000334002:E541K;ENSP00000343170:E524K	ENSP00000309392:E593K	E	-	1	0	HAP1	37134718	1.000000	0.71417	1.000000	0.80357	0.144000	0.21451	1.049000	0.30392	1.090000	0.41315	0.511000	0.50034	GAG		0.627	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	NM_003949		15	331	0	0	0	0.003163	0	15	331				
JUP	3728	broad.mit.edu	37	17	39927916	39927916	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:39927916C>G	ENST00000393931.3	-	2	309	c.191G>C	c.(190-192)gGg>gCg	p.G64A	JUP_ENST00000540235.1_Missense_Mutation_p.G64A|JUP_ENST00000310706.5_Missense_Mutation_p.G64A|JUP_ENST00000393930.1_Missense_Mutation_p.G64A	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	64					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		GGGGGGCACCCCCTGGGTGTA	0.612																																					Colon(16;42 520 6044 17852 28530)	Colon(16;42 520 6044 17852 28530)	uc002hxq.2		NA																	0				ovary(2)|lung(2)|breast(1)	5						c.(190-192)GGG>GCG		junction plakoglobin							61.0	66.0	64.0					17																	39927916		2203	4300	6503	SO:0001583	missense	3728				adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity	g.chr17:39927916C>G	AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.191G>C	17.37:g.39927916C>G	ENSP00000377508:p.Gly64Ala					JUP_uc010wfs.1_Missense_Mutation_p.G64A|JUP_uc002hxr.2_Missense_Mutation_p.G64A|JUP_uc002hxs.2_Missense_Mutation_p.G64A	p.G64A	NM_021991	NP_068831	P14923	PLAK_HUMAN	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)	2	468	-		Breast(137;0.000162)	64					Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Missense_Mutation	SNP	ENST00000393931.3	37	c.191G>C	CCDS11407.1	.	.	.	.	.	.	.	.	.	.	C	2.067	-0.414003	0.04799	.	.	ENSG00000173801	ENST00000540235;ENST00000393930;ENST00000310706;ENST00000393931;ENST00000449889;ENST00000437187;ENST00000420370;ENST00000424457;ENST00000437369	T;T;T;T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14	4.68	1.48	0.22813	.	1.294210	0.04926	N	0.455826	T	0.22859	0.0552	N	0.21282	0.65	0.21950	N	0.999455	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.20107	-1.0285	10	0.18710	T	0.47	-22.6595	4.3117	0.10974	0.1456:0.4526:0.3178:0.084	.	64;64	B4DE59;P14923	.;PLAK_HUMAN	A	64	ENSP00000441751:G64A;ENSP00000377507:G64A;ENSP00000311113:G64A;ENSP00000377508:G64A;ENSP00000389886:G64A;ENSP00000394146:G64A;ENSP00000411449:G64A;ENSP00000401034:G64A;ENSP00000409948:G64A	ENSP00000311113:G64A	G	-	2	0	JUP	37181442	0.015000	0.18098	0.364000	0.25888	0.174000	0.22865	0.257000	0.18369	0.183000	0.20059	0.542000	0.68232	GGG		0.612	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257406.1			16	39	0	0	0	0.004007	0	16	39				
ITGA2B	3674	broad.mit.edu	37	17	42457145	42457145	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:42457145A>T	ENST00000262407.5	-	18	1821	c.1790T>A	c.(1789-1791)gTg>gAg	p.V597E	ITGA2B_ENST00000353281.4_Missense_Mutation_p.V597E	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	597					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	GAGGCTGAGCACAATGGGGCT	0.607																																							uc002igt.1		NA																	0				ovary(2)|lung(1)	3						c.(1789-1791)GTG>GAG		integrin alpha 2b preproprotein	Tirofiban(DB00775)						96.0	78.0	84.0					17																	42457145		2203	4300	6503	SO:0001583	missense	3674				axon guidance|integrin-mediated signaling pathway|platelet activation|platelet degranulation	integrin complex|platelet alpha granule membrane	identical protein binding|receptor activity	g.chr17:42457145A>T		CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.1790T>A	17.37:g.42457145A>T	ENSP00000262407:p.Val597Glu					ITGA2B_uc002igu.1_Missense_Mutation_p.V78E	p.V597E	NM_000419	NP_000410	P08514	ITA2B_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.191)	18	1822	-		Prostate(33;0.0181)	597			Extracellular (Potential).		B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	ENST00000262407.5	37	c.1790T>A	CCDS32665.1	.	.	.	.	.	.	.	.	.	.	A	11.20	1.568996	0.28003	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	T;T	0.42900	0.96;0.96	4.76	4.76	0.60689	Integrin alpha-2 (1);	0.255736	0.20319	U	0.094668	T	0.54303	0.1850	M	0.72479	2.2	0.80722	D	1	D;D	0.63046	0.992;0.977	P;P	0.62813	0.907;0.765	T	0.53865	-0.8378	10	0.30854	T	0.27	.	5.8724	0.18810	0.8146:0.0:0.1854:0.0	.	195;597	Q59FA8;P08514	.;ITA2B_HUMAN	E	597	ENSP00000262407:V597E;ENSP00000340536:V597E	ENSP00000262407:V597E	V	-	2	0	ITGA2B	39812671	0.766000	0.28496	0.995000	0.50966	0.128000	0.20619	1.790000	0.38734	2.002000	0.58637	0.402000	0.26972	GTG		0.607	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439823.1			16	87	0	0	0	0.004007	0	16	87				
ABCA10	10349	broad.mit.edu	37	17	67197703	67197703	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:67197703C>A	ENST00000269081.4	-	11	2022	c.1113G>T	c.(1111-1113)gaG>gaT	p.E371D	ABCA10_ENST00000416101.2_Missense_Mutation_p.E371D|ABCA10_ENST00000432313.2_Missense_Mutation_p.E371D	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	371					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					CAGAGGAATGCTCAGGATTTA	0.358																																							uc010dfa.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1111-1113)GAG>GAT		ATP-binding cassette, sub-family A, member 10							93.0	96.0	95.0					17																	67197703		2203	4299	6502	SO:0001583	missense	10349				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:67197703C>A	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.1113G>T	17.37:g.67197703C>A	ENSP00000269081:p.Glu371Asp					ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_5'UTR|ABCA10_uc010dfc.1_Intron	p.E371D	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN			11	1992	-	Breast(10;6.95e-12)		371					C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	c.1113G>T	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	C	2.731	-0.264296	0.05754	.	.	ENSG00000154263	ENST00000269081;ENST00000416101;ENST00000432313	D;D;D	0.87729	-2.29;-2.09;-1.75	2.78	-0.825	0.10809	.	0.763514	0.10386	U	0.681006	T	0.74137	0.3677	L	0.35593	1.075	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.55153	-0.8185	10	0.21014	T	0.42	.	0.6674	0.00853	0.1726:0.3506:0.1693:0.3074	.	371	Q8WWZ4	ABCAA_HUMAN	D	371	ENSP00000269081:E371D;ENSP00000407772:E371D;ENSP00000387674:E371D	ENSP00000269081:E371D	E	-	3	2	ABCA10	64709298	0.000000	0.05858	0.001000	0.08648	0.803000	0.45373	-1.359000	0.02602	-0.428000	0.07339	0.508000	0.49915	GAG		0.358	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282		14	52	1	0	1.49906e-05	0.00245	1.92454e-05	14	52				
SDK2	54549	broad.mit.edu	37	17	71419589	71419589	+	Silent	SNP	C	C	G	rs146912233		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:71419589C>G	ENST00000392650.3	-	14	1833	c.1833G>C	c.(1831-1833)acG>acC	p.T611T	SDK2_ENST00000388726.3_Silent_p.T611T	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	611	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GCTTGGTCCACGTCAGGTTGA	0.607																																							uc010dfm.2		NA																	0				ovary(2)	2						c.(1831-1833)ACG>ACC		sidekick 2							78.0	58.0	65.0					17																	71419589		2203	4300	6503	SO:0001819	synonymous_variant	54549				cell adhesion	integral to membrane		g.chr17:71419589C>G	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1833G>C	17.37:g.71419589C>G						SDK2_uc010dfn.2_Silent_p.T290T	p.T611T	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN			14	1833	-			611			Extracellular (Potential).|Fibronectin type-III 1.		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	ENST00000392650.3	37	c.1833G>C	CCDS45769.1																																																																																				0.607	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064		12	15	0	0	0	0.000978	0	12	15				
SDK2	54549	broad.mit.edu	37	17	71431626	71431626	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:71431626G>T	ENST00000392650.3	-	9	1158	c.1158C>A	c.(1156-1158)gcC>gcA	p.A386A	SDK2_ENST00000388726.3_Silent_p.A386A	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	386	Ig-like C2-type 4.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GCACCTCGCCGGCTGCATTGC	0.632																																							uc010dfm.2		NA																	0				ovary(2)	2						c.(1156-1158)GCC>GCA		sidekick 2							51.0	39.0	43.0					17																	71431626		2203	4299	6502	SO:0001819	synonymous_variant	54549				cell adhesion	integral to membrane		g.chr17:71431626G>T	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1158C>A	17.37:g.71431626G>T						SDK2_uc010dfn.2_Silent_p.A65A	p.A386A	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN			9	1158	-			386			Extracellular (Potential).|Ig-like C2-type 4.		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	ENST00000392650.3	37	c.1158C>A	CCDS45769.1																																																																																				0.632	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064		3	7	1	0	0.004672	0.004672	0.00517176	3	7				
GGA3	23163	broad.mit.edu	37	17	73235895	73235895	+	Missense_Mutation	SNP	C	C	A	rs539752229		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:73235895C>A	ENST00000245541.6	-	13	1774	c.1558G>T	c.(1558-1560)Gat>Tat	p.D520Y	GGA3_ENST00000538886.1_Missense_Mutation_p.D398Y|GGA3_ENST00000351904.7_Missense_Mutation_p.D487Y|GGA3_ENST00000582717.1_Missense_Mutation_p.D448Y|GGA3_ENST00000578348.1_Missense_Mutation_p.D398Y|GGA3_ENST00000582486.1_Missense_Mutation_p.D448Y	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	520	Unstructured hinge.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			AGAAGCTGATCGAGGGCATCC	0.587																																							uc002jni.1		NA																	0				ovary(1)|breast(1)	2						c.(1558-1560)GAT>TAT		ADP-ribosylation factor binding protein 3							79.0	51.0	60.0					17																	73235895		2200	4296	6496	SO:0001583	missense	23163				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding	g.chr17:73235895C>A	AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.1558G>T	17.37:g.73235895C>A	ENSP00000245541:p.Asp520Tyr					GGA3_uc002jnj.1_Missense_Mutation_p.D487Y|GGA3_uc010wrw.1_Missense_Mutation_p.D398Y|GGA3_uc002jnk.1_Missense_Mutation_p.D448Y|GGA3_uc010wrx.1_Missense_Mutation_p.D398Y|GGA3_uc010wry.1_Missense_Mutation_p.D448Y	p.D520Y	NM_138619	NP_619525	Q9NZ52	GGA3_HUMAN	all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)		13	1567	-			520			Unstructured hinge.		B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Missense_Mutation	SNP	ENST00000245541.6	37	c.1558G>T	CCDS11717.1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.298434	0.23650	.	.	ENSG00000125447	ENST00000245541;ENST00000351904;ENST00000537584;ENST00000538886	T;T	0.48201	2.14;0.82	5.22	4.03	0.46877	.	1.061630	0.07192	N	0.855999	T	0.63105	0.2483	L	0.55481	1.735	0.09310	N	0.999998	D;D;D	0.65815	0.995;0.994;0.99	P;P;P	0.61658	0.892;0.847;0.706	T	0.53085	-0.8488	10	0.62326	D	0.03	-13.6339	12.937	0.58320	0.0:0.9103:0.0:0.0897	.	398;487;520	B7Z7E2;Q9NZ52-2;Q9NZ52	.;.;GGA3_HUMAN	Y	520;487;448;398	ENSP00000245541:D520Y;ENSP00000326575:D487Y	ENSP00000245541:D520Y	D	-	1	0	GGA3	70747490	0.876000	0.30132	0.743000	0.31040	0.866000	0.49608	2.660000	0.46749	2.419000	0.82065	0.563000	0.77884	GAT		0.587	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446645.1	NM_138619		13	33	1	0	9.05144e-12	0.001855	1.51152e-11	13	33				
QRICH2	84074	broad.mit.edu	37	17	74301008	74301008	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:74301008C>A	ENST00000262765.5	-	2	230	c.51G>T	c.(49-51)cgG>cgT	p.R17R		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	17										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						GTTCATCAACCCGCTGTAAAA	0.517																																							uc002jrd.1		NA																	0				ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						c.(49-51)CGG>CGT		glutamine rich 2							169.0	171.0	171.0					17																	74301008		2203	4300	6503	SO:0001819	synonymous_variant	84074						protein binding	g.chr17:74301008C>A	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.51G>T	17.37:g.74301008C>A						QRICH2_uc010dgw.1_5'UTR	p.R17R	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN			2	231	-			17					A2RRE1|Q96LM3	Silent	SNP	ENST00000262765.5	37	c.51G>T	CCDS32741.1																																																																																				0.517	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134		45	107	1	0	2.40228e-13	0.003214	4.14332e-13	45	107				
SEPT9	10801	broad.mit.edu	37	17	75398255	75398255	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr17:75398255A>G	ENST00000427177.1	+	3	317	c.191A>G	c.(190-192)cAg>cGg	p.Q64R	SEPT9_ENST00000585930.1_5'Flank|SEPT9_ENST00000423034.2_Missense_Mutation_p.Q57R|SEPT9_ENST00000590294.1_Missense_Mutation_p.Q46R|SEPT9_ENST00000431235.2_5'UTR|SEPT9_ENST00000592420.1_5'UTR|SEPT9_ENST00000449803.2_5'UTR|SEPT9_ENST00000329047.8_Missense_Mutation_p.Q46R|SEPT9_ENST00000591198.1_Missense_Mutation_p.Q45R|SEPT9_ENST00000588690.1_5'UTR|SEPT9_ENST00000427674.2_5'UTR	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	64					cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			CAGAAATTCCAGGACCTGGGC	0.652																																							uc002jts.3		NA																	0				breast(2)|ovary(1)	3						c.(190-192)CAG>CGG		septin 9 isoform a							32.0	35.0	34.0					17																	75398255		1929	4138	6067	SO:0001583	missense	10801				cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding	g.chr17:75398255A>G	AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.191A>G	17.37:g.75398255A>G	ENSP00000391249:p.Gln64Arg					SEPT9_uc010wtk.1_Missense_Mutation_p.Q45R|SEPT9_uc002jtt.3_5'UTR|SEPT9_uc002jtu.3_Missense_Mutation_p.Q46R|SEPT9_uc002jtv.2_Missense_Mutation_p.Q57R|SEPT9_uc002jtw.2_5'UTR|SEPT9_uc002jtx.1_5'UTR|SEPT9_uc010wtl.1_5'Flank	p.Q64R	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.153)		3	317	+			64					A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Missense_Mutation	SNP	ENST00000427177.1	37	c.191A>G	CCDS45790.1	.	.	.	.	.	.	.	.	.	.	A	13.46	2.244397	0.39697	.	.	ENSG00000184640	ENST00000427177;ENST00000329047;ENST00000423034	T;T;T	0.33654	1.4;1.41;1.47	4.89	4.89	0.63831	.	4.793030	0.00520	U	0.000191	T	0.33440	0.0863	N	0.17082	0.46	0.80722	D	1	P;B;B;B	0.47910	0.902;0.015;0.015;0.036	B;B;B;B	0.43301	0.415;0.026;0.026;0.012	T	0.11867	-1.0570	10	0.36615	T	0.2	.	13.6885	0.62531	1.0:0.0:0.0:0.0	.	45;57;46;64	Q9UHD8-7;Q9UHD8-5;Q9UHD8-2;Q9UHD8	.;.;.;SEPT9_HUMAN	R	64;46;57	ENSP00000391249:Q64R;ENSP00000329161:Q46R;ENSP00000405877:Q57R	ENSP00000329161:Q46R	Q	+	2	0	SEPT9	72909850	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.707000	0.74654	1.834000	0.53371	0.454000	0.30748	CAG		0.652	SEPT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000436304.2	NM_006640		3	50	0	0	0	0.009096	0	3	50				
LAMA1	284217	broad.mit.edu	37	18	7044769	7044769	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr18:7044769G>C	ENST00000389658.3	-	7	1021	c.928C>G	c.(928-930)Cag>Gag	p.Q310E		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	310	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CAGGGCTGCTGATGGTACCCA	0.478																																							uc002knm.2		NA																	0				ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(928-930)CAG>GAG		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						126.0	120.0	122.0					18																	7044769		2203	4300	6503	SO:0001583	missense	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:7044769G>C	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.928C>G	18.37:g.7044769G>C	ENSP00000374309:p.Gln310Glu					LAMA1_uc010wzj.1_Translation_Start_Site	p.Q310E	NM_005559	NP_005550	P25391	LAMA1_HUMAN			7	1022	-		Colorectal(10;0.172)	310			Laminin EGF-like 1.			Missense_Mutation	SNP	ENST00000389658.3	37	c.928C>G	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.510112	0.64522	.	.	ENSG00000101680	ENST00000389658	T	0.62788	0.0	4.82	4.82	0.62117	EGF-like, laminin (4);	0.000000	0.64402	D	0.000001	T	0.80592	0.4652	M	0.87971	2.92	0.58432	D	0.999992	D	0.67145	0.996	D	0.63488	0.915	T	0.82157	-0.0596	10	0.39692	T	0.17	.	18.2561	0.90020	0.0:0.0:1.0:0.0	.	310	P25391	LAMA1_HUMAN	E	310	ENSP00000374309:Q310E	ENSP00000374309:Q310E	Q	-	1	0	LAMA1	7034769	1.000000	0.71417	0.994000	0.49952	0.186000	0.23388	9.769000	0.98969	2.375000	0.81037	0.655000	0.94253	CAG		0.478	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		17	116	0	0	0	0.00499	0	17	116				
CEP192	55125	broad.mit.edu	37	18	13048964	13048964	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr18:13048964C>T	ENST00000325971.8	+	14	1979	c.386C>T	c.(385-387)gCa>gTa	p.A129V	CEP192_ENST00000506447.1_Missense_Mutation_p.A725V|CEP192_ENST00000430049.2_Missense_Mutation_p.A250V			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	129					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						ATTGCAGAGGCATCAGTTAAT	0.413																																							uc010xac.1		NA																	0				ovary(4)|pancreas(1)	5						c.(2173-2175)GCA>GTA		centrosomal protein 192kDa							84.0	81.0	82.0					18																	13048964		2203	4300	6503	SO:0001583	missense	55125							g.chr18:13048964C>T	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.386C>T	18.37:g.13048964C>T	ENSP00000317156:p.Ala129Val					CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.A250V|CEP192_uc002kru.2_RNA|CEP192_uc002krs.1_Missense_Mutation_p.A466V	p.A725V	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN			16	2254	+			725					A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37	c.2174C>T		.	.	.	.	.	.	.	.	.	.	C	11.50	1.658408	0.29425	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.13307	2.74;2.6;2.64	5.14	4.2	0.49525	.	0.240490	0.21589	N	0.072121	T	0.04998	0.0134	N	0.01352	-0.895	0.35845	D	0.826353	P;P;P	0.41450	0.513;0.75;0.75	B;B;B	0.39152	0.103;0.168;0.292	T	0.45175	-0.9279	10	0.35671	T	0.21	-3.1698	10.5795	0.45246	0.0:0.8943:0.0:0.1057	.	250;725;129	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	V	725;129;129;250	ENSP00000427550:A725V;ENSP00000317156:A129V;ENSP00000389190:A250V	ENSP00000317156:A129V	A	+	2	0	CEP192	13038964	0.995000	0.38212	0.098000	0.21074	0.191000	0.23601	3.288000	0.51739	1.130000	0.42092	0.650000	0.86243	GCA		0.413	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142		10	108	0	0	0	0.006214	0	10	108				
POTEC	388468	broad.mit.edu	37	18	14542862	14542862	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr18:14542862C>A	ENST00000358970.5	-	1	283	c.284G>T	c.(283-285)aGg>aTg	p.R95M	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	95										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						CATCTTGCTCCTGAGCGTCTT	0.617																																							uc010dln.2		NA																	0				skin(3)	3						c.(283-285)AGG>ATG		ANKRD26-like family B, member 2							48.0	53.0	52.0					18																	14542862		692	1591	2283	SO:0001583	missense	388468							g.chr18:14542862C>A	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.284G>T	18.37:g.14542862C>A	ENSP00000351856:p.Arg95Met					POTEC_uc010xaj.1_RNA	p.R95M	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN			1	738	-			95						Missense_Mutation	SNP	ENST00000358970.5	37	c.284G>T	CCDS45835.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.272004	0.23221	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.39406	1.08	0.399	0.399	0.16325	.	.	.	.	.	T	0.52629	0.1746	L	0.50333	1.59	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.36648	-0.9739	8	0.51188	T	0.08	.	.	.	.	.	95	B2RU33	POTEC_HUMAN	M	95	ENSP00000351856:R95M	ENSP00000351856:R95M	R	-	2	0	POTEC	14532862	0.007000	0.16637	0.005000	0.12908	0.010000	0.07245	1.180000	0.32005	0.448000	0.26722	0.175000	0.17021	AGG		0.617	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269		8	261	1	0	1.12685e-05	0.004482	1.46598e-05	8	261				
GATA6	2627	broad.mit.edu	37	18	19762969	19762969	+	Missense_Mutation	SNP	A	A	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr18:19762969A>C	ENST00000269216.3	+	6	1862	c.1585A>C	c.(1585-1587)Aat>Cat	p.N529H	GATA6_ENST00000581694.1_Missense_Mutation_p.N529H|RNU6-702P_ENST00000364982.1_RNA	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	529					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			TTGCAGCAAAAATACTTCCCC	0.373																																					Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	uc002ktt.1		NA																	0				central_nervous_system(3)	3						c.(1585-1587)AAT>CAT		GATA binding protein 6							119.0	107.0	111.0					18																	19762969		2203	4300	6503	SO:0001583	missense	2627				blood coagulation|cardiac vascular smooth muscle cell differentiation|cellular response to hypoxia|intestinal epithelial cell differentiation|male gonad development|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor-beta1 production|negative regulation of transforming growth factor-beta2 production|outflow tract septum morphogenesis|positive regulation of angiogenesis|positive regulation of cell cycle arrest|positive regulation of transcription from RNA polymerase II promoter|response to drug|response to growth factor stimulus		protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding	g.chr18:19762969A>C	U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.1585A>C	18.37:g.19762969A>C	ENSP00000269216:p.Asn529His					GATA6_uc002ktu.1_Missense_Mutation_p.N529H	p.N529H	NM_005257	NP_005248	Q92908	GATA6_HUMAN	STAD - Stomach adenocarcinoma(5;0.106)		6	1850	+	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		529					B0YJ17|P78327	Missense_Mutation	SNP	ENST00000269216.3	37	c.1585A>C	CCDS11872.1	.	.	.	.	.	.	.	.	.	.	A	19.69	3.875365	0.72180	.	.	ENSG00000141448	ENST00000269216	D	0.97976	-4.64	6.07	6.07	0.98685	.	0.214632	0.46145	D	0.000316	D	0.97476	0.9174	L	0.59436	1.845	0.58432	D	0.999995	D	0.64830	0.994	P	0.55749	0.783	D	0.96627	0.9464	10	0.21540	T	0.41	-13.3343	15.1979	0.73108	1.0:0.0:0.0:0.0	.	529	Q92908	GATA6_HUMAN	H	529	ENSP00000269216:N529H	ENSP00000269216:N529H	N	+	1	0	GATA6	18016967	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.077000	0.89505	2.326000	0.78906	0.528000	0.53228	AAT		0.373	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254696.1	NM_005257		15	54	0	0	0	0.008871	0	15	54				
DTNA	1837	broad.mit.edu	37	18	32462098	32462098	+	Missense_Mutation	SNP	G	G	T	rs371303988		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr18:32462098G>T	ENST00000399113.3	+	20	2147	c.2147G>T	c.(2146-2148)cGg>cTg	p.R716L	DTNA_ENST00000592449.1_3'UTR|DTNA_ENST00000269192.7_Missense_Mutation_p.R425L|DTNA_ENST00000283365.9_Missense_Mutation_p.R659L|DTNA_ENST00000444659.1_Missense_Mutation_p.R716L|DTNA_ENST00000598334.1_Missense_Mutation_p.R656L|DTNA_ENST00000556414.3_Missense_Mutation_p.R368L|DTNA_ENST00000399097.3_Missense_Mutation_p.R364L|DTNA_ENST00000590831.2_Missense_Mutation_p.R142L|DTNA_ENST00000595022.1_Missense_Mutation_p.R656L|DTNA_ENST00000269190.7_Missense_Mutation_p.R717L|DTNA_ENST00000601125.1_Missense_Mutation_p.R338L|DTNA_ENST00000399121.5_Missense_Mutation_p.R663L|DTNA_ENST00000598142.1_Missense_Mutation_p.R659L|DTNA_ENST00000591182.1_Missense_Mutation_p.R364L			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	716					neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						GACTCTGTCCGGCAGCTGGAG	0.488																																							uc010dmn.1		NA																	0					0						c.(2146-2148)CGG>CTG		dystrobrevin alpha isoform 1							72.0	72.0	72.0					18																	32462098		2203	4300	6503	SO:0001583	missense	1837				neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding	g.chr18:32462098G>T	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.2147G>T	18.37:g.32462098G>T	ENSP00000382064:p.Arg716Leu					DTNA_uc002kxw.2_Missense_Mutation_p.R659L|DTNA_uc010dmj.2_Missense_Mutation_p.R656L|DTNA_uc002kxz.2_Missense_Mutation_p.R663L|DTNA_uc002kxy.2_Missense_Mutation_p.R656L|DTNA_uc010xby.1_Missense_Mutation_p.R406L|DTNA_uc010xbz.1_Missense_Mutation_p.R425L|DTNA_uc010xca.1_Missense_Mutation_p.R368L|DTNA_uc002kye.2_Missense_Mutation_p.R364L	p.R716L	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN			20	2148	+			716					A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	ENST00000399113.3	37	c.2147G>T	CCDS59311.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376844	0.82682	.	.	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000399114;ENST00000269190;ENST00000399097;ENST00000399121;ENST00000444659;ENST00000399113;ENST00000269192;ENST00000450377;ENST00000556414	T;T;T;T	0.21734	1.99;2.01;2.01;2.01	5.96	5.1	0.69264	.	0.000000	0.64402	D	0.000001	T	0.26557	0.0649	N	0.14661	0.345	0.38317	D	0.94342	D;D;P;P;B;D;B;B;B	0.76494	0.999;0.965;0.646;0.895;0.275;0.958;0.18;0.18;0.275	D;P;B;P;B;P;B;B;B	0.63597	0.916;0.827;0.257;0.586;0.045;0.712;0.02;0.02;0.045	T	0.18713	-1.0328	10	0.41790	T	0.15	-12.5243	13.6022	0.62026	0.0715:0.0:0.9285:0.0	.	368;425;406;716;659;364;663;667;659	B4DIU8;B4DIR0;B7Z3X3;Q9Y4J8;F5H5C1;Q9Y4J8-6;E9PEH8;Q59GK7;Q9Y4J8-2	.;.;.;DTNA_HUMAN;.;.;.;.;.	L	659;659;663;717;364;716;716;716;425;364;368	ENSP00000283365:R659L;ENSP00000269190:R717L;ENSP00000405819:R716L;ENSP00000382064:R716L	ENSP00000269190:R717L	R	+	2	0	DTNA	30716096	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.656000	0.54467	1.530000	0.49136	0.650000	0.86243	CGG		0.488	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390		8	33	1	0	1.12685e-05	0.004482	1.46598e-05	8	33				
SETBP1	26040	broad.mit.edu	37	18	42531871	42531871	+	Missense_Mutation	SNP	G	G	A	rs140028039		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr18:42531871G>A	ENST00000282030.5	+	4	2862	c.2566G>A	c.(2566-2568)Gtg>Atg	p.V856M		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	856						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GCTGTCCCCTGTGAGCGAGTC	0.572									Schinzel-Giedion syndrome																														uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(2566-2568)GTG>ATG		SET binding protein 1 isoform a							85.0	56.0	66.0					18																	42531871		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42531871G>A	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2566G>A	18.37:g.42531871G>A	ENSP00000282030:p.Val856Met						p.V856M	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	2862	+			856					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.2566G>A	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069065	0.55539	.	.	ENSG00000152217	ENST00000282030	D	0.90732	-2.72	6.17	6.17	0.99709	.	0.064986	0.64402	D	0.000009	D	0.90696	0.7081	N	0.24115	0.695	0.35244	D	0.778057	D	0.63880	0.993	P	0.62298	0.9	D	0.93219	0.6607	10	0.87932	D	0	.	13.9957	0.64397	0.0685:0.0:0.9315:0.0	.	856	Q9Y6X0	SETBP_HUMAN	M	856	ENSP00000282030:V856M	ENSP00000282030:V856M	V	+	1	0	SETBP1	40785869	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	6.443000	0.73447	2.941000	0.99782	0.655000	0.94253	GTG		0.572	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		14	15	0	0	0	0.00245	0	14	15				
WDR7	23335	broad.mit.edu	37	18	54361959	54361959	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr18:54361959C>T	ENST00000254442.3	+	10	1287	c.1076C>T	c.(1075-1077)tCa>tTa	p.S359L	WDR7_ENST00000357574.3_Missense_Mutation_p.S359L|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	359					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TGGAACATATCAGACACAGCT	0.328																																							uc002lgk.1		NA																	0				ovary(2)|skin(1)	3						c.(1075-1077)TCA>TTA		rabconnectin-3 beta isoform 1							88.0	87.0	87.0					18																	54361959		2203	4299	6502	SO:0001583	missense	23335							g.chr18:54361959C>T	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.1076C>T	18.37:g.54361959C>T	ENSP00000254442:p.Ser359Leu					WDR7_uc010dpk.1_RNA|WDR7_uc002lgl.1_Missense_Mutation_p.S359L	p.S359L	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN		Lung(128;0.0238)|Colorectal(16;0.0296)	10	1287	+			359			WD 4.		A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	37	c.1076C>T	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.959323	0.53400	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.49139	0.79;0.79	5.44	4.56	0.56223	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.340339	0.30151	N	0.010285	T	0.36690	0.0976	N	0.19112	0.55	0.34890	D	0.745434	B;B	0.15930	0.015;0.003	B;B	0.20384	0.029;0.006	T	0.44236	-0.9341	10	0.59425	D	0.04	.	15.7845	0.78291	0.0:0.863:0.137:0.0	.	359;359	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	L	359	ENSP00000254442:S359L;ENSP00000350187:S359L	ENSP00000254442:S359L	S	+	2	0	WDR7	52512957	0.913000	0.31002	0.990000	0.47175	0.966000	0.64601	4.350000	0.59392	1.276000	0.44395	0.585000	0.79938	TCA		0.328	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1			7	27	0	0	0	0.004482	0	7	27				
PTBP1	5725	broad.mit.edu	37	19	810798	810798	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:810798G>C	ENST00000349038.4	+	14	1641	c.1568G>C	c.(1567-1569)cGg>cCg	p.R523P	PTBP1_ENST00000394601.4_Missense_Mutation_p.R542P|PTBP1_ENST00000350092.4_Missense_Mutation_p.R189P|MIR3187_ENST00000583431.1_RNA|PTBP1_ENST00000356948.6_Missense_Mutation_p.R549P	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1	523	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCACCTGCGGGTCTCCTTC	0.612																																							uc002lpr.2		NA																	0				kidney(1)|skin(1)	2						c.(1567-1569)CGG>CCG		polypyrimidine tract-binding protein 1 isoform							60.0	66.0	64.0					19																	810798		2203	4300	6503	SO:0001583	missense	5725				negative regulation of muscle cell differentiation|nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	mRNA binding|nucleotide binding|poly-pyrimidine tract binding|protein binding	g.chr19:810798G>C	X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.1568G>C	19.37:g.810798G>C	ENSP00000014112:p.Arg523Pro					PTBP1_uc002lpp.2_Missense_Mutation_p.R549P|PTBP1_uc002lpq.2_Missense_Mutation_p.R542P|PTBP1_uc002lps.2_Missense_Mutation_p.R189P|PTBP1_uc002lpt.2_RNA|PTBP1_uc002lpu.1_Missense_Mutation_p.R519P|hsa-mir-3187|MI0014231_5'Flank	p.R523P	NM_031991	NP_114368	P26599	PTBP1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	14	1674	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	523			RRM 4.		Q9BUQ0	Missense_Mutation	SNP	ENST00000349038.4	37	c.1568G>C	CCDS32859.1	.	.	.	.	.	.	.	.	.	.	G	32	5.140678	0.94560	.	.	ENSG00000011304	ENST00000356948;ENST00000394601;ENST00000349038;ENST00000350092	T;T;T;T	0.56776	0.46;0.44;0.83;1.28	5.38	5.38	0.77491	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.067657	0.64402	D	0.000016	T	0.81531	0.4842	H	0.95437	3.67	0.80722	D	1	D;D;D;D	0.89917	0.995;1.0;1.0;1.0	D;D;D;D	0.87578	0.994;0.998;0.998;0.998	D	0.87206	0.2244	10	0.87932	D	0	-40.5954	18.1104	0.89533	0.0:0.0:1.0:0.0	.	189;523;542;549	A6NLN1;P26599;P26599-2;Q9BUQ0	.;PTBP1_HUMAN;.;.	P	549;542;523;189	ENSP00000349428:R549P;ENSP00000408096:R542P;ENSP00000014112:R523P;ENSP00000342332:R189P	ENSP00000014112:R523P	R	+	2	0	PTBP1	761798	1.000000	0.71417	0.966000	0.40874	0.849000	0.48306	9.550000	0.98110	2.506000	0.84524	0.655000	0.94253	CGG		0.612	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457605.1			12	72	0	0	0	0.00245	0	12	72				
MCEMP1	199675	broad.mit.edu	37	19	7742605	7742605	+	Silent	SNP	G	G	T	rs142098368		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:7742605G>T	ENST00000333598.3	+	2	631	c.177G>T	c.(175-177)acG>acT	p.T59T	CTD-3214H19.16_ENST00000597959.1_5'Flank|C19orf59_ENST00000597445.1_Intron	NM_174918.2	NP_777578.2	Q8IX19	MCEM1_HUMAN		59						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)|stomach(1)	5						CACGACCCACGAGCCAAGGTG	0.602											OREG0025208	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002mhh.1		NA																	0				skin(1)	1						c.(175-177)ACG>ACT		mast cell-expressed membrane protein 1							59.0	48.0	52.0					19																	7742605		2203	4300	6503	SO:0001819	synonymous_variant	199675					integral to membrane		g.chr19:7742605G>T																												ENST00000333598.3:c.177G>T	19.37:g.7742605G>T			OREG0025208	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	644		p.T59T	NM_174918	NP_777578	Q8IX19	MCEM1_HUMAN			2	202	+			59			Cytoplasmic (Potential).		Q8IX20	Silent	SNP	ENST00000333598.3	37	c.177G>T	CCDS12183.1																																																																																				0.602	C19orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461248.1			5	26	1	0	0.00116845	0.001168	0.00134126	5	26				
ZNF699	374879	broad.mit.edu	37	19	9408097	9408097	+	Silent	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:9408097T>C	ENST00000591998.1	-	5	573	c.345A>G	c.(343-345)gaA>gaG	p.E115E	CTC-325H20.4_ENST00000591336.1_RNA|ZNF699_ENST00000308650.3_Silent_p.E115E			Q32M78	ZN699_HUMAN	zinc finger protein 699	115					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGGATATTTTTTCTCCACAAA	0.348																																							uc002mlc.1		NA																	0					0						c.(343-345)GAA>GAG		zinc finger protein 699							68.0	66.0	66.0					19																	9408097		1813	4066	5879	SO:0001819	synonymous_variant	374879				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9408097T>C	BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.345A>G	19.37:g.9408097T>C							p.E115E	NM_198535	NP_940937	Q32M78	ZN699_HUMAN			4	345	-			115					Q8N9A1	Silent	SNP	ENST00000591998.1	37	c.345A>G	CCDS42495.1																																																																																				0.348	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449010.1	NM_198535		16	44	0	0	0	0.004007	0	16	44				
ZNF791	163049	broad.mit.edu	37	19	12740052	12740052	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:12740052A>G	ENST00000343325.4	+	4	1871	c.1709A>G	c.(1708-1710)cAt>cGt	p.H570R	ZNF791_ENST00000540038.1_Missense_Mutation_p.H461R|ZNF791_ENST00000446165.1_3'UTR|AC010422.1_ENST00000408416.1_RNA|ZNF490_ENST00000465656.1_Intron|ZNF791_ENST00000458122.3_Missense_Mutation_p.H538R	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	570					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						TTAAAAAAACATATGAGAATG	0.333																																							uc002mua.2		NA																	0				ovary(2)	2						c.(1708-1710)CAT>CGT		zinc finger protein 791							54.0	57.0	56.0					19																	12740052		2202	4300	6502	SO:0001583	missense	163049				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12740052A>G	AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.1709A>G	19.37:g.12740052A>G	ENSP00000342974:p.His570Arg					ZNF791_uc010xml.1_Missense_Mutation_p.H538R|ZNF791_uc010dyu.1_Missense_Mutation_p.H461R|ZNF791_uc010xmm.1_Missense_Mutation_p.H461R	p.H570R	NM_153358	NP_699189	Q3KP31	ZN791_HUMAN			4	1871	+			570			C2H2-type 17.		B7Z586|Q8NC99	Missense_Mutation	SNP	ENST00000343325.4	37	c.1709A>G	CCDS12273.1	.	.	.	.	.	.	.	.	.	.	A	10.42	1.346562	0.24426	.	.	ENSG00000173875	ENST00000343325;ENST00000458122;ENST00000540038	D;D;T	0.96200	-3.94;-3.94;2.94	1.83	1.83	0.25207	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.98018	0.9347	H	0.95917	3.74	0.31929	N	0.612384	D	0.76494	0.999	D	0.83275	0.996	D	0.95372	0.8465	9	0.87932	D	0	.	7.2856	0.26337	1.0:0.0:0.0:0.0	.	570	Q3KP31	ZN791_HUMAN	R	570;538;461	ENSP00000342974:H570R;ENSP00000441761:H538R;ENSP00000441038:H461R	ENSP00000342974:H570R	H	+	2	0	ZNF791	12601052	1.000000	0.71417	0.139000	0.22197	0.052000	0.14988	3.259000	0.51515	0.834000	0.34852	0.402000	0.26972	CAT		0.333	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358		18	42	0	0	0	0.010504	0	18	42				
CD97	976	broad.mit.edu	37	19	14507186	14507186	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:14507186T>C	ENST00000242786.5	+	5	459	c.379T>C	c.(379-381)Tgt>Cgt	p.C127R	CD97_ENST00000587728.1_Intron|CD97_ENST00000357355.3_Missense_Mutation_p.C127R|CD97_ENST00000358600.3_Intron	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	127	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CCCAAGGCTCTGTAAAAGCTA	0.572																																							uc002myl.2		NA																	0				ovary(3)|breast(1)	4						c.(379-381)TGT>CGT		CD97 antigen isoform 1 precursor							188.0	147.0	161.0					19																	14507186		2203	4300	6503	SO:0001583	missense	976				cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr19:14507186T>C		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.379T>C	19.37:g.14507186T>C	ENSP00000242786:p.Cys127Arg					CD97_uc002mym.2_Missense_Mutation_p.C127R|CD97_uc002myn.2_Intron	p.C127R	NM_078481	NP_510966	P48960	CD97_HUMAN			5	502	+			127			Extracellular (Potential).|EGF-like 3; calcium-binding (Potential).		A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	c.379T>C	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.314286	0.40996	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000393059	D;D	0.99445	-5.91;-5.91	3.99	2.97	0.34412	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.99513	0.9826	H	0.95004	3.61	0.20975	N	0.999817	B;D	0.69078	0.029;0.997	B;D	0.68765	0.045;0.96	D	0.97626	1.0139	9	0.87932	D	0	.	5.615	0.17426	0.0:0.1268:0.0:0.8732	.	127;127	P48960-3;P48960	.;CD97_HUMAN	R	127;127;126	ENSP00000242786:C127R;ENSP00000349918:C127R	ENSP00000242786:C127R	C	+	1	0	CD97	14368186	0.996000	0.38824	0.004000	0.12327	0.016000	0.09150	2.886000	0.48578	0.605000	0.29947	0.459000	0.35465	TGT		0.572	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481		8	126	0	0	0	0.004482	0	8	126				
EMR2	30817	broad.mit.edu	37	19	14876179	14876179	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:14876179C>A	ENST00000315576.3	-	10	1310	c.859G>T	c.(859-861)Gac>Tac	p.D287Y	EMR2_ENST00000392965.3_Missense_Mutation_p.D287Y|EMR2_ENST00000601345.1_Missense_Mutation_p.D287Y|EMR2_ENST00000594076.1_Missense_Mutation_p.D194Y|EMR2_ENST00000392964.3_Missense_Mutation_p.D26Y|EMR2_ENST00000594294.1_Missense_Mutation_p.D238Y|EMR2_ENST00000353876.1_Missense_Mutation_p.D194Y|EMR2_ENST00000392967.2_Missense_Mutation_p.D287Y|EMR2_ENST00000346057.1_Missense_Mutation_p.D238Y|EMR2_ENST00000353005.1_Missense_Mutation_p.D145Y|EMR2_ENST00000596991.2_Missense_Mutation_p.D287Y|EMR2_ENST00000595839.1_Missense_Mutation_p.D145Y	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	287					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						CTGCCCAGGTCCTGGACTTTG	0.592																																							uc002mzp.1		NA																	0				lung(2)|ovary(1)|skin(1)	4						c.(859-861)GAC>TAC		egf-like module containing, mucin-like, hormone							119.0	108.0	112.0					19																	14876179		2203	4300	6503	SO:0001583	missense	30817				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr19:14876179C>A	AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.859G>T	19.37:g.14876179C>A	ENSP00000319883:p.Asp287Tyr					EMR2_uc010dzs.1_5'UTR|EMR2_uc010xnw.1_Missense_Mutation_p.D287Y|EMR2_uc002mzo.1_Missense_Mutation_p.D287Y|EMR2_uc002mzq.1_Missense_Mutation_p.D238Y|EMR2_uc002mzr.1_Missense_Mutation_p.D238Y|EMR2_uc002mzs.1_Missense_Mutation_p.D145Y|EMR2_uc002mzt.1_Missense_Mutation_p.D194Y|EMR2_uc002mzu.1_Missense_Mutation_p.D194Y|EMR2_uc010xnx.1_RNA|EMR2_uc010xny.1_RNA	p.D287Y	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN			10	1315	-			287			Extracellular (Potential).		B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	ENST00000315576.3	37	c.859G>T	CCDS32935.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.417613	0.25552	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965;ENST00000392964;ENST00000392962	T;T;T;T;T;T;T;T	0.79352	-0.96;-1.09;-0.55;0.26;1.0;-1.26;1.36;-1.26	3.69	-5.85	0.02311	.	.	.	.	.	T	0.66297	0.2775	L	0.41961	1.31	0.09310	N	1	B;B;B;B;B;B;B;B	0.29805	0.257;0.046;0.085;0.11;0.019;0.011;0.011;0.019	B;B;B;B;B;B;B;B	0.29267	0.1;0.025;0.043;0.055;0.025;0.015;0.011;0.033	T	0.56860	-0.7909	9	0.51188	T	0.08	.	10.6972	0.45905	0.0:0.2638:0.0:0.7362	.	287;194;287;145;238;287;287;287	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;.;EMR2_HUMAN;.	Y	287;287;238;194;145;287;26;238	ENSP00000319883:D287Y;ENSP00000376694:D287Y;ENSP00000263380:D238Y;ENSP00000319454:D194Y;ENSP00000319838:D145Y;ENSP00000376692:D287Y;ENSP00000376691:D26Y;ENSP00000376689:D238Y	ENSP00000319883:D287Y	D	-	1	0	EMR2	14737179	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.882000	0.01624	-0.946000	0.03677	-0.550000	0.04213	GAC		0.592	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2			11	101	1	0	1.49906e-05	0.00245	1.92454e-05	11	101				
EMR2	30817	broad.mit.edu	37	19	14877889	14877889	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:14877889A>G	ENST00000315576.3	-	6	839	c.388T>C	c.(388-390)Tgt>Cgt	p.C130R	EMR2_ENST00000392965.3_Missense_Mutation_p.C130R|EMR2_ENST00000601345.1_Missense_Mutation_p.C130R|EMR2_ENST00000594076.1_Intron|EMR2_ENST00000599423.1_5'Flank|EMR2_ENST00000392964.3_5'UTR|EMR2_ENST00000594294.1_Missense_Mutation_p.C130R|EMR2_ENST00000353876.1_Intron|EMR2_ENST00000392967.2_Missense_Mutation_p.C130R|EMR2_ENST00000346057.1_Missense_Mutation_p.C130R|EMR2_ENST00000353005.1_Intron|EMR2_ENST00000596991.2_Missense_Mutation_p.C130R|EMR2_ENST00000595839.1_Intron	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	130	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						TAGCTTTTACAGAGCCTTGGG	0.592																																							uc002mzp.1		NA																	0				lung(2)|ovary(1)|skin(1)	4						c.(388-390)TGT>CGT		egf-like module containing, mucin-like, hormone							83.0	76.0	78.0					19																	14877889		2203	4298	6501	SO:0001583	missense	30817				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr19:14877889A>G	AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.388T>C	19.37:g.14877889A>G	ENSP00000319883:p.Cys130Arg					EMR2_uc010dzs.1_5'Flank|EMR2_uc010xnw.1_Missense_Mutation_p.C130R|EMR2_uc002mzo.1_Missense_Mutation_p.C130R|EMR2_uc002mzq.1_Missense_Mutation_p.C130R|EMR2_uc002mzr.1_Missense_Mutation_p.C130R|EMR2_uc002mzs.1_Intron|EMR2_uc002mzt.1_Intron|EMR2_uc002mzu.1_Intron|EMR2_uc010xnx.1_RNA|EMR2_uc010xny.1_RNA	p.C130R	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN			6	844	-			130			Extracellular (Potential).|EGF-like 3; calcium-binding.		B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	ENST00000315576.3	37	c.388T>C	CCDS32935.1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.756215	0.49362	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000360222;ENST00000392965;ENST00000392962	D;D;D;D;D	0.99445	-5.91;-5.91;-5.91;-5.91;-5.91	3.72	3.72	0.42706	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.99492	0.9819	H	0.94964	3.605	0.41564	D	0.988641	P;P;D;D	0.60575	0.926;0.935;0.988;0.988	P;P;P;P	0.60473	0.605;0.458;0.855;0.875	D	0.99104	1.0844	9	0.87932	D	0	.	9.1648	0.37046	1.0:0.0:0.0:0.0	.	130;130;130;130	E7ESD7;Q9UHX3-3;Q9UHX3;Q9UHX3-2	.;.;EMR2_HUMAN;.	R	130	ENSP00000319883:C130R;ENSP00000376694:C130R;ENSP00000263380:C130R;ENSP00000376692:C130R;ENSP00000376689:C130R	ENSP00000319883:C130R	C	-	1	0	EMR2	14738889	0.996000	0.38824	0.006000	0.13384	0.013000	0.08279	4.949000	0.63596	1.467000	0.48044	0.416000	0.27883	TGT		0.592	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2			7	12	0	0	0	0.001984	0	7	12				
OR7A10	390892	broad.mit.edu	37	19	14952304	14952304	+	Missense_Mutation	SNP	G	G	T	rs373353751		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:14952304G>T	ENST00000248058.1	-	1	385	c.386C>A	c.(385-387)cCt>cAt	p.P129H		NM_001005190.1	NP_001005190.1	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A, member 10	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|stomach(1)	19	Ovarian(108;0.203)					GTAGTGCAGAGGGTGACAGAT	0.468																																							uc002mzx.1		NA																	0					0						c.(385-387)CCT>CAT		olfactory receptor, family 7, subfamily A,							90.0	81.0	84.0					19																	14952304		2203	4300	6503	SO:0001583	missense	390892				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:14952304G>T		CCDS32936.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8356	protein-coding gene	gene with protein product							Standard	NM_001005190		Approved		uc002mzx.1	O76100		ENST00000248058.1:c.386C>A	19.37:g.14952304G>T	ENSP00000248058:p.Pro129His						p.P129H	NM_001005190	NP_001005190	O76100	OR7AA_HUMAN			1	386	-	Ovarian(108;0.203)		129			Cytoplasmic (Potential).		Q6IFP0|Q96R97	Missense_Mutation	SNP	ENST00000248058.1	37	c.386C>A	CCDS32936.1	.	.	.	.	.	.	.	.	.	.	g	13.22	2.171553	0.38315	.	.	ENSG00000127515	ENST00000248058	T	0.01918	4.56	2.8	2.8	0.32819	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38837	U	0.001549	T	0.22085	0.0532	H	0.98951	4.38	0.35773	D	0.82104	D	0.89917	1.0	D	0.91635	0.999	T	0.54463	-0.8290	10	0.87932	D	0	.	11.4446	0.50116	0.0:0.0:1.0:0.0	.	129	O76100	OR7AA_HUMAN	H	129	ENSP00000248058:P129H	ENSP00000248058:P129H	P	-	2	0	OR7A10	14813304	1.000000	0.71417	0.986000	0.45419	0.027000	0.11550	8.007000	0.88571	1.596000	0.50062	0.194000	0.17425	CCT		0.468	OR7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466520.1	NM_001005190		9	58	1	0	2.17888e-05	0.006214	2.75588e-05	9	58				
CYP4F2	8529	broad.mit.edu	37	19	15989681	15989681	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:15989681C>T	ENST00000221700.6	-	13	1558	c.1463G>A	c.(1462-1464)cGc>cAc	p.R488H		NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GACGCGGAAGCGCAGCAGCGT	0.677																																							uc002nbs.1		NA																	0				ovary(1)|skin(1)	2						c.(1462-1464)CGC>CAC		cytochrome P450, family 4, subfamily F,							43.0	41.0	42.0					19																	15989681		2203	4300	6503	SO:0001583	missense	8529				leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding	g.chr19:15989681C>T	U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.1463G>A	19.37:g.15989681C>T	ENSP00000221700:p.Arg488His					CYP4F2_uc010xot.1_Missense_Mutation_p.R339H	p.R488H	NM_001082	NP_001073	P78329	CP4F2_HUMAN			13	1513	-			488						Missense_Mutation	SNP	ENST00000221700.6	37	c.1463G>A	CCDS12336.1	.	.	.	.	.	.	.	.	.	.	c	10.42	1.344987	0.24426	.	.	ENSG00000186115	ENST00000221700;ENST00000392846	T	0.70045	-0.45	2.63	0.368	0.16146	.	0.173875	0.35235	U	0.003349	T	0.52240	0.1722	L	0.41906	1.305	0.80722	D	1	B	0.29571	0.249	B	0.34242	0.178	T	0.32877	-0.9890	10	0.40728	T	0.16	.	5.2098	0.15310	0.0:0.5619:0.0:0.4381	.	488	P78329	CP4F2_HUMAN	H	488;339	ENSP00000221700:R488H	ENSP00000221700:R488H	R	-	2	0	CYP4F2	15850681	0.646000	0.27295	0.984000	0.44739	0.412000	0.31113	1.112000	0.31172	0.020000	0.15106	-0.424000	0.05967	CGC		0.677	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082		6	50	0	0	0	0.00308	0	6	50				
FCHO1	23149	broad.mit.edu	37	19	17892047	17892047	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:17892047G>T	ENST00000596536.1	+	21	1918	c.1635G>T	c.(1633-1635)atG>atT	p.M545I	FCHO1_ENST00000596951.1_Missense_Mutation_p.M545I|FCHO1_ENST00000539407.1_Missense_Mutation_p.M545I|FCHO1_ENST00000389133.4_Missense_Mutation_p.M545I|FCHO1_ENST00000597512.1_Missense_Mutation_p.M552I|FCHO1_ENST00000595033.1_Missense_Mutation_p.M495I|FCHO1_ENST00000252771.7_Missense_Mutation_p.M545I|FCHO1_ENST00000600676.1_Missense_Mutation_p.M545I|FCHO1_ENST00000594202.1_Missense_Mutation_p.M545I	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	545	Pro-rich.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						TAGACCTGATGCCTGCACCTG	0.627																																							uc010ebb.2		NA																	0				breast(1)	1						c.(1633-1635)ATG>ATT		FCH domain only 1 isoform b							68.0	72.0	71.0					19																	17892047		2203	4300	6503	SO:0001583	missense	23149							g.chr19:17892047G>T	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.1635G>T	19.37:g.17892047G>T	ENSP00000470731:p.Met545Ile					FCHO1_uc002nhg.3_Missense_Mutation_p.M545I|FCHO1_uc002nhh.2_Missense_Mutation_p.M545I|FCHO1_uc010xpw.1_Missense_Mutation_p.M495I|FCHO1_uc002nhi.2_Missense_Mutation_p.M1I|FCHO1_uc002nhj.2_Intron	p.M545I	NM_001161358	NP_001154830	O14526	FCHO1_HUMAN			20	1824	+			545			Pro-rich.		A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	ENST00000596536.1	37	c.1635G>T	CCDS32955.1	.	.	.	.	.	.	.	.	.	.	G	6.171	0.399779	0.11696	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.29655	1.56;1.56;1.56	4.11	0.741	0.18336	.	1.829490	0.03319	U	0.191640	T	0.22781	0.0550	N	0.25647	0.755	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.11329	0.002;0.006	T	0.19257	-1.0311	10	0.33940	T	0.23	-1.5466	6.0751	0.19911	0.3464:0.0:0.6536:0.0	.	545;545	O14526;O14526-2	FCHO1_HUMAN;.	I	545	ENSP00000252771:M545I;ENSP00000373785:M545I;ENSP00000437978:M545I	ENSP00000252771:M545I	M	+	3	0	FCHO1	17753047	0.033000	0.19621	0.000000	0.03702	0.456000	0.32438	2.322000	0.43814	-0.044000	0.13491	0.491000	0.48974	ATG		0.627	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466946.2	NM_015122		11	122	1	0	1.08611e-07	0.000978	1.55843e-07	11	122				
SUGP2	10147	broad.mit.edu	37	19	19136604	19136604	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:19136604C>G	ENST00000601879.1	-	3	850	c.553G>C	c.(553-555)Gag>Cag	p.E185Q	SUGP2_ENST00000452918.2_Missense_Mutation_p.E185Q|SUGP2_ENST00000598202.1_5'UTR|SUGP2_ENST00000600377.1_Missense_Mutation_p.E199Q|SUGP2_ENST00000337018.6_Missense_Mutation_p.E185Q|SUGP2_ENST00000456085.2_Intron			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	185					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CTCTCCTTCTCCAAACACTCT	0.517																																							uc002nkx.2		NA																	0					0						c.(553-555)GAG>CAG		splicing factor, arginine/serine-rich 14							103.0	90.0	94.0					19																	19136604		2203	4300	6503	SO:0001583	missense	10147				mRNA processing|RNA splicing	nucleus	RNA binding	g.chr19:19136604C>G	AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.553G>C	19.37:g.19136604C>G	ENSP00000472286:p.Glu185Gln					SFRS14_uc002nkz.1_Missense_Mutation_p.E199Q|SFRS14_uc002nla.1_Missense_Mutation_p.E185Q|SFRS14_uc002nlb.2_Missense_Mutation_p.E185Q|SFRS14_uc010xqk.1_Intron	p.E185Q	NM_014884	NP_055699	Q8IX01	SUGP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;3.05e-05)|Epithelial(12;0.00161)		3	699	-			185					C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	ENST00000601879.1	37	c.553G>C	CCDS12392.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.039431	0.55003	.	.	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918	T;T;T	0.11063	2.81;2.81;2.81	5.3	5.3	0.74995	.	0.299670	0.28166	N	0.016352	T	0.07728	0.0194	N	0.14661	0.345	0.80722	D	1	P;P	0.50617	0.915;0.937	B;P	0.46110	0.374;0.504	T	0.40776	-0.9545	10	0.11485	T	0.65	-31.9113	11.6206	0.51115	0.0:0.9147:0.0:0.0853	.	185;185	A8K5G0;Q8IX01	.;SUGP2_HUMAN	Q	185	ENSP00000337926:E185Q;ENSP00000332373:E185Q;ENSP00000389380:E185Q	ENSP00000332373:E185Q	E	-	1	0	SUGP2	18997604	0.773000	0.28580	1.000000	0.80357	0.915000	0.54546	1.114000	0.31196	2.493000	0.84123	0.313000	0.20887	GAG		0.517	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464627.1	NM_001017392		5	46	0	0	0	0.001168	0	5	46				
ZNF430	80264	broad.mit.edu	37	19	21216307	21216307	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:21216307G>T	ENST00000261560.5	+	3	323	c.142G>T	c.(142-144)Gag>Tag	p.E48*	ZNF430_ENST00000595401.1_Nonsense_Mutation_p.E48*|ZNF430_ENST00000599548.1_Nonsense_Mutation_p.E48*	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	48	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						TTCTCTGGAGGAGTGGCAATG	0.448																																							uc002npj.2		NA																	0				skin(2)	2						c.(142-144)GAG>TAG		zinc finger protein 430							117.0	121.0	120.0					19																	21216307		2203	4300	6503	SO:0001587	stop_gained	80264				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21216307G>T	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.142G>T	19.37:g.21216307G>T	ENSP00000261560:p.Glu48*					ZNF430_uc002npk.2_Nonsense_Mutation_p.E48*	p.E48*	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN			3	252	+			48			KRAB.		Q86V70	Nonsense_Mutation	SNP	ENST00000261560.5	37	c.142G>T	CCDS32978.1	.	.	.	.	.	.	.	.	.	.	.	12.69	2.013087	0.35511	.	.	ENSG00000118620	ENST00000261560	.	.	.	0.916	0.916	0.19373	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.9698	0.14110	0.0:0.0:1.0:0.0	.	.	.	.	X	48	.	ENSP00000261560:E48X	E	+	1	0	ZNF430	21008147	0.998000	0.40836	0.095000	0.20976	0.097000	0.18754	2.330000	0.43885	0.300000	0.22699	0.305000	0.20034	GAG		0.448	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463539.1	NM_025189		34	96	1	0	1.45844e-13	0.002836	2.5411e-13	34	96				
ZNF208	7757	broad.mit.edu	37	19	22154080	22154080	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:22154080G>T	ENST00000397126.4	-	4	3904	c.3756C>A	c.(3754-3756)ccC>ccA	p.P1252P	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1252					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CACATTTGTAGGGTTTCTCTC	0.373																																							uc002nqp.2		NA																	0				ovary(5)|skin(2)	7						c.(3370-3372)CCC>CCA		zinc finger protein 208							42.0	45.0	44.0					19																	22154080		2112	4241	6353	SO:0001819	synonymous_variant	7757							g.chr19:22154080G>T	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3756C>A	19.37:g.22154080G>T						ZNF208_uc002nqo.1_Intron	p.P1124P	NM_007153	NP_009084					6	3521	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Silent	SNP	ENST00000397126.4	37	c.3372C>A	CCDS54240.1																																																																																				0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		13	48	1	0	7.03913e-09	0.001368	1.06838e-08	13	48				
ZNF208	7757	broad.mit.edu	37	19	22154113	22154114	+	Missense_Mutation	DNP	AG	AG	TA			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	AG	AG	-	-	AG	AG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:22154113_22154114AG>TA	ENST00000397126.4	-	4	3870_3871	c.3722_3723CT>TA	c.(3721-3723)aCT>aTA	p.T1241I	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1241					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CCTTATGTTTAGTGAGGATTGA	0.386																																							uc002nqp.2		NA																	0				ovary(5)|skin(2)	7						c.(3337-3339)ACT>ATA		zinc finger protein 208																																				SO:0001583	missense	7757							g.chr19:22154113_22154114AG>TA	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3722_3723delinsTA	19.37:g.22154113_22154114delinsTA	ENSP00000380315:p.Thr1241Ile					ZNF208_uc002nqo.1_Intron	p.T1113I	NM_007153	NP_009084					6	3487_3488	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Missense_Mutation	DNP	ENST00000397126.4	37	c.3338_3339CT>TA	CCDS54240.1																																																																																				0.386	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		10	56	0	0	0	0.004672	0	10	56				
ZNF98	148198	broad.mit.edu	37	19	22574517	22574517	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:22574517G>T	ENST00000357774.5	-	4	1641	c.1520C>A	c.(1519-1521)aCa>aAa	p.T507K		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	507					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CATCTTATGTGTAGTAAGGTG	0.383																																							uc002nqt.2		NA																	0				ovary(1)|skin(1)	2						c.(1519-1521)ACA>AAA		zinc finger protein 98							63.0	55.0	58.0					19																	22574517		2175	4272	6447	SO:0001583	missense	148198				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22574517G>T		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1520C>A	19.37:g.22574517G>T	ENSP00000350418:p.Thr507Lys						p.T507K	NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN			4	1642	-		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)	507			C2H2-type 12.			Missense_Mutation	SNP	ENST00000357774.5	37	c.1520C>A	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.339486	0.00017	.	.	ENSG00000197360	ENST00000357774	T	0.07216	3.21	1.26	-2.53	0.06326	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02342	0.0072	N	0.05012	-0.13	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.39683	-0.9602	9	0.02654	T	1	.	0.8073	0.01086	0.4806:0.187:0.1479:0.1845	.	507	A6NK75	ZNF98_HUMAN	K	507	ENSP00000350418:T507K	ENSP00000350418:T507K	T	-	2	0	ZNF98	22366357	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-8.275000	0.00022	-2.049000	0.00906	-0.914000	0.02751	ACA		0.383	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626		24	62	1	0	7.07758e-08	0.004656	1.02851e-07	24	62				
ZNF536	9745	broad.mit.edu	37	19	31038967	31038967	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:31038967G>T	ENST00000355537.3	+	4	2588	c.2441G>T	c.(2440-2442)gGg>gTg	p.G814V		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	814					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCGCTGTCTGGGCAACCCCCA	0.572																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(2440-2442)GGG>GTG		zinc finger protein 536							69.0	75.0	73.0					19																	31038967		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31038967G>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2441G>T	19.37:g.31038967G>T	ENSP00000347730:p.Gly814Val					ZNF536_uc010edd.1_Missense_Mutation_p.G814V	p.G814V	NM_014717	NP_055532	O15090	ZN536_HUMAN			4	2579	+	Esophageal squamous(110;0.0834)		814					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.2441G>T	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	9.667	1.145777	0.21288	.	.	ENSG00000198597	ENST00000355537	T	0.10099	2.91	5.98	3.79	0.43588	.	0.269430	0.42682	D	0.000674	T	0.12518	0.0304	L	0.32530	0.975	0.58432	D	0.999996	P;P	0.49635	0.926;0.926	P;P	0.44597	0.454;0.454	T	0.02053	-1.1222	10	0.72032	D	0.01	-10.3449	16.6384	0.85065	0.0:0.2453:0.7546:0.0	.	814;814	A7E228;O15090	.;ZN536_HUMAN	V	814	ENSP00000347730:G814V	ENSP00000347730:G814V	G	+	2	0	ZNF536	35730807	1.000000	0.71417	0.355000	0.25773	0.050000	0.14768	3.521000	0.53472	0.815000	0.34398	0.591000	0.81541	GGG		0.572	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		35	110	1	0	6.53348e-20	0.003755	1.28229e-19	35	110				
DMKN	93099	broad.mit.edu	37	19	36003562	36003562	+	Missense_Mutation	SNP	A	A	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:36003562A>C	ENST00000339686.3	-	2	733	c.557T>G	c.(556-558)aTg>aGg	p.M186R	DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000440396.1_Missense_Mutation_p.M186R|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.M186R|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000424570.2_Missense_Mutation_p.M186R|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.M186R|DMKN_ENST00000451297.2_Missense_Mutation_p.M186R|DMKN_ENST00000429837.1_Missense_Mutation_p.M186R|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000419602.1_Missense_Mutation_p.M186R|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000402589.2_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	186	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CTGAGGATTCATTCCAAAGCT	0.607																																							uc002nzm.3		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(556-558)ATG>AGG		dermokine isoform 2 precursor							84.0	88.0	87.0					19																	36003562		2203	4300	6503	SO:0001583	missense	93099					extracellular region		g.chr19:36003562A>C	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.557T>G	19.37:g.36003562A>C	ENSP00000342012:p.Met186Arg					DMKN_uc002nzj.2_5'Flank|DMKN_uc002nzk.3_5'Flank|DMKN_uc002nzl.3_5'Flank|DMKN_uc002nzo.3_Missense_Mutation_p.M186R|DMKN_uc002nzn.3_Missense_Mutation_p.M186R|DMKN_uc002nzw.2_5'Flank|DMKN_uc002nzr.2_5'Flank|DMKN_uc002nzp.2_5'Flank|DMKN_uc002nzq.2_5'Flank|DMKN_uc002nzt.2_5'Flank|DMKN_uc002nzs.2_5'Flank|DMKN_uc002nzu.2_5'Flank|DMKN_uc002nzv.2_5'Flank|DMKN_uc010xsv.1_5'Flank|DMKN_uc010xsw.1_5'Flank|DMKN_uc002nzx.3_5'Flank|DMKN_uc002nzy.3_5'Flank|DMKN_uc002nzz.2_5'Flank|DMKN_uc002oac.3_Missense_Mutation_p.M186R|DMKN_uc010eeb.2_Missense_Mutation_p.M186R|DMKN_uc002oaa.3_Missense_Mutation_p.M186R|DMKN_uc002oab.3_Missense_Mutation_p.M186R	p.M186R	NM_033317	NP_201574	Q6E0U4	DMKN_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)		2	740	-	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		186			Gly-rich.		A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	37	c.557T>G	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	A	4.022	0.001603	0.07819	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000429837;ENST00000419602;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T;T;T	0.17528	2.77;2.55;2.55;2.28;2.28;2.28;2.28;2.27	4.78	-2.06	0.07298	.	1.258540	0.05766	N	0.605850	T	0.07818	0.0196	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001;0.001;0.001	B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.37337	-0.9710	10	0.62326	D	0.03	-1.7005	2.6051	0.04876	0.0916:0.313:0.3067:0.2888	.	186;186;186;186;186;186;186	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;C9J4P6;Q6E0U4-4;Q6E0U4	.;.;.;.;.;.;DMKN_HUMAN	R	186	ENSP00000342012:M186R;ENSP00000405503:M186R;ENSP00000391036:M186R;ENSP00000394908:M186R;ENSP00000415277:M186R;ENSP00000414743:M186R;ENSP00000388404:M186R;ENSP00000409513:M186R	ENSP00000342012:M186R	M	-	2	0	DMKN	40695402	0.042000	0.20092	0.000000	0.03702	0.024000	0.10985	0.047000	0.14056	-0.044000	0.13491	-1.258000	0.01471	ATG		0.607	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317		8	69	0	0	0	0.004482	0	8	69				
ZNF567	163081	broad.mit.edu	37	19	37211274	37211274	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:37211274G>T	ENST00000536254.2	+	6	1870	c.1648G>T	c.(1648-1650)Gta>Tta	p.V550L	ZNF850_ENST00000589390.1_Intron|ZNF567_ENST00000588311.1_Missense_Mutation_p.V519L|ZNF567_ENST00000392163.2_Missense_Mutation_p.V519L|ZNF567_ENST00000585696.1_Missense_Mutation_p.V519L|ZNF567_ENST00000360729.4_Missense_Mutation_p.V519L			Q8N184	ZN567_HUMAN	zinc finger protein 567	550					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AACCCTCACTGTACATCAGAA	0.408																																							uc010xtl.1		NA																	0					0						c.(1648-1650)GTA>TTA		zinc finger protein 567							66.0	68.0	67.0					19																	37211274		2203	4300	6503	SO:0001583	missense	163081				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37211274G>T	AK093034	CCDS12495.1, CCDS74349.1	19q13.12	2013-10-08				ENSG00000189042		"""Zinc fingers, C2H2-type"", ""-"""	28696	protein-coding gene	gene with protein product						12477932	Standard	XM_006723064		Approved	MGC45586	uc002oep.4	Q8N184		ENST00000536254.2:c.1648G>T	19.37:g.37211274G>T	ENSP00000441838:p.Val550Leu					ZNF567_uc002oeo.1_Missense_Mutation_p.V550L|ZNF567_uc010xtk.1_Missense_Mutation_p.V550L|ZNF567_uc002oep.3_Missense_Mutation_p.V519L|ZNF567_uc002oeq.1_Missense_Mutation_p.V519L	p.V550L	NM_152603	NP_689816	Q8N184	ZN567_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)		6	1870	+	Esophageal squamous(110;0.198)		550			C2H2-type 12.		B3KX49|Q6N044	Missense_Mutation	SNP	ENST00000536254.2	37	c.1648G>T		.	.	.	.	.	.	.	.	.	.	G	12.72	2.022511	0.35701	.	.	ENSG00000189042	ENST00000536254;ENST00000378686;ENST00000360729;ENST00000423498;ENST00000392163	T;T;T	0.18016	2.24;2.24;2.24	4.84	2.63	0.31362	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.194579	0.25363	N	0.031215	T	0.16514	0.0397	N	0.20685	0.6	0.09310	N	0.999994	B;P	0.35077	0.025;0.483	B;P	0.49665	0.054;0.618	T	0.29731	-1.0002	10	0.19590	T	0.45	.	8.1669	0.31233	0.0851:0.0:0.7585:0.1564	.	550;519	Q8N184;F8WEL6	ZN567_HUMAN;.	L	550;494;519;549;519	ENSP00000441838:V550L;ENSP00000353957:V519L;ENSP00000376003:V519L	ENSP00000353957:V519L	V	+	1	0	ZNF567	41903114	0.000000	0.05858	0.978000	0.43139	0.983000	0.72400	-1.194000	0.03046	0.714000	0.32081	0.561000	0.74099	GTA		0.408	ZNF567-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000453549.1	NM_152603		26	123	1	0	6.12954e-19	0.004656	1.18597e-18	26	123				
MAP4K1	11184	broad.mit.edu	37	19	39087686	39087686	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:39087686G>C	ENST00000591517.1	-	25	1957	c.1929C>G	c.(1927-1929)ttC>ttG	p.F643L	MAP4K1_ENST00000589130.1_Missense_Mutation_p.F639L|MAP4K1_ENST00000586296.1_Intron|MAP4K1_ENST00000396857.2_Missense_Mutation_p.F643L|CTB-186G2.1_ENST00000589557.1_RNA	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	643	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGACAAGCAGGAATTTGTTCA	0.592																																							uc002oix.1		NA																	0				skin(4)|lung(3)|ovary(1)	8						c.(1927-1929)TTC>TTG		mitogen-activated protein kinase kinase kinase							64.0	71.0	69.0					19																	39087686		2037	4174	6211	SO:0001583	missense	11184				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity	g.chr19:39087686G>C	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.1929C>G	19.37:g.39087686G>C	ENSP00000465039:p.Phe643Leu					MAP4K1_uc002oiw.1_Missense_Mutation_p.F230L|MAP4K1_uc002oiy.1_Missense_Mutation_p.F643L	p.F643L	NM_007181	NP_009112	Q92918	M4K1_HUMAN	Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)		25	2037	-	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		643			CNH.			Missense_Mutation	SNP	ENST00000591517.1	37	c.1929C>G	CCDS59385.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.613613	0.87359	.	.	ENSG00000104814	ENST00000396857;ENST00000221409	T	0.06294	3.32	5.01	3.83	0.44106	Citron-like (3);	0.000000	0.85682	D	0.000000	T	0.23806	0.0576	M	0.80183	2.485	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.79108	0.987;0.992	T	0.00909	-1.1518	10	0.87932	D	0	.	10.5434	0.45045	0.1001:0.0:0.8999:0.0	.	643;643	Q92918-2;Q92918	.;M4K1_HUMAN	L	643	ENSP00000380066:F643L	ENSP00000221409:F643L	F	-	3	2	MAP4K1	43779526	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.106000	0.57804	1.172000	0.42781	0.555000	0.69702	TTC		0.592	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453390.1	NM_001042600		4	81	0	0	0	0.009096	0	4	81				
PLD3	23646	broad.mit.edu	37	19	40872767	40872767	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:40872767G>A	ENST00000409587.1	+	5	587	c.190G>A	c.(190-192)Gac>Aac	p.D64N	PLD3_ENST00000356508.5_Missense_Mutation_p.D64N|PLD3_ENST00000409735.4_Missense_Mutation_p.D64N|PLD3_ENST00000409281.1_Missense_Mutation_p.D64N|PLD3_ENST00000409419.1_Missense_Mutation_p.D64N			Q8IV08	PLD3_HUMAN	phospholipase D family, member 3	64					cell death (GO:0008219)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phospholipase D activity (GO:0004630)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			GGAATACGGCGACTTGCATCT	0.627																																							uc002onm.3		NA																	0				skin(2)|ovary(1)	3						c.(190-192)GAC>AAC		phospholipase D3							72.0	69.0	70.0					19																	40872767		2203	4300	6503	SO:0001583	missense	23646				lipid catabolic process	endoplasmic reticulum membrane|integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity|protein binding	g.chr19:40872767G>A	BC000553	CCDS33027.1	19q13.2	2014-03-14	2005-05-20		ENSG00000105223	ENSG00000105223			17158	protein-coding gene	gene with protein product		615698	"""phospholipase D3"""			9140189, 15794758	Standard	XM_005258704		Approved	HU-K4	uc002onj.4	Q8IV08	OTTHUMG00000152736	ENST00000409587.1:c.190G>A	19.37:g.40872767G>A	ENSP00000387050:p.Asp64Asn					PLD3_uc002onj.3_Missense_Mutation_p.D64N|PLD3_uc002onk.3_Missense_Mutation_p.D64N|PLD3_uc002onl.3_Missense_Mutation_p.D64N|PLD3_uc002onn.2_Missense_Mutation_p.D64N|PLD3_uc002ono.2_Missense_Mutation_p.R93Q	p.D64N	NM_001031696	NP_001026866	Q8IV08	PLD3_HUMAN	Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)		5	588	+			64			Lumenal (Potential).		Q92853|Q9BW87	Missense_Mutation	SNP	ENST00000409587.1	37	c.190G>A	CCDS33027.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098931	0.56183	.	.	ENSG00000105223	ENST00000392032;ENST00000409419;ENST00000409587;ENST00000356508;ENST00000536031;ENST00000409735;ENST00000409281;ENST00000359274	T;T;T;T;T;T;T	0.42900	0.96;0.99;0.99;0.99;0.99;0.99;0.97	5.36	5.36	0.76844	.	0.805758	0.12137	N	0.496213	T	0.25232	0.0613	N	0.14661	0.345	0.30997	N	0.720783	P	0.51791	0.948	B	0.37989	0.262	T	0.03453	-1.1035	10	0.15499	T	0.54	-42.2876	14.9586	0.71138	0.0:0.0:1.0:0.0	.	64	Q8IV08	PLD3_HUMAN	N	64	ENSP00000375886:D64N;ENSP00000386293:D64N;ENSP00000387050:D64N;ENSP00000348901:D64N;ENSP00000386938:D64N;ENSP00000387022:D64N;ENSP00000352220:D64N	ENSP00000348901:D64N	D	+	1	0	PLD3	45564607	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	2.962000	0.49176	2.674000	0.91012	0.655000	0.94253	GAC		0.627	PLD3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327721.1	NM_012268		15	118	0	0	0	0.004007	0	15	118				
ERCC1	2067	broad.mit.edu	37	19	45923668	45923668	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:45923668C>T	ENST00000300853.3	-	4	930	c.339G>A	c.(337-339)ctG>ctA	p.L113L	ERCC1_ENST00000423698.2_Silent_p.L41L|ERCC1_ENST00000013807.5_Silent_p.L113L|ERCC1_ENST00000589165.1_Silent_p.L113L|ERCC1_ENST00000340192.7_Silent_p.L113L|ERCC1_ENST00000591636.1_Silent_p.L113L	NM_001983.3	NP_001974.1	P07992	ERCC1_HUMAN	excision repair cross-complementation group 1	113					cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|male gonad development (GO:0008584)|mitotic recombination (GO:0006312)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|oogenesis (GO:0048477)|post-embryonic hemopoiesis (GO:0035166)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|replicative cell aging (GO:0001302)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to sucrose (GO:0009744)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)|syncytium formation (GO:0006949)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	cytoplasm (GO:0005737)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|skin(1)	15		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		GCACGAACTTCAGTACGGGAT	0.587								Nucleotide excision repair (NER)																															uc002pbs.1		NA																	0				ovary(2)	2						c.(337-339)CTG>CTA	NER	excision repair cross-complementing 1 isofrom 2							101.0	77.0	85.0					19																	45923668		2203	4300	6503	SO:0001819	synonymous_variant	2067				mitotic recombination|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|response to oxidative stress|transcription-coupled nucleotide-excision repair	cytoplasm|nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair complex	damaged DNA binding|endonuclease activity|protein C-terminus binding|protein domain specific binding|single-stranded DNA binding	g.chr19:45923668C>T		CCDS12662.1, CCDS12663.1, CCDS54279.1	19q13.32	2014-03-07	2014-03-07			ENSG00000012061			3433	protein-coding gene	gene with protein product		126380	"""excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)"""			6462228	Standard	NM_001983		Approved	RAD10	uc002pbs.2	P07992		ENST00000300853.3:c.339G>A	19.37:g.45923668C>T						ERCC1_uc002pbt.1_Silent_p.L113L|ERCC1_uc002pbu.1_Silent_p.L41L|ERCC1_uc002pbv.2_Silent_p.L113L	p.L113L	NM_001983	NP_001974	P07992	ERCC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0247)	4	485	-		Ovarian(192;0.051)|all_neural(266;0.112)	113					B2RC01|B3KRR0|Q7Z7F5|Q96S40	Silent	SNP	ENST00000300853.3	37	c.339G>A	CCDS12662.1																																																																																				0.587	ERCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459542.1	NM_001983		6	8	0	0	0	0.001168	0	6	8				
IGFL3	388555	broad.mit.edu	37	19	46627241	46627241	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:46627241G>T	ENST00000341415.2	-	3	276	c.252C>A	c.(250-252)ccC>ccA	p.P84P	AC007193.6_ENST00000597989.1_lincRNA	NM_207393.1	NP_997276.1	Q6UXB1	IGFL3_HUMAN	IGF-like family member 3	84						extracellular region (GO:0005576)		p.P84P(1)		endometrium(1)|large_intestine(1)|lung(5)	7		Ovarian(192;0.0175)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00473)|GBM - Glioblastoma multiforme(486;0.0149)|Epithelial(262;0.239)		CAAAAGACTCGGGACAGCAGA	0.537																																							uc002pea.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(250-252)CCC>CCA		IGF-like family member 3 precursor							92.0	114.0	107.0					19																	46627241		2186	4300	6486	SO:0001819	synonymous_variant	388555					extracellular region	protein binding	g.chr19:46627241G>T	AY358434	CCDS33058.1	19q13.32	2006-07-14				ENSG00000188624			32930	protein-coding gene	gene with protein product		610546				14702039	Standard	NM_207393		Approved	UNQ483	uc002pea.1	Q6UXB1		ENST00000341415.2:c.252C>A	19.37:g.46627241G>T							p.P84P	NM_207393	NP_997276	Q6UXB1	IGFL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00473)|GBM - Glioblastoma multiforme(486;0.0149)|Epithelial(262;0.239)	3	277	-		Ovarian(192;0.0175)|all_neural(266;0.0476)	84						Silent	SNP	ENST00000341415.2	37	c.252C>A	CCDS33058.1																																																																																				0.537	IGFL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421323.1	NM_207393		69	109	1	0	2.26907e-38	0.00361	4.8735e-38	69	109				
PRR12	57479	broad.mit.edu	37	19	50099610	50099610	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:50099610G>A	ENST00000418929.2	+	4	2030	c.2018G>A	c.(2017-2019)gGa>gAa	p.G673E		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0	Pro-rich.						DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		GCCTCTAAGGGACTTGGGGGG	0.672																																							uc002poo.3		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(2017-2019)GGA>GAA		proline rich 12							12.0	15.0	14.0					19																	50099610		1852	4001	5853	SO:0001583	missense	57479						DNA binding	g.chr19:50099610G>A	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.2018G>A	19.37:g.50099610G>A	ENSP00000394510:p.Gly673Glu						p.G673E	NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)	4	2018	+		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)	416			Pro-rich.		E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	c.2018G>A	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340224	0.24339	.	.	ENSG00000126464	ENST00000418929	.	.	.	3.61	3.61	0.41365	.	.	.	.	.	T	0.24624	0.0597	.	.	.	0.27326	N	0.956914	P	0.46784	0.884	B	0.40477	0.33	T	0.03576	-1.1023	7	0.26408	T	0.33	.	8.5794	0.33619	0.1112:0.0:0.8888:0.0	.	673	Q9ULL5-3	.	E	673	.	ENSP00000394510:G673E	G	+	2	0	PRR12	54791422	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	2.271000	0.43364	2.051000	0.60960	0.297000	0.19635	GGA		0.672	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719		3	10	0	0	0	0.009096	0	3	10				
IZUMO2	126123	broad.mit.edu	37	19	50666245	50666245	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:50666245C>A	ENST00000293405.3	-	1	207	c.207G>T	c.(205-207)gcG>gcT	p.A69A		NM_152358.2	NP_689571.2	Q6UXV1	IZUM2_HUMAN	IZUMO family member 2	69						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						ACACGTTCAGCGCGTAGTCCC	0.682																																							uc002prp.1		NA																	0					0						c.(205-207)GCG>GCT		hypothetical protein LOC126123 precursor							46.0	51.0	49.0					19																	50666245		1985	4170	6155	SO:0001819	synonymous_variant	126123					integral to membrane		g.chr19:50666245C>A	AY358196	CCDS12792.2	19q13.33	2014-02-17	2010-07-29	2010-07-29	ENSG00000161652	ENSG00000161652		"""-"""	28518	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 41"""	C19orf41		19658160, 22957301	Standard	XM_006723007		Approved	MGC33947, SCRL	uc002prp.1	Q6UXV1	OTTHUMG00000074063	ENST00000293405.3:c.207G>T	19.37:g.50666245C>A							p.A69A	NM_152358	NP_689571	Q6UXV1	IZUM2_HUMAN		GBM - Glioblastoma multiforme(134;0.00364)|OV - Ovarian serous cystadenocarcinoma(262;0.0052)	1	294	-		all_neural(266;0.0459)|Ovarian(192;0.0728)	69			Extracellular (Potential).		Q5GRG3|Q5GRG4|Q6ZNM5|Q8NHR8	Silent	SNP	ENST00000293405.3	37	c.207G>T	CCDS12792.2																																																																																				0.682	IZUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157232.1	NM_152358		20	32	1	0	1.64293e-13	0.00333	2.85528e-13	20	32				
GPR32	2854	broad.mit.edu	37	19	51274755	51274755	+	Missense_Mutation	SNP	G	G	T	rs373076896		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:51274755G>T	ENST00000270590.4	+	1	1035	c.898G>T	c.(898-900)Gct>Tct	p.A300S		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	300					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CATCCTCCAGGCTAGCTTTGC	0.522																																					Esophageal Squamous(113;152 1581 5732 15840 44398)	Esophageal Squamous(113;152 1581 5732 15840 44398)	uc010ycf.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(898-900)GCT>TCT		G protein-coupled receptor 32							85.0	82.0	83.0					19																	51274755		2203	4300	6503	SO:0001583	missense	2854					integral to plasma membrane	N-formyl peptide receptor activity	g.chr19:51274755G>T	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.898G>T	19.37:g.51274755G>T	ENSP00000270590:p.Ala300Ser						p.A300S	NM_001506	NP_001497	O75388	GPR32_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)	1	898	+		all_neural(266;0.131)	300			Extracellular (Potential).		Q502U7|Q6NWS5	Missense_Mutation	SNP	ENST00000270590.4	37	c.898G>T	CCDS12801.1	.	.	.	.	.	.	.	.	.	.	G	2.981	-0.210331	0.06140	.	.	ENSG00000142511	ENST00000270590	T	0.38240	1.15	1.88	0.814	0.18756	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.27419	0.0673	L	0.32530	0.975	0.09310	N	1	B	0.23806	0.091	B	0.33121	0.158	T	0.35895	-0.9770	9	0.52906	T	0.07	.	4.5686	0.12198	0.2003:0.0:0.7997:0.0	.	300	O75388	GPR32_HUMAN	S	300	ENSP00000270590:A300S	ENSP00000270590:A300S	A	+	1	0	GPR32	55966567	0.000000	0.05858	0.085000	0.20634	0.086000	0.17979	0.075000	0.14686	0.346000	0.23899	-0.657000	0.03884	GCT		0.522	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1			41	62	1	0	2.95478e-19	0.00874	5.74961e-19	41	62				
ZNF766	90321	broad.mit.edu	37	19	52793794	52793794	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:52793794G>A	ENST00000439461.1	+	4	793	c.750G>A	c.(748-750)aaG>aaA	p.K250K	CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000599581.1_3'UTR|ZNF766_ENST00000593612.1_Silent_p.K265K|ZNF766_ENST00000359102.4_Silent_p.K265K	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	250					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		AGTGTGGCAAGCTCTTCAATC	0.443																																							uc002pyr.1		NA																	0					0						c.(748-750)AAG>AAA		zinc finger protein 766							46.0	47.0	47.0					19																	52793794		2189	4294	6483	SO:0001819	synonymous_variant	90321				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52793794G>A	AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.750G>A	19.37:g.52793794G>A						ZNF766_uc002pys.1_3'UTR|ZNF766_uc002pyt.1_Silent_p.K265K	p.K250K	NM_001010851	NP_001010851	Q5HY98	ZN766_HUMAN		GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)	4	793	+			250			C2H2-type 3.		B2RNE0|Q7Z326	Silent	SNP	ENST00000439461.1	37	c.750G>A	CCDS46163.1																																																																																				0.443	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462764.1	NM_001010851		13	18	0	0	0	0.001368	0	13	18				
TSEN34	79042	broad.mit.edu	37	19	54695979	54695979	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:54695979C>T	ENST00000396383.1	+	4	811	c.500C>T	c.(499-501)tCc>tTc	p.S167F	MBOAT7_ENST00000474910.1_5'Flank|MBOAT7_ENST00000391754.1_5'Flank|TSEN34_ENST00000429671.2_Missense_Mutation_p.S167F|MBOAT7_ENST00000245615.1_5'Flank|TSEN34_ENST00000396388.2_Missense_Mutation_p.S167F|MBOAT7_ENST00000338624.6_5'Flank|CTD-3093M3.1_ENST00000594382.1_lincRNA|TSEN34_ENST00000302937.4_Missense_Mutation_p.S167F|MBOAT7_ENST00000431666.2_5'Flank			Q9BSV6	SEN34_HUMAN	TSEN34 tRNA splicing endonuclease subunit	167					mRNA processing (GO:0006397)|tRNA-type intron splice site recognition and cleavage (GO:0000379)	tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	10	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CCCTCGTCTTCCCAAGCAGGA	0.602																																					Esophageal Squamous(37;841 964 4869 42824)	Esophageal Squamous(37;841 964 4869 42824)	uc002qdu.2		NA																	0					0						c.(499-501)TCC>TTC		tRNA-intron endonuclease 34							66.0	69.0	68.0					19																	54695979		1872	4090	5962	SO:0001583	missense	79042				mRNA processing|tRNA-type intron splice site recognition and cleavage	nucleolus|tRNA-intron endonuclease complex	nucleic acid binding|tRNA-intron endonuclease activity	g.chr19:54695979C>T	AF211970	CCDS42609.1, CCDS74446.1	19q13.4	2013-08-06	2013-08-06	2005-03-12	ENSG00000170892	ENSG00000170892		"""tRNA splicing endonuclease subunits"""	15506	protein-coding gene	gene with protein product		608754	"""leukocyte receptor cluster (LRC) member 5"", ""tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae)"", ""tRNA splicing endonuclease 34 homolog (S. cerevisiae)"""	LENG5		10941842, 15109492	Standard	NM_024075		Approved	SEN34, SEN34L	uc002qdw.3	Q9BSV6	OTTHUMG00000066515	ENST00000396383.1:c.500C>T	19.37:g.54695979C>T	ENSP00000379667:p.Ser167Phe					MBOAT7_uc002qdq.2_5'Flank|MBOAT7_uc002qdr.2_5'Flank|MBOAT7_uc002qds.2_5'Flank|MBOAT7_uc010yen.1_5'Flank|MBOAT7_uc002qdt.3_5'Flank|TSEN34_uc010yeo.1_Missense_Mutation_p.S167F|TSEN34_uc002qdv.2_Missense_Mutation_p.S167F|TSEN34_uc002qdw.2_Missense_Mutation_p.S167F	p.S167F	NM_024075	NP_076980	Q9BSV6	SEN34_HUMAN			4	609	+	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		167					A6NNB1|B0V3J1|Q9BVT1|Q9H6H5	Missense_Mutation	SNP	ENST00000396383.1	37	c.500C>T	CCDS42609.1	.	.	.	.	.	.	.	.	.	.	C	4.366	0.067525	0.08388	.	.	ENSG00000170892	ENST00000455798;ENST00000456872;ENST00000302937;ENST00000429671;ENST00000396383;ENST00000396388	T;T;T;T;T;T	0.66280	-0.16;-0.2;-0.18;-0.19;-0.18;-0.18	3.5	1.32	0.21799	.	0.830006	0.10434	N	0.675173	T	0.45716	0.1356	L	0.36672	1.1	0.09310	N	1	B;B	0.31054	0.306;0.148	B;B	0.23852	0.049;0.02	T	0.28964	-1.0027	10	0.39692	T	0.17	.	5.7654	0.18224	0.1924:0.7007:0.0:0.107	.	167;167	E7EQB3;Q9BSV6	.;SEN34_HUMAN	F	167;170;167;167;167;167	ENSP00000400743:S167F;ENSP00000408689:S170F;ENSP00000305524:S167F;ENSP00000397402:S167F;ENSP00000379667:S167F;ENSP00000379671:S167F	ENSP00000305524:S167F	S	+	2	0	TSEN34	59387791	0.000000	0.05858	0.648000	0.29521	0.406000	0.30931	0.090000	0.15025	0.468000	0.27243	0.561000	0.74099	TCC		0.602	TSEN34-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142200.1	NM_024075		5	77	0	0	0	0.001168	0	5	77				
LILRB3	11025	broad.mit.edu	37	19	54724968	54724968	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:54724968G>C	ENST00000391750.1	-	6	1078	c.942C>G	c.(940-942)aaC>aaG	p.N314K	LILRB3_ENST00000424807.1_Missense_Mutation_p.N314K|LILRB3_ENST00000407860.2_Missense_Mutation_p.N314K|LILRA6_ENST00000440558.2_Intron|LILRB3_ENST00000346401.6_Missense_Mutation_p.N314K|LILRB3_ENST00000469273.1_5'Flank|LILRA6_ENST00000391735.3_Intron|LILRA6_ENST00000270464.5_Missense_Mutation_p.N314K|LILRA6_ENST00000419410.2_Intron|LILRB3_ENST00000245620.9_Missense_Mutation_p.N314K			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	314	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCATCAGGATGTTCAGGGGGT	0.682																																							uc002qef.1		NA																	0				skin(2)|ovary(1)	3						c.(940-942)AAC>AAG		leukocyte immunoglobulin-like receptor,							11.0	10.0	11.0					19																	54724968		1551	1800	3351	SO:0001583	missense	11025				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity	g.chr19:54724968G>C	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.942C>G	19.37:g.54724968G>C	ENSP00000375630:p.Asn314Lys					LILRB3_uc002qee.1_Missense_Mutation_p.N314K|LILRB3_uc002qeh.1_Missense_Mutation_p.N314K|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Missense_Mutation_p.N314K|LILRA6_uc002qek.1_Intron|LILRB3_uc010erh.1_Missense_Mutation_p.N314K|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Missense_Mutation_p.N314K|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Missense_Mutation_p.N314K|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron	p.N314K	NM_006864	NP_006855	O75022	LIRB3_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	5	1053	-	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		314			Extracellular (Potential).|Ig-like C2-type 3.		C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	ENST00000391750.1	37	c.942C>G	CCDS33105.1	.	.	.	.	.	.	.	.	.	.	G	8.312	0.822436	0.16678	.	.	ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000244482	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000407860;ENST00000270464	T;T;T;T;T;T	0.12879	2.64;2.64;2.64;2.64;2.64;2.64	2.52	1.47	0.22746	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.389073	0.18849	N	0.129445	T	0.05227	0.0139	N	0.03050	-0.425	0.80722	D	1	B;B;B;B;B	0.27013	0.042;0.032;0.117;0.004;0.166	B;B;B;B;B	0.29524	0.103;0.043;0.029;0.004;0.074	T	0.31916	-0.9926	10	0.56958	D	0.05	.	5.3544	0.16053	0.1634:0.0:0.8366:0.0	.	314;314;314;314;314	B5MCX0;F8W6G6;O75022-2;O75022;O75022-3	.;.;.;LIRB3_HUMAN;.	K	314	ENSP00000375630:N314K;ENSP00000412771:N314K;ENSP00000345184:N314K;ENSP00000245620:N314K;ENSP00000384274:N314K;ENSP00000270464:N314K	ENSP00000270464:N314K	N	-	3	2	LILRB3;LILRA6	59416780	0.000000	0.05858	0.921000	0.36526	0.404000	0.30871	-0.291000	0.08343	0.635000	0.30488	0.573000	0.79308	AAC		0.682	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864		13	12	0	0	0	0.007413	0	13	12				
NLRP7	199713	broad.mit.edu	37	19	55450278	55450278	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:55450278C>A	ENST00000590030.1	-	3	1949	c.1909G>T	c.(1909-1911)Gaa>Taa	p.E637*	NLRP7_ENST00000328092.5_Nonsense_Mutation_p.E637*|NLRP7_ENST00000588756.1_Nonsense_Mutation_p.E637*|NLRP7_ENST00000592784.1_Nonsense_Mutation_p.E637*|NLRP7_ENST00000448121.2_Nonsense_Mutation_p.E637*|NLRP7_ENST00000446217.1_Nonsense_Mutation_p.E665*|NLRP7_ENST00000340844.2_Nonsense_Mutation_p.E637*			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	637							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		ATGTCCAGTTCAAAATCCATG	0.468																																							uc002qih.3		NA																	0				large_intestine(1)|breast(1)|central_nervous_system(1)	3						c.(1909-1911)GAA>TAA		NACHT, leucine rich repeat and PYD containing 7							84.0	78.0	80.0					19																	55450278		2203	4300	6503	SO:0001587	stop_gained	199713						ATP binding	g.chr19:55450278C>A	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1909G>T	19.37:g.55450278C>A	ENSP00000465520:p.Glu637*					NLRP7_uc002qig.3_Nonsense_Mutation_p.E637*|NLRP7_uc002qii.3_Nonsense_Mutation_p.E637*|NLRP7_uc010esk.2_Nonsense_Mutation_p.E637*|NLRP7_uc010esl.2_Nonsense_Mutation_p.E665*	p.E637*	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	4	1985	-			637			LRR 1.		E9PE16|Q32MH8|Q7RTR1	Nonsense_Mutation	SNP	ENST00000590030.1	37	c.1909G>T	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.568551	0.86439	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	.	.	.	1.92	0.851	0.18989	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	4.5319	0.12010	0.0:0.802:0.0:0.198	.	.	.	.	X	637;637;637;665;404	.	ENSP00000329568:E637X	E	-	1	0	NLRP7	60142090	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.021000	0.12504	0.368000	0.24481	0.462000	0.41574	GAA		0.468	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176		22	43	1	0	1.9806e-07	0.002299	2.82411e-07	22	43				
NLRP11	204801	broad.mit.edu	37	19	56313001	56313001	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:56313001A>T	ENST00000589093.1	-	5	2201	c.2108T>A	c.(2107-2109)cTa>cAa	p.L703Q	NLRP11_ENST00000360133.3_Missense_Mutation_p.L649Q|NLRP11_ENST00000592953.1_Missense_Mutation_p.L604Q|NLRP11_ENST00000589824.2_Missense_Mutation_p.L649Q|NLRP11_ENST00000443188.1_Missense_Mutation_p.L703Q			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	703							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		AAACATATTTAGGGAAATGGA	0.463																																							uc010ygf.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(2107-2109)CTA>CAA		NLR family, pyrin domain containing 11							162.0	140.0	148.0					19																	56313001		2203	4300	6503	SO:0001583	missense	204801						ATP binding	g.chr19:56313001A>T	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.2108T>A	19.37:g.56313001A>T	ENSP00000466285:p.Leu703Gln					NLRP11_uc002qlz.2_Missense_Mutation_p.L550Q|NLRP11_uc002qmb.2_Missense_Mutation_p.L604Q|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	p.L703Q	NM_145007	NP_659444	P59045	NAL11_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	7	2819	-		Colorectal(82;0.0002)	703					C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	37	c.2108T>A	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.452902	0.01080	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.51817	0.69;0.69	2.11	-4.21	0.03812	.	.	.	.	.	T	0.21103	0.0508	N	0.16368	0.405	0.09310	N	1	B;B	0.13145	0.002;0.007	B;B	0.16722	0.007;0.016	T	0.23048	-1.0199	9	0.14252	T	0.57	.	0.751	0.00990	0.1765:0.1714:0.3599:0.2922	.	703;649	P59045;P59045-2	NAL11_HUMAN;.	Q	703;649	ENSP00000409898:L703Q;ENSP00000353251:L649Q	ENSP00000353251:L649Q	L	-	2	0	NLRP11	61004813	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.576000	0.05854	-1.592000	0.01619	0.533000	0.62120	CTA		0.463	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007		24	49	0	0	0	0.004656	0	24	49				
NLRP5	126206	broad.mit.edu	37	19	56565158	56565158	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr19:56565158G>C	ENST00000390649.3	+	13	3283	c.3283G>C	c.(3283-3285)Gtt>Ctt	p.V1095L		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	1095					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		AAAGAACAGTGTTCTGGCGAG	0.617																																							uc002qmj.2		NA																	0				ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7						c.(3283-3285)GTT>CTT		NACHT, LRR and PYD containing protein 5							88.0	90.0	90.0					19																	56565158		2059	4178	6237	SO:0001583	missense	126206					mitochondrion|nucleolus	ATP binding	g.chr19:56565158G>C	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.3283G>C	19.37:g.56565158G>C	ENSP00000375063:p.Val1095Leu					NLRP5_uc002qmi.2_Missense_Mutation_p.V1076L	p.V1095L	NM_153447	NP_703148	P59047	NALP5_HUMAN		GBM - Glioblastoma multiforme(193;0.0326)	13	3283	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	1095					A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	c.3283G>C	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	G	7.312	0.615203	0.14129	.	.	ENSG00000171487	ENST00000390649	T	0.52526	0.66	3.69	-2.89	0.05665	.	2.264110	0.02430	N	0.083483	T	0.32882	0.0844	L	0.31926	0.97	0.09310	N	1	B	0.10296	0.003	B	0.15484	0.013	T	0.06041	-1.0849	10	0.29301	T	0.29	.	2.8262	0.05486	0.1346:0.1:0.4755:0.2899	.	1095	P59047	NALP5_HUMAN	L	1095	ENSP00000375063:V1095L	ENSP00000375063:V1095L	V	+	1	0	NLRP5	61256970	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.903000	0.01594	-0.679000	0.05217	-1.045000	0.02358	GTT		0.617	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		13	39	0	0	0	0.004007	0	13	39				
MYT1L	23040	broad.mit.edu	37	2	1890380	1890380	+	Splice_Site	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:1890380C>A	ENST00000399161.2	-	18	3390		c.e18-1		MYT1L_ENST00000428368.2_Splice_Site	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCCAGACAGACTGTAAGACAG	0.448																																							uc002qxe.2		NA																	0				ovary(5)|central_nervous_system(1)	6						c.e18-1		myelin transcription factor 1-like							42.0	44.0	44.0					2																	1890380		1873	4119	5992	SO:0001630	splice_region_variant	23040				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:1890380C>A	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2643-1G>T	2.37:g.1890380C>A						MYT1L_uc002qxd.2_Splice_Site_p.T879_splice|MYT1L_uc010ewl.1_Splice_Site	p.T881_splice	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)	18	3470	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)						A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Splice_Site	SNP	ENST00000399161.2	37	c.2643_splice		.	.	.	.	.	.	.	.	.	.	C	21.2	4.108465	0.77096	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5417	0.95277	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYT1L	1869387	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.729000	0.84864	2.614000	0.88457	0.655000	0.94253	.		0.448	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	Intron	6	36	1	0	5.9392e-07	0.001168	8.31245e-07	6	36				
KCNF1	3754	broad.mit.edu	37	2	11053045	11053046	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:11053045_11053046CA>AG	ENST00000295082.1	+	1	983_984	c.493_494CA>AG	c.(493-495)CAg>AGg	p.Q165R		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	165					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		GCGCCGCTGCCAGAAGTGCGTC	0.698																																							uc002rax.2		NA																	0				ovary(1)	1						c.(493-495)CAG>AGG		potassium voltage-gated channel, subfamily F,																																				SO:0001583	missense	3754					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr2:11053045_11053046CA>AG	AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	Exception_encountered	2.37:g.11053045_11053046delinsAG	ENSP00000295082:p.Gln165Arg						p.Q165R	NM_002236	NP_002227	Q9H3M0	KCNF1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)	1	983_984	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		165			Cytoplasmic (Potential).		O43527|Q585L3	Missense_Mutation	DNP	ENST00000295082.1	37	c.493_494CA>AG	CCDS1676.1																																																																																				0.698	KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239265.1	NM_002236		5	40	0	0	0	0.004672	0	5	40				
DRC1	92749	broad.mit.edu	37	2	26676259	26676259	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:26676259G>T	ENST00000288710.2	+	14	1835	c.1761G>T	c.(1759-1761)gaG>gaT	p.E587D		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	587	Glu-rich.				axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											CAGAATTggagctggcagagc	0.582																																							uc002rhg.2		NA																	0					0						c.(1759-1761)GAG>GAT		hypothetical protein LOC92749							129.0	108.0	115.0					2																	26676259		2203	4300	6503	SO:0001583	missense	92749							g.chr2:26676259G>T	AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.1761G>T	2.37:g.26676259G>T	ENSP00000288710:p.Glu587Asp						p.E587D	NM_145038	NP_659475	Q96MC2	CC164_HUMAN			14	1835	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		587			Glu-rich.		A8K1N8|Q53R91|Q53TA3|Q8NDI5	Missense_Mutation	SNP	ENST00000288710.2	37	c.1761G>T	CCDS1723.1	.	.	.	.	.	.	.	.	.	.	G	7.505	0.653484	0.14580	.	.	ENSG00000157856	ENST00000288710;ENST00000439066	T	0.15372	2.43	4.89	-0.348	0.12613	.	0.565011	0.17970	N	0.155882	T	0.11410	0.0278	L	0.46157	1.445	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.37753	-0.9692	10	0.15066	T	0.55	-7.5635	5.889	0.18897	0.2375:0.4021:0.3604:0.0	.	587	Q96MC2	CC164_HUMAN	D	587;143	ENSP00000288710:E587D	ENSP00000288710:E587D	E	+	3	2	CCDC164	26529763	0.006000	0.16342	0.000000	0.03702	0.006000	0.05464	-0.322000	0.08007	-0.299000	0.08909	-0.175000	0.13238	GAG		0.582	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246862.1	NM_145038		20	81	1	0	1.37878e-21	0.00333	2.75353e-21	20	81				
OTOF	9381	broad.mit.edu	37	2	26690031	26690031	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:26690031C>A	ENST00000272371.2	-	35	4424	c.4298G>T	c.(4297-4299)cGg>cTg	p.R1433L	OTOF_ENST00000338581.6_Missense_Mutation_p.R666L|OTOF_ENST00000403946.3_Missense_Mutation_p.R1433L|OTOF_ENST00000402415.3_Missense_Mutation_p.R743L|OTOF_ENST00000339598.3_Missense_Mutation_p.R666L	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1433					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTCTTGCCCCGAAGCAAGTT	0.602																																					GBM(102;732 1451 20652 24062 31372)	GBM(102;732 1451 20652 24062 31372)	uc002rhk.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7						c.(4297-4299)CGG>CTG		otoferlin isoform a							69.0	64.0	66.0					2																	26690031		2203	4300	6503	SO:0001583	missense	9381				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding	g.chr2:26690031C>A	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4298G>T	2.37:g.26690031C>A	ENSP00000272371:p.Arg1433Leu					OTOF_uc010yla.1_Missense_Mutation_p.R163L|OTOF_uc002rhh.2_Missense_Mutation_p.R666L|OTOF_uc002rhi.2_Missense_Mutation_p.R743L|OTOF_uc002rhj.2_Missense_Mutation_p.R666L	p.R1433L	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN			35	4425	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1433			Cytoplasmic (Potential).		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	c.4298G>T	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.857998	0.91433	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	D;D;D;D;D	0.85629	-1.69;-1.71;-1.71;-1.99;-2.01	5.06	4.18	0.49190	.	0.052758	0.85682	D	0.000000	D	0.93184	0.7829	M	0.90483	3.12	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.998;0.987;1.0;0.998	D	0.94238	0.7482	10	0.87932	D	0	-25.0678	13.587	0.61937	0.0:0.923:0.0:0.077	.	1433;666;743;666	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	L	666;666;743;1433;1433	ENSP00000345137:R666L;ENSP00000344521:R666L;ENSP00000383906:R743L;ENSP00000272371:R1433L;ENSP00000385255:R1433L	ENSP00000272371:R1433L	R	-	2	0	OTOF	26543535	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	7.749000	0.85096	1.257000	0.44085	0.655000	0.94253	CGG		0.602	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			14	57	1	0	3.27435e-08	0.00245	4.81979e-08	14	57				
OTOF	9381	broad.mit.edu	37	2	26739403	26739403	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:26739403C>A	ENST00000272371.2	-	5	518	c.392G>T	c.(391-393)gGg>gTg	p.G131V	OTOF_ENST00000403946.3_Missense_Mutation_p.G131V	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	131					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGAAGTCCCCATCGTCCCA	0.647																																					GBM(102;732 1451 20652 24062 31372)	GBM(102;732 1451 20652 24062 31372)	uc002rhk.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7						c.(391-393)GGG>GTG		otoferlin isoform a							77.0	74.0	75.0					2																	26739403		2203	4300	6503	SO:0001583	missense	9381				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding	g.chr2:26739403C>A	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.392G>T	2.37:g.26739403C>A	ENSP00000272371:p.Gly131Val					OTOF_uc010ylb.1_RNA	p.G131V	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN			5	519	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		131			Cytoplasmic (Potential).		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	c.392G>T	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.560539	0.65538	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.79940	-1.32;-1.32	4.84	3.96	0.45880	C2 calcium/lipid-binding domain, CaLB (1);	0.156542	0.56097	D	0.000031	T	0.75700	0.3885	L	0.54323	1.7	0.80722	D	1	B	0.23058	0.079	B	0.24155	0.051	T	0.73480	-0.3969	10	0.52906	T	0.07	-23.7141	11.2498	0.49020	0.0:0.9103:0.0:0.0897	.	131	Q9HC10	OTOF_HUMAN	V	131	ENSP00000272371:G131V;ENSP00000385255:G131V	ENSP00000272371:G131V	G	-	2	0	OTOF	26592907	0.530000	0.26330	0.991000	0.47740	0.934000	0.57294	2.126000	0.42026	1.256000	0.44068	0.655000	0.94253	GGG		0.647	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			20	87	1	0	3.73194e-20	0.010504	7.37893e-20	20	87				
LTBP1	4052	broad.mit.edu	37	2	33540297	33540297	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:33540297C>A	ENST00000404816.2	+	24	4044	c.3691C>A	c.(3691-3693)Cag>Aag	p.Q1231K	LTBP1_ENST00000418533.2_Missense_Mutation_p.Q905K|LTBP1_ENST00000390003.4_Missense_Mutation_p.Q906K|LTBP1_ENST00000404525.1_Missense_Mutation_p.Q852K|LTBP1_ENST00000272273.5_Missense_Mutation_p.Q171K|LTBP1_ENST00000402934.1_Missense_Mutation_p.Q852K|LTBP1_ENST00000407925.1_Missense_Mutation_p.Q905K|LTBP1_ENST00000354476.3_Missense_Mutation_p.Q1232K			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1231	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TGTCTGCCAGCAGGGTTTCTC	0.423																																							uc002ros.2		NA																	0				ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8						c.(3694-3696)CAG>AAG		latent transforming growth factor beta binding							116.0	104.0	108.0					2																	33540297		2203	4300	6503	SO:0001583	missense	4052				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity	g.chr2:33540297C>A		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.3691C>A	2.37:g.33540297C>A	ENSP00000386043:p.Gln1231Lys					LTBP1_uc002rot.2_Missense_Mutation_p.Q906K|LTBP1_uc002rou.2_Missense_Mutation_p.Q905K|LTBP1_uc002rov.2_Missense_Mutation_p.Q852K|LTBP1_uc010ymz.1_Missense_Mutation_p.Q905K|LTBP1_uc010yna.1_Missense_Mutation_p.Q852K|LTBP1_uc010ynb.1_Missense_Mutation_p.Q171K	p.Q1232K	NM_206943	NP_996826	Q14766	LTBP1_HUMAN			24	3694	+	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)	1231			EGF-like 12; calcium-binding (Potential).		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	c.3694C>A	CCDS33177.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.30|17.30	3.353484|3.353484	0.61293|0.61293	.|.	.|.	ENSG00000049323|ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000272273;ENST00000422669|ENST00000415140	D;D;D;D;D;D;D;D;D|.	0.91945|.	-2.94;-2.94;-2.94;-2.94;-2.94;-2.94;-2.94;-2.94;-2.94|.	4.98|4.98	4.98|4.98	0.66077|0.66077	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);|.	.|.	.|.	.|.	.|.	T|T	0.60444|0.60444	0.2269|0.2269	L|L	0.37507|0.37507	1.11|1.11	0.44798|0.44798	D|D	0.997805|0.997805	B;B;P;B;B;B;B|.	0.36647|.	0.027;0.416;0.563;0.05;0.363;0.363;0.363|.	B;B;B;B;B;B;P|.	0.44518|.	0.016;0.403;0.254;0.022;0.384;0.384;0.452|.	T|T	0.56553|0.56553	-0.7960|-0.7960	9|5	0.56958|.	D|.	0.05|.	.|.	18.2782|18.2782	0.90089|0.90089	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	171;1231;905;852;905;906;1232|.	E7EUU6;Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4|.	.;LTBP1_HUMAN;.;.;.;.;.|.	K|R	1231;1232;906;905;852;852;905;171;109|192	ENSP00000386043:Q1231K;ENSP00000346467:Q1232K;ENSP00000374653:Q906K;ENSP00000393057:Q905K;ENSP00000384373:Q852K;ENSP00000385359:Q852K;ENSP00000384091:Q905K;ENSP00000272273:Q171K;ENSP00000395211:Q109K|.	ENSP00000272273:Q171K|.	Q|S	+|+	1|3	0|2	LTBP1|LTBP1	33393801|33393801	0.998000|0.998000	0.40836|0.40836	0.899000|0.899000	0.35326|0.35326	0.685000|0.685000	0.39939|0.39939	4.091000|4.091000	0.57700|0.57700	2.295000|2.295000	0.77249|0.77249	0.655000|0.655000	0.94253|0.94253	CAG|AGC		0.423	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943		12	60	1	0	1.5842e-08	0.001855	2.38854e-08	12	60				
SRSF7	6432	broad.mit.edu	37	2	38975201	38975201	+	Missense_Mutation	SNP	G	G	A	rs375213460		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:38975201G>A	ENST00000313117.6	-	5	797	c.560C>T	c.(559-561)tCg>tTg	p.S187L	SRSF7_ENST00000446327.2_Missense_Mutation_p.S187L|SRSF7_ENST00000409276.1_Missense_Mutation_p.S187L	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	187	6 X 8 AA repeats of R-R-S-R-S-X-S-X.|Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						GAAATACCTCGATCCTTTTAT	0.388																																							uc002rqz.2		NA																	0					0						c.(559-561)TCG>TTG		splicing factor, arginine/serine-rich 7		G	LEU/SER,LEU/SER	0,4406		0,0,2203	103.0	96.0	98.0		560,560	6.2	1.0	2		98	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SRSF7	NM_001031684.2,NM_001195446.1	145,145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	187/239,187/227	38975201	1,13005	2203	4300	6503	SO:0001583	missense	6432				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding|zinc ion binding	g.chr2:38975201G>A	L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875		"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7		8013463, 20516191	Standard	NM_001031684		Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.560C>T	2.37:g.38975201G>A	ENSP00000325905:p.Ser187Leu					SFRS7_uc002rra.2_RNA|SFRS7_uc010ynp.1_Missense_Mutation_p.S187L	p.S187L	NM_001031684	NP_001026854	Q16629	SRSF7_HUMAN			5	798	-		all_hematologic(82;0.248)	187			6 X 8 AA repeats of R-R-S-R-S-X-S-X.|Arg/Ser-rich (RS domain).		B4DLU6|G5E9M3|Q564D3	Missense_Mutation	SNP	ENST00000313117.6	37	c.560C>T	CCDS33183.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294049	0.60086	0.0	1.16E-4	ENSG00000115875	ENST00000313117;ENST00000446327;ENST00000409276	T;T;T	0.39787	1.06;1.06;1.56	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000015	T	0.63355	0.2504	L	0.60455	1.87	0.80722	D	1	D;D	0.69078	0.997;0.994	D;P	0.66847	0.947;0.885	T	0.59936	-0.7360	10	0.59425	D	0.04	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	187;187	G5E9M3;Q16629	.;SRSF7_HUMAN	L	187	ENSP00000325905:S187L;ENSP00000402264:S187L;ENSP00000386806:S187L	ENSP00000325905:S187L	S	-	2	0	SRSF7	38828705	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.436000	0.66538	2.941000	0.99782	0.655000	0.94253	TCG		0.388	SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219889.2	NM_001031684		10	49	0	0	0	0.008291	0	10	49				
ABCG8	64241	broad.mit.edu	37	2	44102542	44102542	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:44102542C>G	ENST00000272286.2	+	11	1836	c.1746C>G	c.(1744-1746)agC>agG	p.S582R		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	582	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	ACTTGAGCAGCCTGTGGACAG	0.577																																							uc002rtq.2		NA																	0				skin(3)|ovary(1)	4						c.(1744-1746)AGC>AGG		ATP-binding cassette sub-family G member 8							32.0	35.0	34.0					2																	44102542		2203	4300	6503	SO:0001583	missense	64241				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity	g.chr2:44102542C>G	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1746C>G	2.37:g.44102542C>G	ENSP00000272286:p.Ser582Arg					ABCG8_uc010yoa.1_Missense_Mutation_p.S581R	p.S582R	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN			11	1836	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	582			Helical; Name=5; (Potential).|ABC transmembrane type-2.		Q53QN8	Missense_Mutation	SNP	ENST00000272286.2	37	c.1746C>G	CCDS1815.1	.	.	.	.	.	.	.	.	.	.	C	7.167	0.586858	0.13749	.	.	ENSG00000143921	ENST00000272286	T	0.72942	-0.7	4.5	-0.835	0.10775	ABC-2 type transporter (1);	0.145459	0.64402	D	0.000013	T	0.45094	0.1325	N	0.08118	0	0.25591	N	0.986696	B;B	0.33883	0.376;0.43	B;B	0.34590	0.117;0.186	T	0.40440	-0.9563	10	0.62326	D	0.03	.	6.7619	0.23546	0.4857:0.3784:0.0:0.1358	.	581;582	Q9H221-2;Q9H221	.;ABCG8_HUMAN	R	582	ENSP00000272286:S582R	ENSP00000272286:S582R	S	+	3	2	ABCG8	43956046	1.000000	0.71417	0.004000	0.12327	0.023000	0.10783	2.002000	0.40835	-0.609000	0.05724	-0.521000	0.04368	AGC		0.577	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437		8	43	0	0	0	0.00308	0	8	43				
PSME4	23198	broad.mit.edu	37	2	54133777	54133777	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:54133777C>T	ENST00000404125.1	-	26	2956	c.2901G>A	c.(2899-2901)atG>atA	p.M967I	PSME4_ENST00000421748.2_Missense_Mutation_p.M111I	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	967					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GATCTCTGATCATATCTTGAT	0.353																																							uc002rxp.2		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(2899-2901)ATG>ATA		proteasome (prosome, macropain) activator							161.0	162.0	162.0					2																	54133777		2203	4300	6503	SO:0001583	missense	23198				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding	g.chr2:54133777C>T	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2901G>A	2.37:g.54133777C>T	ENSP00000384211:p.Met967Ile					PSME4_uc010yop.1_Missense_Mutation_p.M853I|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.M342I|PSME4_uc010fbv.1_Missense_Mutation_p.M111I	p.M967I	NM_014614	NP_055429	Q14997	PSME4_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		26	2957	-			967					Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	c.2901G>A	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	C	9.921	1.212081	0.22289	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.60672	0.17;0.17	5.51	5.51	0.81932	Armadillo-like helical (1);Armadillo-type fold (1);	0.083432	0.85682	D	0.000000	T	0.41096	0.1144	N	0.11427	0.14	0.50313	D	0.999865	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.21827	-1.0234	10	0.19147	T	0.46	-22.3722	19.777	0.96399	0.0:1.0:0.0:0.0	.	342;111;967	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	I	111;967	ENSP00000410830:M111I;ENSP00000384211:M967I	ENSP00000384211:M967I	M	-	3	0	PSME4	53987281	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.641000	0.37197	2.742000	0.94016	0.650000	0.86243	ATG		0.353	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158		20	88	0	0	0	0.001882	0	20	88				
SPTBN1	6711	broad.mit.edu	37	2	54872392	54872392	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:54872392G>T	ENST00000356805.4	+	21	4577	c.4296G>T	c.(4294-4296)cgG>cgT	p.R1432R	SPTBN1_ENST00000333896.5_Silent_p.R1419R	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1432					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			TGGAAGTGCGGAAGAAGGAGA	0.562																																							uc002rxu.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8						c.(4294-4296)CGG>CGT		spectrin, beta, non-erythrocytic 1 isoform 1							93.0	89.0	90.0					2																	54872392		2203	4300	6503	SO:0001819	synonymous_variant	6711				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton	g.chr2:54872392G>T		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.4296G>T	2.37:g.54872392G>T						SPTBN1_uc002rxx.2_Silent_p.R1419R	p.R1432R	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	Lung(47;0.24)		21	4545	+			1432			Spectrin 11.		B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	ENST00000356805.4	37	c.4296G>T	CCDS33198.1																																																																																				0.562	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3			15	72	1	0	2.31682e-05	0.003163	2.91954e-05	15	72				
CYP26B1	56603	broad.mit.edu	37	2	72362450	72362450	+	Silent	SNP	G	G	C	rs143775993		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:72362450G>C	ENST00000001146.2	-	3	731	c.528C>G	c.(526-528)ccC>ccG	p.P176P	CYP26B1_ENST00000546307.1_Silent_p.P101P|CYP26B1_ENST00000412253.1_5'UTR	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	176					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						TGATGGCCTCGGGGTGGCTGC	0.627																																							uc002sih.1		NA																	0				skin(2)	2						c.(526-528)CCC>CCG		cytochrome P450, family 26, subfamily b,							95.0	93.0	93.0					2																	72362450		2203	4300	6503	SO:0001819	synonymous_variant	56603				cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding	g.chr2:72362450G>C		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.528C>G	2.37:g.72362450G>C						CYP26B1_uc010yra.1_Silent_p.P159P|CYP26B1_uc010yrb.1_Silent_p.P101P	p.P176P	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN			3	528	-			176					B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Silent	SNP	ENST00000001146.2	37	c.528C>G	CCDS1919.1																																																																																				0.627	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885		12	79	0	0	0	0.000978	0	12	79				
FUNDC2P2	388965	broad.mit.edu	37	2	84518123	84518123	+	RNA	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:84518123T>A	ENST00000331369.5	+	0	317									FUN14 domain containing 2 pseudogene 2																		GTGCACGGGTTTTATATTCCA	0.488																																							uc010ffz.1		NA																	0					0						c.(181-183)TTT>ATT		RecName: Full=FUN14 domain-containing protein 2; AltName: Full=Hepatitis C virus core-binding protein 6; AltName: Full=Cervical cancer proto-oncogene 3 protein;          Short=HCC-3;																																						388965							g.chr2:84518123T>A			2p11.2	2010-03-12			ENSG00000182814	ENSG00000182814			17247	pseudogene	pseudogene							Standard	NR_003663		Approved		uc010ffz.1		OTTHUMG00000152875		2.37:g.84518123T>A							p.F61I	NR_003663						1	318	+									Missense_Mutation	SNP	ENST00000331369.5	37	c.181T>A																																																																																					0.488	FUNDC2P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000333681.1	NR_003663		27	155	0	0	0	0.00632	0	27	155				
NMS	129521	broad.mit.edu	37	2	101097619	101097619	+	Missense_Mutation	SNP	T	T	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:101097619T>G	ENST00000376865.1	+	8	411	c.404T>G	c.(403-405)tTc>tGc	p.F135C		NM_001011717.1	NP_001011717.1	Q5H8A3	NMS_HUMAN	neuromedin S	135					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				breast(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)	14						CGACCCTTTTTCCTTTTCAGG	0.438																																							uc002tan.1		NA																	0				ovary(1)	1						c.(403-405)TTC>TGC		neuromedin S precursor							293.0	277.0	282.0					2																	101097619		2203	4300	6503	SO:0001583	missense	129521				neuropeptide signaling pathway|regulation of smooth muscle contraction	extracellular region		g.chr2:101097619T>G	AB164464	CCDS33259.1	2q11.2	2013-02-26			ENSG00000204640	ENSG00000204640		"""Endogenous ligands"""	32203	protein-coding gene	gene with protein product	"""prepro-NMS"""					15635449	Standard	NM_001011717		Approved		uc002tan.1	Q5H8A3	OTTHUMG00000153142	ENST00000376865.1:c.404T>G	2.37:g.101097619T>G	ENSP00000366061:p.Phe135Cys						p.F135C	NM_001011717	NP_001011717	Q5H8A3	NMS_HUMAN			8	411	+			135						Missense_Mutation	SNP	ENST00000376865.1	37	c.404T>G	CCDS33259.1	.	.	.	.	.	.	.	.	.	.	T	9.962	1.223173	0.22457	.	.	ENSG00000204640	ENST00000376865	T	0.48201	0.82	4.93	2.46	0.29980	.	0.067612	0.64402	D	0.000017	T	0.35828	0.0945	L	0.36672	1.1	0.33293	D	0.563824	B	0.22851	0.076	B	0.30316	0.114	T	0.41538	-0.9503	10	0.87932	D	0	-11.6739	5.615	0.17426	0.1716:0.0:0.1795:0.6489	.	135	Q5H8A3	NMS_HUMAN	C	135	ENSP00000366061:F135C	ENSP00000366061:F135C	F	+	2	0	NMS	100464051	1.000000	0.71417	0.999000	0.59377	0.648000	0.38561	1.465000	0.35299	0.411000	0.25702	-0.291000	0.09656	TTC		0.438	NMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329737.1	NM_001011717		34	114	0	0	0	0.003271	0	34	114				
SLC9A4	389015	broad.mit.edu	37	2	103095489	103095489	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:103095489C>G	ENST00000295269.4	+	2	905	c.448C>G	c.(448-450)Ccc>Gcc	p.P150A		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	150					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GCCCACCCGGCCCTTCTTTGA	0.592																																							uc002tbz.3		NA																	0				skin(2)|central_nervous_system(1)	3						c.(448-450)CCC>GCC		solute carrier family 9 (sodium/hydrogen							60.0	57.0	58.0					2																	103095489		2203	4300	6503	SO:0001583	missense	389015				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity	g.chr2:103095489C>G		CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.448C>G	2.37:g.103095489C>G	ENSP00000295269:p.Pro150Ala						p.P150A	NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN			2	905	+			150			Cytoplasmic (Potential).		Q69YK0	Missense_Mutation	SNP	ENST00000295269.4	37	c.448C>G	CCDS33264.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.829711	0.50845	.	.	ENSG00000180251	ENST00000295269	T	0.14266	2.52	5.51	5.51	0.81932	Cation/H+ exchanger (1);	0.055929	0.64402	D	0.000001	T	0.12050	0.0293	L	0.31752	0.955	0.53688	D	0.999971	B	0.14438	0.01	B	0.13407	0.009	T	0.14587	-1.0467	10	0.10636	T	0.68	.	19.4362	0.94796	0.0:1.0:0.0:0.0	.	150	Q6AI14	SL9A4_HUMAN	A	150	ENSP00000295269:P150A	ENSP00000295269:P150A	P	+	1	0	SLC9A4	102461921	1.000000	0.71417	0.983000	0.44433	0.989000	0.77384	3.847000	0.55895	2.589000	0.87451	0.655000	0.94253	CCC		0.592	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329498.1	NM_001011552.3		7	42	0	0	0	0.00308	0	7	42				
SULT1C2	6819	broad.mit.edu	37	2	108910141	108910141	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:108910141C>A	ENST00000437390.2	+	2	195	c.18C>A	c.(16-18)gaC>gaA	p.D6E	SULT1C2_ENST00000326853.5_Missense_Mutation_p.D6E|SULT1C2_ENST00000251481.6_Missense_Mutation_p.D6E|SULT1C2_ENST00000409880.1_Missense_Mutation_p.D6E			O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 2	12					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						TGACCTCAGACCTGGGGAAAC	0.478																																							uc002tdy.2		NA																	0				ovary(1)	1						c.(16-18)GAC>GAA		sulfotransferase family, cytosolic, 1C, member 1							64.0	62.0	63.0					2																	108910141		2203	4300	6503	SO:0001583	missense	6819				3'-phosphoadenosine 5'-phosphosulfate metabolic process|amine metabolic process|sulfation|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	sulfotransferase activity	g.chr2:108910141C>A	U66036, AF186255	CCDS2075.1, CCDS2076.1	2q12.3	2010-09-30	2007-03-16	2007-03-16	ENSG00000198203	ENSG00000198203		"""Sulfotransferases, cytosolic"""	11456	protein-coding gene	gene with protein product		602385	"""sulfotransferase family, cytosolic, 1C, member 1"""	SULT1C1		9169148, 10783263	Standard	NM_001056		Approved	ST1C1	uc002tdx.3	O00338	OTTHUMG00000153215	ENST00000437390.2:c.18C>A	2.37:g.108910141C>A	ENSP00000399651:p.Asp6Glu					SULT1C2_uc010ywp.1_5'UTR|SULT1C2_uc002tdx.2_Missense_Mutation_p.D6E|SULT1C2_uc010ywq.1_Missense_Mutation_p.D6E	p.D6E	NM_001056	NP_001047	O00338	ST1C2_HUMAN			2	471	+			6					Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	ENST00000437390.2	37	c.18C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.064|2.064	-0.414608|-0.414608	0.04766|0.04766	.|.	.|.	ENSG00000198203|ENSG00000198203	ENST00000251481;ENST00000326853;ENST00000438339;ENST00000409880;ENST00000437390|ENST00000409067	T;T;T;T;T|.	0.07444|.	4.96;4.92;3.19;4.83;4.86|.	4.57|4.57	-8.76|-8.76	0.00830|0.00830	.|.	1.266490|.	0.05419|.	N|.	0.543874|.	T|T	0.11580|0.11580	0.0282|0.0282	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.06405|.	0.0;0.001;0.002|.	T|T	0.16217|0.16217	-1.0410|-1.0410	10|5	0.07644|.	T|.	0.81|.	.|.	2.972|2.972	0.05926|0.05926	0.436:0.3038:0.1583:0.1019|0.436:0.3038:0.1583:0.1019	.|.	6;6;6|.	B4DLP0;O00338;O00338-2|.	.;ST1C2_HUMAN;.|.	E|T	6|3	ENSP00000251481:D6E;ENSP00000319622:D6E;ENSP00000401996:D6E;ENSP00000387054:D6E;ENSP00000399651:D6E|.	ENSP00000251481:D6E|.	D|P	+|+	3|1	2|0	SULT1C2|SULT1C2	108276573|108276573	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.032000|0.032000	0.12392|0.12392	-1.771000|-1.771000	0.01789|0.01789	-2.105000|-2.105000	0.00842|0.00842	-1.036000|-1.036000	0.02392|0.02392	GAC|CCT		0.478	SULT1C2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000329969.2	NM_176825		14	54	1	0	2.32078e-09	0.003163	3.60249e-09	14	54				
IL36G	56300	broad.mit.edu	37	2	113737597	113737597	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:113737597G>T	ENST00000259205.4	+	4	241	c.172G>T	c.(172-174)Gtt>Ttt	p.V58F	IL36G_ENST00000376489.2_Missense_Mutation_p.V23F	NM_019618.2	NP_062564.1	Q9NZH8	IL36G_HUMAN	interleukin 36, gamma	58					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						CACTGTTGCTGTTATCACATG	0.413																																						Esophageal Squamous(44;715 981 6239 42838 46707)	uc002tio.1		NA																	0					0						c.(172-174)GTT>TTT		interleukin 1 family, member 9							104.0	100.0	101.0					2																	113737597		2203	4300	6503	SO:0001583	missense	56300				cell-cell signaling	extracellular space	cytokine activity|interleukin-1 receptor antagonist activity	g.chr2:113737597G>T	AF200492	CCDS2108.1, CCDS62992.1	2q12-q21	2011-07-14	2011-06-06	2011-06-06	ENSG00000136688	ENSG00000136688		"""Interleukins and interleukin receptors"""	15741	protein-coding gene	gene with protein product	"""interleukin-1 homolog 1"", ""interleukin 1-related protein 2"", ""interleukin-1 epsilon"""	605542	"""interleukin 1 family, member 9"""	IL1F9		10860666, 10744718, 11991722, 11991723	Standard	NM_019618		Approved	IL-1H1, IL-1RP2, IL-1F9, IL1H1, IL1E	uc002tio.1	Q9NZH8	OTTHUMG00000131336	ENST00000259205.4:c.172G>T	2.37:g.113737597G>T	ENSP00000259205:p.Val58Phe					IL1F9_uc010fkr.1_Missense_Mutation_p.V23F	p.V58F	NM_019618	NP_062564	Q9NZH8	IL36G_HUMAN			4	241	+			58					Q56B91|Q6UVX7|Q7RTZ9	Missense_Mutation	SNP	ENST00000259205.4	37	c.172G>T	CCDS2108.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790634	0.50102	.	.	ENSG00000136688	ENST00000376489;ENST00000259205	T;T	0.52983	2.38;0.64	4.78	-9.56	0.00566	.	1.191720	0.06087	N	0.663034	T	0.56688	0.2002	M	0.82323	2.585	0.09310	N	1	P;D	0.55605	0.902;0.972	B;D	0.65010	0.421;0.931	T	0.57791	-0.7750	10	0.29301	T	0.29	-1.0423	2.078	0.03628	0.4636:0.091:0.1695:0.2758	.	23;58	Q9NZH8-2;Q9NZH8	.;IL36G_HUMAN	F	23;58	ENSP00000365672:V23F;ENSP00000259205:V58F	ENSP00000259205:V58F	V	+	1	0	IL36G	113454068	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-3.379000	0.00491	-2.907000	0.00309	0.650000	0.86243	GTT		0.413	IL36G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330713.2	NM_019618		5	92	1	0	1.06961e-07	0.00308	1.54449e-07	5	92				
MARCO	8685	broad.mit.edu	37	2	119735461	119735461	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:119735461C>G	ENST00000327097.4	+	8	851	c.716C>G	c.(715-717)cCa>cGa	p.P239R	MARCO_ENST00000541757.1_Missense_Mutation_p.P161R	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	239	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						CTCATTGGCCCAAAAGGGGAA	0.592																																					GBM(8;18 374 7467 11269 32796)	GBM(8;18 374 7467 11269 32796)	uc002tln.1		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(715-717)CCA>CGA		macrophage receptor with collagenous structure							45.0	44.0	44.0					2																	119735461		2202	4300	6502	SO:0001583	missense	8685				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity	g.chr2:119735461C>G	AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.716C>G	2.37:g.119735461C>G	ENSP00000318916:p.Pro239Arg					MARCO_uc010yyf.1_Missense_Mutation_p.P161R	p.P239R	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN			8	848	+			239			Collagen-like.|Extracellular (Potential).		B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	c.716C>G	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	C	4.501	0.092987	0.08632	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.83673	-1.75;-1.75	4.62	3.75	0.43078	.	0.241469	0.33813	N	0.004521	D	0.85856	0.5794	L	0.51853	1.615	0.40597	D	0.981544	D	0.63046	0.992	D	0.69479	0.964	D	0.84478	0.0603	9	.	.	.	.	8.6742	0.34170	0.0:0.8957:0.0:0.1043	.	239	Q9UEW3	MARCO_HUMAN	R	239;239;161	ENSP00000318916:P239R;ENSP00000441769:P161R	.	P	+	2	0	MARCO	119451931	0.587000	0.26791	0.903000	0.35520	0.259000	0.26198	0.548000	0.23314	1.174000	0.42811	0.561000	0.74099	CCA		0.592	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770		5	17	0	0	0	0.001168	0	5	17				
CNTNAP5	129684	broad.mit.edu	37	2	125175026	125175026	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:125175026G>A	ENST00000431078.1	+	4	752	c.388G>A	c.(388-390)Gca>Aca	p.A130T		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	130	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCAGACCTTTGCAGGAAACAT	0.488																																							uc002tno.2		NA																	0				ovary(10)	10						c.(388-390)GCA>ACA		contactin associated protein-like 5 precursor							76.0	75.0	75.0					2																	125175026		1994	4188	6182	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125175026G>A	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.388G>A	2.37:g.125175026G>A	ENSP00000399013:p.Ala130Thr					CNTNAP5_uc010flu.2_Missense_Mutation_p.A130T	p.A130T	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	4	752	+			130			F5/8 type C.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.388G>A	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.889130	0.33348	.	.	ENSG00000155052	ENST00000431078	D	0.98135	-4.74	6.13	0.636	0.17729	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.536195	0.15993	N	0.234707	D	0.89368	0.6695	N	0.04116	-0.275	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.81566	-0.0874	10	0.16896	T	0.51	.	3.6913	0.08347	0.0991:0.1166:0.3914:0.3929	.	130	Q8WYK1	CNTP5_HUMAN	T	130	ENSP00000399013:A130T	ENSP00000399013:A130T	A	+	1	0	CNTNAP5	124891496	0.054000	0.20591	0.737000	0.30932	0.991000	0.79684	0.408000	0.21065	0.436000	0.26393	0.650000	0.86243	GCA		0.488	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			7	24	0	0	0	0.00308	0	7	24				
GPR148	344561	broad.mit.edu	37	2	131487397	131487397	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:131487397C>G	ENST00000309926.4	+	1	755	c.673C>G	c.(673-675)Ctg>Gtg	p.L225V		NM_207364.2	NP_997247.2	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(15)|skin(3)|upper_aerodigestive_tract(1)	27	Colorectal(110;0.1)					CACCTCCATTCTGTGCGTTCT	0.562																																							uc002trv.1		NA																	0				skin(1)	1						c.(673-675)CTG>GTG		G protein-coupled receptor 148							154.0	147.0	149.0					2																	131487397		2203	4300	6503	SO:0001583	missense	344561					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr2:131487397C>G	AY255532	CCDS2163.1	2q21.2	2012-08-21			ENSG00000173302	ENSG00000173302		"""GPCR / Class A : Orphans"""	23623	protein-coding gene	gene with protein product						12679517	Standard	NM_207364		Approved	PGR6	uc002trv.2	Q8TDV2	OTTHUMG00000131655	ENST00000309926.4:c.673C>G	2.37:g.131487397C>G	ENSP00000308908:p.Leu225Val						p.L225V	NM_207364	NP_997247	Q8TDV2	GP148_HUMAN			1	675	+	Colorectal(110;0.1)		225			Helical; Name=5; (Potential).		Q2M369|Q86SP7|Q86U87	Missense_Mutation	SNP	ENST00000309926.4	37	c.673C>G	CCDS2163.1	.	.	.	.	.	.	.	.	.	.	.	0.461	-0.889137	0.02511	.	.	ENSG00000173302	ENST00000309926	T	0.72167	-0.63	2.87	-1.63	0.08345	GPCR, rhodopsin-like superfamily (1);	0.627020	0.12847	N	0.434321	T	0.42108	0.1188	N	0.08118	0	0.09310	N	1	B	0.29909	0.261	B	0.33392	0.163	T	0.34104	-0.9842	10	0.14656	T	0.56	-0.0127	3.8197	0.08830	0.0:0.2295:0.1986:0.5718	.	225	Q8TDV2	GP148_HUMAN	V	225	ENSP00000308908:L225V	ENSP00000308908:L225V	L	+	1	2	GPR148	131203867	0.804000	0.28969	0.000000	0.03702	0.035000	0.12851	0.077000	0.14738	-0.437000	0.07243	-0.379000	0.06801	CTG		0.562	GPR148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254552.3	XM_293092		10	87	0	0	0	0.001855	0	10	87				
AMER3	205147	broad.mit.edu	37	2	131520863	131520863	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:131520863C>A	ENST00000423981.1	+	2	1328	c.1218C>A	c.(1216-1218)ggC>ggA	p.G406G	AMER3_ENST00000321420.4_Silent_p.G406G	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	406					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										AGAGCCCAGGCACTCCTGCCG	0.622																																							uc002trw.2		NA																	0				pancreas(2)|ovary(1)	3						c.(1216-1218)GGC>GGA		hypothetical protein LOC205147							66.0	54.0	58.0					2																	131520863		2203	4300	6503	SO:0001819	synonymous_variant	205147							g.chr2:131520863C>A	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.1218C>A	2.37:g.131520863C>A						FAM123C_uc010fmv.2_Silent_p.G406G|FAM123C_uc010fms.1_Silent_p.G406G|FAM123C_uc010fmt.1_Silent_p.G406G|FAM123C_uc010fmu.1_Silent_p.G406G	p.G406G	NM_152698	NP_689911	Q8N944	F123C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	1408	+	Colorectal(110;0.1)		406					B7ZLH6	Silent	SNP	ENST00000423981.1	37	c.1218C>A	CCDS2164.1																																																																																				0.622	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		7	49	1	0	0.00198382	0.001984	0.0022658	7	49				
AMER3	205147	broad.mit.edu	37	2	131521085	131521085	+	Missense_Mutation	SNP	C	C	A	rs571439503		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:131521085C>A	ENST00000423981.1	+	2	1550	c.1440C>A	c.(1438-1440)agC>agA	p.S480R	AMER3_ENST00000321420.4_Missense_Mutation_p.S480R	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	480					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										ACCTGCTCAGCCAGGGCTTCC	0.652																																							uc002trw.2		NA																	0				pancreas(2)|ovary(1)	3						c.(1438-1440)AGC>AGA		hypothetical protein LOC205147							22.0	23.0	23.0					2																	131521085		2201	4299	6500	SO:0001583	missense	205147							g.chr2:131521085C>A	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.1440C>A	2.37:g.131521085C>A	ENSP00000392700:p.Ser480Arg					FAM123C_uc010fmv.2_Missense_Mutation_p.S480R|FAM123C_uc010fms.1_Missense_Mutation_p.S480R|FAM123C_uc010fmt.1_Missense_Mutation_p.S480R|FAM123C_uc010fmu.1_Missense_Mutation_p.S480R	p.S480R	NM_152698	NP_689911	Q8N944	F123C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	1630	+	Colorectal(110;0.1)		480					B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	c.1440C>A	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152000	0.57151	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.62105	0.05;0.05	5.16	-0.0751	0.13728	.	0.299176	0.28612	N	0.014724	T	0.58793	0.2147	L	0.32530	0.975	0.29675	N	0.842163	D	0.58620	0.983	P	0.56474	0.799	T	0.58962	-0.7543	10	0.72032	D	0.01	-5.9984	8.4027	0.32597	0.0:0.426:0.0:0.574	.	480	Q8N944	F123C_HUMAN	R	480	ENSP00000314914:S480R;ENSP00000392700:S480R	ENSP00000314914:S480R	S	+	3	2	FAM123C	131237555	0.992000	0.36948	0.884000	0.34674	0.994000	0.84299	0.182000	0.16900	-0.012000	0.14223	0.561000	0.74099	AGC		0.652	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		3	28	1	0	0.00909568	0.009096	0.00997167	3	28				
POTEE	445582	broad.mit.edu	37	2	132021450	132021450	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:132021450G>C	ENST00000356920.5	+	15	2516	c.2422G>C	c.(2422-2424)Gcc>Ccc	p.A808P	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	808	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GCTGACCGAGGCCCCCCTGAA	0.597																																							uc002tsn.2		NA																	0					0						c.(2422-2424)GCC>CCC		protein expressed in prostate, ovary, testis,							71.0	75.0	73.0					2																	132021450		2201	4295	6496	SO:0001583	missense	445582						ATP binding	g.chr2:132021450G>C	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2422G>C	2.37:g.132021450G>C	ENSP00000439189:p.Ala808Pro					PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Missense_Mutation_p.A408P|POTEE_uc002tsl.2_Missense_Mutation_p.A390P|POTEE_uc010fmy.1_Missense_Mutation_p.A272P	p.A808P	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN			15	2474	+			808			Actin-like.		Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	c.2422G>C	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	15.99	2.996393	0.54147	.	.	ENSG00000188219	ENST00000356920	D	0.96265	-3.96	.	.	.	Actin/actin-like conserved site (1);	.	.	.	.	D	0.95316	0.8480	L	0.51853	1.615	0.80722	D	1	P	0.48834	0.916	P	0.55011	0.766	D	0.92399	0.5928	8	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	808	Q6S8J3	POTEE_HUMAN	P	808	ENSP00000439189:A808P	ENSP00000439189:A808P	A	+	1	0	AC131180.1	131737920	1.000000	0.71417	0.234000	0.24042	0.238000	0.25445	6.504000	0.73704	0.119000	0.18210	0.121000	0.15741	GCC		0.597	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538		33	136	0	0	0	0.005524	0	33	136				
NCKAP5	344148	broad.mit.edu	37	2	133489455	133489455	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:133489455G>T	ENST00000409261.1	-	17	5671	c.5298C>A	c.(5296-5298)gcC>gcA	p.A1766A	NCKAP5_ENST00000409213.1_Silent_p.A447A|NCKAP5_ENST00000317721.6_Silent_p.A1766A|NCKAP5_ENST00000405974.3_Silent_p.A447A|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1766										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CAAGGGTTTGGGCTCTCATGG	0.592																																							uc002ttp.2		NA																	0					0						c.(5296-5298)GCC>GCA		Nck-associated protein 5 isoform 1							101.0	107.0	105.0					2																	133489455		2074	4209	6283	SO:0001819	synonymous_variant	344148						protein binding	g.chr2:133489455G>T	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.5298C>A	2.37:g.133489455G>T						NCKAP5_uc002ttq.2_Silent_p.A447A	p.A1766A	NM_207363	NP_997246	O14513	NCKP5_HUMAN			17	5672	-			1766					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	ENST00000409261.1	37	c.5298C>A	CCDS46418.1																																																																																				0.592	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		8	81	1	0	0.000157383	0.00308	0.000188254	8	81				
MAP3K19	80122	broad.mit.edu	37	2	135745227	135745227	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:135745227G>T	ENST00000375845.3	-	7	1245	c.1215C>A	c.(1213-1215)agC>agA	p.S405R	MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000358371.4_Missense_Mutation_p.S292R|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000392915.1_Missense_Mutation_p.S422R	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	405							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										CTTCATCCTGGCTTGGAGTTA	0.348																																							uc002tue.1		NA																	0				stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5						c.(1213-1215)AGC>AGA		Yeast Sps1/Ste20-related kinase 4 isoform 1							96.0	96.0	96.0					2																	135745227		2203	4299	6502	SO:0001583	missense	80122						ATP binding|protein serine/threonine kinase activity	g.chr2:135745227G>T	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.1215C>A	2.37:g.135745227G>T	ENSP00000365005:p.Ser405Arg					YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Missense_Mutation_p.S292R|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_Missense_Mutation_p.S133R|YSK4_uc002tui.3_Missense_Mutation_p.S422R	p.S405R	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.112)	7	1246	-			405					B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	37	c.1215C>A	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	G	10.87	1.471634	0.26423	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000392915	T;T;T	0.70869	-0.52;-0.52;1.84	5.03	0.217	0.15264	.	1.005840	0.07999	N	0.988461	T	0.56992	0.2023	L	0.39898	1.24	0.30108	N	0.806838	B;B;B	0.20261	0.019;0.043;0.011	B;B;B	0.18561	0.007;0.022;0.003	T	0.52931	-0.8509	10	0.72032	D	0.01	.	1.9023	0.03270	0.1633:0.1349:0.4679:0.2339	.	292;422;405	Q56UN5-3;A8MWG7;Q56UN5	.;.;YSK4_HUMAN	R	405;292;422	ENSP00000365005:S405R;ENSP00000351140:S292R;ENSP00000376647:S422R	ENSP00000351140:S292R	S	-	3	2	YSK4	135461697	0.000000	0.05858	0.005000	0.12908	0.798000	0.45092	-0.247000	0.08866	-0.149000	0.11215	0.585000	0.79938	AGC		0.348	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052		18	88	1	0	5.03518e-11	0.007413	8.14936e-11	18	88				
R3HDM1	23518	broad.mit.edu	37	2	136393668	136393668	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:136393668G>T	ENST00000264160.4	+	11	1188	c.818G>T	c.(817-819)cGt>cTt	p.R273L	R3HDM1_ENST00000329971.3_Missense_Mutation_p.R229L|R3HDM1_ENST00000409606.1_Missense_Mutation_p.R273L|R3HDM1_ENST00000410054.1_Missense_Mutation_p.R217L|R3HDM1_ENST00000409478.1_Missense_Mutation_p.R229L	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	273	SUZ. {ECO:0000255|PROSITE- ProRule:PRU01009}.						poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		ATGAGAATACGTTTGAAAGAT	0.353																																							uc002tuo.2		NA																	0				skin(1)	1						c.(817-819)CGT>CTT		R3H domain containing 1							125.0	136.0	132.0					2																	136393668		2203	4300	6503	SO:0001583	missense	23518						nucleic acid binding	g.chr2:136393668G>T	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.818G>T	2.37:g.136393668G>T	ENSP00000264160:p.Arg273Leu					R3HDM1_uc010fni.2_Missense_Mutation_p.R271L|R3HDM1_uc002tup.2_Missense_Mutation_p.R217L|R3HDM1_uc010zbh.1_Missense_Mutation_p.R105L	p.R273L	NM_015361	NP_056176	Q15032	R3HD1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.127)	11	1188	+			273					A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Missense_Mutation	SNP	ENST00000264160.4	37	c.818G>T	CCDS2177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.52|18.52	3.642025|3.642025	0.67244|0.67244	.|.	.|.	ENSG00000048991|ENSG00000048991	ENST00000422577;ENST00000409478;ENST00000264160;ENST00000329971;ENST00000410054;ENST00000409606|ENST00000456040	T;T;T;T;T|.	0.43688|.	0.94;0.94;0.94;0.94;0.94|.	5.58|5.58	5.58|5.58	0.84498|0.84498	SUZ domain (1);|.	0.052668|.	0.85682|.	D|.	0.000000|.	T|T	0.54902|0.54902	0.1887|0.1887	L|L	0.44542|0.44542	1.39|1.39	0.28738|0.28738	N|N	0.902111|0.902111	D;D;D;D|.	0.89917|.	0.999;1.0;0.999;0.999|.	D;D;D;D|.	0.85130|.	0.965;0.988;0.997;0.997|.	T|T	0.49606|0.49606	-0.8922|-0.8922	10|5	0.40728|.	T|.	0.16|.	-8.0704|-8.0704	19.922|19.922	0.97089|0.97089	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	229;273;217;273|.	G5E9G8;E9PBB4;E9PG42;Q15032|.	.;.;.;R3HD1_HUMAN|.	L|F	229;229;273;229;217;273|256	ENSP00000386457:R229L;ENSP00000264160:R273L;ENSP00000331396:R229L;ENSP00000386877:R217L;ENSP00000387010:R273L|.	ENSP00000264160:R273L|.	R|V	+|+	2|1	0|0	R3HDM1|R3HDM1	136110138|136110138	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.585000|6.585000	0.74062|0.74062	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	CGT|GTT		0.353	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254659.1	NM_015361		31	84	1	0	1.39806e-14	0.008361	2.51945e-14	31	84				
LCT	3938	broad.mit.edu	37	2	136569890	136569890	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:136569890C>A	ENST00000264162.2	-	7	2354	c.2344G>T	c.(2344-2346)Gtg>Ttg	p.V782L	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	782	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	CCCTTGAGCACCTCATTGATA	0.408																																							uc002tuu.1		NA																	0				ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(2344-2346)GTG>TTG		lactase-phlorizin hydrolase preproprotein							109.0	109.0	109.0					2																	136569890		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136569890C>A	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2344G>T	2.37:g.136569890C>A	ENSP00000264162:p.Val782Leu						p.V782L	NM_002299	NP_002290	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	7	2355	-			782			Extracellular (Potential).|4 X approximate repeats.|2.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.2344G>T	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349232	0.82132	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.35048	1.33	5.56	5.56	0.83823	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.061092	0.64402	D	0.000004	T	0.46908	0.1417	L	0.33792	1.035	0.51233	D	0.999918	D	0.59767	0.986	P	0.58172	0.834	T	0.31641	-0.9936	10	0.44086	T	0.13	-20.8226	19.5245	0.95199	0.0:1.0:0.0:0.0	.	782	P09848	LPH_HUMAN	L	782;214	ENSP00000264162:V782L	ENSP00000264162:V782L	V	-	1	0	LCT	136286360	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.046000	0.71029	2.608000	0.88229	0.655000	0.94253	GTG		0.408	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		8	118	1	0	2.17888e-05	0.006214	2.75588e-05	8	118				
LRP1B	53353	broad.mit.edu	37	2	141055532	141055532	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:141055532G>C	ENST00000389484.3	-	84	13783	c.12812C>G	c.(12811-12813)cCc>cGc	p.P4271R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4271	EGF-like 18. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.P4271H(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCTGCAGGTGGGTCTCCCTAT	0.403										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(12811-12813)CCC>CGC		low density lipoprotein-related protein 1B							90.0	95.0	93.0					2																	141055532		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141055532G>C	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12812C>G	2.37:g.141055532G>C	ENSP00000374135:p.Pro4271Arg	TSP Lung(27;0.18)					p.P4271R	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	84	13784	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4271			Extracellular (Potential).|EGF-like 11.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.12812C>G	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	4.003733|4.003733	0.74932|0.74932	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000437977;ENST00000442974|ENST00000389484;ENST00000544579	D;T|D	0.92647|0.92858	-3.08;2.66|-3.12	6.08|6.08	6.08|6.08	0.98989|0.98989	.|EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.94348|0.94348	0.8183|0.8183	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.91025|0.91025	0.4860|0.4860	8|10	0.24483|0.18710	T|T	0.36|0.47	.|.	20.6634|20.6634	0.99662|0.99662	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|4271	.|Q9NZR2	.|LRP1B_HUMAN	A|R	503;3|4271;4209	ENSP00000415052:P503A;ENSP00000393859:P3A|ENSP00000374135:P4271R	ENSP00000415052:P503A|ENSP00000374135:P4271R	P|P	-|-	1|2	0|0	LRP1B|LRP1B	140772002|140772002	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.611000|0.611000	0.37282|0.37282	9.824000|9.824000	0.99380|0.99380	2.894000|2.894000	0.99253|0.99253	0.655000|0.655000	0.94253|0.94253	CCA|CCC		0.403	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		11	137	0	0	0	0.000978	0	11	137				
KYNU	8942	broad.mit.edu	37	2	143718199	143718199	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:143718199G>C	ENST00000264170.4	+	8	847	c.589G>C	c.(589-591)Gaa>Caa	p.E197Q	KYNU_ENST00000409512.1_Missense_Mutation_p.E197Q|KYNU_ENST00000375773.2_Missense_Mutation_p.E197Q	NM_003937.2	NP_003928.1			kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		TTAGGGGGAAGAAACCTTAAG	0.383																																							uc002tvl.2		NA																	0				skin(2)	2						c.(589-591)GAA>CAA		kynureninase (L-kynurenine hydrolase) isoform a	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)						91.0	91.0	91.0					2																	143718199		2203	4300	6503	SO:0001583	missense	8942				anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity	g.chr2:143718199G>C	U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.589G>C	2.37:g.143718199G>C	ENSP00000264170:p.Glu197Gln					KYNU_uc002tvk.2_Missense_Mutation_p.E197Q|KYNU_uc010fnm.2_Missense_Mutation_p.E197Q	p.E197Q	NM_003937	NP_003928	Q16719	KYNU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.072)	8	719	+			197						Missense_Mutation	SNP	ENST00000264170.4	37	c.589G>C	CCDS2183.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.823801	0.50739	.	.	ENSG00000115919	ENST00000264170;ENST00000375773;ENST00000409512	D;D;D	0.86030	-2.06;-2.06;-2.06	5.35	5.35	0.76521	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.162190	0.53938	D	0.000042	T	0.78566	0.4303	L	0.34521	1.04	0.80722	D	1	B;B	0.21520	0.007;0.057	B;B	0.14578	0.007;0.011	T	0.72852	-0.4167	10	0.12766	T	0.61	.	19.0789	0.93173	0.0:0.0:1.0:0.0	.	197;197	Q16719;Q9BVW3	KYNU_HUMAN;.	Q	197	ENSP00000264170:E197Q;ENSP00000364928:E197Q;ENSP00000386731:E197Q	ENSP00000264170:E197Q	E	+	1	0	KYNU	143434669	1.000000	0.71417	0.995000	0.50966	0.946000	0.59487	9.360000	0.97119	2.668000	0.90789	0.644000	0.83932	GAA		0.383	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254772.1	NM_001032998		13	55	0	0	0	0.003163	0	13	55				
PKP4	8502	broad.mit.edu	37	2	159537118	159537118	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:159537118G>A	ENST00000389759.3	+	22	3620	c.3508G>A	c.(3508-3510)Gac>Aac	p.D1170N	AC005042.4_ENST00000442666.1_RNA|AC005042.4_ENST00000342892.4_RNA|PKP4_ENST00000389757.3_Missense_Mutation_p.D1127N	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	1170					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						AAATTATGTAGACTTTTATTC	0.418										HNSCC(62;0.18)																													uc002tzv.2		NA																	0				ovary(5)|skin(2)	7						c.(3508-3510)GAC>AAC		plakophilin 4 isoform a							122.0	124.0	123.0					2																	159537118		2202	4300	6502	SO:0001583	missense	8502				cell adhesion	desmosome	protein binding	g.chr2:159537118G>A	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.3508G>A	2.37:g.159537118G>A	ENSP00000374409:p.Asp1170Asn	HNSCC(62;0.18)				PKP4_uc002tzw.2_Missense_Mutation_p.D1127N|PKP4_uc002tzx.2_Missense_Mutation_p.D827N|PKP4_uc002uaa.2_Missense_Mutation_p.D979N|uc002uab.1_Intron|PKP4_uc002uac.2_Missense_Mutation_p.D351N|PKP4_uc002uad.2_RNA	p.D1170N	NM_003628	NP_003619	Q99569	PKP4_HUMAN			22	3768	+			1170					Q86W91	Missense_Mutation	SNP	ENST00000389759.3	37	c.3508G>A	CCDS33305.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852446	0.71719	.	.	ENSG00000144283	ENST00000389757;ENST00000389759	D;D	0.89270	-2.49;-2.0	5.49	5.49	0.81192	.	0.049501	0.85682	D	0.000000	D	0.92103	0.7497	L	0.36672	1.1	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.531	D;D;B	0.87578	0.998;0.998;0.098	D	0.91723	0.5390	10	0.48119	T	0.1	-16.8185	19.7433	0.96241	0.0:0.0:1.0:0.0	.	1125;1127;1170	Q4W5T8;Q99569-2;Q99569	.;.;PKP4_HUMAN	N	1127;1170	ENSP00000374407:D1127N;ENSP00000374409:D1170N	ENSP00000374407:D1127N	D	+	1	0	PKP4	159245364	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.420000	0.97426	2.733000	0.93635	0.655000	0.94253	GAC		0.418	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1			5	137	0	0	0	0.000602	0	5	137				
BAZ2B	29994	broad.mit.edu	37	2	160295207	160295207	+	Splice_Site	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:160295207C>A	ENST00000392783.2	-	8	1396		c.e8-1		BAZ2B_ENST00000343439.5_Splice_Site|BAZ2B_ENST00000355831.2_Splice_Site|BAZ2B_ENST00000392782.1_Splice_Site	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						GTAATAGCACCTAGATATAAA	0.373																																							uc002uao.2		NA																	0				ovary(3)|skin(1)	4						c.e8-1		bromodomain adjacent to zinc finger domain, 2B							124.0	121.0	122.0					2																	160295207		1808	4081	5889	SO:0001630	splice_region_variant	29994				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr2:160295207C>A	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.901-1G>T	2.37:g.160295207C>A						BAZ2B_uc002uap.2_Splice_Site_p.V299_splice|BAZ2B_uc002uas.1_Splice_Site_p.V238_splice|BAZ2B_uc002uau.1_Intron|BAZ2B_uc002uaq.1_Splice_Site_p.V229_splice|BAZ2B_uc002uat.3_3'UTR|BAZ2B_uc010fop.1_Intron	p.V301_splice	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN			8	1253	-								D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Splice_Site	SNP	ENST00000392783.2	37	c.901_splice	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830430	0.71258	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000546335	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3195	0.90232	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BAZ2B	160003453	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.934000	0.70138	2.374000	0.81015	0.650000	0.86243	.		0.373	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		Intron	29	125	1	0	1.7881e-09	0.008361	2.7883e-09	29	125				
SLC4A10	57282	broad.mit.edu	37	2	162719434	162719434	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:162719434C>T	ENST00000446997.1	+	6	721	c.628C>T	c.(628-630)Cgc>Tgc	p.R210C	SLC4A10_ENST00000535165.1_Missense_Mutation_p.R210C|SLC4A10_ENST00000415876.2_Missense_Mutation_p.R210C|SLC4A10_ENST00000272716.5_Missense_Mutation_p.R210C|SLC4A10_ENST00000375514.5_Missense_Mutation_p.R221C|SLC4A10_ENST00000421911.1_Missense_Mutation_p.R210C|SLC4A10_ENST00000493021.1_3'UTR	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	210					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	TGAAGATGTACGCCATAGGGT	0.438																																							uc002ubx.3		NA																	0				ovary(2)|lung(2)|pancreas(1)	5						c.(628-630)CGC>TGC		solute carrier family 4, sodium bicarbonate							80.0	77.0	78.0					2																	162719434		1957	4172	6129	SO:0001583	missense	57282				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity	g.chr2:162719434C>T		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.628C>T	2.37:g.162719434C>T	ENSP00000393066:p.Arg210Cys					SLC4A10_uc010fpa.1_Missense_Mutation_p.R222C|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Missense_Mutation_p.R210C|SLC4A10_uc010zcs.1_Missense_Mutation_p.R221C	p.R210C	NM_022058	NP_071341	Q6U841	S4A10_HUMAN			6	812	+			210			Cytoplasmic (Potential).		B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	37	c.628C>T	CCDS54411.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.548827	0.86127	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000535165;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8;-0.8	5.81	5.81	0.92471	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.090614	0.64402	D	0.000001	D	0.90909	0.7143	H	0.95402	3.665	0.80722	D	1	D;D;D;D	0.89917	1.0;0.987;1.0;1.0	D;D;D;D	0.78314	0.987;0.927;0.968;0.991	D	0.92882	0.6324	10	0.87932	D	0	.	19.6853	0.95977	0.0:1.0:0.0:0.0	.	221;210;210;210	F8W675;E7EW28;Q6U841-2;Q6U841	.;.;.;S4A10_HUMAN	C	221;210;210;210;210;210;210;210	ENSP00000364664:R221C;ENSP00000395797:R210C;ENSP00000437527:R210C;ENSP00000272716:R210C;ENSP00000393066:R210C;ENSP00000404486:R210C	ENSP00000272716:R210C	R	+	1	0	SLC4A10	162427680	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	3.966000	0.56795	2.759000	0.94783	0.591000	0.81541	CGC		0.438	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058		4	23	0	0	0	0.009096	0	4	23				
XIRP2	129446	broad.mit.edu	37	2	167760202	167760202	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:167760202G>T	ENST00000409728.1	+	2	299	c.210G>T	c.(208-210)atG>atT	p.M70I	XIRP2_ENST00000420519.1_Missense_Mutation_p.M70I|XIRP2_ENST00000409043.1_Missense_Mutation_p.M70I|XIRP2_ENST00000409195.1_Missense_Mutation_p.M70I|XIRP2_ENST00000409756.2_Missense_Mutation_p.M70I|XIRP2_ENST00000295237.9_Missense_Mutation_p.M70I	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GGGAAGAGATGTGGAGTTCGA	0.512																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(208-210)ATG>ATT		xin actin-binding repeat containing 2 isoform 1							81.0	82.0	82.0					2																	167760202		1959	4131	6090	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:167760202G>T	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.210G>T	2.37:g.167760202G>T	ENSP00000386619:p.Met70Ile					XIRP2_uc010fpn.2_Missense_Mutation_p.M70I|XIRP2_uc010fpo.2_Missense_Mutation_p.M70I|XIRP2_uc010fpp.2_Missense_Mutation_p.M70I	p.M70I	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			1	228	+			Error:Variant_position_missing_in_A4UGR9_after_alignment					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	37	c.210G>T	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	G	1.335	-0.595648	0.03771	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237	T;T;T;T;T;T	0.76060	-0.98;-0.99;4.36;-0.98;-0.99;4.36	4.59	0.535	0.17133	.	.	.	.	.	T	0.47783	0.1464	.	.	.	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.13407	0.009;0.009	T	0.30794	-0.9966	8	0.06757	T	0.87	-0.8258	6.5756	0.22564	0.4434:0.0:0.5566:0.0	.	70;70	A4UGR9-4;A4UGR9-6	.;.	I	70	ENSP00000386454:M70I;ENSP00000386619:M70I;ENSP00000386840:M70I;ENSP00000386724:M70I;ENSP00000415541:M70I;ENSP00000295237:M70I	ENSP00000295237:M70I	M	+	3	0	XIRP2	167468448	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.514000	0.02254	-0.086000	0.12550	0.655000	0.94253	ATG		0.512	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381		7	37	1	0	0.00198382	0.001984	0.0022658	7	37				
XIRP2	129446	broad.mit.edu	37	2	168102003	168102003	+	Silent	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:168102003T>A	ENST00000409195.1	+	9	4190	c.4101T>A	c.(4099-4101)acT>acA	p.T1367T	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Silent_p.T1367T|XIRP2_ENST00000409273.1_Silent_p.T1145T	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1192					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AATCAGAAACTGTGTATGTTA	0.368																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(4099-4101)ACT>ACA		xin actin-binding repeat containing 2 isoform 1							66.0	62.0	63.0					2																	168102003		1841	4092	5933	SO:0001819	synonymous_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168102003T>A	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.4101T>A	2.37:g.168102003T>A						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.T1192T|XIRP2_uc010fpq.2_Silent_p.T1145T|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	p.T1367T	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			8	4119	+			1192					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	c.4101T>A	CCDS42769.1																																																																																				0.368	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		25	65	0	0	0	0.00278	0	25	65				
LRP2	4036	broad.mit.edu	37	2	169995821	169995821	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:169995821G>A	ENST00000263816.3	-	74	13613	c.13328C>T	c.(13327-13329)gCa>gTa	p.A4443V		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4443					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GAAGAATCCTGCAATTGCCAG	0.483																																							uc002ues.2		NA																	0				ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(13327-13329)GCA>GTA		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						73.0	75.0	74.0					2																	169995821		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:169995821G>A		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13328C>T	2.37:g.169995821G>A	ENSP00000263816:p.Ala4443Val						p.A4443V	NM_004525	NP_004516	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	74	13541	-			4443			Helical; (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.13328C>T	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	1.730	-0.494289	0.04322	.	.	ENSG00000081479	ENST00000263816	D	0.88975	-2.45	5.53	2.23	0.28157	.	0.296036	0.37012	N	0.002292	T	0.70736	0.3258	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.58387	-0.7645	10	0.05721	T	0.95	.	7.0854	0.25254	0.319:0.4831:0.198:0.0	.	4443	P98164	LRP2_HUMAN	V	4443	ENSP00000263816:A4443V	ENSP00000263816:A4443V	A	-	2	0	LRP2	169704067	0.983000	0.35010	0.023000	0.16930	0.086000	0.17979	3.753000	0.55180	0.047000	0.15862	-0.484000	0.04775	GCA		0.483	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		9	60	0	0	0	0.006214	0	9	60				
LRP2	4036	broad.mit.edu	37	2	170094605	170094605	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:170094605C>G	ENST00000263816.3	-	27	4787	c.4502G>C	c.(4501-4503)aGa>aCa	p.R1501T		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1501					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACTTACCACTCTTCTGTCCGT	0.443																																							uc002ues.2		NA																	0				ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(4501-4503)AGA>ACA		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						116.0	94.0	102.0					2																	170094605		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170094605C>G		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.4502G>C	2.37:g.170094605C>G	ENSP00000263816:p.Arg1501Thr						p.R1501T	NM_004525	NP_004516	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	27	4715	-			1501			LDL-receptor class B 10.|Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.4502G>C	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	7.351	0.622858	0.14193	.	.	ENSG00000081479	ENST00000263816	D	0.90844	-2.74	5.39	3.32	0.38043	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.226284	0.44483	D	0.000450	T	0.77096	0.4080	N	0.11064	0.09	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.64019	-0.6505	10	0.25751	T	0.34	.	4.9024	0.13781	0.0:0.3509:0.0:0.6491	.	1501	P98164	LRP2_HUMAN	T	1501	ENSP00000263816:R1501T	ENSP00000263816:R1501T	R	-	2	0	LRP2	169802851	1.000000	0.71417	0.138000	0.22173	0.672000	0.39443	2.135000	0.42112	0.541000	0.28827	0.655000	0.94253	AGA		0.443	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		3	39	0	0	0	0.004672	0	3	39				
UBR3	130507	broad.mit.edu	37	2	170863539	170863539	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:170863539G>T	ENST00000272793.5	+	28	4119	c.4069G>T	c.(4069-4071)Gaa>Taa	p.E1357*	UBR3_ENST00000392631.1_Nonsense_Mutation_p.E178*|UBR3_ENST00000418381.1_Nonsense_Mutation_p.E1357*			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1357					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						GGACAAAGGAGAATTCACGTG	0.403																																							uc010zdi.1		NA																	0					0						c.(4069-4071)GAA>TAA		E3 ubiquitin-protein ligase UBR3							154.0	140.0	145.0					2																	170863539		2203	4300	6503	SO:0001587	stop_gained	130507				sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding	g.chr2:170863539G>T	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.4069G>T	2.37:g.170863539G>T	ENSP00000272793:p.Glu1357*					UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_Nonsense_Mutation_p.E178*|UBR3_uc002uft.3_Nonsense_Mutation_p.E210*|UBR3_uc010zdj.1_Nonsense_Mutation_p.E19*	p.E1357*	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN			28	4069	+			1357			RING-type; degenerate.		B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Nonsense_Mutation	SNP	ENST00000272793.5	37	c.4069G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	37|37	6.315503|6.315503	0.97467|0.97467	.|.	.|.	ENSG00000144357|ENSG00000144357	ENST00000392632|ENST00000272793;ENST00000442603;ENST00000418381;ENST00000392631;ENST00000439681	.|.	.|.	.|.	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|.	0.78805|.	0.4341|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.81064|.	-0.1102|.	4|.	.|0.66056	.|D	.|0.02	.|.	19.0814|19.0814	0.93185|0.93185	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	D|X	414|1357;1357;1357;178;28	.|.	.|ENSP00000272793:E1357X	E|E	+|+	3|1	2|0	UBR3|UBR3	170571785|170571785	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	9.464000|9.464000	0.97655|0.97655	2.511000|2.511000	0.84671|0.84671	0.454000|0.454000	0.30748|0.30748	GAG|GAA		0.403	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070		23	48	1	0	4.26978e-12	0.00333	7.1829e-12	23	48				
ITGA6	3655	broad.mit.edu	37	2	173352049	173352049	+	Silent	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:173352049A>T	ENST00000264106.6	+	16	2348	c.2145A>T	c.(2143-2145)atA>atT	p.I715I	ITGA6_ENST00000343713.4_Silent_p.I671I|ITGA6_ENST00000375221.2_Silent_p.I715I|AC093818.1_ENST00000442417.1_RNA|ITGA6_ENST00000409532.1_Silent_p.I557I|ITGA6_ENST00000409080.1_Silent_p.I676I|ITGA6_ENST00000264107.7_Silent_p.I676I			P23229	ITA6_HUMAN	integrin, alpha 6	715					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			CTTTAGAAATAACAGTGACAA	0.388																																							uc002uhp.1		NA																	0				ovary(1)|lung(1)	2						c.(2026-2028)ATA>ATT		integrin alpha chain, alpha 6 isoform a							66.0	69.0	68.0					2																	173352049		2203	4300	6503	SO:0001819	synonymous_variant	3655				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity	g.chr2:173352049A>T		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.2145A>T	2.37:g.173352049A>T						ITGA6_uc010zdy.1_Silent_p.I557I|ITGA6_uc002uho.1_Silent_p.I676I|ITGA6_uc010fqm.1_Silent_p.I322I	p.I676I	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0979)		15	2231	+			715			Extracellular (Potential).		B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Silent	SNP	ENST00000264106.6	37	c.2028A>T																																																																																					0.388	ITGA6-201	KNOWN	basic	protein_coding	protein_coding				20	61	0	0	0	0.007413	0	20	61				
SCRN3	79634	broad.mit.edu	37	2	175263030	175263030	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:175263030G>T	ENST00000272732.6	+	2	101	c.19G>T	c.(19-21)Gac>Tac	p.D7Y	SCRN3_ENST00000409673.3_Intron|CIR1_ENST00000342016.3_5'Flank|CIR1_ENST00000362053.5_5'Flank	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	7							dipeptidase activity (GO:0016805)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			TTTTTCCTGTGACACTTTCGT	0.279																																							uc002uiq.2		NA																	0				ovary(1)	1						c.(19-21)GAC>TAC		secernin 3							74.0	79.0	77.0					2																	175263030		2203	4300	6503	SO:0001583	missense	79634				proteolysis		dipeptidase activity	g.chr2:175263030G>T	AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.19G>T	2.37:g.175263030G>T	ENSP00000272732:p.Asp7Tyr					CIR1_uc002uim.2_5'Flank|CIR1_uc002uin.2_5'Flank|CIR1_uc002uio.2_5'Flank|CIR1_uc002uip.2_5'Flank|SCRN3_uc010zen.1_Intron|SCRN3_uc010zeo.1_5'UTR|SCRN3_uc002uir.1_RNA	p.D7Y	NM_024583	NP_078859	Q0VDG4	SCRN3_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.229)		2	107	+			7					B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Missense_Mutation	SNP	ENST00000272732.6	37	c.19G>T	CCDS2258.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.945425	0.92593	.	.	ENSG00000144306	ENST00000458563;ENST00000272732;ENST00000435964;ENST00000424069;ENST00000427038;ENST00000548031	T;T;T;T;T	0.50277	1.85;2.4;0.75;0.78;1.77	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.77491	0.4138	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81044	-0.1111	10	0.87932	D	0	-23.0031	20.2331	0.98353	0.0:0.0:1.0:0.0	.	7	Q0VDG4	SCRN3_HUMAN	Y	7	ENSP00000396884:D7Y;ENSP00000272732:D7Y;ENSP00000402086:D7Y;ENSP00000408376:D7Y;ENSP00000446727:D7Y	ENSP00000272732:D7Y	D	+	1	0	SCRN3	174971276	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.599000	0.82757	2.885000	0.99019	0.643000	0.83706	GAC		0.279	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255451.2	NM_024583		10	61	1	0	6.40141e-05	0.000978	7.90626e-05	10	61				
TTN	7273	broad.mit.edu	37	2	179582757	179582757	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:179582757C>A	ENST00000591111.1	-	84	24249	c.24025G>T	c.(24025-24027)Gtg>Ttg	p.V8009L	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V7082L|TTN_ENST00000589042.1_Missense_Mutation_p.V8326L|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12201	Ig-like 62.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTGATCCACTTTGTTGATT	0.403																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(21244-21246)GTG>TTG		titin isoform N2-A							200.0	190.0	193.0					2																	179582757		1982	4157	6139	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179582757C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.24025G>T	2.37:g.179582757C>A	ENSP00000465570:p.Val8009Leu					TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.V3743L	p.V7082L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		83	21468	-			8009					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.21244G>T		.	.	.	.	.	.	.	.	.	.	C	11.15	1.553925	0.27739	.	.	ENSG00000155657	ENST00000342992	T	0.70986	-0.53	6.16	6.16	0.99307	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65186	0.2667	L	0.41415	1.275	0.80722	D	1	B	0.23377	0.084	B	0.22152	0.038	T	0.61987	-0.6949	9	0.87932	D	0	.	15.9288	0.79644	0.0:0.9342:0.0:0.0658	.	8009	Q8WZ42	TITIN_HUMAN	L	7082	ENSP00000343764:V7082L	ENSP00000343764:V7082L	V	-	1	0	TTN	179291002	0.997000	0.39634	1.000000	0.80357	0.936000	0.57629	3.304000	0.51866	2.937000	0.99478	0.650000	0.86243	GTG		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		21	117	1	0	2.39187e-15	0.008871	4.38652e-15	21	117				
NCKAP1	10787	broad.mit.edu	37	2	183867758	183867758	+	Splice_Site	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:183867758C>G	ENST00000361354.4	-	4	685	c.313G>C	c.(313-315)Gac>Cac	p.D105H	NCKAP1_ENST00000360982.2_Splice_Site_p.D111H	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	105					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			CAAACATGGTCCTGAAAAGAA	0.289																																							uc002upc.2		NA																	0				ovary(2)	2						c.(313-315)GAC>CAC		NCK-associated protein 1 isoform 1							39.0	41.0	40.0					2																	183867758		2201	4298	6499	SO:0001630	splice_region_variant	10787				apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding	g.chr2:183867758C>G	AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.313-1G>C	2.37:g.183867758C>G						NCKAP1_uc002upb.2_Missense_Mutation_p.D111H	p.D105H	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)		4	715	-			105					O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	ENST00000361354.4	37	c.313G>C	CCDS2287.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.103729	0.56291	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.39997	1.05;1.05	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.71126	0.3303	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.73708	0.981;0.968	T	0.75679	-0.3234	10	0.87932	D	0	-14.0747	19.8513	0.96741	0.0:1.0:0.0:0.0	.	105;111	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	H	105;111	ENSP00000355348:D105H;ENSP00000354251:D111H	ENSP00000354251:D111H	D	-	1	0	NCKAP1	183576003	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	5.436000	0.66538	2.694000	0.91930	0.585000	0.79938	GAC		0.289	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842	Missense_Mutation	5	38	0	0	0	0.000602	0	5	38				
ZSWIM2	151112	broad.mit.edu	37	2	187692860	187692860	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:187692860T>C	ENST00000295131.2	-	9	1792	c.1753A>G	c.(1753-1755)Aca>Gca	p.T585A		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	585					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			AGTTTAGCTGTGCTCCAATTG	0.373																																							uc002upu.1		NA																	0				ovary(2)|skin(1)	3						c.(1753-1755)ACA>GCA		zinc finger, SWIM domain containing 2							116.0	113.0	114.0					2																	187692860		2203	4299	6502	SO:0001583	missense	151112				apoptosis		zinc ion binding	g.chr2:187692860T>C	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.1753A>G	2.37:g.187692860T>C	ENSP00000295131:p.Thr585Ala						p.T585A	NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)		9	1793	-			585					B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	SNP	ENST00000295131.2	37	c.1753A>G	CCDS33348.1	.	.	.	.	.	.	.	.	.	.	T	5.290	0.238959	0.10023	.	.	ENSG00000163012	ENST00000295131	T	0.23754	1.89	5.45	1.48	0.22813	.	0.513593	0.18255	N	0.146812	T	0.18676	0.0448	L	0.46157	1.445	0.09310	N	1	B	0.25667	0.131	B	0.22386	0.039	T	0.20806	-1.0264	10	0.72032	D	0.01	-0.0038	3.834	0.08886	0.3303:0.0903:0.0:0.5795	.	585	Q8NEG5	ZSWM2_HUMAN	A	585	ENSP00000295131:T585A	ENSP00000295131:T585A	T	-	1	0	ZSWIM2	187401105	0.001000	0.12720	0.001000	0.08648	0.045000	0.14185	0.649000	0.24843	0.356000	0.24157	0.397000	0.26171	ACA		0.373	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521		6	61	0	0	0	0.001168	0	6	61				
ABCA12	26154	broad.mit.edu	37	2	215815684	215815684	+	Silent	SNP	A	A	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:215815684A>G	ENST00000272895.7	-	45	6990	c.6771T>C	c.(6769-6771)taT>taC	p.Y2257Y	ABCA12_ENST00000389661.4_Silent_p.Y1939Y|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2257	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTGTGAGACAATAAAGTTGGA	0.413																																					Ovarian(66;664 1488 5121 34295)	Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(6769-6771)TAT>TAC		ATP-binding cassette, sub-family A, member 12							197.0	193.0	194.0					2																	215815684		2203	4300	6503	SO:0001819	synonymous_variant	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215815684A>G	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6771T>C	2.37:g.215815684A>G						ABCA12_uc002vev.2_Silent_p.Y1939Y|ABCA12_uc010zjn.1_Silent_p.Y1184Y	p.Y2257Y	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	45	6991	-		Renal(323;0.127)	2257			ABC transporter 2.		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	37	c.6771T>C	CCDS33372.1																																																																																				0.413	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		39	103	0	0	0	0.004878	0	39	103				
SPEG	10290	broad.mit.edu	37	2	220315884	220315884	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:220315884G>C	ENST00000312358.7	+	5	2272	c.2140G>C	c.(2140-2142)Gct>Cct	p.A714P	SPEG_ENST00000396695.2_5'UTR|SPEG_ENST00000396698.1_Missense_Mutation_p.A610P|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	714					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.V712_P722del(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CTACGTGTCCGCTGGAGAAGA	0.587																																							uc010fwg.2		NA																	1	Deletion - In frame(1)	p.V712_P722del(1)	ovary(1)	stomach(9)|ovary(4)|central_nervous_system(1)	14						c.(2140-2142)GCT>CCT		SPEG complex locus							103.0	104.0	104.0					2																	220315884		1947	4141	6088	SO:0001583	missense	10290				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr2:220315884G>C	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2140G>C	2.37:g.220315884G>C	ENSP00000311684:p.Ala714Pro					SPEG_uc002vlm.2_RNA|SPEG_uc010fwh.1_5'UTR|SPEG_uc002vln.1_5'UTR|SPEG_uc002vlp.1_5'UTR	p.A714P	NM_005876	NP_005867	Q15772	SPEG_HUMAN		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)	5	2140	+		Renal(207;0.0183)	714					A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	c.2140G>C	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.794855	0.90453	.	.	ENSG00000072195	ENST00000312358;ENST00000265327;ENST00000396698	T;T	0.67523	-0.27;-0.02	5.43	5.43	0.79202	.	0.000000	0.41823	D	0.000814	T	0.73048	0.3537	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.76753	-0.2843	10	0.72032	D	0.01	.	18.835	0.92159	0.0:0.0:1.0:0.0	.	714	Q15772	SPEG_HUMAN	P	714;714;610	ENSP00000311684:A714P;ENSP00000379926:A610P	ENSP00000265327:A714P	A	+	1	0	SPEG	220024128	1.000000	0.71417	0.763000	0.31416	0.859000	0.49053	9.430000	0.97488	2.556000	0.86216	0.655000	0.94253	GCT		0.587	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876		12	120	0	0	0	0.001368	0	12	120				
SPEG	10290	broad.mit.edu	37	2	220332025	220332025	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:220332025G>T	ENST00000312358.7	+	10	3143	c.3011G>T	c.(3010-3012)cGt>cTt	p.R1004L	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1004	Ig-like 4.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R1004L(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		TGGCTGTGCCGTGGCCGCCTG	0.627																																							uc010fwg.2		NA																	1	Substitution - Missense(1)		lung(1)	stomach(9)|ovary(4)|central_nervous_system(1)	14						c.(3010-3012)CGT>CTT		SPEG complex locus							48.0	59.0	55.0					2																	220332025		2142	4246	6388	SO:0001583	missense	10290				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr2:220332025G>T	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.3011G>T	2.37:g.220332025G>T	ENSP00000311684:p.Arg1004Leu						p.R1004L	NM_005876	NP_005867	Q15772	SPEG_HUMAN		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)	10	3011	+		Renal(207;0.0183)	1004			Ig-like 4.		A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	c.3011G>T	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262528	0.23051	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.70045	-0.45	4.75	2.97	0.34412	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.36066	N	0.002812	T	0.61800	0.2376	L	0.28400	0.85	0.35910	D	0.831018	P	0.48503	0.911	P	0.50590	0.645	T	0.69331	-0.5173	10	0.62326	D	0.03	.	10.6577	0.45684	0.1562:0.0:0.8438:0.0	.	1004	Q15772	SPEG_HUMAN	L	1004	ENSP00000311684:R1004L	ENSP00000265327:R1004L	R	+	2	0	SPEG	220040269	0.828000	0.29307	0.617000	0.29091	0.396000	0.30629	4.069000	0.57541	0.620000	0.30215	-0.137000	0.14449	CGT		0.627	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876		16	64	1	0	6.72482e-11	0.003163	1.08072e-10	16	64				
KCNE4	23704	broad.mit.edu	37	2	223917945	223917945	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:223917945G>C	ENST00000281830.3	+	2	881	c.550G>C	c.(550-552)Gac>Cac	p.D184H	KCNE4_ENST00000604125.1_Missense_Mutation_p.D133H|KCNE4_ENST00000488477.2_Intron			Q8WWG9	KCNE4_HUMAN	potassium voltage-gated channel, Isk-related family, member 4	184						apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	voltage-gated potassium channel activity (GO:0005249)			large_intestine(2)|lung(5)|ovary(2)|skin(1)	10		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)		CTCCTCCCCGGACGTGCACCT	0.642																																							uc002vnl.3		NA																	0				ovary(1)	1						c.(397-399)GAC>CAC		potassium voltage-gated channel, Isk-related							40.0	42.0	41.0					2																	223917945		2203	4300	6503	SO:0001583	missense	23704					integral to membrane	voltage-gated potassium channel activity	g.chr2:223917945G>C	AY065987	CCDS2456.1, CCDS2456.2	2q36.1	2008-02-05			ENSG00000152049	ENSG00000152049		"""Potassium channels"""	6244	protein-coding gene	gene with protein product		607775				10219239, 12670483	Standard	NM_080671		Approved	MiRP3	uc002vnl.5	Q8WWG9	OTTHUMG00000133161	ENST00000281830.3:c.550G>C	2.37:g.223917945G>C	ENSP00000281830:p.Asp184His						p.D133H	NM_080671	NP_542402	Q8WWG9	KCNE4_HUMAN		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)	2	551	+		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)	133			Cytoplasmic (Potential).		B7Z275|Q53SM4|Q96CC4	Missense_Mutation	SNP	ENST00000281830.3	37	c.397G>C		.	.	.	.	.	.	.	.	.	.	G	31	5.102975	0.94245	.	.	ENSG00000152049	ENST00000281830	.	.	.	6.17	6.17	0.99709	.	0.047590	0.85682	D	0.000000	T	0.73505	0.3595	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.73883	-0.3842	9	0.87932	D	0	-14.1432	20.8794	0.99867	0.0:0.0:1.0:0.0	.	133	Q8WWG9	KCNE4_HUMAN	H	133	.	ENSP00000281830:D133H	D	+	1	0	KCNE4	223626189	1.000000	0.71417	0.217000	0.23759	0.947000	0.59692	9.287000	0.95975	2.941000	0.99782	0.655000	0.94253	GAC		0.642	KCNE4-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000330997.2	NM_080671		5	33	0	0	0	0.000602	0	5	33				
CUL3	8452	broad.mit.edu	37	2	225422432	225422432	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:225422432C>G	ENST00000264414.4	-	2	546	c.208G>C	c.(208-210)Gga>Cga	p.G70R	CUL3_ENST00000409096.1_Missense_Mutation_p.G46R|CUL3_ENST00000344951.4_Intron|CUL3_ENST00000409777.1_Missense_Mutation_p.G46R|CUL3_ENST00000432260.2_5'UTR	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	70					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		AGCTTTTCTCCATGTTTATGC	0.333																																							uc002vny.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4						c.(208-210)GGA>CGA		cullin 3							96.0	97.0	97.0					2																	225422432		2203	4299	6502	SO:0001583	missense	8452				cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding	g.chr2:225422432C>G	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.208G>C	2.37:g.225422432C>G	ENSP00000264414:p.Gly70Arg					CUL3_uc010zls.1_Intron|CUL3_uc010fwy.1_Missense_Mutation_p.G76R	p.G70R	NM_003590	NP_003581	Q13618	CUL3_HUMAN		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)	2	592	-		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)	70					A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	ENST00000264414.4	37	c.208G>C	CCDS2462.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.5|25.5	4.647211|4.647211	0.87958|0.87958	.|.	.|.	ENSG00000036257|ENSG00000036257	ENST00000264414;ENST00000409096;ENST00000409777|ENST00000436172	T;T;T|.	0.78707|.	-1.2;-1.2;-1.2|.	5.85|5.85	5.85|5.85	0.93711|0.93711	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90359|0.90359	0.6983|0.6983	H|H	0.96604|0.96604	3.85|3.85	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.83275|.	0.996;0.996|.	D|D	0.92799|0.92799	0.6255|0.6255	10|5	0.87932|.	D|.	0|.	.|.	20.1731|20.1731	0.98165|0.98165	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	48;70|.	Q53S54;Q13618|.	.;CUL3_HUMAN|.	R|S	70;46;46|90	ENSP00000264414:G70R;ENSP00000387200:G46R;ENSP00000386525:G46R|.	ENSP00000264414:G70R|.	G|W	-|-	1|2	0|0	CUL3|CUL3	225130676|225130676	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.699000|7.699000	0.84547|0.84547	2.768000|2.768000	0.95171|0.95171	0.655000|0.655000	0.94253|0.94253	GGA|TGG		0.333	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2			3	27	0	0	0	0.004672	0	3	27				
SP110	3431	broad.mit.edu	37	2	231042313	231042313	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:231042313C>A	ENST00000358662.4	-	14	1609	c.1531G>T	c.(1531-1533)Gca>Tca	p.A511S	SP110_ENST00000540870.1_Missense_Mutation_p.A517S|SP110_ENST00000338556.3_Missense_Mutation_p.A213S|SP110_ENST00000258382.5_Missense_Mutation_p.A511S|SP110_ENST00000392048.3_Missense_Mutation_p.A509S|SP110_ENST00000258381.6_Missense_Mutation_p.A511S	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	511	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		CAGTTCTTTGCGTTCCTTCCT	0.428																																							uc002vqh.3		NA																	0				ovary(2)|breast(2)	4						c.(1531-1533)GCA>TCA		SP110 nuclear body protein isoform a							334.0	312.0	319.0					2																	231042313		2203	4300	6503	SO:0001583	missense	3431				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|signal transducer activity|zinc ion binding	g.chr2:231042313C>A	L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.1531G>T	2.37:g.231042313C>A	ENSP00000351488:p.Ala511Ser					SP110_uc002vqg.3_Missense_Mutation_p.A511S|SP110_uc002vqi.3_Missense_Mutation_p.A511S|SP110_uc010fxk.2_Missense_Mutation_p.A509S|SP110_uc010fxj.2_Missense_Mutation_p.A154S	p.A511S	NM_004509	NP_004500	Q9HB58	SP110_HUMAN		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)	14	1771	-		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)	511			SAND.		B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Missense_Mutation	SNP	ENST00000358662.4	37	c.1531G>T	CCDS2474.1	.	.	.	.	.	.	.	.	.	.	C	0.666	-0.803866	0.02819	.	.	ENSG00000135899	ENST00000258381;ENST00000358662;ENST00000392048;ENST00000258382;ENST00000540870;ENST00000338556	T;T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15;0.15	4.83	-0.844	0.10741	SAND domain-like (2);SAND domain (3);	1.300420	0.05910	N	0.631442	T	0.17662	0.0424	N	0.00339	-1.615	0.09310	N	1	B;B;B;B;B	0.16396	0.001;0.017;0.002;0.004;0.004	B;B;B;B;B	0.19666	0.001;0.026;0.001;0.022;0.007	T	0.32587	-0.9901	10	0.02654	T	1	.	4.978	0.14151	0.3973:0.2829:0.0:0.3197	.	509;213;517;511;511	G5E9C0;E7ER70;F5H1M1;Q9HB58;Q9HB58-6	.;.;.;SP110_HUMAN;.	S	511;511;509;511;517;213	ENSP00000258381:A511S;ENSP00000351488:A511S;ENSP00000375902:A509S;ENSP00000258382:A511S;ENSP00000439558:A517S;ENSP00000344049:A213S	ENSP00000258381:A511S	A	-	1	0	SP110	230750557	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.427000	0.06999	-0.191000	0.10448	-0.339000	0.08088	GCA		0.428	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000332414.1	NM_080424		40	233	1	0	5.71845e-15	0.005524	1.036e-14	40	233				
UGT1A4	54657	broad.mit.edu	37	2	234628155	234628155	+	Missense_Mutation	SNP	C	C	T	rs372293131		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:234628155C>T	ENST00000373409.3	+	1	732	c.689C>T	c.(688-690)cCt>cTt	p.P230L	UGT1A7_ENST00000373426.3_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000373450.4_Intron	NM_007120.2	NP_009051.1	P22310	UD14_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A4	230					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	26		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Asenapine(DB06216)|Clozapine(DB00363)|Ezogabine(DB04953)|Lamotrigine(DB00555)|Midazolam(DB00683)|Paricalcitol(DB00910)|Tamoxifen(DB00675)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)	TTTTCTGCCCCTTATGCAAGT	0.488																																					Melanoma(99;1011 1962 13201 26492)	Melanoma(99;1011 1962 13201 26492)	uc002vux.2		NA																	0				skin(1)	1						c.(688-690)CCT>CTT		UDP glycosyltransferase 1 family, polypeptide A4	Imipramine(DB00458)|Lamotrigine(DB00555)|Paricalcitol(DB00910)|Trifluoperazine(DB00831)	C	,LEU/PRO,,,,,,	0,4406		0,0,2203	238.0	225.0	229.0		,689,,,,,,	2.7	0.0	2		229	2,8598	2.2+/-6.3	0,2,4298	no	intron,missense,intron,intron,intron,intron,intron,intron	UGT1A10,UGT1A8,UGT1A7,UGT1A6,UGT1A5,UGT1A9,UGT1A4	NM_001072.3,NM_007120.2,NM_019075.2,NM_019076.4,NM_019077.2,NM_019078.1,NM_021027.2,NM_205862.1	,98,,,,,,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,,,,,,,	,230/535,,,,,,	234628155	2,13004	2203	4300	6503	SO:0001583	missense	54657				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity	g.chr2:234628155C>T	M84128	CCDS33405.1	2q37.1	2014-01-10	2005-07-20		ENSG00000244474	ENSG00000244474		"""UDP glucuronosyltransferases"""	12536	other	complex locus constituent		606429	"""UDP glycosyltransferase 1 family, polypeptide A4"""			9295054, 1339448	Standard	NM_007120		Approved	HUG-BR2, UGT1D	uc002vux.3	P22310	OTTHUMG00000059119	ENST00000373409.3:c.689C>T	2.37:g.234628155C>T	ENSP00000362508:p.Pro230Leu					UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Missense_Mutation_p.P230L	p.P230L	NM_007120	NP_009051	P22310	UD14_HUMAN		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	1	718	+		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)	230					B2R937|B8K288|Q5DT00	Missense_Mutation	SNP	ENST00000373409.3	37	c.689C>T	CCDS33405.1	.	.	.	.	.	.	.	.	.	.	C	10.62	1.400528	0.25291	0.0	2.33E-4	ENSG00000244474	ENST00000373409	T	0.59638	0.25	4.49	2.68	0.31781	.	.	.	.	.	T	0.67720	0.2923	L	0.49571	1.57	0.09310	N	0.999999	D;D	0.69078	0.997;0.979	D;P	0.71414	0.973;0.9	T	0.56944	-0.7895	9	0.56958	D	0.05	.	10.5456	0.45058	0.0:0.8402:0.0:0.1598	.	230;230	B8K288;P22310	.;UD14_HUMAN	L	230	ENSP00000362508:P230L	ENSP00000362508:P230L	P	+	2	0	UGT1A4	234292894	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.006000	0.12833	0.345000	0.23873	-0.332000	0.08345	CCT		0.488	UGT1A4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130984.1	NM_007120		47	194	0	0	0	0.00361	0	47	194				
GPCPD1	56261	broad.mit.edu	37	20	5566906	5566906	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:5566906C>A	ENST00000379019.4	-	5	453	c.241G>T	c.(241-243)Ggt>Tgt	p.G81C	GPCPD1_ENST00000481038.1_5'Flank	NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	81	CBM20. {ECO:0000255|PROSITE- ProRule:PRU00594}.				glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						TGACATGGACCACCGATAGTC	0.373																																							uc002wme.3		NA																	0					0						c.(241-243)GGT>TGT		hypothetical protein LOC56261							180.0	163.0	169.0					20																	5566906		2203	4300	6503	SO:0001583	missense	56261				glycerol metabolic process|lipid metabolic process		carbohydrate binding|glycerophosphodiester phosphodiesterase activity	g.chr20:5566906C>A		CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.241G>T	20.37:g.5566906C>A	ENSP00000368305:p.Gly81Cys					GPCPD1_uc002wmd.3_5'Flank	p.G81C	NM_019593	NP_062539	Q9NPB8	GPCP1_HUMAN			5	454	-			81			CBM20.		D3DW06|Q9BQL8|Q9NUX0	Missense_Mutation	SNP	ENST00000379019.4	37	c.241G>T	CCDS13090.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358915	0.82353	.	.	ENSG00000125772	ENST00000379019	T	0.47869	0.83	5.9	5.9	0.94986	Carbohydrate-binding-like fold (1);Glycoside hydrolase, carbohydrate-binding (1);	0.104954	0.64402	D	0.000004	T	0.67069	0.2854	M	0.63428	1.95	0.58432	D	0.999999	D	0.76494	0.999	D	0.64687	0.928	T	0.65405	-0.6176	10	0.54805	T	0.06	-15.0466	20.3298	0.98711	0.0:1.0:0.0:0.0	.	81	Q9NPB8	GPCP1_HUMAN	C	81	ENSP00000368305:G81C	ENSP00000368305:G81C	G	-	1	0	GPCPD1	5514906	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.810000	0.96702	0.585000	0.79938	GGT		0.373	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077869.1	NM_019593		27	124	1	0	1.26454e-06	0.005443	1.73779e-06	27	124				
BPIFB4	149954	broad.mit.edu	37	20	31695558	31695558	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:31695558G>T	ENST00000375483.3	+	15	1753	c.1753G>T	c.(1753-1755)Ggt>Tgt	p.G585C	BPIFB4_ENST00000494121.1_3'UTR	NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	585						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										AGCTGTGCTGGGTTCTGGCGT	0.468																																							uc010zue.1		NA																	0					0						c.(1753-1755)GGT>TGT		antimicrobial peptide RY2G5 precursor							145.0	118.0	127.0					20																	31695558		2203	4300	6503	SO:0001583	missense	149954					cytoplasm|extracellular region	lipid binding	g.chr20:31695558G>T	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.1753G>T	20.37:g.31695558G>T	ENSP00000364632:p.Gly585Cys						p.G585C	NM_182519	NP_872325	P59827	LPLC4_HUMAN			15	1768	+			585					Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	37	c.1753G>T	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578015	0.45902	.	.	ENSG00000186191	ENST00000375483	T	0.08193	3.12	6.01	5.06	0.68205	.	0.000000	0.64402	D	0.000001	T	0.24470	0.0593	M	0.66939	2.045	0.49051	D	0.999742	D	0.89917	1.0	D	0.97110	1.0	T	0.00052	-1.2191	10	0.66056	D	0.02	-19.3636	10.1924	0.43035	0.0878:0.0:0.9122:0.0	.	585	P59827	BPIB4_HUMAN	C	585	ENSP00000364632:G585C	ENSP00000364632:G585C	G	+	1	0	BPIFB4	31159219	1.000000	0.71417	1.000000	0.80357	0.146000	0.21551	2.742000	0.47434	2.860000	0.98153	0.655000	0.94253	GGT		0.468	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519		8	38	1	0	7.48243e-07	0.006214	1.03872e-06	8	38				
PHF20	51230	broad.mit.edu	37	20	34519200	34519200	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:34519200G>T	ENST00000374012.3	+	15	2263	c.2134G>T	c.(2134-2136)Gac>Tac	p.D712Y	PHF20_ENST00000439301.1_3'UTR|RNU6-937P_ENST00000384325.1_RNA			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	712					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					GTACTGGTATGACAAGGAGTG	0.512																																							uc002xek.1		NA																	0				ovary(1)	1						c.(2134-2136)GAC>TAC		PHD finger protein 20							103.0	89.0	94.0					20																	34519200		2203	4300	6503	SO:0001583	missense	51230				regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding	g.chr20:34519200G>T	AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.2134G>T	20.37:g.34519200G>T	ENSP00000363124:p.Asp712Tyr						p.D712Y	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN			15	2245	+	Breast(12;0.00631)|all_lung(11;0.0145)		712					A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	c.2134G>T	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.731808	0.89390	.	.	ENSG00000025293	ENST00000374012	T	0.47869	0.83	5.02	5.02	0.67125	.	0.095382	0.64402	D	0.000001	T	0.63414	0.2509	L	0.57536	1.79	0.80722	D	1	D	0.71674	0.998	P	0.60173	0.87	T	0.66858	-0.5817	10	0.87932	D	0	.	18.5392	0.91022	0.0:0.0:1.0:0.0	.	712	Q9BVI0	PHF20_HUMAN	Y	712	ENSP00000363124:D712Y	ENSP00000363124:D712Y	D	+	1	0	PHF20	33982614	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.263000	0.95617	2.591000	0.87537	0.643000	0.83706	GAC		0.512	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436		11	44	1	0	1.08611e-07	0.000978	1.55843e-07	11	44				
BPI	671	broad.mit.edu	37	20	36952318	36952318	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:36952318C>A	ENST00000262865.4	+	8	904	c.815C>A	c.(814-816)cCa>cAa	p.P272Q	CTD-2308N23.2_ENST00000437016.1_RNA|BPI_ENST00000489102.1_Intron	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	272					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)			kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				CCCTTTGCTCCACCAGTGATG	0.527																																							uc002xib.2		NA																	0				ovary(4)	4						c.(814-816)CCA>CAA		bactericidal/permeability-increasing protein							134.0	111.0	119.0					20																	36952318		2203	4300	6503	SO:0001583	missense	671				defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding	g.chr20:36952318C>A	J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.815C>A	20.37:g.36952318C>A	ENSP00000262865:p.Pro272Gln						p.P272Q	NM_001725	NP_001716	P17213	BPI_HUMAN			8	877	+		Myeloproliferative disorder(115;0.00878)	272					B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Missense_Mutation	SNP	ENST00000262865.4	37	c.815C>A	CCDS13303.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.70|16.70	3.195106|3.195106	0.58017|0.58017	.|.	.|.	ENSG00000101425|ENSG00000101425	ENST00000417318|ENST00000262865	.|T	.|0.10192	.|2.9	4.5|4.5	4.5|4.5	0.54988|0.54988	.|Lipid-binding serum glycoprotein, C-terminal (1);Bactericidal permeability-increasing protein, alpha/beta domain (1);	.|0.000000	.|0.64402	.|D	.|0.000003	T|T	0.33556|0.33556	0.0867|0.0867	M|M	0.78344|0.78344	2.41|2.41	0.09310|0.09310	N|N	0.999999|0.999999	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.05666|0.05666	-1.0871|-1.0871	5|10	.|0.49607	.|T	.|0.09	-26.669|-26.669	15.1102|15.1102	0.72349|0.72349	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|272	.|P17213	.|BPI_HUMAN	N|Q	98|272	.|ENSP00000262865:P272Q	.|ENSP00000262865:P272Q	H|P	+|+	1|2	0|0	BPI|BPI	36385732|36385732	0.780000|0.780000	0.28664|0.28664	0.006000|0.006000	0.13384|0.13384	0.018000|0.018000	0.09664|0.09664	4.841000|4.841000	0.62824|0.62824	2.495000|2.495000	0.84180|0.84180	0.655000|0.655000	0.94253|0.94253	CAC|CCA		0.527	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2	NM_001725		12	49	1	0	4.3838e-07	0.001855	6.16077e-07	12	49				
FAM83D	81610	broad.mit.edu	37	20	37570728	37570728	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:37570728G>T	ENST00000217429.4	+	2	741	c.700G>T	c.(700-702)Gat>Tat	p.D234Y		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	204					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				TCAATTTCTGGATATGTGCAT	0.428																																							uc002xjg.2		NA																	0				ovary(3)	3						c.(700-702)GAT>TAT		hypothetical protein LOC81610							182.0	177.0	179.0					20																	37570728		1927	4149	6076	SO:0001583	missense	81610				cell division|mitosis	cytoplasm|spindle pole		g.chr20:37570728G>T	AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.700G>T	20.37:g.37570728G>T	ENSP00000217429:p.Asp234Tyr					FAM83D_uc002xjf.2_Missense_Mutation_p.D234Y	p.D234Y	NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN			2	741	+		Myeloproliferative disorder(115;0.00878)	204					B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Missense_Mutation	SNP	ENST00000217429.4	37	c.700G>T	CCDS42872.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.563509	0.65651	.	.	ENSG00000101447	ENST00000217429;ENST00000424027	T	0.12774	2.65	6.07	6.07	0.98685	.	0.322777	0.37761	N	0.001960	T	0.36441	0.0967	M	0.75085	2.285	0.37486	D	0.916179	D;D	0.71674	0.998;0.998	D;D	0.68353	0.957;0.929	T	0.21690	-1.0238	10	0.72032	D	0.01	.	13.466	0.61254	0.0717:0.0:0.9283:0.0	.	204;188	Q9H4H8;Q9H4H8-2	FA83D_HUMAN;.	Y	234;188	ENSP00000217429:D234Y	ENSP00000217429:D234Y	D	+	1	0	FAM83D	37004142	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	1.108000	0.31123	2.884000	0.98904	0.655000	0.94253	GAT		0.428	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1			14	120	1	0	1.15088e-07	0.004007	1.64445e-07	14	120				
FAM83D	81610	broad.mit.edu	37	20	37576645	37576645	+	Splice_Site	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:37576645T>A	ENST00000217429.4	+	3	907		c.e3+2			NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D						mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				CTCCTACAGGTAAGTCTCTAA	0.433																																							uc002xjg.2		NA																	0				ovary(3)	3						c.e3+2		hypothetical protein LOC81610							75.0	72.0	73.0					20																	37576645		1937	4135	6072	SO:0001630	splice_region_variant	81610				cell division|mitosis	cytoplasm|spindle pole		g.chr20:37576645T>A	AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.866+2T>A	20.37:g.37576645T>A							p.S289_splice	NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN			3	907	+		Myeloproliferative disorder(115;0.00878)						B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Splice_Site	SNP	ENST00000217429.4	37	c.866_splice	CCDS42872.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.249886	0.80024	.	.	ENSG00000101447	ENST00000217429;ENST00000424027	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7633	0.51916	0.0:0.0693:0.0:0.9306	.	.	.	.	.	-1	.	.	.	+	.	.	FAM83D	37010059	1.000000	0.71417	0.995000	0.50966	0.899000	0.52679	4.698000	0.61789	2.367000	0.80283	0.528000	0.53228	.		0.433	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1		Intron	15	60	0	0	0	0.003163	0	15	60				
PTPRT	11122	broad.mit.edu	37	20	41419856	41419856	+	Silent	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:41419856A>T	ENST00000373187.1	-	3	464	c.465T>A	c.(463-465)acT>acA	p.T155T	PTPRT_ENST00000373190.1_Silent_p.T155T|PTPRT_ENST00000373198.4_Silent_p.T155T|PTPRT_ENST00000373201.1_Silent_p.T155T|PTPRT_ENST00000373193.3_Silent_p.T155T|PTPRT_ENST00000373184.1_Silent_p.T155T|PTPRT_ENST00000356100.2_Silent_p.T155T			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	155	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GTGGCCAGAAAGTGCTGATGG	0.483																																							uc002xkg.2		NA																	0				skin(8)|ovary(7)|lung(5)	20						c.(463-465)ACT>ACA		protein tyrosine phosphatase, receptor type, T							97.0	102.0	100.0					20																	41419856		1989	4179	6168	SO:0001819	synonymous_variant	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:41419856A>T	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.465T>A	20.37:g.41419856A>T						PTPRT_uc010ggj.2_Silent_p.T155T	p.T155T	NM_007050	NP_008981	O14522	PTPRT_HUMAN			3	649	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	155			Extracellular (Potential).|MAM.		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	c.465T>A	CCDS42874.1																																																																																				0.483	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			7	145	0	0	0	0.001984	0	7	145				
ZNF334	55713	broad.mit.edu	37	20	45130201	45130201	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:45130201T>C	ENST00000347606.4	-	5	1959	c.1777A>G	c.(1777-1779)Act>Gct	p.T593A	ZNF334_ENST00000593880.1_Missense_Mutation_p.T616A|ZNF334_ENST00000457685.2_Missense_Mutation_p.T555A	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	593					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CCAGTGTGAGTTCGCTGATGT	0.438																																							uc002xsc.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1777-1779)ACT>GCT		zinc finger protein 334 isoform a							126.0	120.0	122.0					20																	45130201		2203	4300	6503	SO:0001583	missense	55713				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:45130201T>C	AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1777A>G	20.37:g.45130201T>C	ENSP00000255129:p.Thr593Ala					ZNF334_uc002xsa.2_Missense_Mutation_p.T616A|ZNF334_uc002xsb.2_Missense_Mutation_p.T555A|ZNF334_uc002xsd.2_Missense_Mutation_p.T555A|ZNF334_uc010ghl.2_Missense_Mutation_p.T592A	p.T593A	NM_018102	NP_060572	Q9HCZ1	ZN334_HUMAN			5	1961	-		Myeloproliferative disorder(115;0.0122)	593			C2H2-type 11.		Q5T6U2|Q9NVW4	Missense_Mutation	SNP	ENST00000347606.4	37	c.1777A>G	CCDS33480.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.981192	0.53827	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.00966	5.49;5.49	3.01	3.01	0.34805	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01287	0.0042	L	0.48218	1.51	0.30739	N	0.746414	B;B;B	0.33964	0.434;0.434;0.434	B;B;B	0.33568	0.166;0.166;0.166	T	0.20009	-1.0288	9	0.62326	D	0.03	.	9.4466	0.38701	0.0:0.0:0.0:1.0	.	555;593;616	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	A	555;593	ENSP00000402582:T555A;ENSP00000255129:T593A	ENSP00000255129:T593A	T	-	1	0	ZNF334	44563608	0.000000	0.05858	0.927000	0.36925	0.793000	0.44817	0.758000	0.26447	1.378000	0.46305	0.482000	0.46254	ACT		0.438	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1			32	132	0	0	0	0.002096	0	32	132				
NELFCD	51497	broad.mit.edu	37	20	57561906	57561906	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:57561906C>G	ENST00000344018.3	+	3	328	c.301C>G	c.(301-303)Ctc>Gtc	p.L101V	NELFCD_ENST00000602795.1_Missense_Mutation_p.L110V			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	101					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)											GGCCGAGTGGCTCATTCAGAC	0.483																																							uc002yag.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(301-303)CTC>GTC		TH1-like protein							125.0	121.0	122.0					20																	57561906		2203	4300	6503	SO:0001583	missense	51497				negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding	g.chr20:57561906C>G	AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.301C>G	20.37:g.57561906C>G	ENSP00000342300:p.Leu101Val					TH1L_uc010zzu.1_Missense_Mutation_p.L101V|TH1L_uc002yaf.1_RNA|TH1L_uc002yah.2_Missense_Mutation_p.L101V	p.L101V	NM_198976	NP_945327	Q8IXH7	NELFD_HUMAN	Colorectal(105;0.109)		3	328	+	all_lung(29;0.00711)		101					B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Missense_Mutation	SNP	ENST00000344018.3	37	c.301C>G		.	.	.	.	.	.	.	.	.	.	C	23.4	4.413314	0.83449	.	.	ENSG00000101158	ENST00000344018	.	.	.	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000001	D	0.84092	0.5396	M	0.86178	2.8	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.979;0.979	D;D;D	0.87578	0.998;0.982;0.973	D	0.86329	0.1697	9	0.87932	D	0	-28.3503	17.7389	0.88402	0.0:1.0:0.0:0.0	.	101;110;101	B4E2K1;E1P5H4;Q8IXH7	.;.;NELFD_HUMAN	V	101	.	ENSP00000342300:L101V	L	+	1	0	TH1L	56995301	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.482000	0.66833	2.626000	0.88956	0.655000	0.94253	CTC		0.483	NELFCD-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_198976		26	70	0	0	0	0.005443	0	26	70				
LAMA5	3911	broad.mit.edu	37	20	60891003	60891003	+	Splice_Site	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:60891003C>A	ENST00000252999.3	-	58	7934		c.e58+1			NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5						angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCTCCGCATACCTGTGTCCAT	0.667																																							uc002ycq.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.e58+1		laminin alpha 5 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						18.0	17.0	17.0					20																	60891003		2185	4279	6464	SO:0001630	splice_region_variant	3911				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding	g.chr20:60891003C>A	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.7867+1G>T	20.37:g.60891003C>A							p.D2623_splice	NM_005560	NP_005551	O15230	LAMA5_HUMAN	BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		58	7934	-	Breast(26;1.57e-08)							Q8TDF8|Q8WZA7|Q9H1P1	Splice_Site	SNP	ENST00000252999.3	37	c.7867_splice	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	c	11.75	1.730945	0.30684	.	.	ENSG00000130702	ENST00000252999	.	.	.	4.24	4.24	0.50183	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1242	0.53907	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LAMA5	60324398	1.000000	0.71417	0.960000	0.40013	0.287000	0.27160	3.376000	0.52417	1.912000	0.55364	0.486000	0.48141	.		0.667	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	Intron	6	8	1	0	3.59834e-05	0.001168	4.47662e-05	6	8				
SLCO4A1	28231	broad.mit.edu	37	20	61303108	61303108	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:61303108G>T	ENST00000370507.1	+	11	2128	c.2032G>T	c.(2032-2034)Ggc>Tgc	p.G678C	SLCO4A1_ENST00000217159.1_Missense_Mutation_p.G678C			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	678					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CCAGGTGCTGGGCGTCCTCTT	0.627																																					Pancreas(168;741 2006 10379 40139 45334)	Pancreas(168;741 2006 10379 40139 45334)	uc002ydb.1		NA																	0				ovary(1)	1						c.(2032-2034)GGC>TGC		solute carrier organic anion transporter family							100.0	102.0	101.0					20																	61303108		2203	4300	6503	SO:0001583	missense	28231				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity	g.chr20:61303108G>T	AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.2032G>T	20.37:g.61303108G>T	ENSP00000359538:p.Gly678Cys					SLCO4A1_uc002ydc.1_Intron|SLCO4A1_uc002yde.1_Missense_Mutation_p.G80C	p.G678C	NM_016354	NP_057438	Q96BD0	SO4A1_HUMAN	BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		12	2237	+	Breast(26;3.65e-08)		678			Helical; Name=12; (Potential).		Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Missense_Mutation	SNP	ENST00000370507.1	37	c.2032G>T	CCDS13501.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951066	0.53186	.	.	ENSG00000101187	ENST00000217159;ENST00000370512;ENST00000370507;ENST00000342674;ENST00000451793	T;T;T	0.80738	0.24;0.24;-1.41	4.42	4.42	0.53409	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.88444	0.6438	M	0.77616	2.38	0.80722	D	1	D	0.76494	0.999	D	0.65987	0.94	D	0.90067	0.4160	10	0.72032	D	0.01	.	14.5271	0.67897	0.0:0.0:1.0:0.0	.	678	Q96BD0	SO4A1_HUMAN	C	678;678;678;530;107	ENSP00000217159:G678C;ENSP00000359538:G678C;ENSP00000414855:G107C	ENSP00000217159:G678C	G	+	1	0	SLCO4A1	60773553	1.000000	0.71417	0.990000	0.47175	0.309000	0.27889	6.132000	0.71676	2.150000	0.67090	0.491000	0.48974	GGC		0.627	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2	NM_016354		31	138	1	0	1.22384e-17	0.002836	2.3414e-17	31	138				
NKAIN4	128414	broad.mit.edu	37	20	61873917	61873917	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:61873917G>T	ENST00000370316.3	-	6	680	c.591C>A	c.(589-591)tcC>tcA	p.S197S	NKAIN4_ENST00000370313.1_Intron|NKAIN4_ENST00000370307.2_Silent_p.S135S|NKAIN4_ENST00000466885.1_5'UTR	NM_152864.3	NP_690603.3	Q8IVV8	NKAI4_HUMAN	Na+/K+ transporting ATPase interacting 4	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|lung(1)|ovary(1)	4	all_cancers(38;2.72e-09)					ACAAGAGACTGGATGGCTTTT	0.473																																							uc002yek.2		NA																	0					0						c.(589-591)TCC>TCA		Na+/K+ transporting ATPase interacting 4							218.0	220.0	220.0					20																	61873917		2203	4300	6503	SO:0001819	synonymous_variant	128414					integral to membrane|plasma membrane		g.chr20:61873917G>T	BC041812	CCDS13514.1	20q13.33	2007-10-04	2007-10-04	2007-10-04	ENSG00000101198	ENSG00000101198		"""Na+/K+ transporting ATPase interacting"""	16191	protein-coding gene	gene with protein product		612873	"""chromosome 20 open reading frame 58"""	C20orf58		17606467	Standard	NM_152864		Approved	bA261N11.2, FAM77A	uc002yek.3	Q8IVV8	OTTHUMG00000032959	ENST00000370316.3:c.591C>A	20.37:g.61873917G>T							p.S197S	NM_152864	NP_690603	Q8IVV8	NKAI4_HUMAN			6	681	-	all_cancers(38;2.72e-09)		197					Q4VXQ6|Q9BQU8|Q9BQU9	Silent	SNP	ENST00000370316.3	37	c.591C>A	CCDS13514.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.723494	0.48728	.	.	ENSG00000101198	ENST00000370317	T	0.23950	1.88	4.54	4.54	0.55810	.	.	.	.	.	T	0.48205	0.1487	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55366	-0.8152	6	0.87932	D	0	-10.1129	16.8987	0.86107	0.0:0.0:1.0:0.0	.	.	.	.	Q	152	ENSP00000359341:P152Q	ENSP00000359341:P152Q	P	-	2	0	NKAIN4	61344362	1.000000	0.71417	0.061000	0.19648	0.467000	0.32768	2.712000	0.47186	2.050000	0.60909	0.491000	0.48974	CCA		0.473	NKAIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080117.3	NM_152864		35	195	1	0	4.40578e-31	0.00623	9.37428e-31	35	195				
HSPA13	6782	broad.mit.edu	37	21	15746076	15746076	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr21:15746076G>A	ENST00000285667.3	-	5	1345	c.1278C>T	c.(1276-1278)ccC>ccT	p.P426P	HSPA13_ENST00000544452.1_Silent_p.P218P	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	426						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						CAGATGTGTTGGGATCTTTTC	0.483																																							uc002yjt.2		NA																	0				kidney(1)	1						c.(1276-1278)CCC>CCT		heat shock protein 70kDa family member 13							92.0	93.0	93.0					21																	15746076		2203	4300	6503	SO:0001819	synonymous_variant	6782					endoplasmic reticulum|microsome	ATP binding	g.chr21:15746076G>A		CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.1278C>T	21.37:g.15746076G>A						HSPA13_uc011abx.1_Silent_p.P218P	p.P426P	NM_006948	NP_008879	P48723	HSP13_HUMAN			5	1347	-			426					B2R616|Q8NE40	Silent	SNP	ENST00000285667.3	37	c.1278C>T	CCDS13567.1																																																																																				0.483	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157815.1			14	56	0	0	0	0.00245	0	14	56				
NCAM2	4685	broad.mit.edu	37	21	22710708	22710708	+	Splice_Site	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr21:22710708G>A	ENST00000400546.1	+	8	1147		c.e8-1		NCAM2_ENST00000284894.7_Splice_Site|NCAM2_ENST00000535285.1_Splice_Site	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2						axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		ATTCTTTACAGTACAGCCTCA	0.358																																							uc002yld.1		NA																	0				ovary(4)	4						c.e8-1		neural cell adhesion molecule 2 precursor							48.0	48.0	48.0					21																	22710708		1835	4075	5910	SO:0001630	splice_region_variant	4685				neuron cell-cell adhesion	integral to membrane|plasma membrane		g.chr21:22710708G>A		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.899-1G>A	21.37:g.22710708G>A						NCAM2_uc011acb.1_Splice_Site_p.V158_splice|NCAM2_uc011acc.1_Splice_Site_p.V325_splice	p.V300_splice	NM_004540	NP_004531	O15394	NCAM2_HUMAN		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)	8	1148	+		Lung NSC(9;0.195)						A8MQ06|B7Z841|Q7Z7F2	Splice_Site	SNP	ENST00000400546.1	37	c.899_splice	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318067	0.81469	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6141	0.91296	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NCAM2	21632579	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.717000	0.74707	2.736000	0.93811	0.591000	0.81541	.		0.358	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	Intron	9	37	0	0	0	0.000978	0	9	37				
TIAM1	7074	broad.mit.edu	37	21	32513751	32513751	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr21:32513751C>T	ENST00000286827.3	-	22	4018	c.3547G>A	c.(3547-3549)Gag>Aag	p.E1183K	TIAM1_ENST00000541036.1_Missense_Mutation_p.E1123K	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1183	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						AGGTACGACTCCAGCGTGGAT	0.572																																							uc002yow.1		NA																	0				lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						c.(3547-3549)GAG>AAG		T-cell lymphoma invasion and metastasis 1							170.0	144.0	153.0					21																	32513751		2203	4300	6503	SO:0001583	missense	7074				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr21:32513751C>T		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.3547G>A	21.37:g.32513751C>T	ENSP00000286827:p.Glu1183Lys					TIAM1_uc011adk.1_Missense_Mutation_p.E1183K|TIAM1_uc011adl.1_Missense_Mutation_p.E1123K	p.E1183K	NM_003253	NP_003244	Q13009	TIAM1_HUMAN			22	4019	-			1183			DH.		B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	c.3547G>A	CCDS13609.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.534719|5.534719	0.96460|0.96460	.|.	.|.	ENSG00000156299|ENSG00000156299	ENST00000286827;ENST00000541036|ENST00000399841	T;T|.	0.63255|.	-0.03;-0.03|.	5.54|5.54	5.54|5.54	0.83059|0.83059	Guanine-nucleotide dissociation stimulator, CDC24, conserved site (1);Dbl homology (DH) domain (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75133|0.75133	0.3808|0.3808	M|M	0.62088|0.62088	1.915|1.915	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.87578|.	0.997;0.998;0.998|.	T|T	0.75634|0.75634	-0.3250|-0.3250	10|6	0.72032|0.56958	D|D	0.01|0.05	.|.	19.4852|19.4852	0.95026|0.95026	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1123;1123;1183|.	F5GZ53;B7ZLR6;Q13009|.	.;.;TIAM1_HUMAN|.	K|E	1183;1123|1022	ENSP00000286827:E1183K;ENSP00000441570:E1123K|.	ENSP00000286827:E1183K|ENSP00000382735:G1022E	E|G	-|-	1|2	0|0	TIAM1|TIAM1	31435622|31435622	1.000000|1.000000	0.71417|0.71417	0.957000|0.957000	0.39632|0.39632	0.811000|0.811000	0.45836|0.45836	7.736000|7.736000	0.84948|0.84948	2.590000|2.590000	0.87494|0.87494	0.563000|0.563000	0.77884|0.77884	GAG|GGA		0.572	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253		30	83	0	0	0	0.002445	0	30	83				
SCAF4	57466	broad.mit.edu	37	21	33043759	33043759	+	Missense_Mutation	SNP	C	C	A	rs563567552		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr21:33043759C>A	ENST00000286835.7	-	20	3779	c.3397G>T	c.(3397-3399)Gtt>Ttt	p.V1133F	SCAF4_ENST00000399804.1_Missense_Mutation_p.V1111F|SCAF4_ENST00000434667.3_Missense_Mutation_p.V1118F	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	1133						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TCGGGTTCAACGGATGAGGTA	0.498																																							uc002ypd.2		NA																	0					0						c.(3397-3399)GTT>TTT		splicing factor, arginine/serine-rich 15 isoform							72.0	65.0	68.0					21																	33043759		2203	4300	6503	SO:0001583	missense	57466					nucleus	nucleotide binding|RNA binding	g.chr21:33043759C>A	AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.3397G>T	21.37:g.33043759C>A	ENSP00000286835:p.Val1133Phe					SFRS15_uc002ype.2_Missense_Mutation_p.V1111F|SFRS15_uc010glu.2_Missense_Mutation_p.V1118F	p.V1133F	NM_020706	NP_065757	O95104	SFR15_HUMAN			20	3823	-			1133					C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Missense_Mutation	SNP	ENST00000286835.7	37	c.3397G>T	CCDS33537.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.510995	0.44660	.	.	ENSG00000156304	ENST00000434667;ENST00000286835;ENST00000399804	T;T;T	0.48836	0.82;0.82;0.8	5.93	3.17	0.36434	.	0.760859	0.11932	N	0.515649	T	0.50411	0.1614	N	0.24115	0.695	0.09310	N	0.999993	D;B;B	0.69078	0.997;0.295;0.195	D;B;B	0.67900	0.954;0.127;0.06	T	0.34775	-0.9815	10	0.62326	D	0.03	-1.3128	7.7707	0.29006	0.0:0.6279:0.1764:0.1957	.	1118;1111;1133	C9JLZ0;O95104-2;O95104	.;.;SFR15_HUMAN	F	1118;1133;1111	ENSP00000402377:V1118F;ENSP00000286835:V1133F;ENSP00000382703:V1111F	ENSP00000286835:V1133F	V	-	1	0	SCAF4	31965630	0.806000	0.28996	0.673000	0.29887	0.992000	0.81027	0.689000	0.25437	0.428000	0.26173	-0.150000	0.13652	GTT		0.498	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000192659.1	XM_047889		17	53	1	0	4.14922e-12	0.004007	7.01464e-12	17	53				
POTEH	23784	broad.mit.edu	37	22	16267078	16267078	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr22:16267078C>T	ENST00000343518.6	-	9	1422	c.1371G>A	c.(1369-1371)aaG>aaA	p.K457K		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	457										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TTCCGTGCTTCTTCATTTCTT	0.358																																							uc010gqp.2		NA																	0				skin(1)	1						c.(1369-1371)AAG>AAA		ANKRD26-like family C, member 3							130.0	129.0	129.0					22																	16267078		692	1591	2283	SO:0001819	synonymous_variant	23784							g.chr22:16267078C>T	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1371G>A	22.37:g.16267078C>T						POTEH_uc002zlg.1_RNA|POTEH_uc002zlh.1_Silent_p.K176K|POTEH_uc002zlj.1_Silent_p.K292K	p.K457K	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN			9	1423	-			457					A2CEK4|A6NCI1|A9Z1W0	Silent	SNP	ENST00000343518.6	37	c.1371G>A	CCDS46658.1																																																																																				0.358	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		11	385	0	0	0	0.001855	0	11	385				
PRAME	23532	broad.mit.edu	37	22	22890900	22890900	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr22:22890900C>T	ENST00000398741.1	-	6	1425	c.1119G>A	c.(1117-1119)ctG>ctA	p.L373L	PRAME_ENST00000398743.2_Silent_p.L373L|PRAME_ENST00000424204.2_Silent_p.L357L|PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000402697.1_Silent_p.L373L|PRAME_ENST00000539862.1_Silent_p.L357L|PRAME_ENST00000543184.1_Silent_p.L373L|PRAME_ENST00000405655.3_Silent_p.L373L	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	373					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		AGGCTCTCTCCAGCAGAGCTT	0.592																																					Melanoma(73;1707 1838 15168 27201)	Melanoma(73;1707 1838 15168 27201)	uc002zwf.2		NA																	0				central_nervous_system(2)	2						c.(1117-1119)CTG>CTA		preferentially expressed antigen in melanoma							102.0	99.0	100.0					22																	22890900		2203	4300	6503	SO:0001819	synonymous_variant	23532				apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding	g.chr22:22890900C>T	U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.1119G>A	22.37:g.22890900C>T						LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Silent_p.L357L|PRAME_uc010gtr.2_Silent_p.L373L|PRAME_uc002zwg.2_Silent_p.L373L|PRAME_uc002zwh.2_Silent_p.L373L|PRAME_uc002zwi.2_Silent_p.L373L|PRAME_uc002zwj.2_Silent_p.L373L|PRAME_uc002zwk.2_Silent_p.L373L	p.L373L	NM_206956	NP_996839	P78395	PRAME_HUMAN		READ - Rectum adenocarcinoma(21;0.0649)	5	1275	-	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)	373					B2R6Y7|O43481|Q8IXN8	Silent	SNP	ENST00000398741.1	37	c.1119G>A	CCDS13801.1																																																																																				0.592	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321644.1	NM_206953		43	72	0	0	0	0.002522	0	43	72				
MYO18B	84700	broad.mit.edu	37	22	26299729	26299729	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr22:26299729G>T	ENST00000407587.2	+	31	5251	c.5082G>T	c.(5080-5082)ttG>ttT	p.L1694F	MYO18B_ENST00000536204.1_3'UTR|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|MYO18B_ENST00000536101.1_Missense_Mutation_p.L1693F|MYO18B_ENST00000335473.7_Missense_Mutation_p.L1693F|CTA-125H2.2_ENST00000609275.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1693	Gln-rich.|Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TCTGGAAGTTGGAATCCAGCG	0.557																																							uc003abz.1		NA																	0				ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(5077-5079)TTG>TTT		myosin XVIIIB							45.0	50.0	48.0					22																	26299729		1920	4127	6047	SO:0001583	missense	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26299729G>T	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5082G>T	22.37:g.26299729G>T	ENSP00000386096:p.Leu1694Phe					MYO18B_uc003aca.1_Missense_Mutation_p.L1574F|MYO18B_uc010guy.1_Missense_Mutation_p.L1575F|MYO18B_uc010guz.1_Missense_Mutation_p.L1573F|MYO18B_uc011aka.1_Missense_Mutation_p.L847F|MYO18B_uc011akb.1_Missense_Mutation_p.L1206F	p.L1693F	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN			31	5329	+			1693			Potential.|Tail.|Gln-rich.		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37	c.5079G>T		.	.	.	.	.	.	.	.	.	.	G	14.50	2.552813	0.45487	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.89746	-2.52;-2.52;-2.56	4.74	4.74	0.60224	.	0.096296	0.43747	D	0.000529	D	0.93805	0.8019	M	0.80982	2.52	0.33395	D	0.576636	D;D;D;D	0.76494	0.998;0.998;0.992;0.999	D;P;P;D	0.66084	0.911;0.874;0.859;0.941	D	0.95990	0.8985	10	0.54805	T	0.06	.	15.2967	0.73913	0.0:0.0:1.0:0.0	.	1206;1693;1694;1693	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	F	1693;1693;1694	ENSP00000441229:L1693F;ENSP00000334563:L1693F;ENSP00000386096:L1694F	ENSP00000334563:L1693F	L	+	3	2	MYO18B	24629729	1.000000	0.71417	1.000000	0.80357	0.112000	0.19704	3.222000	0.51223	2.465000	0.83290	0.655000	0.94253	TTG		0.557	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		5	13	1	0	1.23904e-05	0.000602	1.59673e-05	5	13				
ASPHD2	57168	broad.mit.edu	37	22	26830260	26830260	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr22:26830260G>A	ENST00000215906.5	+	2	1117	c.679G>A	c.(679-681)Gag>Aag	p.E227K		NM_020437.4	NP_065170.2	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	227					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	16						CCCCAGCGGGGAGTGGTTCAC	0.542																																							uc003acg.2		NA																	0				ovary(1)	1						c.(679-681)GAG>AAG		aspartate beta-hydroxylase domain containing 2							92.0	85.0	87.0					22																	26830260		2203	4300	6503	SO:0001583	missense	57168				peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity	g.chr22:26830260G>A	AK097157	CCDS13834.2	22q12.1	2006-02-02			ENSG00000128203	ENSG00000128203			30437	protein-coding gene	gene with protein product							Standard	NM_020437		Approved	FLJ39838	uc003acg.2	Q6ICH7	OTTHUMG00000150884	ENST00000215906.5:c.679G>A	22.37:g.26830260G>A	ENSP00000215906:p.Glu227Lys						p.E227K	NM_020437	NP_065170	Q6ICH7	ASPH2_HUMAN			2	1076	+			227			Lumenal (Potential).		B2RCH3|Q7L0W3|Q9NSN3	Missense_Mutation	SNP	ENST00000215906.5	37	c.679G>A	CCDS13834.2	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449354	0.63178	.	.	ENSG00000128203	ENST00000215906	T	0.39592	1.07	4.82	4.82	0.62117	.	0.121004	0.56097	D	0.000023	T	0.34077	0.0885	L	0.31476	0.935	0.52501	D	0.999959	B	0.27882	0.192	B	0.30943	0.122	T	0.09079	-1.0691	10	0.21540	T	0.41	-24.5587	17.0945	0.86631	0.0:0.0:1.0:0.0	.	227	Q6ICH7	ASPH2_HUMAN	K	227	ENSP00000215906:E227K	ENSP00000215906:E227K	E	+	1	0	ASPHD2	25160260	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.088000	0.64486	2.498000	0.84270	0.557000	0.71058	GAG		0.542	ASPHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320422.1	NM_020437		8	86	0	0	0	0.004482	0	8	86				
OSBP2	23762	broad.mit.edu	37	22	31091455	31091455	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr22:31091455G>T	ENST00000332585.6	+	1	663	c.559G>T	c.(559-561)Ggc>Tgc	p.G187C	OSBP2_ENST00000407373.1_Intron|OSBP2_ENST00000382310.3_Missense_Mutation_p.G187C|OSBP2_ENST00000446658.2_Missense_Mutation_p.G187C|OSBP2_ENST00000403222.3_Intron	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	187	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						CAGCTTCGAGGGCTGGCTTCT	0.597																																							uc003aiy.1		NA																	0				breast(1)|skin(1)	2						c.(559-561)GGC>TGC		oxysterol binding protein 2 isoform a							59.0	63.0	62.0					22																	31091455		2039	4181	6220	SO:0001583	missense	23762				lipid transport	membrane	lipid binding	g.chr22:31091455G>T		CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.559G>T	22.37:g.31091455G>T	ENSP00000332576:p.Gly187Cys					OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc003aix.1_Missense_Mutation_p.G187C|OSBP2_uc011alb.1_Missense_Mutation_p.G187C|OSBP2_uc003aiz.1_Missense_Mutation_p.G187C	p.G187C	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN			1	663	+			187			PH.		B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Missense_Mutation	SNP	ENST00000332585.6	37	c.559G>T	CCDS43002.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956523	0.92726	.	.	ENSG00000184792	ENST00000332585;ENST00000382310;ENST00000446658	D;D;D	0.89123	-2.47;-2.47;-2.47	4.36	4.36	0.52297	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.97331	0.9127	H	0.99789	4.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98982	1.0805	10	0.87932	D	0	-21.0433	16.2135	0.82186	0.0:0.0:1.0:0.0	.	187;187;187	B4DFA8;Q0VF99;Q969R2	.;.;OSBP2_HUMAN	C	187	ENSP00000332576:G187C;ENSP00000371747:G187C;ENSP00000392080:G187C	ENSP00000332576:G187C	G	+	1	0	OSBP2	29421455	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.516000	0.90552	2.430000	0.82344	0.655000	0.94253	GGC		0.597	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321547.2	NM_030758		13	63	1	0	3.27435e-08	0.00245	4.81979e-08	13	63				
MIOX	55586	broad.mit.edu	37	22	50925850	50925850	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr22:50925850G>T	ENST00000216075.6	+	2	126	c.52G>T	c.(52-54)Gac>Tac	p.D18Y	MIOX_ENST00000395732.3_Missense_Mutation_p.D18Y|MIOX_ENST00000395733.3_Missense_Mutation_p.D18Y	NM_017584.5	NP_060054.4	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	18					inositol catabolic process (GO:0019310)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)	aldo-keto reductase (NADP) activity (GO:0004033)|ferric iron binding (GO:0008199)|inositol oxygenase activity (GO:0050113)|NADP binding (GO:0050661)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen (GO:0016701)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	13		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACCTGATGTGGACCCAGAGGT	0.597																																							uc003bll.1		NA																	0					0						c.(52-54)GAC>TAC		myo-inositol oxygenase							107.0	88.0	94.0					22																	50925850		2203	4300	6503	SO:0001583	missense	55586				inositol catabolic process	cytoplasm|inclusion body	aldo-keto reductase (NADP) activity|ferric iron binding|inositol oxygenase activity	g.chr22:50925850G>T	AF197129	CCDS14092.1	22q13.3	2008-06-11	2005-06-15	2005-06-15	ENSG00000100253	ENSG00000100253			14522	protein-coding gene	gene with protein product	"""kidney-specific protein 32"""	606774	"""aldehyde reductase (aldose reductase) like 6"""	ALDRL6		10944187, 11716759	Standard	NM_017584		Approved		uc003bll.1	Q9UGB7	OTTHUMG00000150207	ENST00000216075.6:c.52G>T	22.37:g.50925850G>T	ENSP00000216075:p.Asp18Tyr					MIOX_uc003blm.1_Missense_Mutation_p.D18Y|MIOX_uc003bln.1_Missense_Mutation_p.D18Y	p.D18Y	NM_017584	NP_060054	Q9UGB7	MIOX_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	2	166	+		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	18					Q05DJ6|Q5S8C9|Q9BZZ1|Q9UHB8	Missense_Mutation	SNP	ENST00000216075.6	37	c.52G>T	CCDS14092.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892364	0.33442	.	.	ENSG00000100253	ENST00000395733;ENST00000216075;ENST00000395732;ENST00000451761	.	.	.	4.65	2.41	0.29592	.	0.571356	0.18609	N	0.136220	T	0.14787	0.0357	N	0.19112	0.55	0.09310	N	1	B;P;B	0.37276	0.42;0.589;0.446	B;B;B	0.30179	0.099;0.112;0.098	T	0.13845	-1.0494	9	0.66056	D	0.02	-4.389	5.0465	0.14487	0.1198:0.2172:0.663:0.0	.	18;18;18	Q9UGB7-2;A6PVH2;Q9UGB7	.;.;MIOX_HUMAN	Y	18;18;18;13	.	ENSP00000216075:D18Y	D	+	1	0	MIOX	49272716	0.190000	0.23276	0.164000	0.22755	0.935000	0.57460	1.246000	0.32803	1.154000	0.42482	0.491000	0.48974	GAC		0.597	MIOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316835.1	NM_017584		7	42	1	0	5.18039e-06	0.00308	6.89709e-06	7	42				
NUP210	23225	broad.mit.edu	37	3	13368843	13368843	+	Missense_Mutation	SNP	C	C	A	rs61751581		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:13368843C>A	ENST00000254508.5	-	32	4463	c.4381G>T	c.(4381-4383)Gca>Tca	p.A1461S		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1461					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GGGTGCTCTGCGTCCCACACA	0.642																																							uc003bxv.1		NA																	0				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11						c.(4381-4383)GCA>TCA		nucleoporin 210 precursor							52.0	45.0	47.0					3																	13368843		2203	4300	6503	SO:0001583	missense	23225				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore		g.chr3:13368843C>A	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.4381G>T	3.37:g.13368843C>A	ENSP00000254508:p.Ala1461Ser						p.A1461S	NM_024923	NP_079199	Q8TEM1	PO210_HUMAN			32	4464	-	all_neural(104;0.187)		1461			Lumenal (Probable).		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	c.4381G>T	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	C	0.292	-0.979675	0.02197	.	.	ENSG00000132182	ENST00000254508	T	0.04809	3.55	5.74	-7.09	0.01553	.	1.092530	0.06781	N	0.785215	T	0.01627	0.0052	N	0.08118	0	0.09310	N	0.999996	B	0.06786	0.001	B	0.04013	0.001	T	0.45789	-0.9237	10	0.06236	T	0.91	.	2.8005	0.05413	0.0957:0.3142:0.1747:0.4154	.	1461	Q8TEM1	PO210_HUMAN	S	1461	ENSP00000254508:A1461S	ENSP00000254508:A1461S	A	-	1	0	NUP210	13343843	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	-1.935000	0.01550	-0.986000	0.03498	-0.345000	0.07892	GCA		0.642	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923		6	28	1	0	8.12818e-05	0.001984	9.89581e-05	6	28				
ZNF385D	79750	broad.mit.edu	37	3	21706379	21706379	+	Splice_Site	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:21706379G>T	ENST00000281523.2	-	2	682	c.164C>A	c.(163-165)gCg>gAg	p.A55E	ZNF385D_ENST00000494118.1_Intron	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	55						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						GGTACTTACCGCATTGAAATT	0.473																																							uc003cce.2		NA																	0				large_intestine(2)|skin(2)|ovary(1)	5						c.(163-165)GCG>GAG		zinc finger protein 385D							100.0	93.0	95.0					3																	21706379		2203	4300	6503	SO:0001630	splice_region_variant	79750					nucleus	nucleic acid binding|zinc ion binding	g.chr3:21706379G>T	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.165+1C>A	3.37:g.21706379G>T						ZNF385D_uc010hfb.1_Intron	p.A55E	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN			2	572	-			55						Missense_Mutation	SNP	ENST00000281523.2	37	c.164C>A	CCDS2636.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.552055	0.65311	.	.	ENSG00000151789	ENST00000281523	T	0.39787	1.06	5.53	5.53	0.82687	.	0.063084	0.64402	D	0.000008	T	0.29321	0.0730	N	0.17082	0.46	0.44149	D	0.996948	P	0.40144	0.704	B	0.33799	0.17	T	0.14559	-1.0468	10	0.52906	T	0.07	-0.033	18.4189	0.90582	0.0:0.0:1.0:0.0	.	55	Q9H6B1	Z385D_HUMAN	E	55	ENSP00000281523:A55E	ENSP00000281523:A55E	A	-	2	0	ZNF385D	21681383	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.114000	0.77103	2.604000	0.88044	0.591000	0.81541	GCG		0.473	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697	Missense_Mutation	13	86	1	0	1.05317e-09	0.00245	1.6536e-09	13	86				
NR1D2	9975	broad.mit.edu	37	3	24001260	24001260	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:24001260G>C	ENST00000312521.4	+	4	790	c.471G>C	c.(469-471)caG>caC	p.Q157H	NR1D2_ENST00000492552.1_3'UTR	NM_001145425.1|NM_005126.4	NP_001138897.1|NP_005117	Q14995	NR1D2_HUMAN	nuclear receptor subfamily 1, group D, member 2	157	Hinge.				gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lipid homeostasis (GO:0055088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of inflammatory response (GO:0050727)|regulation of lipid metabolic process (GO:0019216)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	22						ACAGATGTCAGCAATGTCGCT	0.378																																							uc003ccs.2		NA																	0				urinary_tract(1)|kidney(1)|skin(1)	3						c.(469-471)CAG>CAC		nuclear receptor subfamily 1, group D, member 2							177.0	163.0	168.0					3																	24001260		2203	4300	6503	SO:0001583	missense	9975				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding	g.chr3:24001260G>C	BC045613	CCDS33718.1	3p24.1	2013-01-16			ENSG00000174738	ENSG00000174738		"""Nuclear hormone receptors"""	7963	protein-coding gene	gene with protein product		602304				7997240, 10198169	Standard	NM_005126		Approved	BD73, RVR, EAR-1r, HZF2, Hs.37288	uc003ccs.2	Q14995	OTTHUMG00000155659	ENST00000312521.4:c.471G>C	3.37:g.24001260G>C	ENSP00000310006:p.Gln157His					NR1D2_uc010hfd.2_RNA|NR1D2_uc011awk.1_Missense_Mutation_p.Q82H	p.Q157H	NM_005126	NP_005117	Q14995	NR1D2_HUMAN			4	790	+			157			Nuclear receptor.|NR C4-type.		B2R8Q3|O00402|Q86XD4	Missense_Mutation	SNP	ENST00000312521.4	37	c.471G>C	CCDS33718.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.911511	0.52439	.	.	ENSG00000174738	ENST00000312521;ENST00000396676	D	0.96802	-4.13	5.85	5.85	0.93711	Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.85682	D	0.000000	D	0.98738	0.9576	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99208	1.0875	10	0.87932	D	0	.	20.1589	0.98128	0.0:0.0:1.0:0.0	.	157	Q14995	NR1D2_HUMAN	H	157	ENSP00000310006:Q157H	ENSP00000310006:Q157H	Q	+	3	2	NR1D2	23976264	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	3.461000	0.53035	2.769000	0.95229	0.650000	0.86243	CAG		0.378	NR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341017.3			18	99	0	0	0	0.008871	0	18	99				
SLC4A7	9497	broad.mit.edu	37	3	27473031	27473031	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:27473031G>A	ENST00000295736.5	-	7	951	c.881C>T	c.(880-882)cCt>cTt	p.P294L	SLC4A7_ENST00000388777.4_5'UTR|SLC4A7_ENST00000454389.1_Missense_Mutation_p.P303L|SLC4A7_ENST00000425128.2_Missense_Mutation_p.P286L|SLC4A7_ENST00000428386.1_Intron|SLC4A7_ENST00000445684.1_Missense_Mutation_p.P290L|SLC4A7_ENST00000437179.1_Intron|SLC4A7_ENST00000446700.1_Missense_Mutation_p.P286L|SLC4A7_ENST00000455077.1_Intron|SLC4A7_ENST00000440156.1_Missense_Mutation_p.P290L|SLC4A7_ENST00000435667.2_Intron	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	294					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	TGAGCCTGCAGGGGTTCCAGC	0.512																																							uc003cdv.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(880-882)CCT>CTT		solute carrier family 4, sodium bicarbonate							89.0	96.0	94.0					3																	27473031		2203	4300	6503	SO:0001583	missense	9497					apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity	g.chr3:27473031G>A	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.881C>T	3.37:g.27473031G>A	ENSP00000295736:p.Pro294Leu					SLC4A7_uc011awu.1_RNA|SLC4A7_uc011awv.1_Intron|SLC4A7_uc003cdu.3_Intron|SLC4A7_uc011aww.1_Missense_Mutation_p.P303L|SLC4A7_uc011awx.1_Missense_Mutation_p.P290L|SLC4A7_uc011awy.1_Missense_Mutation_p.P286L|SLC4A7_uc011awz.1_Intron|SLC4A7_uc011axa.1_Intron|SLC4A7_uc011axb.1_Missense_Mutation_p.P290L|SLC4A7_uc010hfm.2_Intron|SLC4A7_uc003cdw.2_Intron	p.P294L	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN			7	952	-			294			Extracellular (Potential).		A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	37	c.881C>T	CCDS33721.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.201540	0.79015	.	.	ENSG00000033867	ENST00000295736;ENST00000454389;ENST00000440156;ENST00000446700;ENST00000445684;ENST00000425128	T;T;T;T;T;T	0.77229	-0.99;-0.99;-1.08;-1.08;-1.08;0.42	5.72	5.72	0.89469	Bicarbonate transporter, cytoplasmic (1);	0.582024	0.17020	N	0.190166	D	0.83557	0.5280	L	0.34521	1.04	0.58432	D	0.999999	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.85130	0.997;0.997;0.997;0.997;0.997	T	0.80125	-0.1513	10	0.30078	T	0.28	.	19.8692	0.96843	0.0:0.0:1.0:0.0	.	290;286;290;303;294	E9PFN4;E9PGC1;B5M453;E9PDL9;Q9Y6M7	.;.;.;.;S4A7_HUMAN	L	294;303;290;286;290;286	ENSP00000295736:P294L;ENSP00000390394:P303L;ENSP00000414797:P290L;ENSP00000406605:P286L;ENSP00000406804:P290L;ENSP00000401949:P286L	ENSP00000295736:P294L	P	-	2	0	SLC4A7	27448035	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.241000	0.78201	2.714000	0.92807	0.591000	0.81541	CCT		0.512	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615		14	65	0	0	0	0.001855	0	14	65				
ARPP21	10777	broad.mit.edu	37	3	35723305	35723305	+	Missense_Mutation	SNP	C	C	T	rs139626582		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:35723305C>T	ENST00000187397.4	+	3	518	c.62C>T	c.(61-63)aCg>aTg	p.T21M	ARPP21_ENST00000436702.1_Missense_Mutation_p.T21M|ARPP21_ENST00000427542.1_Missense_Mutation_p.T21M|ARPP21_ENST00000396481.2_Missense_Mutation_p.T21M|ARPP21_ENST00000396482.2_Missense_Mutation_p.T21M|ARPP21_ENST00000441454.1_Missense_Mutation_p.T21M|ARPP21_ENST00000412048.1_Missense_Mutation_p.T21M|ARPP21_ENST00000428373.1_Missense_Mutation_p.T21M|ARPP21_ENST00000337271.5_Missense_Mutation_p.T21M|ARPP21_ENST00000417925.1_Missense_Mutation_p.T21M|ARPP21_ENST00000432682.1_Missense_Mutation_p.T21M|ARPP21_ENST00000458225.1_Missense_Mutation_p.T21M|ARPP21_ENST00000444190.1_Missense_Mutation_p.T21M|ARPP21_ENST00000438071.1_Missense_Mutation_p.T21M|ARPP21_ENST00000474696.1_Missense_Mutation_p.T21M	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	21					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						GAGCAGGAGACGGCCACTCCA	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		14958	0.0		0.001	False		,,,				2504	0.0						uc003cgb.2		NA																	0				ovary(2)|skin(1)	3						c.(61-63)ACG>ATG		cyclic AMP-regulated phosphoprotein, 21 kD		C	MET/THR,MET/THR,MET/THR,MET/THR	2,4404	4.2+/-10.8	0,2,2201	94.0	93.0	93.0		62,62,62,62	1.0	0.0	3	dbSNP_134	93	0,8600		0,0,4300	yes	missense,missense,missense,missense	ARPP21	NM_001025068.1,NM_001025069.1,NM_016300.4,NM_198399.1	81,81,81,81	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign,benign,benign	21/90,21/90,21/813,21/90	35723305	2,13004	2203	4300	6503	SO:0001583	missense	10777					cytoplasm	nucleic acid binding	g.chr3:35723305C>T	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.62C>T	3.37:g.35723305C>T	ENSP00000187397:p.Thr21Met					ARPP21_uc003cga.2_Missense_Mutation_p.T21M|ARPP21_uc011axy.1_Missense_Mutation_p.T21M|ARPP21_uc003cfz.2_RNA|ARPP21_uc003cgc.2_Missense_Mutation_p.T21M|ARPP21_uc003cgd.2_Missense_Mutation_p.T21M|ARPP21_uc011axx.1_RNA|ARPP21_uc003cge.2_Missense_Mutation_p.T21M	p.T21M	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN			3	326	+			21					B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	c.62C>T	CCDS2661.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.32	1.318689	0.23994	4.54E-4	0.0	ENSG00000172995	ENST00000450234;ENST00000428373;ENST00000421492;ENST00000458225;ENST00000337271;ENST00000444190;ENST00000449196;ENST00000187397;ENST00000452563;ENST00000438577;ENST00000419330;ENST00000427542;ENST00000474696;ENST00000412048;ENST00000396482;ENST00000432682;ENST00000432450;ENST00000413378;ENST00000417925;ENST00000396481;ENST00000441454;ENST00000436702;ENST00000438071	T;T;T;T;T;T;T	0.48522	0.81;1.88;1.87;1.87;1.88;0.83;1.88	5.25	1.04	0.20106	.	1.269220	0.05182	N	0.501483	T	0.33789	0.0875	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.11235	0.004;0.003;0.002;0.004	B;B;B;B	0.12837	0.004;0.003;0.003;0.008	T	0.24977	-1.0145	10	0.45353	T	0.12	4.2817	5.5824	0.17256	0.0:0.5612:0.1308:0.3081	.	21;21;21;21	Q9UBL0-3;A8K1F3;Q9UBL0;Q9UBL0-4	.;.;ARP21_HUMAN;.	M	21	ENSP00000411644:T21M;ENSP00000414351:T21M;ENSP00000337792:T21M;ENSP00000405276:T21M;ENSP00000187397:T21M;ENSP00000390169:T21M;ENSP00000412326:T21M	ENSP00000187397:T21M	T	+	2	0	ARPP21	35698309	0.000000	0.05858	0.000000	0.03702	0.586000	0.36452	0.059000	0.14322	-0.099000	0.12263	0.650000	0.86243	ACG		0.468	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399		7	27	0	0	0	0.001984	0	7	27				
TRANK1	9881	broad.mit.edu	37	3	36898278	36898278	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:36898278T>C	ENST00000429976.2	-	12	3050	c.2803A>G	c.(2803-2805)Aaa>Gaa	p.K935E	TRANK1_ENST00000301807.6_Missense_Mutation_p.K385E|TRANK1_ENST00000428977.2_Missense_Mutation_p.K385E	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	935							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						ACTTGGCCTTTATTGATACCT	0.498																																							uc003cgj.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1153-1155)AAA>GAA		lupus brain antigen 1							144.0	135.0	138.0					3																	36898278		1986	4185	6171	SO:0001583	missense	9881				DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr3:36898278T>C	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.2803A>G	3.37:g.36898278T>C	ENSP00000416168:p.Lys935Glu						p.K385E	NM_014831	NP_055646	O15050	TRNK1_HUMAN			3	1455	-			935					Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	c.1153A>G	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	T	4.763	0.141791	0.09083	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.30448	1.53;1.94;1.53	5.49	2.95	0.34219	.	0.472859	0.21375	N	0.075574	T	0.17109	0.0411	N	0.14661	0.345	0.09310	N	1	B	0.24483	0.104	B	0.21708	0.036	T	0.18398	-1.0338	10	0.18276	T	0.48	.	12.2865	0.54795	0.0:0.0:0.2835:0.7165	.	935	O15050	TRNK1_HUMAN	E	385;935;385	ENSP00000416826:K385E;ENSP00000416168:K935E;ENSP00000301807:K385E	ENSP00000301807:K385E	K	-	1	0	TRANK1	36873282	0.011000	0.17503	0.150000	0.22450	0.597000	0.36814	0.618000	0.24373	1.031000	0.39867	0.448000	0.29417	AAA		0.498	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831		15	96	0	0	0	0.004007	0	15	96				
CCR8	1237	broad.mit.edu	37	3	39373851	39373851	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:39373851C>A	ENST00000326306.4	+	2	167	c.29C>A	c.(28-30)aCa>aAa	p.T10K	CCR8_ENST00000545843.1_5'UTR|CCR8_ENST00000414803.1_Missense_Mutation_p.T10K	NM_005201.3	NP_005192.1	P51685	CCR8_HUMAN	chemokine (C-C motif) receptor 8	10					cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)			NS(3)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0504)|Kidney(284;0.0635)		CTCAGTGTGACAACAGTGACC	0.413																																							uc010hhr.2		NA																	0				ovary(1)|lung(1)	2						c.(28-30)ACA>AAA		chemokine (C-C motif) receptor 8							141.0	128.0	132.0					3																	39373851		2203	4300	6503	SO:0001583	missense	1237				cell adhesion|chemotaxis|elevation of cytosolic calcium ion concentration|immune response	integral to plasma membrane	coreceptor activity	g.chr3:39373851C>A	D49919	CCDS2684.1	3p22	2012-08-08			ENSG00000179934	ENSG00000179934		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1609	protein-coding gene	gene with protein product		601834		CMKBRL2, CMKBR8		8816377, 8886020	Standard	NM_005201		Approved	CY6, TER1, CKR-L1, GPR-CY6, CDw198	uc010hhr.2	P51685	OTTHUMG00000131290	ENST00000326306.4:c.29C>A	3.37:g.39373851C>A	ENSP00000326432:p.Thr10Lys					CCR8_uc003cjm.2_5'UTR	p.T10K	NM_005201	NP_005192	P51685	CCR8_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0504)|Kidney(284;0.0635)	2	167	+			10			Extracellular (Potential).		B2RC64|Q3KNQ8|Q3KNR3|Q9BYX5	Missense_Mutation	SNP	ENST00000326306.4	37	c.29C>A	CCDS2684.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.430889	0.43122	.	.	ENSG00000179934	ENST00000326306;ENST00000414803	T;T	0.23147	1.92;1.92	5.24	3.36	0.38483	.	0.976806	0.08371	N	0.956130	T	0.11922	0.0290	N	0.08118	0	0.20638	N	0.999877	P	0.38922	0.651	B	0.36030	0.216	T	0.12142	-1.0559	10	0.38643	T	0.18	.	3.0871	0.06281	0.2161:0.5545:0.0:0.2295	.	10	P51685	CCR8_HUMAN	K	10	ENSP00000326432:T10K;ENSP00000390104:T10K	ENSP00000326432:T10K	T	+	2	0	CCR8	39348855	0.002000	0.14202	0.045000	0.18777	0.109000	0.19521	1.684000	0.37649	1.140000	0.42260	0.313000	0.20887	ACA		0.413	CCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254058.2	NM_005201		16	81	1	0	3.99206e-14	0.007413	7.13763e-14	16	81				
NKTR	4820	broad.mit.edu	37	3	42679196	42679196	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:42679196G>A	ENST00000232978.8	+	13	2188	c.2000G>A	c.(1999-2001)aGa>aAa	p.R667K	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	667	Arg/Ser-rich.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		TACCATAAAAGAGAAAAAAAT	0.378																																							uc003clo.2		NA																	0				ovary(2)|skin(1)	3						c.(1999-2001)AGA>AAA		natural killer-tumor recognition sequence							74.0	81.0	79.0					3																	42679196		2201	4299	6500	SO:0001583	missense	4820				protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity	g.chr3:42679196G>A		CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.2000G>A	3.37:g.42679196G>A	ENSP00000232978:p.Arg667Lys					NKTR_uc003clm.1_Missense_Mutation_p.R414K|NKTR_uc003clp.2_Missense_Mutation_p.R414K|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Missense_Mutation_p.R557K|NKTR_uc003clr.1_Missense_Mutation_p.R414K|NKTR_uc003cls.2_Missense_Mutation_p.R367K	p.R667K	NM_005385	NP_005376	P30414	NKTR_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.24)	13	2147	+			667			Arg/Ser-rich.			Missense_Mutation	SNP	ENST00000232978.8	37	c.2000G>A	CCDS2702.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974630	0.34848	.	.	ENSG00000114857	ENST00000232978	T	0.12147	2.71	5.54	5.54	0.83059	.	0.263683	0.32918	N	0.005481	T	0.15046	0.0363	L	0.27053	0.805	0.80722	D	1	D;D	0.57571	0.98;0.966	P;B	0.48840	0.592;0.388	T	0.00695	-1.1606	10	0.54805	T	0.06	-25.7927	13.2036	0.59782	0.0826:0.0:0.9174:0.0	.	367;667	Q6M1B8;P30414	.;NKTR_HUMAN	K	667	ENSP00000232978:R667K	ENSP00000232978:R667K	R	+	2	0	NKTR	42654200	0.998000	0.40836	1.000000	0.80357	0.777000	0.43975	2.241000	0.43097	2.617000	0.88574	0.591000	0.81541	AGA		0.378	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385		10	76	0	0	0	0.006214	0	10	76				
RBM6	10180	broad.mit.edu	37	3	50036934	50036934	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:50036934G>A	ENST00000266022.4	+	6	1804	c.1545G>A	c.(1543-1545)atG>atA	p.M515I	RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000442092.1_Intron|RBM6_ENST00000443081.1_Missense_Mutation_p.M383I|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000422955.1_Intron	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	515	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		TCGGATGCATGGAGGCCAACC	0.433																																							uc003cyc.2		NA																	0				ovary(2)	2						c.(1543-1545)ATG>ATA		RNA binding motif protein 6							182.0	167.0	172.0					3																	50036934		2203	4300	6503	SO:0001583	missense	10180				RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr3:50036934G>A	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1545G>A	3.37:g.50036934G>A	ENSP00000266022:p.Met515Ile					RBM6_uc011bdh.1_Intron|RBM6_uc010hlc.1_Missense_Mutation_p.M34I|RBM6_uc003cyd.2_Intron|RBM6_uc003cye.2_Intron|RBM6_uc011bdi.1_Intron|RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron	p.M515I	NM_005777	NP_005768	P78332	RBM6_HUMAN		BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)	6	1678	+			515			RRM.		O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	37	c.1545G>A	CCDS2809.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605788	0.87157	.	.	ENSG00000004534	ENST00000266022;ENST00000443081	T;T	0.06933	3.24;3.24	6.17	6.17	0.99709	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.155094	0.51477	D	0.000099	T	0.20129	0.0484	L	0.28649	0.875	0.80722	D	1	D;B	0.71674	0.998;0.068	D;B	0.71870	0.975;0.109	T	0.00649	-1.1627	9	.	.	.	-13.0886	20.4745	0.99168	0.0:0.0:1.0:0.0	.	383;515	E9PGM9;P78332	.;RBM6_HUMAN	I	515;383	ENSP00000266022:M515I;ENSP00000396466:M383I	.	M	+	3	0	RBM6	50011938	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.293000	0.96082	2.941000	0.99782	0.655000	0.94253	ATG		0.433	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777		16	95	0	0	0	0.00499	0	16	95				
RBM6	10180	broad.mit.edu	37	3	50112758	50112758	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:50112758G>T	ENST00000266022.4	+	20	3500	c.3241G>T	c.(3241-3243)Gag>Tag	p.E1081*	RBM6_ENST00000442092.1_Nonsense_Mutation_p.E559*|RBM6_ENST00000443081.1_Nonsense_Mutation_p.E949*|RBM6_ENST00000539992.1_Nonsense_Mutation_p.E423*|RBM6_ENST00000422955.1_Nonsense_Mutation_p.E559*|RBM6_ENST00000421682.1_Nonsense_Mutation_p.E77*	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	1081	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E1081Q(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		GGCTTCATCAGAGGAGGTAAA	0.483																																							uc003cyc.2		NA																	1	Substitution - Missense(1)		breast(1)	ovary(2)	2						c.(3241-3243)GAG>TAG		RNA binding motif protein 6							96.0	98.0	98.0					3																	50112758		2203	4300	6503	SO:0001587	stop_gained	10180				RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr3:50112758G>T	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.3241G>T	3.37:g.50112758G>T	ENSP00000266022:p.Glu1081*					RBM6_uc003cyd.2_Nonsense_Mutation_p.E559*|RBM6_uc003cye.2_Nonsense_Mutation_p.E559*|RBM6_uc011bdi.1_Nonsense_Mutation_p.E423*|RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron	p.E1081*	NM_005777	NP_005768	P78332	RBM6_HUMAN		BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)	20	3374	+			1081			G-patch.		O60549|O75524|Q86SS3	Nonsense_Mutation	SNP	ENST00000266022.4	37	c.3241G>T	CCDS2809.1	.	.	.	.	.	.	.	.	.	.	G	42	9.279689	0.99123	.	.	ENSG00000004534	ENST00000442092;ENST00000266022;ENST00000443081;ENST00000539992;ENST00000422955;ENST00000421682	.	.	.	5.62	5.62	0.85841	.	0.169757	0.37623	N	0.002006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.5415	12.1776	0.54194	0.08:0.0:0.92:0.0	.	.	.	.	X	559;1081;949;423;559;77	.	.	E	+	1	0	RBM6	50087762	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.167000	0.42415	2.648000	0.89879	0.650000	0.86243	GAG		0.483	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777		7	69	1	0	1.06961e-07	0.00308	1.54449e-07	7	69				
DOCK3	1795	broad.mit.edu	37	3	51264742	51264742	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:51264742C>T	ENST00000266037.9	+	16	1429	c.1406C>T	c.(1405-1407)cCa>cTa	p.P469L		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	469	DHR-1.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TCAGGAGAGCCAAATAGGAGT	0.468																																							uc011bds.1		NA																	0					0						c.(1405-1407)CCA>CTA		dedicator of cytokinesis 3							171.0	164.0	166.0					3																	51264742		1872	4099	5971	SO:0001583	missense	1795					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr3:51264742C>T	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1406C>T	3.37:g.51264742C>T	ENSP00000266037:p.Pro469Leu						p.P469L	NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)	16	1429	+			469			DHR-1.		O15017	Missense_Mutation	SNP	ENST00000266037.9	37	c.1406C>T	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854327	0.91355	.	.	ENSG00000088538	ENST00000266037	T	0.13657	2.57	6.05	6.05	0.98169	.	0.096430	0.64402	D	0.000001	T	0.43567	0.1253	M	0.83483	2.645	0.80722	D	1	D	0.67145	0.996	D	0.70016	0.967	T	0.11616	-1.0580	10	0.41790	T	0.15	.	20.6013	0.99457	0.0:1.0:0.0:0.0	.	469	Q8IZD9	DOCK3_HUMAN	L	469	ENSP00000266037:P469L	ENSP00000266037:P469L	P	+	2	0	DOCK3	51239782	0.998000	0.40836	0.992000	0.48379	0.993000	0.82548	3.947000	0.56652	2.878000	0.98634	0.650000	0.86243	CCA		0.468	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947		21	135	0	0	0	0.002299	0	21	135				
RAD54L2	23132	broad.mit.edu	37	3	51690031	51690031	+	Missense_Mutation	SNP	G	G	T	rs375539054		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:51690031G>T	ENST00000409535.2	+	19	3196	c.3071G>T	c.(3070-3072)cGt>cTt	p.R1024L	RAD54L2_ENST00000296477.3_Missense_Mutation_p.R718L	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	1024						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GCCAGTGTTCGTCCTGTGCAG	0.507																																							uc011bdt.1		NA																	0				ovary(3)	3						c.(3070-3072)CGT>CTT		RAD54-like 2							157.0	144.0	148.0					3																	51690031		2203	4300	6503	SO:0001583	missense	23132					nucleus	ATP binding|DNA binding|helicase activity	g.chr3:51690031G>T	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.3071G>T	3.37:g.51690031G>T	ENSP00000386520:p.Arg1024Leu					RAD54L2_uc003dbh.2_Missense_Mutation_p.R613L|RAD54L2_uc011bdu.1_Missense_Mutation_p.R718L|RAD54L2_uc003dbj.2_Missense_Mutation_p.R350L	p.R1024L	NM_015106	NP_055921	Q9Y4B4	ARIP4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)	19	3196	+			1024					Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	37	c.3071G>T	CCDS33765.2	.	.	.	.	.	.	.	.	.	.	G	33	5.232618	0.95207	.	.	ENSG00000164080	ENST00000409535;ENST00000296477	D;D	0.94862	-3.46;-3.54	6.04	6.04	0.98038	.	0.051030	0.85682	D	0.000000	D	0.96482	0.8852	L	0.57536	1.79	0.52501	D	0.999955	D;D	0.76494	0.999;0.999	P;D	0.65010	0.907;0.931	D	0.96180	0.9130	10	0.62326	D	0.03	-10.0068	19.583	0.95478	0.0:0.0:1.0:0.0	.	1024;613	Q9Y4B4;B3KV54	ARIP4_HUMAN;.	L	1024;718	ENSP00000386520:R1024L;ENSP00000296477:R718L	ENSP00000296477:R718L	R	+	2	0	RAD54L2	51665071	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.597000	0.82733	2.873000	0.98535	0.563000	0.77884	CGT		0.507	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106		24	123	1	0	5.45024e-15	0.00333	9.9003e-15	24	123				
PXK	54899	broad.mit.edu	37	3	58385031	58385031	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:58385031G>T	ENST00000356151.2	+	12	1217	c.1108G>T	c.(1108-1110)Gtg>Ttg	p.V370L	PXK_ENST00000383715.4_Missense_Mutation_p.V353L|PXK_ENST00000536660.1_Missense_Mutation_p.V233L|PXK_ENST00000479241.1_Missense_Mutation_p.V353L|PXK_ENST00000484288.1_Missense_Mutation_p.V370L|PXK_ENST00000383716.3_Missense_Mutation_p.V337L|PXK_ENST00000463280.1_Missense_Mutation_p.V337L|PXK_ENST00000302779.5_Missense_Mutation_p.V353L	NM_017771.3	NP_060241.2			PX domain containing serine/threonine kinase											cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		TCAAGTGGCCGTGTTGGAGTC	0.438																																							uc003djz.1		NA																	0				ovary(1)	1						c.(1108-1110)GTG>TTG		PX domain containing serine/threonine kinase							198.0	166.0	177.0					3																	58385031		2203	4300	6503	SO:0001583	missense	54899				cell communication|inflammatory response|negative regulation of ATPase activity|negative regulation of ion transport|regulation of synaptic transmission	centrosome|cytoplasm|nucleus|plasma membrane	actin binding|ATP binding|phosphatidylinositol binding|phosphatidylinositol binding|protein C-terminus binding|protein kinase activity	g.chr3:58385031G>T	AY274811	CCDS2889.1, CCDS74952.1, CCDS74954.1, CCDS74955.1	3p21.2	2008-02-05			ENSG00000168297	ENSG00000168297			23326	protein-coding gene	gene with protein product		611450					Standard	XM_005265255		Approved	FLJ20335	uc003djz.1	Q7Z7A4	OTTHUMG00000159149	ENST00000356151.2:c.1108G>T	3.37:g.58385031G>T	ENSP00000348472:p.Val370Leu					PXK_uc003djx.1_Missense_Mutation_p.V370L|PXK_uc003djy.1_Missense_Mutation_p.V353L|PXK_uc003dka.1_Missense_Mutation_p.V370L|PXK_uc003dkb.1_Missense_Mutation_p.V287L|PXK_uc003dkc.1_Missense_Mutation_p.V353L|PXK_uc011bfe.1_Missense_Mutation_p.V337L|PXK_uc010hnj.1_Missense_Mutation_p.V337L|PXK_uc003dkd.1_Missense_Mutation_p.V233L|PXK_uc010hnk.1_Missense_Mutation_p.V144L	p.V370L	NM_017771	NP_060241	Q7Z7A4	PXK_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)	12	1207	+			370			Protein kinase.			Missense_Mutation	SNP	ENST00000356151.2	37	c.1108G>T	CCDS2889.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.853253	0.32699	.	.	ENSG00000168297	ENST00000356151;ENST00000302779;ENST00000383716;ENST00000463280;ENST00000383715;ENST00000484288;ENST00000479241;ENST00000536660;ENST00000536750	T;T;T;T;T;T;T;T	0.27557	2.6;2.57;2.59;1.7;1.68;1.7;1.66;2.52	5.87	5.87	0.94306	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43033	0.1229	L	0.33668	1.02	0.80722	D	1	D;B;D;P;B;B	0.76494	0.999;0.239;0.999;0.516;0.401;0.052	D;B;D;B;B;B	0.85130	0.996;0.069;0.997;0.182;0.069;0.04	T	0.05162	-1.0902	10	0.02654	T	1	-15.6192	20.5827	0.99408	0.0:0.0:1.0:0.0	.	337;337;337;370;353;370	E9PD56;Q7Z7A4-6;B4DID9;Q7Z7A4;Q7Z7A4-4;Q7Z7A4-2	.;.;.;PXK_HUMAN;.;.	L	370;353;337;337;353;370;353;233;233	ENSP00000348472:V370L;ENSP00000305045:V353L;ENSP00000373222:V337L;ENSP00000417903:V337L;ENSP00000373221:V353L;ENSP00000417915:V370L;ENSP00000419049:V353L;ENSP00000438356:V233L	ENSP00000305045:V353L	V	+	1	0	PXK	58360071	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.069000	0.89491	2.941000	0.99782	0.655000	0.94253	GTG		0.438	PXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353499.1	NM_017771		6	31	1	0	3.59834e-05	0.001168	4.47662e-05	6	31				
CADPS	8618	broad.mit.edu	37	3	62636563	62636563	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:62636563G>T	ENST00000383710.4	-	5	1511	c.1162C>A	c.(1162-1164)Cag>Aag	p.Q388K	CADPS_ENST00000490353.2_Missense_Mutation_p.Q388K|CADPS_ENST00000283269.9_Missense_Mutation_p.Q388K|CADPS_ENST00000357948.3_Missense_Mutation_p.Q388K	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	388					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TTGGAGAGCTGGTTCTCACTC	0.517																																							uc003dll.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1162-1164)CAG>AAG		Ca2+-dependent secretion activator isoform 1							118.0	103.0	108.0					3																	62636563		2203	4300	6503	SO:0001583	missense	8618				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding	g.chr3:62636563G>T	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.1162C>A	3.37:g.62636563G>T	ENSP00000373215:p.Gln388Lys					CADPS_uc003dlm.2_Missense_Mutation_p.Q388K|CADPS_uc003dln.2_Missense_Mutation_p.Q388K	p.Q388K	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)	5	1522	-		Lung SC(41;0.0452)	388					A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	c.1162C>A	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.709724	0.48517	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	T;T;T;T	0.43294	0.96;0.97;0.97;0.95	6.03	6.03	0.97812	.	0.122334	0.56097	D	0.000026	T	0.44414	0.1292	L	0.47716	1.5	0.50632	D	0.999888	P;B;B	0.36412	0.552;0.152;0.081	B;B;B	0.38428	0.273;0.058;0.014	T	0.23583	-1.0184	10	0.44086	T	0.13	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	388;388;388	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	K	388	ENSP00000373215:Q388K;ENSP00000350632:Q388K;ENSP00000283269:Q388K;ENSP00000418736:Q388K	ENSP00000283269:Q388K	Q	-	1	0	CADPS	62611603	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.286000	0.72665	2.861000	0.98227	0.655000	0.94253	CAG		0.517	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394		8	52	1	0	1.76689e-08	0.006214	2.62345e-08	8	52				
KBTBD8	84541	broad.mit.edu	37	3	67054223	67054223	+	Nonsense_Mutation	SNP	C	C	T	rs371508471		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:67054223C>T	ENST00000417314.2	+	3	881	c.832C>T	c.(832-834)Cag>Tag	p.Q278*	KBTBD8_ENST00000295568.4_Nonsense_Mutation_p.Q252*|KBTBD8_ENST00000469661.1_3'UTR|KBTBD8_ENST00000460576.1_Intron			Q8NFY9	KBTB8_HUMAN	kelch repeat and BTB (POZ) domain containing 8	278						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)	20		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		TGGCTGTACACAGAGGCTTGG	0.428																																							uc003dmy.2		NA																	0				ovary(2)|large_intestine(1)|breast(1)	4						c.(832-834)CAG>TAG		T-cell activation kelch repeat protein							111.0	110.0	110.0					3																	67054223		2203	4300	6503	SO:0001587	stop_gained	84541							g.chr3:67054223C>T	AF385438	CCDS2906.1, CCDS2906.2	3p14	2013-01-08			ENSG00000163376	ENSG00000163376		"""BTB/POZ domain containing"""	30691	protein-coding gene	gene with protein product	"""T-cell activation kelch repeat protein"""					11347906	Standard	NM_032505		Approved	TA-KRP, KIAA1842	uc003dmy.3	Q8NFY9	OTTHUMG00000158779	ENST00000417314.2:c.832C>T	3.37:g.67054223C>T	ENSP00000401878:p.Gln278*					KBTBD8_uc011bfv.1_Intron	p.Q278*	NM_032505	NP_115894	Q8NFY9	KBTB8_HUMAN		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)	3	885	+		Lung NSC(201;0.0765)	278					B4DTW6|Q96JI5	Nonsense_Mutation	SNP	ENST00000417314.2	37	c.832C>T	CCDS2906.2	.	.	.	.	.	.	.	.	.	.	C	22.5	4.296363	0.81025	.	.	ENSG00000163376	ENST00000295568;ENST00000417314	.	.	.	4.58	4.58	0.56647	.	40.644100	0.01377	N	0.012790	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	17.7233	0.88358	0.0:1.0:0.0:0.0	.	.	.	.	X	252;278	.	ENSP00000295568:Q252X	Q	+	1	0	KBTBD8	67136913	1.000000	0.71417	0.998000	0.56505	0.939000	0.58152	7.706000	0.84615	2.228000	0.72767	0.557000	0.71058	CAG		0.428	KBTBD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352189.1	NM_032505		23	101	0	0	0	0.00333	0	23	101				
FAM86DP	692099	broad.mit.edu	37	3	75476773	75476773	+	RNA	SNP	C	C	T	rs188081472	byFrequency	TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:75476773C>T	ENST00000459803.1	-	0	583					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		AAGATGAATGCCCGGGGGCGG	0.587													.|||	7	0.00139776	0.0053	0.0	5008	,	,		19657	0.0		0.0	False		,,,				2504	0.0						uc003dpp.3		NA																	0					0						c.(292-294)GCA>ACA		RecName: Full=Protein FAM86B1;																																						692099							g.chr3:75476773C>T	BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75476773C>T						FAM86D_uc003dpo.3_Intron|FAM86D_uc003dps.3_Intron|FAM86D_uc003dpq.3_Missense_Mutation_p.A6T|FAM86D_uc003dpr.3_Intron	p.A98T	NR_024241						6	651	-									Missense_Mutation	SNP	ENST00000459803.1	37	c.292G>A																																																																																					0.587	FAM86DP-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000352425.1	NR_024241		8	32	0	0	0	0.00308	0	8	32				
CLDND1	56650	broad.mit.edu	37	3	98237790	98237790	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:98237790C>A	ENST00000503004.1	-	3	1221	c.342G>T	c.(340-342)caG>caT	p.Q114H	CLDND1_ENST00000341181.6_Missense_Mutation_p.Q114H|CLDND1_ENST00000502288.1_Missense_Mutation_p.Q19H|CLDND1_ENST00000394181.2_Missense_Mutation_p.Q114H|CLDND1_ENST00000513287.1_Missense_Mutation_p.Q114H|CLDND1_ENST00000510545.1_Missense_Mutation_p.Q114H|CLDND1_ENST00000508503.1_5'UTR|CLDND1_ENST00000437922.1_Missense_Mutation_p.Q137H|CLDND1_ENST00000511081.1_Missense_Mutation_p.Q19H|CLDND1_ENST00000507874.1_Missense_Mutation_p.Q114H|CLDND1_ENST00000394180.2_Missense_Mutation_p.Q114H|CLDND1_ENST00000394185.2_Missense_Mutation_p.Q114H			Q9NY35	CLDN1_HUMAN	claudin domain containing 1	114						apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	9						TCTCCATGAACTGCTCAGTTA	0.388																																							uc003dsp.2		NA																	0				ovary(1)	1						c.(340-342)CAG>CAT		claudin domain containing 1 protein isoform a							90.0	84.0	86.0					3																	98237790		2203	4300	6503	SO:0001583	missense	56650					integral to membrane		g.chr3:98237790C>A	AF116664	CCDS2930.1, CCDS43116.1	3q12.1	2005-12-23	2005-12-23	2005-12-23		ENSG00000080822			1322	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 4"""	C3orf4			Standard	NM_001040181		Approved		uc003dst.3	Q9NY35		ENST00000503004.1:c.342G>T	3.37:g.98237790C>A	ENSP00000421226:p.Gln114His					CLDND1_uc003dso.2_Missense_Mutation_p.Q114H|CLDND1_uc003dsq.2_Missense_Mutation_p.Q114H|CLDND1_uc003dss.2_Missense_Mutation_p.Q114H|CLDND1_uc003dsr.2_Missense_Mutation_p.Q19H|CLDND1_uc003dst.2_Missense_Mutation_p.Q137H|CLDND1_uc003dsu.2_Missense_Mutation_p.Q114H|CLDND1_uc003dsv.2_Missense_Mutation_p.Q114H	p.Q114H	NM_019895	NP_063948	Q9NY35	CLDN1_HUMAN			3	1222	-			114					B3KQR1|D3DN36|F2Z2D9|Q502Y8|Q6UVX2|Q9BUZ9|Q9NZZ5|Q9Y4S9	Missense_Mutation	SNP	ENST00000503004.1	37	c.342G>T	CCDS2930.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.110940	0.77210	.	.	ENSG00000080822	ENST00000502288;ENST00000507874;ENST00000341181;ENST00000437922;ENST00000394180;ENST00000506885;ENST00000503004;ENST00000394185;ENST00000394181;ENST00000510545;ENST00000511081;ENST00000513287;ENST00000511667;ENST00000513452;ENST00000502299;ENST00000508902;ENST00000514537;ENST00000515620;ENST00000507944;ENST00000508659;ENST00000503621;ENST00000508071	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.42900	1.73;1.71;1.73;1.73;1.73;1.73;1.73;1.05;1.73;0.96;1.74;1.68;1.69;1.24	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.64983	0.2648	M	0.71581	2.175	0.80722	D	1	D;D;D;P	0.69078	0.997;0.996;0.997;0.95	D;D;D;P	0.85130	0.997;0.992;0.997;0.824	T	0.67094	-0.5757	10	0.66056	D	0.02	-8.5812	16.9188	0.86158	0.0:1.0:0.0:0.0	.	114;19;114;114	D6RCR8;F2Z2D9;Q9NY35;Q9NY35-2	.;.;CLDN1_HUMAN;.	H	19;114;114;137;114;67;114;114;114;114;19;114;92;114;114;114;114;114;114;114;92;114	ENSP00000340247:Q114H;ENSP00000388457:Q137H;ENSP00000377734:Q114H;ENSP00000421226:Q114H;ENSP00000377739:Q114H;ENSP00000377735:Q114H;ENSP00000423590:Q114H;ENSP00000424669:Q19H;ENSP00000426869:Q114H;ENSP00000423732:Q92H;ENSP00000425539:Q114H;ENSP00000420913:Q114H;ENSP00000421413:Q114H;ENSP00000423151:Q114H	ENSP00000340247:Q114H	Q	-	3	2	CLDND1	99720480	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.395000	0.44459	2.584000	0.87258	0.563000	0.77884	CAG		0.388	CLDND1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359071.1	NM_019895		5	33	1	0	5.18039e-06	0.00308	6.89709e-06	5	33				
NXPE3	91775	broad.mit.edu	37	3	101540739	101540739	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:101540739G>T	ENST00000491511.2	+	8	2577	c.1621G>T	c.(1621-1623)Gtt>Ttt	p.V541F	NXPE3_ENST00000422132.1_Missense_Mutation_p.V541F|NXPE3_ENST00000477909.1_Missense_Mutation_p.V541F|NXPE3_ENST00000273347.5_Missense_Mutation_p.V541F|RP11-49I4.3_ENST00000490324.2_RNA	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	541						extracellular region (GO:0005576)											TCCAGATGAAGTTATTGTGAA	0.498																																							uc003dvn.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(1621-1623)GTT>TTT		hypothetical protein LOC91775 precursor							103.0	87.0	92.0					3																	101540739		2203	4300	6503	SO:0001583	missense	91775					extracellular region		g.chr3:101540739G>T	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.1621G>T	3.37:g.101540739G>T	ENSP00000417485:p.Val541Phe					FAM55C_uc010hpn.2_Missense_Mutation_p.V541F	p.V541F	NM_145037	NP_659474	Q969Y0	FA55C_HUMAN			8	2258	+			541					A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	c.1621G>T	CCDS2945.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872565	0.51695	.	.	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	6.03	4.18	0.49190	.	0.476861	0.25361	N	0.031236	T	0.23727	0.0574	L	0.61218	1.895	0.37835	D	0.928855	P	0.39717	0.684	B	0.36186	0.219	T	0.08513	-1.0718	10	0.31617	T	0.26	-6.1188	8.5921	0.33693	0.3142:0.0:0.6858:0.0	.	541	Q969Y0	FA55C_HUMAN	F	541	ENSP00000273347:V541F;ENSP00000417485:V541F;ENSP00000418369:V541F;ENSP00000396421:V541F	ENSP00000273347:V541F	V	+	1	0	FAM55C	103023429	0.818000	0.29161	1.000000	0.80357	0.997000	0.91878	0.809000	0.27168	0.806000	0.34183	0.655000	0.94253	GTT		0.498	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037		18	77	1	0	8.00594e-06	0.007413	1.05561e-05	18	77				
TIMMDC1	51300	broad.mit.edu	37	3	119236073	119236073	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:119236073G>A	ENST00000494664.1	+	6	820	c.618G>A	c.(616-618)ctG>ctA	p.L206L	TIMMDC1_ENST00000493694.1_Silent_p.L72L	NM_016589.3	NP_057673.2	Q9NPL8	TIDC1_HUMAN	translocase of inner mitochondrial membrane domain containing 1	206						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	15						GAGGCCTGCTGATGGCATTTC	0.453																																							uc003ecn.2		NA																	0					0						c.(616-618)CTG>CTA		hypothetical protein LOC51300							102.0	106.0	105.0					3																	119236073		2203	4300	6503	SO:0001819	synonymous_variant	51300					integral to membrane|mitochondrial inner membrane	protein transporter activity	g.chr3:119236073G>A	AF210057	CCDS33831.1	3q13.33	2013-12-05	2011-07-05	2011-07-05	ENSG00000113845	ENSG00000113845			1321	protein-coding gene	gene with protein product		615534	"""chromosome 3 open reading frame 1"""	C3orf1		11092749	Standard	NM_016589		Approved	FLJ22597	uc003ecn.3	Q9NPL8	OTTHUMG00000159388	ENST00000494664.1:c.618G>A	3.37:g.119236073G>A						C3orf1_uc003eco.2_RNA|C3orf1_uc003ecp.2_RNA	p.L206L	NM_016589	NP_057673	Q9NPL8	TIDC1_HUMAN		GBM - Glioblastoma multiforme(114;0.186)	6	831	+			206			Helical; (Potential).		D3DN81|Q6IAJ7|Q6UWU6|Q9NPR3|Q9NPS5|Q9P0Y6	Silent	SNP	ENST00000494664.1	37	c.618G>A	CCDS33831.1																																																																																				0.453	TIMMDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355077.3	NM_016589		5	76	0	0	0	0.001168	0	5	76				
ARGFX	503582	broad.mit.edu	37	3	121289635	121289635	+	Silent	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:121289635G>C	ENST00000334384.3	+	1	85	c.75G>C	c.(73-75)gtG>gtC	p.V25V		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	25					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		ACATGAAGGTGATACCACCAC	0.463																																							uc003eef.2		NA																	0				skin(2)|ovary(1)	3						c.(73-75)GTG>GTC		arginine-fifty homeobox							106.0	94.0	98.0					3																	121289635		2203	4300	6503	SO:0001819	synonymous_variant	503582					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr3:121289635G>C		CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.75G>C	3.37:g.121289635G>C							p.V25V	NM_001012659	NP_001012677	A6NJG6	ARGFX_HUMAN		GBM - Glioblastoma multiforme(114;0.152)	2	170	+			25						Silent	SNP	ENST00000334384.3	37	c.75G>C	CCDS33834.1																																																																																				0.463	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355096.2	NM_001012659		6	88	0	0	0	0.001168	0	6	88				
FBXO40	51725	broad.mit.edu	37	3	121341065	121341065	+	Silent	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:121341065T>C	ENST00000338040.4	+	3	1203	c.789T>C	c.(787-789)gcT>gcC	p.A263A		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	263					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		GAGAGGGCGCTCCCAAAAAGA	0.483																																							uc003eeg.2		NA																	0				ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(787-789)GCT>GCC		F-box protein 40							70.0	76.0	74.0					3																	121341065		2203	4300	6503	SO:0001819	synonymous_variant	51725				muscle cell differentiation	centrosome|nucleus	ubiquitin-protein ligase activity|zinc ion binding	g.chr3:121341065T>C	AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.789T>C	3.37:g.121341065T>C							p.A263A	NM_016298	NP_057382	Q9UH90	FBX40_HUMAN		GBM - Glioblastoma multiforme(114;0.189)	3	999	+			263					B2RAX7|Q32M70|Q9ULM5	Silent	SNP	ENST00000338040.4	37	c.789T>C	CCDS33835.1																																																																																				0.483	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	NM_016298		10	34	0	0	0	0.006214	0	10	34				
GOLGB1	2804	broad.mit.edu	37	3	121413027	121413027	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:121413027C>T	ENST00000340645.5	-	13	6453	c.6328G>A	c.(6328-6330)Gaa>Aaa	p.E2110K	GOLGB1_ENST00000393667.3_Missense_Mutation_p.E2115K	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2110					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TTAACTGATTCTTTATTTGAC	0.403																																							uc003eei.3		NA																	0				ovary(6)|breast(2)|skin(2)	10						c.(6328-6330)GAA>AAA		golgi autoantigen, golgin subfamily b,							170.0	174.0	173.0					3																	121413027		2203	4300	6503	SO:0001583	missense	2804				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding	g.chr3:121413027C>T	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.6328G>A	3.37:g.121413027C>T	ENSP00000341848:p.Glu2110Lys					GOLGB1_uc010hrc.2_Missense_Mutation_p.E2115K|GOLGB1_uc003eej.3_Missense_Mutation_p.E2076K|GOLGB1_uc011bjm.1_Missense_Mutation_p.E1996K|GOLGB1_uc010hrd.1_Missense_Mutation_p.E2074K	p.E2110K	NM_004487	NP_004478	Q14789	GOGB1_HUMAN		GBM - Glioblastoma multiforme(114;0.0989)	13	6454	-			2110			Cytoplasmic (Potential).|Potential.		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	c.6328G>A	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341444	0.60963	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.17528	2.27;2.27	5.93	5.93	0.95920	.	0.091409	0.47455	D	0.000234	T	0.40015	0.1100	M	0.71581	2.175	0.58432	D	0.999994	D;P;P;D	0.76494	0.998;0.873;0.873;0.999	D;P;P;D	0.80764	0.994;0.523;0.523;0.925	T	0.06552	-1.0820	10	0.12766	T	0.61	.	17.8272	0.88669	0.0:1.0:0.0:0.0	.	2035;2115;2115;2110	F1T0J2;E7EP74;B2ZZ91;Q14789	.;.;.;GOGB1_HUMAN	K	2110;2115	ENSP00000341848:E2110K;ENSP00000377275:E2115K	ENSP00000341848:E2110K	E	-	1	0	GOLGB1	122895717	1.000000	0.71417	0.959000	0.39883	0.997000	0.91878	5.954000	0.70298	2.818000	0.97014	0.591000	0.81541	GAA		0.403	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487		11	195	0	0	0	0.001368	0	11	195				
ADCY5	111	broad.mit.edu	37	3	123049747	123049747	+	Silent	SNP	G	G	T	rs144214981	byFrequency	TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:123049747G>T	ENST00000462833.1	-	5	2847	c.1635C>A	c.(1633-1635)atC>atA	p.I545I	ADCY5_ENST00000309879.5_Silent_p.I195I|ADCY5_ENST00000491190.1_Silent_p.I178I	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	545	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		AGATGGCCTCGATCATGTCCA	0.602																																							uc003egh.1		NA																	0				ovary(4)	4						c.(1633-1635)ATC>ATA		adenylate cyclase 5							92.0	75.0	81.0					3																	123049747		2203	4300	6503	SO:0001819	synonymous_variant	111				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding	g.chr3:123049747G>T	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1635C>A	3.37:g.123049747G>T						ADCY5_uc003egg.1_Silent_p.I178I|ADCY5_uc003egi.1_Silent_p.I104I	p.I545I	NM_183357	NP_899200	O95622	ADCY5_HUMAN		GBM - Glioblastoma multiforme(114;0.0342)	5	1635	-			545			Guanylate cyclase 1.|Cytoplasmic (Potential).		B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	ENST00000462833.1	37	c.1635C>A	CCDS3022.1																																																																																				0.602	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048		8	25	1	0	2.17888e-05	0.006214	2.75588e-05	8	25				
ISY1	57461	broad.mit.edu	37	3	128852984	128852984	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:128852984C>T	ENST00000393295.3	-	9	913	c.596G>A	c.(595-597)aGa>aAa	p.R199K	ISY1_ENST00000471497.1_Intron|ISY1-RAB43_ENST00000418265.1_Missense_Mutation_p.R199K|ISY1_ENST00000393292.3_Silent_p.K200K|ISY1_ENST00000273541.8_Missense_Mutation_p.R221K	NM_001199469.1|NM_020701.3	NP_001186398.1|NP_065752.1	Q9ULR0	ISY1_HUMAN	ISY1 splicing factor homolog (S. cerevisiae)	199					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|skin(1)	15						ctTTTCTCCTCTTGCCAGCCG	0.512																																							uc003elo.1		NA																	0				lung(1)	1						c.(595-597)AGA>AAA		ISY1 splicing factor homolog							105.0	108.0	107.0					3																	128852984		1982	4174	6156	SO:0001583	missense	339122				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding	g.chr3:128852984C>T		CCDS43149.1, CCDS56277.1	3q21.3	2008-11-25			ENSG00000240682	ENSG00000240682			29201	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 33"""	612764				16103217	Standard	NM_020701		Approved	KIAA1160, fSAP33		Q9ULR0	OTTHUMG00000137365	ENST00000393295.3:c.596G>A	3.37:g.128852984C>T	ENSP00000376973:p.Arg199Lys					ISY1_uc010hsz.1_Intron|ISY1_uc003elp.1_Missense_Mutation_p.R199K|ISY1_uc010hta.1_Missense_Mutation_p.R221K	p.R199K	NM_020701	NP_065752	Q86YS6	RAB43_HUMAN			9	807	-			Error:Variant_position_missing_in_Q86YS6_after_alignment					Q96IL2|Q9BT05	Missense_Mutation	SNP	ENST00000393295.3	37	c.596G>A	CCDS43149.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.046432	0.36085	.	.	ENSG00000240682	ENST00000418265;ENST00000393295;ENST00000273541	T	0.28255	1.62	5.64	3.82	0.43975	.	0.176776	0.50627	D	0.000112	T	0.15392	0.0371	N	0.17474	0.49	0.80722	D	1	B;B;B	0.15473	0.004;0.013;0.003	B;B;B	0.22386	0.01;0.039;0.008	T	0.06734	-1.0810	10	0.05833	T	0.94	-46.5129	8.8832	0.35387	0.0:0.8227:0.0:0.1773	.	221;199;199	Q9ULR0-2;Q9ULR0;Q9ULR0-1	.;ISY1_HUMAN;.	K	199;199;221	ENSP00000273541:R221K	ENSP00000273541:R221K	R	-	2	0	ISY1	130335674	0.973000	0.33851	1.000000	0.80357	0.991000	0.79684	1.789000	0.38724	1.371000	0.46172	0.585000	0.79938	AGA		0.512	ISY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267856.1	NM_020701		8	75	0	0	0	0.004482	0	8	75				
EPHB1	2047	broad.mit.edu	37	3	134968224	134968224	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:134968224T>A	ENST00000398015.3	+	15	3107	c.2737T>A	c.(2737-2739)Ttt>Att	p.F913I	EPHB1_ENST00000493838.1_Missense_Mutation_p.F474I	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	913	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						CTTCACGGCCTTTACCACCGT	0.587																																							uc003eqt.2		NA																	0				lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						c.(2737-2739)TTT>ATT		ephrin receptor EphB1 precursor							85.0	87.0	86.0					3																	134968224		2087	4218	6305	SO:0001583	missense	2047					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding	g.chr3:134968224T>A	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.2737T>A	3.37:g.134968224T>A	ENSP00000381097:p.Phe913Ile					EPHB1_uc003equ.2_Missense_Mutation_p.F474I	p.F913I	NM_004441	NP_004432	P54762	EPHB1_HUMAN			15	2957	+			913			Cytoplasmic (Potential).|SAM.		A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	c.2737T>A	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	T	33	5.290192	0.95546	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.51574	0.7;0.7	5.43	5.43	0.79202	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.106284	0.64402	D	0.000004	T	0.51244	0.1663	M	0.72118	2.19	0.80722	D	1	P	0.35684	0.515	B	0.36608	0.229	T	0.57900	-0.7731	10	0.72032	D	0.01	.	15.65	0.77084	0.0:0.0:0.0:1.0	.	913	P54762	EPHB1_HUMAN	I	913;474	ENSP00000381097:F913I;ENSP00000419574:F474I	ENSP00000381097:F913I	F	+	1	0	EPHB1	136450914	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.825000	0.86693	2.281000	0.76405	0.528000	0.53228	TTT		0.587	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441		14	50	0	0	0	0.00245	0	14	50				
MSL2	55167	broad.mit.edu	37	3	135870369	135870369	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:135870369C>A	ENST00000309993.2	-	2	2086	c.1354G>T	c.(1354-1356)Gtg>Ttg	p.V452L	MSL2_ENST00000434835.2_Missense_Mutation_p.V378L	NM_018133.3	NP_060603.2	Q9HCI7	MSL2_HUMAN	male-specific lethal 2 homolog (Drosophila)	452	Lys-rich.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	18						TTTTTGTACACAGTCTTGGTA	0.428																																							uc003eqx.1		NA																	0				central_nervous_system(1)	1						c.(1354-1356)GTG>TTG		ring finger protein 184 isoform 1							85.0	88.0	87.0					3																	135870369		2203	4300	6503	SO:0001583	missense	55167				histone H4-K16 acetylation	MSL complex	zinc ion binding	g.chr3:135870369C>A	AK001408	CCDS33861.1, CCDS46922.1	3q22.2	2008-10-29	2008-10-29	2008-10-29	ENSG00000174579	ENSG00000174579		"""RING-type (C3HC4) zinc fingers"""	25544	protein-coding gene	gene with protein product	"""male-specific lethal-2 homolog (Drosophila)"""	614802	"""ring finger protein 184"", ""male-specific lethal 2-like 1 (Drosophila)"""	RNF184, MSL2L1		16227571, 16543150	Standard	NM_018133		Approved	FLJ10546, KIAA1585, msl-2	uc003eqx.1	Q9HCI7	OTTHUMG00000159793	ENST00000309993.2:c.1354G>T	3.37:g.135870369C>A	ENSP00000311827:p.Val452Leu					MSL2_uc011bmb.1_Missense_Mutation_p.V378L	p.V452L	NM_018133	NP_060603	Q9HCI7	MSL2_HUMAN			2	2087	-			452			Lys-rich.		B4DYL4|G5E9I1|Q0D2P1|Q8NDB4|Q9NVS4	Missense_Mutation	SNP	ENST00000309993.2	37	c.1354G>T	CCDS33861.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.418494	0.25552	.	.	ENSG00000174579	ENST00000309993;ENST00000434835	.	.	.	5.86	4.99	0.66335	.	0.205916	0.41194	D	0.000926	T	0.46171	0.1379	L	0.33485	1.01	0.45704	D	0.998612	B	0.28178	0.202	B	0.31614	0.133	T	0.32666	-0.9898	9	0.11182	T	0.66	-1.165	14.2445	0.65978	0.0:0.9287:0.0:0.0713	.	452	Q9HCI7	MSL2_HUMAN	L	452;378	.	ENSP00000311827:V452L	V	-	1	0	MSL2	137353059	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.920000	0.70017	1.480000	0.48289	0.563000	0.77884	GTG		0.428	MSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357347.1	NM_018133		16	104	1	0	2.35188e-11	0.006122	3.87069e-11	16	104				
STAG1	10274	broad.mit.edu	37	3	136141303	136141303	+	Missense_Mutation	SNP	A	A	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:136141303A>C	ENST00000383202.2	-	19	2242	c.1986T>G	c.(1984-1986)atT>atG	p.I662M	STAG1_ENST00000536929.1_Missense_Mutation_p.I246M|STAG1_ENST00000434713.2_Missense_Mutation_p.I436M|STAG1_ENST00000236698.5_Missense_Mutation_p.I662M	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	662					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						CAAACTCATCAATCAGCTGGC	0.358																																							uc003era.1		NA																	0				ovary(2)	2						c.(1984-1986)ATT>ATG		stromal antigen 1							125.0	122.0	123.0					3																	136141303		2203	4300	6503	SO:0001583	missense	10274				cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding	g.chr3:136141303A>C	Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.1986T>G	3.37:g.136141303A>C	ENSP00000372689:p.Ile662Met					STAG1_uc003erb.1_Missense_Mutation_p.I662M|STAG1_uc003erc.1_Missense_Mutation_p.I436M|STAG1_uc010hua.1_Missense_Mutation_p.I525M	p.I662M	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN			19	2278	-			662					O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	c.1986T>G	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	A	18.63	3.664845	0.67700	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	T;T;T;T	0.34667	1.77;1.78;1.81;1.35	5.65	4.37	0.52481	Armadillo-type fold (1);	0.099877	0.64402	D	0.000004	T	0.38081	0.1027	L	0.55103	1.725	0.58432	D	0.999999	B;P;B	0.48640	0.114;0.913;0.114	B;P;B	0.45232	0.065;0.474;0.065	T	0.25916	-1.0118	10	0.45353	T	0.12	.	13.1044	0.59239	0.8721:0.0:0.0:0.1279	.	679;662;662	Q4LE48;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	M	662;662;436;246	ENSP00000372689:I662M;ENSP00000236698:I662M;ENSP00000404396:I436M;ENSP00000445787:I246M	ENSP00000236698:I662M	I	-	3	3	STAG1	137623993	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.927000	0.48900	2.156000	0.67533	0.524000	0.50904	ATT		0.358	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862		22	72	0	0	0	0.001882	0	22	72				
SLC9A9	285195	broad.mit.edu	37	3	143082363	143082363	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:143082363C>A	ENST00000316549.6	-	14	1775	c.1567G>T	c.(1567-1569)Gct>Tct	p.A523S		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	523					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						AAGAGCCGAGCACTCTCTGCT	0.373																																							uc003evn.2		NA																	0				ovary(2)|skin(1)	3						c.(1567-1569)GCT>TCT		solute carrier family 9 (sodium/hydrogen							154.0	146.0	149.0					3																	143082363		2203	4300	6503	SO:0001583	missense	285195				regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity	g.chr3:143082363C>A	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.1567G>T	3.37:g.143082363C>A	ENSP00000320246:p.Ala523Ser						p.A523S	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN			14	1749	-			523					A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	37	c.1567G>T	CCDS33872.1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.085465	0.55861	.	.	ENSG00000181804	ENST00000316549	T	0.56941	0.43	5.71	5.71	0.89125	.	0.228737	0.37761	N	0.001952	T	0.52709	0.1751	M	0.63428	1.95	0.58432	D	0.999993	P	0.34522	0.455	B	0.33392	0.163	T	0.48758	-0.9007	10	0.23302	T	0.38	.	19.8677	0.96824	0.0:1.0:0.0:0.0	.	523	Q8IVB4	SL9A9_HUMAN	S	523	ENSP00000320246:A523S	ENSP00000320246:A523S	A	-	1	0	SLC9A9	144565053	1.000000	0.71417	0.674000	0.29902	0.561000	0.35649	5.506000	0.66993	2.709000	0.92574	0.655000	0.94253	GCT		0.373	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653		19	80	1	0	4.35082e-09	0.010504	6.69281e-09	19	80				
SLC9A9	285195	broad.mit.edu	37	3	143292936	143292936	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:143292936G>T	ENST00000316549.6	-	8	1202	c.994C>A	c.(994-996)Cta>Ata	p.L332I		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	332					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						TGACCTGTTAGGCCGGCAGCC	0.537																																							uc003evn.2		NA																	0				ovary(2)|skin(1)	3						c.(994-996)CTA>ATA		solute carrier family 9 (sodium/hydrogen							49.0	48.0	48.0					3																	143292936		2203	4300	6503	SO:0001583	missense	285195				regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity	g.chr3:143292936G>T	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.994C>A	3.37:g.143292936G>T	ENSP00000320246:p.Leu332Ile						p.L332I	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN			8	1176	-			332			Helical; (Potential).		A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	37	c.994C>A	CCDS33872.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260039	0.80246	.	.	ENSG00000181804	ENST00000316549;ENST00000450105	T	0.18338	2.22	5.39	4.5	0.54988	Cation/H+ exchanger (1);	0.000000	0.52532	D	0.000070	T	0.39489	0.1080	M	0.76938	2.355	0.53688	D	0.999977	D	0.61080	0.989	P	0.62298	0.9	T	0.34229	-0.9837	10	0.66056	D	0.02	.	13.1215	0.59329	0.0782:0.0:0.9218:0.0	.	332	Q8IVB4	SL9A9_HUMAN	I	332;215	ENSP00000320246:L332I	ENSP00000320246:L332I	L	-	1	2	SLC9A9	144775626	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.003000	0.63959	1.243000	0.43853	0.563000	0.77884	CTA		0.537	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653		14	41	1	0	2.23348e-06	0.004007	3.00289e-06	14	41				
MFSD1	64747	broad.mit.edu	37	3	158537491	158537491	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:158537491G>T	ENST00000264266.8	+	8	768	c.706G>T	c.(706-708)Gat>Tat	p.D236Y	MFSD1_ENST00000415822.2_Missense_Mutation_p.D285Y|MFSD1_ENST00000392813.4_Missense_Mutation_p.D246Y			Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing 1	236					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	26			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TGCCTACTTGGATCAGAGAGC	0.358																																					Pancreas(62;1186 1654 36636 37908)	Pancreas(62;1186 1654 36636 37908)	uc003fcl.1		NA																	0					0						c.(706-708)GAT>TAT		major facilitator superfamily domain containing							56.0	56.0	56.0					3																	158537491		2203	4300	6503	SO:0001583	missense	64747				transmembrane transport	integral to membrane		g.chr3:158537491G>T	BC017661	CCDS3185.1, CCDS3185.2, CCDS54666.1	3q25.32	2005-11-17			ENSG00000118855	ENSG00000118855			25874	protein-coding gene	gene with protein product							Standard	NM_022736		Approved	FLJ14153, UG0581B09	uc003fcl.2	Q9H3U5	OTTHUMG00000158835	ENST00000264266.8:c.706G>T	3.37:g.158537491G>T	ENSP00000264266:p.Asp236Tyr					MFSD1_uc003fcm.1_RNA|MFSD1_uc003fcn.1_Missense_Mutation_p.D139Y|MFSD1_uc011bow.1_Missense_Mutation_p.D197Y|MFSD1_uc011box.1_Missense_Mutation_p.D163Y	p.D236Y	NM_022736	NP_073573	Q9H3U5	MFSD1_HUMAN	Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)		8	736	+			236					B4DGJ8|B4DMR8|B4DU49|B4DWU1|C9JS94|J3KQL7|Q05C07|Q5XKJ1|Q8IVS1|Q8IXG4|Q9H7X1	Missense_Mutation	SNP	ENST00000264266.8	37	c.706G>T		.	.	.	.	.	.	.	.	.	.	G	26.9	4.786115	0.90282	.	.	ENSG00000118855	ENST00000415822;ENST00000392813;ENST00000264266;ENST00000361159;ENST00000477743	T;T;T;T	0.80824	0.25;0.25;0.25;-1.42	5.6	5.6	0.85130	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.92802	0.7711	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94146	0.7401	10	0.87932	D	0	.	19.6142	0.95626	0.0:0.0:1.0:0.0	.	246;236	C9JS94;Q9H3U5	.;MFSD1_HUMAN	Y	285;246;236;160;70	ENSP00000403117:D285Y;ENSP00000376560:D246Y;ENSP00000264266:D236Y;ENSP00000417163:D70Y	ENSP00000264266:D236Y	D	+	1	0	MFSD1	160020185	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.827000	0.92041	2.631000	0.89168	0.585000	0.79938	GAT		0.358	MFSD1-018	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470730.1	NM_022736		10	42	1	0	1.58986e-06	0.008291	2.1588e-06	10	42				
SI	6476	broad.mit.edu	37	3	164766935	164766935	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:164766935G>C	ENST00000264382.3	-	15	1757	c.1695C>G	c.(1693-1695)agC>agG	p.S565R		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	565	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CTATAGCCATGCTGTATCCAT	0.328										HNSCC(35;0.089)																													uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(1693-1695)AGC>AGG		sucrase-isomaltase	Acarbose(DB00284)						96.0	88.0	90.0					3																	164766935		2203	4300	6503	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164766935G>C	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1695C>G	3.37:g.164766935G>C	ENSP00000264382:p.Ser565Arg	HNSCC(35;0.089)					p.S565R	NM_001041	NP_001032	P14410	SUIS_HUMAN			15	1757	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	565			Lumenal.|Isomaltase.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.1695C>G	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.413067	0.42817	.	.	ENSG00000090402	ENST00000264382	D	0.91577	-2.87	5.24	3.42	0.39159	Glycoside hydrolase, superfamily (1);	0.111636	0.64402	D	0.000010	D	0.95382	0.8501	M	0.93594	3.435	0.47949	D	0.999551	D	0.89917	1.0	D	0.79784	0.993	D	0.93629	0.6954	10	0.87932	D	0	.	5.5861	0.17275	0.1696:0.0:0.6744:0.156	.	565	P14410	SUIS_HUMAN	R	565	ENSP00000264382:S565R	ENSP00000264382:S565R	S	-	3	2	SI	166249629	1.000000	0.71417	1.000000	0.80357	0.521000	0.34408	0.676000	0.25247	0.681000	0.31386	-0.459000	0.05422	AGC		0.328	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		14	38	0	0	0	0.003163	0	14	38				
SLITRK3	22865	broad.mit.edu	37	3	164905951	164905951	+	Missense_Mutation	SNP	G	G	T	rs550891799		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:164905951G>T	ENST00000475390.1	-	2	3111	c.2668C>A	c.(2668-2670)Cca>Aca	p.P890T	SLITRK3_ENST00000241274.3_Missense_Mutation_p.P890T			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	890					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						GCAGGCTGTGGCCTCTCTCGA	0.562										HNSCC(40;0.11)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		15817	0.0		0.0	False		,,,				2504	0.0						uc003fej.3		NA																	0				ovary(6)|skin(3)|pancreas(1)	10						c.(2668-2670)CCA>ACA		slit and trk like 3 protein precursor							55.0	53.0	54.0					3																	164905951		2203	4300	6503	SO:0001583	missense	22865					integral to membrane		g.chr3:164905951G>T	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2668C>A	3.37:g.164905951G>T	ENSP00000420091:p.Pro890Thr	HNSCC(40;0.11)				SLITRK3_uc003fek.2_Missense_Mutation_p.P890T	p.P890T	NM_014926	NP_055741	O94933	SLIK3_HUMAN			2	3112	-			890			Cytoplasmic (Potential).		Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	c.2668C>A	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.424972	0.43020	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.65549	-0.16;-0.16	5.75	3.98	0.46160	.	0.000000	0.34338	N	0.004049	T	0.48484	0.1502	L	0.29908	0.895	0.47123	D	0.99932	B	0.14012	0.009	B	0.19666	0.026	T	0.31138	-0.9954	10	0.22706	T	0.39	-9.6708	12.0484	0.53493	0.1299:0.0:0.8701:0.0	.	890	O94933	SLIK3_HUMAN	T	890	ENSP00000420091:P890T;ENSP00000241274:P890T	ENSP00000241274:P890T	P	-	1	0	SLITRK3	166388645	1.000000	0.71417	0.999000	0.59377	0.898000	0.52572	3.263000	0.51546	0.797000	0.33971	-0.794000	0.03295	CCA		0.562	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		13	62	1	0	5.50884e-06	0.001368	7.29174e-06	13	62				
PLD1	5337	broad.mit.edu	37	3	171426597	171426597	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:171426597C>A	ENST00000351298.4	-	11	1219	c.1093G>T	c.(1093-1095)Gtg>Ttg	p.V365L	PLD1_ENST00000356327.5_Missense_Mutation_p.V365L|PLD1_ENST00000342215.6_Missense_Mutation_p.V365L|PLD1_ENST00000340989.4_Missense_Mutation_p.V365L	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	365					chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GCATTTGCCACATCTTCAAAA	0.318																																					NSCLC(149;2174 3517 34058)	NSCLC(149;2174 3517 34058)	uc003fhs.2		NA																	0				ovary(2)|lung(1)	3						c.(1093-1095)GTG>TTG		phospholipase D1 isoform a	Choline(DB00122)						160.0	160.0	160.0					3																	171426597		2202	4300	6502	SO:0001583	missense	5337				cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity	g.chr3:171426597C>A	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.1093G>T	3.37:g.171426597C>A	ENSP00000342793:p.Val365Leu					PLD1_uc003fht.2_Missense_Mutation_p.V365L	p.V365L	NM_002662	NP_002653	Q13393	PLD1_HUMAN	LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		11	1209	-	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		365						Missense_Mutation	SNP	ENST00000351298.4	37	c.1093G>T	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018604	0.54576	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989	T;T;T;T	0.22134	1.97;1.97;1.97;1.97	6.07	1.77	0.24775	.	0.200467	0.43579	D	0.000553	T	0.17662	0.0424	L	0.45581	1.43	0.48452	D	0.999652	B;B	0.16603	0.018;0.002	B;B	0.18263	0.021;0.005	T	0.06481	-1.0824	10	0.28530	T	0.3	-8.6892	10.9735	0.47452	0.0:0.6854:0.0:0.3146	.	388;365	Q59EA4;Q13393	.;PLD1_HUMAN	L	365	ENSP00000348681:V365L;ENSP00000342793:V365L;ENSP00000339936:V365L;ENSP00000340326:V365L	ENSP00000340326:V365L	V	-	1	0	PLD1	172909291	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.632000	0.37102	0.437000	0.26423	0.655000	0.94253	GTG		0.318	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662		15	62	1	0	1.67942e-08	0.006122	2.51544e-08	15	62				
RTP1	132112	broad.mit.edu	37	3	186917596	186917596	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:186917596T>A	ENST00000312295.4	+	2	560	c.530T>A	c.(529-531)gTg>gAg	p.V177E	RP11-208N14.4_ENST00000356133.3_RNA	NM_153708.2	NP_714919.2	P59025	RTP1_HUMAN	receptor (chemosensory) transporter protein 1	177					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)			breast(2)|endometrium(4)|large_intestine(5)|lung(6)|ovary(3)|skin(2)	22	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		CGCATCCACGTGGCCAGCCGC	0.672																																							uc003frg.2		NA																	0				ovary(2)|breast(1)	3						c.(529-531)GTG>GAG		receptor transporting protein 1							25.0	24.0	25.0					3																	186917596		2199	4294	6493	SO:0001583	missense	132112				protein insertion into membrane	cell surface|integral to membrane|plasma membrane	olfactory receptor binding	g.chr3:186917596T>A	BC034744	CCDS3287.2	3q27.3	2014-02-20	2006-11-21		ENSG00000175077	ENSG00000175077		"""Receptor transporter proteins"""	28580	protein-coding gene	gene with protein product	"""receptor transporting protein 1"", ""zinc finger, 3CxxC-type 1"""	609137	"""receptor transporter protein 1"""			16271481, 15550249, 16720576	Standard	NM_153708		Approved	MGC35450, Z3CXXC1	uc003frg.3	P59025	OTTHUMG00000149886	ENST00000312295.4:c.530T>A	3.37:g.186917596T>A	ENSP00000311712:p.Val177Glu						p.V177E	NM_153708	NP_714919	P59025	RTP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)	2	560	+	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		177			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000312295.4	37	c.530T>A	CCDS3287.2	.	.	.	.	.	.	.	.	.	.	T	22.9	4.354227	0.82243	.	.	ENSG00000175077	ENST00000312295	T	0.21734	1.99	5.7	5.7	0.88788	.	0.492839	0.23175	N	0.051082	T	0.36991	0.0987	L	0.47716	1.5	0.34100	D	0.661762	D	0.76494	0.999	D	0.68483	0.958	T	0.47886	-0.9082	10	0.40728	T	0.16	.	12.3618	0.55207	0.0:0.0:0.0:1.0	.	177	P59025	RTP1_HUMAN	E	177	ENSP00000311712:V177E	ENSP00000311712:V177E	V	+	2	0	RTP1	188400290	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.127000	0.50484	2.189000	0.69895	0.459000	0.35465	GTG		0.672	RTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313731.2	NM_153708		9	23	0	0	0	0.006214	0	9	23				
MASP1	5648	broad.mit.edu	37	3	186980341	186980341	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:186980341G>T	ENST00000337774.5	-	3	794	c.405C>A	c.(403-405)taC>taA	p.Y135*	MASP1_ENST00000392472.2_Nonsense_Mutation_p.Y22*|MASP1_ENST00000392470.2_Nonsense_Mutation_p.Y109*|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000169293.6_Nonsense_Mutation_p.Y135*|MASP1_ENST00000296280.6_Nonsense_Mutation_p.Y135*	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	135	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.|Homodimerization. {ECO:0000250}.|Interaction with FCN2.|Interaction with MBL2.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CCACAGCCATGTAGTGGGCAT	0.522																																							uc003frh.1		NA																	0				ovary(2)|breast(1)|liver(1)	4						c.(403-405)TAC>TAA		mannan-binding lectin serine protease 1 isoform							71.0	75.0	74.0					3																	186980341		2203	4300	6503	SO:0001587	stop_gained	5648				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity	g.chr3:186980341G>T	D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.405C>A	3.37:g.186980341G>T	ENSP00000336792:p.Tyr135*					MASP1_uc003fri.2_Nonsense_Mutation_p.Y135*|MASP1_uc003frj.2_Nonsense_Mutation_p.Y104*|MASP1_uc003frk.1_Nonsense_Mutation_p.Y135*|MASP1_uc011bse.1_Nonsense_Mutation_p.Y109*	p.Y135*	NM_001879	NP_001870	P48740	MASP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)	3	737	-	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		135			Interaction with FCN2.|Interaction with MBL2.|Homodimerization (By similarity).|CUB 1.		A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Nonsense_Mutation	SNP	ENST00000337774.5	37	c.405C>A	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	G	38	6.963414	0.97967	.	.	ENSG00000127241	ENST00000337774;ENST00000296280;ENST00000392472;ENST00000541896;ENST00000169293;ENST00000392470;ENST00000392475	.	.	.	5.45	2.58	0.30949	.	0.060731	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0152	0.30376	0.3281:0.0:0.6719:0.0	.	.	.	.	X	135;135;22;22;135;109;142	.	ENSP00000169293:Y135X	Y	-	3	2	MASP1	188463035	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.807000	0.47955	0.323000	0.23307	-0.345000	0.07892	TAC		0.522	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879		12	45	1	0	3.07112e-06	0.000978	4.10484e-06	12	45				
TP63	8626	broad.mit.edu	37	3	189612219	189612219	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr3:189612219G>T	ENST00000264731.3	+	14	2060	c.1971G>T	c.(1969-1971)gaG>gaT	p.E657D	TP63_ENST00000320472.5_3'UTR|TP63_ENST00000382063.4_Missense_Mutation_p.E572D|TP63_ENST00000456148.1_Missense_Mutation_p.E559D|TP63_ENST00000449992.1_Missense_Mutation_p.E478D|TP63_ENST00000440651.2_Missense_Mutation_p.E653D|TP63_ENST00000354600.5_Missense_Mutation_p.E563D	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	657	Transactivation inhibition.				apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CCCGAGATGAGTGGAATGACT	0.552										HNSCC(45;0.13)																													uc003fry.2		NA																	0				skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12						c.(1969-1971)GAG>GAT		tumor protein p63 isoform 1							102.0	94.0	97.0					3																	189612219		2203	4300	6503	SO:0001583	missense	8626	Hay-Wells_syndrome			anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr3:189612219G>T	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.1971G>T	3.37:g.189612219G>T	ENSP00000264731:p.Glu657Asp	HNSCC(45;0.13)				TP63_uc003frz.2_3'UTR|TP63_uc010hzc.1_3'UTR|TP63_uc003fsc.2_Missense_Mutation_p.E563D|TP63_uc003fsd.2_3'UTR|TP63_uc010hzd.1_Missense_Mutation_p.E478D	p.E657D	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)	14	2060	+	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		657			Transactivation inhibition.		O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	c.1971G>T	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295933	0.40594	.	.	ENSG00000073282	ENST00000264731;ENST00000440651;ENST00000382063;ENST00000354600;ENST00000449992;ENST00000456148	D;D;D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07;-2.07;-2.07	5.91	2.99	0.34606	.	0.105240	0.64402	D	0.000004	T	0.68943	0.3056	N	0.12746	0.255	0.47476	D	0.999438	B;B;B	0.13594	0.008;0.004;0.004	B;B;B	0.14578	0.011;0.011;0.007	T	0.58036	-0.7707	9	.	.	.	-20.758	9.3625	0.38203	0.1441:0.1973:0.6586:0.0	.	478;563;657	Q9H3D4-10;Q9H3D4-2;Q9H3D4	.;.;P63_HUMAN	D	657;653;572;563;478;559	ENSP00000264731:E657D;ENSP00000394337:E653D;ENSP00000371495:E572D;ENSP00000346614:E563D;ENSP00000387839:E478D;ENSP00000389485:E559D	.	E	+	3	2	TP63	191094913	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.581000	0.46077	0.839000	0.34971	0.655000	0.94253	GAG		0.552	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722		21	70	1	0	7.45023e-12	0.010504	1.24718e-11	21	70				
CTBP1	1487	broad.mit.edu	37	4	1206751	1206751	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:1206751G>A	ENST00000290921.6	-	8	1270	c.1089C>T	c.(1087-1089)gcC>gcT	p.A363A	CTBP1_ENST00000382952.3_Silent_p.A352A	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1	363					Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		GGTCCATGCTGGCCCAGTGGG	0.647																																							uc003gcv.1		NA																	0				ovary(1)	1						c.(1087-1089)GCC>GCT		C-terminal binding protein 1 isoform 1							83.0	80.0	81.0					4																	1206751		2203	4300	6503	SO:0001819	synonymous_variant	1487				interspecies interaction between organisms|negative regulation of cell proliferation|negative regulation of histone H4 acetylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|protein phosphorylation|regulation of cell cycle|regulation of transcription by chromatin organization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|viral genome replication|white fat cell differentiation	cytoplasm|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein C-terminus binding|protein domain specific binding|transcription factor binding	g.chr4:1206751G>A	U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259	ENST00000290921.6:c.1089C>T	4.37:g.1206751G>A						uc003gcs.1_Intron|CTBP1_uc003gct.1_Silent_p.A344A|CTBP1_uc003gcu.1_Silent_p.A352A|CTBP1_uc003gcw.2_Silent_p.A37A	p.A363A	NM_001328	NP_001319	Q13363	CTBP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)	8	1254	-			363					Q4W5N3|Q7Z2Q5	Silent	SNP	ENST00000290921.6	37	c.1089C>T	CCDS3348.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.747982	0.30955	.	.	ENSG00000159692	ENST00000503594;ENST00000504092	.	.	.	4.34	3.48	0.39840	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-29.7763	13.9573	0.64157	0.0:0.1535:0.8465:0.0	.	.	.	.	X	106;210	.	.	Q	-	1	0	CTBP1	1196751	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.328000	0.43867	0.780000	0.33566	0.561000	0.74099	CAG		0.647	CTBP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000202938.1	NM_001328		11	56	0	0	0	0.003163	0	11	56				
LETM1	3954	broad.mit.edu	37	4	1834499	1834499	+	Missense_Mutation	SNP	C	C	T	rs539912035		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:1834499C>T	ENST00000302787.2	-	6	1348	c.1052G>A	c.(1051-1053)cGg>cAg	p.R351Q		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	351	LETM1.				cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			GGAGCGCAGCCGCATGGTAAG	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		19009	0.001		0.0	False		,,,				2504	0.0						uc003gdv.2		NA																	0				central_nervous_system(1)	1						c.(1051-1053)CGG>CAG		leucine zipper-EF-hand containing transmembrane							97.0	92.0	94.0					4																	1834499		2203	4300	6503	SO:0001583	missense	3954				cristae formation	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding	g.chr4:1834499C>T	AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.1052G>A	4.37:g.1834499C>T	ENSP00000305653:p.Arg351Gln						p.R351Q	NM_012318	NP_036450	O95202	LETM1_HUMAN	all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)		6	1349	-			351			Mitochondrial matrix (Potential).|LETM1.		B4DED2|Q9UF65	Missense_Mutation	SNP	ENST00000302787.2	37	c.1052G>A	CCDS3355.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.376406	0.61735	.	.	ENSG00000168924	ENST00000302787	T	0.46819	0.86	4.61	4.61	0.57282	LETM1-like (1);	0.052875	0.64402	D	0.000001	T	0.40398	0.1115	L	0.45228	1.405	0.43559	D	0.995872	D	0.53151	0.958	B	0.43809	0.432	T	0.40232	-0.9574	10	0.72032	D	0.01	-40.4529	8.5674	0.33547	0.0:0.8273:0.0:0.1727	.	351	O95202	LETM1_HUMAN	Q	351	ENSP00000305653:R351Q	ENSP00000305653:R351Q	R	-	2	0	LETM1	1804297	1.000000	0.71417	0.992000	0.48379	0.718000	0.41266	2.909000	0.48758	2.131000	0.65755	0.561000	0.74099	CGG		0.567	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241634.1			14	63	0	0	0	0.004007	0	14	63				
ZFYVE28	57732	broad.mit.edu	37	4	2306941	2306941	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:2306941C>A	ENST00000290974.2	-	8	1465	c.1126G>T	c.(1126-1128)Gag>Tag	p.E376*	ZFYVE28_ENST00000515312.1_Nonsense_Mutation_p.E306*|ZFYVE28_ENST00000511071.1_Nonsense_Mutation_p.E346*|RP11-478C1.7_ENST00000510632.1_RNA	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	376					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						GGGCTGCCCTCCGCTCCTGGC	0.672																																							uc003gex.1		NA																	0				skin(2)|ovary(1)	3						c.(1126-1128)GAG>TAG		zinc finger, FYVE domain containing 28							37.0	38.0	38.0					4																	2306941		2203	4299	6502	SO:0001587	stop_gained	57732				negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr4:2306941C>A	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.1126G>T	4.37:g.2306941C>A	ENSP00000290974:p.Glu376*					ZFYVE28_uc011bvk.1_Nonsense_Mutation_p.E306*|ZFYVE28_uc011bvl.1_Nonsense_Mutation_p.E346*|ZFYVE28_uc003gew.1_Nonsense_Mutation_p.E262*	p.E376*	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN			8	1445	-			376					B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Nonsense_Mutation	SNP	ENST00000290974.2	37	c.1126G>T	CCDS33942.1	.	.	.	.	.	.	.	.	.	.	C	33	5.267970	0.95429	.	.	ENSG00000159733	ENST00000290974;ENST00000511071;ENST00000515312	.	.	.	5.35	1.98	0.26296	.	0.718258	0.14738	N	0.301354	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	6.8515	0.24018	0.0:0.5476:0.3355:0.1169	.	.	.	.	X	376;346;306	.	ENSP00000290974:E376X	E	-	1	0	ZFYVE28	2276739	0.002000	0.14202	0.185000	0.23176	0.035000	0.12851	1.100000	0.31025	0.566000	0.29273	0.537000	0.68136	GAG		0.672	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371		5	45	1	0	0.00116845	0.001168	0.00134126	5	45				
CYTL1	54360	broad.mit.edu	37	4	5018685	5018685	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:5018685A>T	ENST00000307746.4	-	3	231	c.205T>A	c.(205-207)Tgt>Agt	p.C69S		NM_018659.2	NP_061129.1	Q9NRR1	CYTL1_HUMAN	cytokine-like 1	69					cartilage homeostasis (GO:1990079)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|inner ear development (GO:0048839)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)			breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		TCCAGCACACAGTAATTCTGG	0.557																																					Colon(15;457 478 29696 43408 47165)	Colon(15;457 478 29696 43408 47165)	uc003gig.2		NA																	0				skin(1)	1						c.(205-207)TGT>AGT		cytokine-like 1 precursor							69.0	73.0	72.0					4																	5018685		2203	4300	6503	SO:0001583	missense	54360				signal transduction	extracellular space|soluble fraction	receptor binding	g.chr4:5018685A>T	AF193766	CCDS3379.1	4p16-p15	2007-08-01			ENSG00000170891	ENSG00000170891			24435	protein-coding gene	gene with protein product		607930				10857752	Standard	NM_018659		Approved	C17, C4orf4	uc003gig.3	Q9NRR1	OTTHUMG00000125479	ENST00000307746.4:c.205T>A	4.37:g.5018685A>T	ENSP00000303550:p.Cys69Ser						p.C69S	NM_018659	NP_061129	Q9NRR1	CYTL1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.164)	3	230	-			69						Missense_Mutation	SNP	ENST00000307746.4	37	c.205T>A	CCDS3379.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.998488	0.74818	.	.	ENSG00000170891	ENST00000307746	T	0.38722	1.12	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.63510	0.2517	M	0.80183	2.485	0.49130	D	0.999753	D	0.89917	1.0	D	0.71870	0.975	T	0.68538	-0.5382	10	0.87932	D	0	-7.7483	11.0093	0.47652	1.0:0.0:0.0:0.0	.	69	Q9NRR1	CYTL1_HUMAN	S	69	ENSP00000303550:C69S	ENSP00000303550:C69S	C	-	1	0	CYTL1	5069586	1.000000	0.71417	0.990000	0.47175	0.968000	0.65278	4.595000	0.61048	1.858000	0.53909	0.459000	0.35465	TGT		0.557	CYTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246802.1	NM_018659		20	97	0	0	0	0.008871	0	20	97				
DRD5	1816	broad.mit.edu	37	4	9784157	9784157	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:9784157C>A	ENST00000304374.2	+	1	900	c.504C>A	c.(502-504)tcC>tcA	p.S168S		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	168					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GGACCTTGTCCATCCTCATCT	0.632																																							uc003gmb.3		NA																	0				skin(1)	1						c.(502-504)TCC>TCA		dopamine receptor D5	Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)						36.0	36.0	36.0					4																	9784157		2203	4300	6503	SO:0001819	synonymous_variant	1816				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane		g.chr4:9784157C>A	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.504C>A	4.37:g.9784157C>A							p.S168S	NM_000798	NP_000789	P21918	DRD5_HUMAN			1	900	+			168			Helical; Name=4; (Potential).		B2R9S3|Q8NEQ8	Silent	SNP	ENST00000304374.2	37	c.504C>A	CCDS3405.1																																																																																				0.632	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1			4	37	1	0	1.23904e-05	0.000602	1.59673e-05	4	37				
DRD5	1816	broad.mit.edu	37	4	9784743	9784743	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:9784743G>T	ENST00000304374.2	+	1	1486	c.1090G>T	c.(1090-1092)Gac>Tac	p.D364Y		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	364					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CTTCAACGCCGACTTTCAGAA	0.592																																							uc003gmb.3		NA																	0				skin(1)	1						c.(1090-1092)GAC>TAC		dopamine receptor D5	Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)						69.0	63.0	65.0					4																	9784743		2203	4300	6503	SO:0001583	missense	1816				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane		g.chr4:9784743G>T	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1090G>T	4.37:g.9784743G>T	ENSP00000306129:p.Asp364Tyr						p.D364Y	NM_000798	NP_000789	P21918	DRD5_HUMAN			1	1486	+			364			Cytoplasmic (Potential).		B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	c.1090G>T	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	g	21.0	4.085191	0.76642	.	.	ENSG00000169676	ENST00000304374	T	0.40476	1.03	4.59	4.59	0.56863	.	0.106801	0.64402	D	0.000008	T	0.67249	0.2873	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.73824	-0.3861	10	0.87932	D	0	.	16.5794	0.84710	0.0:0.0:1.0:0.0	.	364	P21918	DRD5_HUMAN	Y	364	ENSP00000306129:D364Y	ENSP00000306129:D364Y	D	+	1	0	DRD5	9393841	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	9.202000	0.95026	2.376000	0.81061	0.460000	0.39030	GAC		0.592	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1			16	50	1	0	1.15088e-07	0.004007	1.64445e-07	16	50				
BOD1L1	259282	broad.mit.edu	37	4	13606600	13606600	+	Missense_Mutation	SNP	C	C	T	rs151278291	byFrequency	TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:13606600C>T	ENST00000040738.5	-	10	2059	c.1924G>A	c.(1924-1926)Gac>Aac	p.D642N		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	642	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)										TTGTTTTCGTCAACTACATGC	0.398													C|||	2	0.000399361	0.0	0.0	5008	,	,		17585	0.0		0.001	False		,,,				2504	0.001						uc003gmz.1		NA																	0				ovary(5)|breast(1)	6						c.(1924-1926)GAC>AAC		biorientation of chromosomes in cell division		C	ASN/ASP	2,4404	4.2+/-10.8	0,2,2201	89.0	87.0	88.0		1924	5.5	1.0	4	dbSNP_134	88	5,8595	4.3+/-15.6	0,5,4295	yes	missense	BOD1L	NM_148894.2	23	0,7,6496	TT,TC,CC		0.0581,0.0454,0.0538	probably-damaging	642/3052	13606600	7,12999	2203	4300	6503	SO:0001583	missense	259282						DNA binding	g.chr4:13606600C>T	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.1924G>A	4.37:g.13606600C>T	ENSP00000040738:p.Asp642Asn					BOD1L_uc010idr.1_5'UTR	p.D642N	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN			10	2041	-			642			Lys-rich.		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	c.1924G>A	CCDS3411.2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	22.6	4.310215	0.81358	4.54E-4	5.81E-4	ENSG00000038219	ENST00000040738	T	0.12039	2.72	5.51	5.51	0.81932	.	0.000000	0.43919	D	0.000514	T	0.27278	0.0669	L	0.29908	0.895	0.38540	D	0.949195	D	0.76494	0.999	D	0.65684	0.937	T	0.02484	-1.1152	10	0.54805	T	0.06	-5.6836	19.401	0.94629	0.0:1.0:0.0:0.0	.	642	Q8NFC6	BOD1L_HUMAN	N	642	ENSP00000040738:D642N	ENSP00000040738:D642N	D	-	1	0	BOD1L	13215698	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	5.677000	0.68142	2.589000	0.87451	0.563000	0.77884	GAC		0.398	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894		25	61	0	0	0	0.00333	0	25	61				
BST1	683	broad.mit.edu	37	4	15707203	15707203	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:15707203T>A	ENST00000265016.4	+	2	449	c.254T>A	c.(253-255)gTg>gAg	p.V85E	BST1_ENST00000382346.3_Missense_Mutation_p.V100E	NM_004334.2	NP_004325.2	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1	85					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|transferase activity (GO:0016740)			central_nervous_system(1)|large_intestine(1)|lung(2)|stomach(3)|urinary_tract(1)	8						CCCTGCTCCGTGCTGCCCTCA	0.473																																							uc003goh.3		NA																	0				central_nervous_system(1)	1						c.(253-255)GTG>GAG		bone marrow stromal cell antigen 1 precursor							150.0	138.0	142.0					4																	15707203		2203	4300	6503	SO:0001583	missense	683				humoral immune response|multicellular organismal development	anchored to membrane|extrinsic to membrane|plasma membrane	binding|NAD+ nucleosidase activity	g.chr4:15707203T>A	D21878	CCDS3416.1	4p15	2010-05-04			ENSG00000109743	ENSG00000109743	3.2.2.5	"""CD molecules"""	1118	protein-coding gene	gene with protein product	"""NAD(+) nucleosidase"", ""ADP-ribosyl cyclase 2"""	600387				8202488	Standard	NM_004334		Approved	CD157	uc003goh.4	Q10588	OTTHUMG00000097739	ENST00000265016.4:c.254T>A	4.37:g.15707203T>A	ENSP00000265016:p.Val85Glu						p.V85E	NM_004334	NP_004325	Q10588	BST1_HUMAN			2	449	+			85					B2R6A2|Q1XII0|Q5U0K0|Q96EN3	Missense_Mutation	SNP	ENST00000265016.4	37	c.254T>A	CCDS3416.1	.	.	.	.	.	.	.	.	.	.	T	15.66	2.898270	0.52227	.	.	ENSG00000109743	ENST00000265016;ENST00000382346	T;T	0.18016	2.24;2.24	5.72	5.72	0.89469	.	0.516357	0.20937	N	0.082988	T	0.32941	0.0846	M	0.74881	2.28	0.39996	D	0.975106	P	0.52316	0.952	P	0.52793	0.709	T	0.08310	-1.0728	9	.	.	.	-10.3602	12.4233	0.55532	0.0:0.0:0.0:1.0	.	85	Q10588	BST1_HUMAN	E	85;100	ENSP00000265016:V85E;ENSP00000371783:V100E	.	V	+	2	0	BST1	15316301	0.984000	0.35163	0.383000	0.26132	0.052000	0.14988	4.232000	0.58645	2.192000	0.70111	0.529000	0.55759	GTG		0.473	BST1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214968.2	NM_004334		16	80	0	0	0	0.004007	0	16	80				
LDB2	9079	broad.mit.edu	37	4	16587550	16587550	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:16587550G>T	ENST00000304523.5	-	5	933	c.610C>A	c.(610-612)Ctc>Atc	p.L204I	LDB2_ENST00000441778.2_Missense_Mutation_p.L204I|LDB2_ENST00000502640.1_Missense_Mutation_p.L204I|LDB2_ENST00000503178.2_Missense_Mutation_p.L80I|LDB2_ENST00000503829.1_5'Flank|LDB2_ENST00000515064.1_Missense_Mutation_p.L204I	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	204					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						CTTACCCTGAGGTAGTTGAGG	0.408																																							uc003goz.2		NA																	0					0						c.(610-612)CTC>ATC		LIM domain binding 2 isoform a							125.0	121.0	122.0					4																	16587550		2203	4300	6503	SO:0001583	missense	9079						LIM domain binding|transcription cofactor activity	g.chr4:16587550G>T	AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.610C>A	4.37:g.16587550G>T	ENSP00000306772:p.Leu204Ile					LDB2_uc003gpa.2_Missense_Mutation_p.L204I|LDB2_uc003gpb.2_Missense_Mutation_p.L204I|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Missense_Mutation_p.L204I|LDB2_uc003goy.2_Missense_Mutation_p.L80I|LDB2_uc011bxi.1_Missense_Mutation_p.L80I	p.L204I	NM_001290	NP_001281	O43679	LDB2_HUMAN			5	926	-			204					O60619|O75480	Missense_Mutation	SNP	ENST00000304523.5	37	c.610C>A	CCDS3420.1	.	.	.	.	.	.	.	.	.	.	G	35	5.482185	0.96307	.	.	ENSG00000169744	ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640;ENST00000503178	.	.	.	6.16	6.16	0.99307	.	0.000000	0.64402	D	0.000007	D	0.84871	0.5568	M	0.84948	2.725	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.997;0.997;0.997;0.999;0.998	D;D;D;D;D;D	0.91635	0.999;0.983;0.96;0.979;0.998;0.997	D	0.85647	0.1280	9	0.87932	D	0	-13.5606	19.848	0.96722	0.0:0.0:1.0:0.0	.	80;204;204;204;204;180	B7Z2D3;E9PFI4;G5E9Y7;O43679-2;O43679;O43679-3	.;.;.;.;LDB2_HUMAN;.	I	204;204;204;204;80	.	ENSP00000306772:L204I	L	-	1	0	LDB2	16196648	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.810000	0.99221	2.937000	0.99478	0.650000	0.86243	CTC		0.408	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250321.2			13	67	1	0	2.68362e-12	0.001368	4.54817e-12	13	67				
SLIT2	9353	broad.mit.edu	37	4	20525799	20525799	+	Splice_Site	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:20525799A>T	ENST00000504154.1	+	14	1689	c.1437A>T	c.(1435-1437)tcA>tcT	p.S479S	SLIT2_ENST00000503823.1_Splice_Site_p.S479S|SLIT2_ENST00000503837.1_Splice_Site_p.S483S|SLIT2_ENST00000273739.5_Splice_Site_p.S483S	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	479	LRRCT 2.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						TCCGTTGTTCAGGTAATTTCT	0.478																																							uc003gpr.1		NA																	0				central_nervous_system(4)|skin(4)|ovary(3)	11						c.(1435-1437)TCA>TCT		slit homolog 2 precursor							77.0	89.0	85.0					4																	20525799		2203	4300	6503	SO:0001630	splice_region_variant	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20525799A>T	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1438+1A>T	4.37:g.20525799A>T						SLIT2_uc003gps.1_Silent_p.S479S	p.S479S	NM_004787	NP_004778	O94813	SLIT2_HUMAN			14	1641	+			479			LRRCT 2.		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	c.1437A>T	CCDS3426.1																																																																																				0.478	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		Silent	24	88	0	0	0	0.002299	0	24	88				
PCDH7	5099	broad.mit.edu	37	4	30726008	30726008	+	Silent	SNP	C	C	A	rs148242685		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:30726008C>A	ENST00000361762.2	+	1	3972	c.2964C>A	c.(2962-2964)ggC>ggA	p.G988G	PCDH7_ENST00000543491.1_Silent_p.G988G	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	988					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GTGGGCCCGGCAGTCCTGACC	0.517																																							uc003gsk.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						c.(2962-2964)GGC>GGA		protocadherin 7 isoform a precursor		C	,,,	0,4406		0,0,2203	85.0	86.0	86.0		2964,2964,2964,2964	3.2	1.0	4	dbSNP_134	86	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PCDH7	NM_001173523.1,NM_002589.2,NM_032456.2,NM_032457.3	,,,	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	,,,	988/1256,988/1070,988/1073,988/1248	30726008	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5099				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chr4:30726008C>A	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2964C>A	4.37:g.30726008C>A						PCDH7_uc011bxw.1_Silent_p.G941G|PCDH7_uc011bxx.1_Silent_p.G988G	p.G988G	NM_002589	NP_002580	O60245	PCDH7_HUMAN			1	3972	+			988			Cytoplasmic (Potential).		O60246|O60247|Q4W5C4	Silent	SNP	ENST00000361762.2	37	c.2964C>A	CCDS33971.1	.	.	.	.	.	.	.	.	.	.	C	1.329	-0.597375	0.03771	0.0	1.16E-4	ENSG00000169851	ENST00000511884	.	.	.	5.08	3.23	0.37069	.	.	.	.	.	T	0.46756	0.1409	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40979	-0.9534	4	.	.	.	.	3.2342	0.06758	0.1483:0.5638:0.1435:0.1444	.	.	.	.	K	678	.	.	Q	+	1	0	PCDH7	30335106	0.114000	0.22134	1.000000	0.80357	0.817000	0.46193	-0.049000	0.11924	1.336000	0.45506	0.561000	0.74099	CAG		0.517	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589		8	63	1	0	0.00307968	0.00308	0.00347099	8	63				
TLR1	7096	broad.mit.edu	37	4	38798817	38798817	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:38798817C>A	ENST00000502213.2	-	3	1865	c.1636G>T	c.(1636-1638)Gtg>Ttg	p.V546L	TLR1_ENST00000510552.1_5'Flank|TLR1_ENST00000308979.2_Missense_Mutation_p.V546L			Q15399	TLR1_HUMAN	toll-like receptor 1	546	LRRCT.				cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						CCCTCTAACACTTCACTTGAT	0.413																																					GBM(5;216 373 40795 46382)	GBM(5;216 373 40795 46382)	uc003gtl.2		NA																	0				lung(2)|skin(2)|prostate(1)	5						c.(1636-1638)GTG>TTG		toll-like receptor 1 precursor							185.0	196.0	192.0					4																	38798817		2203	4300	6503	SO:0001583	missense	7096				cellular response to triacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|inflammatory response|innate immune response|macrophage activation|positive regulation of interleukin-6 biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	integral to plasma membrane|phagocytic vesicle membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	protein heterodimerization activity|transmembrane receptor activity	g.chr4:38798817C>A	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1636G>T	4.37:g.38798817C>A	ENSP00000421259:p.Val546Leu						p.V546L	NM_003263	NP_003254	Q15399	TLR1_HUMAN			4	1910	-			546			Extracellular (Potential).|LRRCT.		D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	ENST00000502213.2	37	c.1636G>T	CCDS33973.1	.	.	.	.	.	.	.	.	.	.	C	8.635	0.894698	0.17613	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	T;T	0.01902	4.57;4.57	4.75	4.75	0.60458	Cysteine-rich flanking region, C-terminal (1);	0.463977	0.20076	N	0.099751	T	0.03827	0.0108	L	0.60845	1.875	0.25342	N	0.98895	B	0.14438	0.01	B	0.20184	0.028	T	0.24693	-1.0153	10	0.31617	T	0.26	.	13.4424	0.61121	0.0:1.0:0.0:0.0	.	546	Q15399	TLR1_HUMAN	L	546	ENSP00000354932:V546L;ENSP00000421259:V546L	ENSP00000354932:V546L	V	-	1	0	TLR1	38475212	0.000000	0.05858	0.838000	0.33150	0.435000	0.31806	0.128000	0.15810	2.636000	0.89361	0.650000	0.86243	GTG		0.413	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3			58	301	1	0	2.93687e-30	0.00361	6.21017e-30	58	301				
GABRG1	2565	broad.mit.edu	37	4	46053569	46053569	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:46053569G>T	ENST00000295452.4	-	8	1170	c.1003C>A	c.(1003-1005)Ctc>Atc	p.L335I		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	335					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GAAACAAAGAGATCCATCGCA	0.383																																							uc003gxb.2		NA																	0				ovary(2)	2						c.(1003-1005)CTC>ATC		gamma-aminobutyric acid A receptor, gamma 1							111.0	100.0	104.0					4																	46053569		2203	4300	6503	SO:0001583	missense	2565				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr4:46053569G>T	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.1003C>A	4.37:g.46053569G>T	ENSP00000295452:p.Leu335Ile						p.L335I	NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN		Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	8	1155	-			335			Helical; (Probable).		Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	37	c.1003C>A	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	G	32	5.106897	0.94292	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	D	0.85088	-1.94	5.64	5.64	0.86602	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.86920	0.6049	N	0.25485	0.75	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.81858	-0.0739	10	0.10636	T	0.68	.	18.7036	0.91630	0.0:0.0:1.0:0.0	.	335	Q8N1C3	GBRG1_HUMAN	I	335	ENSP00000295452:L335I	ENSP00000295452:L335I	L	-	1	0	GABRG1	45748326	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.993000	0.88291	2.664000	0.90586	0.655000	0.94253	CTC		0.383	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536		19	49	1	0	2.39187e-15	0.008871	4.38652e-15	19	49				
USP46	64854	broad.mit.edu	37	4	53468093	53468093	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:53468093T>C	ENST00000441222.3	-	7	1034	c.850A>G	c.(850-852)Aac>Gac	p.N284D	USP46_ENST00000508499.1_Missense_Mutation_p.N277D|USP46_ENST00000451218.2_Missense_Mutation_p.N257D	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	284	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			CTGGAGGTGTTGAAGAGCCGG	0.542																																							uc003gzn.2		NA																	0				ovary(1)	1						c.(850-852)AAC>GAC		ubiquitin specific peptidase 46 isoform 1							116.0	115.0	115.0					4																	53468093		2084	4217	6301	SO:0001583	missense	64854				behavior|protein deubiquitination|regulation of synaptic transmission, GABAergic|ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr4:53468093T>C	AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.850A>G	4.37:g.53468093T>C	ENSP00000407818:p.Asn284Asp					USP46_uc003gzm.3_Missense_Mutation_p.N277D|USP46_uc011bzr.1_Missense_Mutation_p.N261D|USP46_uc011bzs.1_Missense_Mutation_p.N168D	p.N284D	NM_022832	NP_073743	P62068	UBP46_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.0295)		7	1035	-			284					B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Missense_Mutation	SNP	ENST00000441222.3	37	c.850A>G	CCDS47053.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.403224	0.83230	.	.	ENSG00000109189	ENST00000441222;ENST00000451218;ENST00000508499	T;T;T	0.05025	3.51;3.51;3.51	5.17	5.17	0.71159	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000017	T	0.21921	0.0528	M	0.75085	2.285	0.80722	D	1	P;P;D;D	0.60160	0.552;0.552;0.972;0.987	P;P;P;P	0.62491	0.447;0.447;0.877;0.903	T	0.00507	-1.1699	10	0.45353	T	0.12	-26.8716	14.4964	0.67691	0.0:0.0:0.0:1.0	.	168;272;284;277	P62068-2;P62068-4;P62068;P62068-3	.;.;UBP46_HUMAN;.	D	284;257;277	ENSP00000407818:N284D;ENSP00000390102:N257D;ENSP00000423244:N277D	ENSP00000407818:N284D	N	-	1	0	USP46	53162850	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	7.997000	0.88414	2.070000	0.61991	0.528000	0.53228	AAC		0.542	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361516.2	NM_022832		18	49	0	0	0	0.010504	0	18	49				
PDGFRA	5156	broad.mit.edu	37	4	55155261	55155261	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:55155261C>A	ENST00000257290.5	+	21	3191	c.2860C>A	c.(2860-2862)Ctg>Atg	p.L954M	FIP1L1_ENST00000507166.1_Missense_Mutation_p.L714M	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	954	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	GGAGAATCTGCTGCCTGGACA	0.488			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)	Pancreas(151;208 1913 7310 23853 37092)	uc003han.3		NA		Dom	yes		4	4q11-q13	5156	Mis|O|T	"""platelet-derived growth factor, alpha-receptor"""			"""L, M, O"""	FIP1L1		GIST|idiopathic hypereosinophilic syndrome		0				soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674						c.(2860-2862)CTG>ATG		platelet-derived growth factor receptor alpha	Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)						155.0	148.0	150.0					4																	55155261		2203	4300	6503	SO:0001583	missense	5156	Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity	g.chr4:55155261C>A	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.2860C>A	4.37:g.55155261C>A	ENSP00000257290:p.Leu954Met	TSP Lung(21;0.16)				PDGFRA_uc003haa.2_Missense_Mutation_p.L714M	p.L954M	NM_006206	NP_006197	P16234	PGFRA_HUMAN	GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		21	3191	+	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		954			Protein kinase.|Cytoplasmic (Potential).		B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	c.2860C>A	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.267271	0.59540	.	.	ENSG00000145216;ENSG00000134853	ENST00000507166;ENST00000257290	T;T	0.80994	-1.44;-1.3	5.95	4.15	0.48705	Protein kinase, catalytic domain (1);	0.000000	0.26460	U	0.024250	D	0.86326	0.5906	M	0.64404	1.975	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	D	0.85494	0.1187	10	0.66056	D	0.02	.	9.3752	0.38278	0.0:0.7191:0.0:0.2809	.	954	P16234	PGFRA_HUMAN	M	714;954	ENSP00000423325:L714M;ENSP00000257290:L954M	ENSP00000423325:L714M	L	+	1	2	FIP1L1;PDGFRA	54850018	0.998000	0.40836	1.000000	0.80357	0.676000	0.39594	0.656000	0.24948	0.775000	0.33450	0.563000	0.77884	CTG		0.488	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206		8	35	1	0	0.00307968	0.00308	0.00347099	8	35				
LPHN3	23284	broad.mit.edu	37	4	62598770	62598770	+	Missense_Mutation	SNP	T	T	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:62598770T>G	ENST00000514591.1	+	7	1022	c.693T>G	c.(691-693)ttT>ttG	p.F231L	LPHN3_ENST00000514157.1_Missense_Mutation_p.F231L|LPHN3_ENST00000514996.1_Missense_Mutation_p.F231L|LPHN3_ENST00000504896.1_Missense_Mutation_p.F231L|LPHN3_ENST00000506720.1_Missense_Mutation_p.F299L|LPHN3_ENST00000545650.1_Missense_Mutation_p.F231L|LPHN3_ENST00000507625.1_Missense_Mutation_p.F299L|LPHN3_ENST00000511324.1_Missense_Mutation_p.F299L|LPHN3_ENST00000508946.1_Missense_Mutation_p.F231L|LPHN3_ENST00000512091.2_Missense_Mutation_p.F231L|LPHN3_ENST00000507164.1_Missense_Mutation_p.F299L|LPHN3_ENST00000509896.1_Missense_Mutation_p.F299L|LPHN3_ENST00000506700.1_Missense_Mutation_p.F231L|LPHN3_ENST00000508693.1_Missense_Mutation_p.F299L|LPHN3_ENST00000506746.1_Missense_Mutation_p.F299L			Q9HAR2	LPHN3_HUMAN	latrophilin 3	231	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TAGTAAAGTTTGATTTGCGGA	0.463																																							uc010ihh.2		NA																	0				lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(691-693)TTT>TTG		latrophilin 3 precursor							78.0	73.0	74.0					4																	62598770		1908	4116	6024	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62598770T>G	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.693T>G	4.37:g.62598770T>G	ENSP00000422533:p.Phe231Leu					LPHN3_uc003hcq.3_Missense_Mutation_p.F231L|LPHN3_uc010ihg.1_Missense_Mutation_p.F299L|LPHN3_uc003hcs.1_Missense_Mutation_p.F60L	p.F231L	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN			5	866	+			231			Extracellular (Potential).|Olfactomedin-like.		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.693T>G	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.170143	0.57584	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81	5.26	2.89	0.33648	.	0.000000	0.85682	D	0.000000	D	0.92437	0.7599	L	0.55481	1.735	0.48087	D	0.999581	D;D;P	0.63046	0.992;0.992;0.954	D;D;D	0.76071	0.987;0.987;0.943	D	0.91285	0.5054	10	0.72032	D	0.01	.	8.1375	0.31063	0.0:0.1635:0.0:0.8365	.	231;299;231	E9PE04;E7EN28;Q9HAR2-2	.;.;.	L	231;231;299;299;231;231;231;231;231;299;299;299;231;231;231;299;299;231	ENSP00000423388:F231L;ENSP00000422533:F231L;ENSP00000423787:F299L;ENSP00000425033:F299L;ENSP00000424120:F231L;ENSP00000439831:F231L;ENSP00000421476:F299L;ENSP00000424030:F299L;ENSP00000421372:F299L;ENSP00000425201:F231L;ENSP00000423434:F231L;ENSP00000421627:F231L;ENSP00000420931:F299L;ENSP00000425884:F299L;ENSP00000424258:F231L	ENSP00000280009:F231L	F	+	3	2	LPHN3	62281365	0.989000	0.36119	1.000000	0.80357	0.992000	0.81027	0.202000	0.17295	0.861000	0.35504	0.455000	0.32223	TTT		0.463	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			9	19	0	0	0	0.008291	0	9	19				
EPHA5	2044	broad.mit.edu	37	4	66213899	66213899	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:66213899C>A	ENST00000273854.3	-	15	3131	c.2531G>T	c.(2530-2532)tGg>tTg	p.W844L	EPHA5_ENST00000511294.1_Missense_Mutation_p.W845L|EPHA5_ENST00000354839.4_Missense_Mutation_p.W822L|EPHA5_ENST00000432638.2_Missense_Mutation_p.W681L	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	844	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.W844L(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TGGGGCAGTCCATCTGATTGG	0.393										TSP Lung(17;0.13)																													uc003hcy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(2530-2532)TGG>TTG		ephrin receptor EphA5 isoform a precursor							113.0	113.0	113.0					4																	66213899		2203	4300	6503	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66213899C>A	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2531G>T	4.37:g.66213899C>A	ENSP00000273854:p.Trp844Leu	TSP Lung(17;0.13)				EPHA5_uc003hcx.2_Missense_Mutation_p.W776L|EPHA5_uc003hcz.2_Missense_Mutation_p.W822L|EPHA5_uc011cah.1_Missense_Mutation_p.W845L|EPHA5_uc011cai.1_Missense_Mutation_p.W823L|EPHA5_uc003hda.2_Missense_Mutation_p.W845L	p.W844L	NM_004439	NP_004430	P54756	EPHA5_HUMAN			15	2724	-			844			Cytoplasmic (Potential).|Protein kinase.		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.2531G>T	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	31	5.101206	0.94245	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	5.86	5.86	0.93980	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000020	D	0.89914	0.6853	H	0.98559	4.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93147	0.6546	10	0.87932	D	0	.	20.1823	0.98208	0.0:1.0:0.0:0.0	.	823;845;822;844	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	L	844;681;822;845	ENSP00000273854:W844L;ENSP00000389208:W681L;ENSP00000346899:W822L;ENSP00000427638:W845L	ENSP00000273854:W844L	W	-	2	0	EPHA5	65896494	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.771000	0.95319	0.650000	0.86243	TGG		0.393	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		8	78	1	0	1.12685e-05	0.004482	1.46598e-05	8	78				
EPHA5	2044	broad.mit.edu	37	4	66467571	66467571	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:66467571C>G	ENST00000273854.3	-	3	1298	c.698G>C	c.(697-699)tGc>tCc	p.C233S	EPHA5_ENST00000511294.1_Missense_Mutation_p.C233S|EPHA5_ENST00000354839.4_Missense_Mutation_p.C233S|EPHA5_ENST00000432638.2_Missense_Mutation_p.C233S	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	233	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						CACAGAAGGGCATTTTTTATA	0.448										TSP Lung(17;0.13)																													uc003hcy.2		NA																	0				lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(697-699)TGC>TCC		ephrin receptor EphA5 isoform a precursor							69.0	66.0	67.0					4																	66467571		2203	4300	6503	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66467571C>G	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.698G>C	4.37:g.66467571C>G	ENSP00000273854:p.Cys233Ser	TSP Lung(17;0.13)				EPHA5_uc003hcx.2_Missense_Mutation_p.C164S|EPHA5_uc003hcz.2_Missense_Mutation_p.C233S|EPHA5_uc011cah.1_Missense_Mutation_p.C233S|EPHA5_uc011cai.1_Missense_Mutation_p.C233S|EPHA5_uc003hda.2_Missense_Mutation_p.C233S	p.C233S	NM_004439	NP_004430	P54756	EPHA5_HUMAN			3	891	-			233			Extracellular (Potential).|Cys-rich.		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.698G>C	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354561	0.82243	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	5.83	5.83	0.93111	Tyrosine-protein kinase, receptor class V, conserved site (1);Ephrin receptor, ligand binding (2);	0.000000	0.64402	D	0.000002	T	0.57286	0.2043	H	0.94264	3.515	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.91635	0.999;0.995;0.999;0.999	T	0.68678	-0.5345	10	0.87932	D	0	.	20.1208	0.97960	0.0:1.0:0.0:0.0	.	233;233;233;233	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	S	233	ENSP00000273854:C233S;ENSP00000389208:C233S;ENSP00000346899:C233S;ENSP00000427638:C233S	ENSP00000273854:C233S	C	-	2	0	EPHA5	66150166	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.818000	0.86416	2.758000	0.94735	0.655000	0.94253	TGC		0.448	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		14	25	0	0	0	0.00245	0	14	25				
BMP2K	55589	broad.mit.edu	37	4	79832722	79832722	+	Silent	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:79832722T>A	ENST00000335016.5	+	16	3187	c.3021T>A	c.(3019-3021)acT>acA	p.T1007T	PAQR3_ENST00000295462.3_Intron	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	1007					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						CAAAGAAGACTTTGAAGCCTA	0.493																																							uc003hlk.2		NA																	0				lung(1)	1						c.(3019-3021)ACT>ACA		BMP-2 inducible kinase isoform a							64.0	63.0	63.0					4																	79832722		1937	4138	6075	SO:0001819	synonymous_variant	55589					nucleus	ATP binding|protein serine/threonine kinase activity	g.chr4:79832722T>A	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.3021T>A	4.37:g.79832722T>A						PAQR3_uc003hlm.2_Intron|PAQR3_uc003hln.2_Intron|uc010ijm.1_5'Flank	p.T1007T	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN			16	3187	+			1007					O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Silent	SNP	ENST00000335016.5	37	c.3021T>A	CCDS47083.1	.	.	.	.	.	.	.	.	.	.	T	2.974	-0.211773	0.06140	.	.	ENSG00000138756	ENST00000502613	.	.	.	5.41	-10.6	0.00265	.	.	.	.	.	T	0.31389	0.0795	.	.	.	0.38574	D	0.950015	.	.	.	.	.	.	T	0.36311	-0.9753	4	.	.	.	-0.8432	1.6582	0.02786	0.3355:0.1787:0.3413:0.1446	.	.	.	.	I	700	.	.	F	+	1	0	BMP2K	80051746	0.000000	0.05858	0.000000	0.03702	0.598000	0.36846	-2.175000	0.01263	-2.084000	0.00866	0.397000	0.26171	TTT		0.493	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593		27	51	0	0	0	0.004656	0	27	51				
COL25A1	84570	broad.mit.edu	37	4	109805343	109805343	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:109805343C>A	ENST00000399132.1	-	19	1541	c.1011G>T	c.(1009-1011)ccG>ccT	p.P337P	COL25A1_ENST00000399126.1_Silent_p.P337P|COL25A1_ENST00000399127.1_Silent_p.P333P	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		CCTTTATCCCCGGAAGTCCAG	0.408																																							uc003hze.1		NA																	0				ovary(2)	2						c.(1009-1011)CCG>CCT		collagen, type XXV, alpha 1 isoform 1							73.0	70.0	71.0					4																	109805343		1846	4081	5927	SO:0001819	synonymous_variant	84570					collagen|extracellular space	beta-amyloid binding|heparin binding	g.chr4:109805343C>A	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.1011G>T	4.37:g.109805343C>A						COL25A1_uc003hzg.2_Silent_p.P337P|COL25A1_uc003hzd.2_RNA|COL25A1_uc003hzf.2_Silent_p.P118P	p.P337P	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000173)	18	1542	-		Hepatocellular(203;0.217)	337			Extracellular (Potential).|Collagen-like 4.			Silent	SNP	ENST00000399132.1	37	c.1011G>T	CCDS43258.1																																																																																				0.408	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518		19	32	1	0	8.28177e-16	0.007413	1.55397e-15	19	32				
ELOVL6	79071	broad.mit.edu	37	4	110980902	110980902	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:110980902C>T	ENST00000394607.3	-	4	393	c.230G>A	c.(229-231)gGt>gAt	p.G77D	ELOVL6_ENST00000506461.1_5'UTR|ELOVL6_ENST00000302274.3_Missense_Mutation_p.G77D			Q9H5J4	ELOV6_HUMAN	ELOVL fatty acid elongase 6	77					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty acid biosynthetic process (GO:0042759)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	8				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		TCGAAGAGCACCGAATATACT	0.403																																							uc003hzz.2		NA																	0				haematopoietic_and_lymphoid_tissue(1)	1						c.(229-231)GGT>GAT		elongation of very long chain fatty acids-like							67.0	62.0	64.0					4																	110980902		2203	4300	6503	SO:0001583	missense	79071				fatty acid elongation, saturated fatty acid|long-chain fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process		fatty acid elongase activity|protein binding	g.chr4:110980902C>T	AK027031	CCDS3690.1	4q25	2011-05-25	2011-05-25		ENSG00000170522	ENSG00000170522			15829	protein-coding gene	gene with protein product		611546	"""ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"""			11567032	Standard	NM_024090		Approved	FLJ23378, MGC5487, LCE	uc003hzz.3	Q9H5J4	OTTHUMG00000132547	ENST00000394607.3:c.230G>A	4.37:g.110980902C>T	ENSP00000378105:p.Gly77Asp					ELOVL6_uc003iaa.2_Missense_Mutation_p.G77D	p.G77D	NM_001130721	NP_001124193	Q9H5J4	ELOV6_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00462)	4	356	-			77			Helical; (Potential).		Q4W5L0|Q8NCD1	Missense_Mutation	SNP	ENST00000394607.3	37	c.230G>A	CCDS3690.1	.	.	.	.	.	.	.	.	.	.	C	34	5.306889	0.95629	.	.	ENSG00000170522	ENST00000394607;ENST00000302274;ENST00000506625;ENST00000503885	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	5.51	5.51	0.81932	.	0.099330	0.64402	D	0.000002	T	0.61813	0.2377	M	0.92970	3.365	0.80722	D	1	D	0.67145	0.996	D	0.74348	0.983	T	0.65643	-0.6118	10	0.35671	T	0.21	-19.5071	19.8016	0.96509	0.0:1.0:0.0:0.0	.	77	Q9H5J4	ELOV6_HUMAN	D	77	ENSP00000378105:G77D;ENSP00000304736:G77D;ENSP00000425488:G77D;ENSP00000426086:G77D	ENSP00000304736:G77D	G	-	2	0	ELOVL6	111200351	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.718000	0.84743	2.770000	0.95276	0.655000	0.94253	GGT		0.403	ELOVL6-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255748.1	NM_024090		6	22	0	0	0	0.001168	0	6	22				
NAA15	80155	broad.mit.edu	37	4	140291517	140291518	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:140291517_140291518GG>AT	ENST00000296543.5	+	15	2229_2230	c.1906_1907GG>AT	c.(1906-1908)GGa>ATa	p.G636I	NAA15_ENST00000398947.1_Missense_Mutation_p.G636I	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	636	Interaction with HYPK.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						tgaggagataggaggtccaaaa	0.356																																							uc003ihu.1		NA																	0				ovary(1)|skin(1)	2						c.(1906-1908)GGA>ATA		NMDA receptor regulated 1																																				SO:0001583	missense	80155				angiogenesis|cell differentiation|N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	protein binding	g.chr4:140291517_140291518GG>AT	AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	Exception_encountered	4.37:g.140291517_140291518delinsAT	ENSP00000296543:p.Gly636Ile						p.G636I	NM_057175	NP_476516	Q9BXJ9	NAA15_HUMAN			15	2162_2163	+			636					D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Missense_Mutation	DNP	ENST00000296543.5	37	c.1906_1907GG>AT	CCDS43270.1																																																																																				0.356	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000267839.2	NM_057175		3	27	0	0	0	0.004672	0	3	27				
FAT1	2195	broad.mit.edu	37	4	187541782	187541782	+	Silent	SNP	C	C	T	rs370045952		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr4:187541782C>T	ENST00000441802.2	-	10	6167	c.5958G>A	c.(5956-5958)gcG>gcA	p.A1986A		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1986	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A1989A(2)|p.A1986A(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CTTTCACTACCGCAGAGTAGA	0.438										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(5956-5958)GCG>GCA		FAT tumor suppressor 1 precursor		C		0,3690		0,0,1845	220.0	218.0	219.0		5958	-10.5	0.0	4		219	2,8200		0,2,4099	no	coding-synonymous	FAT1	NM_005245.3		0,2,5944	TT,TC,CC		0.0244,0.0,0.0168		1986/4589	187541782	2,11890	1845	4101	5946	SO:0001819	synonymous_variant	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187541782C>T	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.5958G>A	4.37:g.187541782C>T		HNSCC(5;0.00058)					p.A1986A	NM_005245	NP_005236	Q14517	FAT1_HUMAN			10	6146	-			1986			Extracellular (Potential).|Cadherin 18.			Silent	SNP	ENST00000441802.2	37	c.5958G>A	CCDS47177.1																																																																																				0.438	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		63	172	0	0	0	0.00361	0	63	172				
ADAMTS16	170690	broad.mit.edu	37	5	5237092	5237092	+	Missense_Mutation	SNP	A	A	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:5237092A>C	ENST00000274181.7	+	14	2172	c.2034A>C	c.(2032-2034)ttA>ttC	p.L678F	ADAMTS16_ENST00000513709.1_Intron	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	678	Cys-rich.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						ATCAGGACTTATGCAAACTCT	0.333																																							uc003jdl.2		NA																	0				ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						c.(2032-2034)TTA>TTC		ADAM metallopeptidase with thrombospondin type 1							141.0	127.0	132.0					5																	5237092		1838	4083	5921	SO:0001583	missense	170690				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:5237092A>C	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2034A>C	5.37:g.5237092A>C	ENSP00000274181:p.Leu678Phe					ADAMTS16_uc003jdk.1_Missense_Mutation_p.L678F|ADAMTS16_uc010itk.1_Intron	p.L678F	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN			14	2172	+			678			Cys-rich.		C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	c.2034A>C	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	A	5.752	0.323107	0.10900	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.03607	3.87	5.75	3.36	0.38483	.	0.508381	0.19019	N	0.124871	T	0.03695	0.0105	L	0.51422	1.61	0.31363	N	0.681131	B;B	0.14012	0.007;0.009	B;B	0.17722	0.007;0.019	T	0.26018	-1.0115	10	0.10111	T	0.7	.	6.5896	0.22639	0.6243:0.2987:0.077:0.0	.	678;678	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	F	678	ENSP00000274181:L678F	ENSP00000274181:L678F	L	+	3	2	ADAMTS16	5290092	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	0.619000	0.24388	0.982000	0.38575	0.533000	0.62120	TTA		0.333	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		66	73	0	0	0	0.00361	0	66	73				
ICE1	23379	broad.mit.edu	37	5	5489358	5489358	+	Missense_Mutation	SNP	G	G	A	rs373516910		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:5489358G>A	ENST00000296564.7	+	19	6938	c.6716G>A	c.(6715-6717)cGg>cAg	p.R2239Q		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		2239					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GAAGCTTGGCGGAGAGAGGCC	0.532																																							uc003jdm.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(6715-6717)CGG>CAG		hypothetical protein LOC23379		G	GLN/ARG	0,3956		0,0,1978	56.0	59.0	58.0		6716	3.7	0.8	5		58	1,8321		0,1,4160	no	missense	KIAA0947	NM_015325.1	43	0,1,6138	AA,AG,GG		0.012,0.0,0.0081	probably-damaging	2239/2267	5489358	1,12277	1978	4161	6139	SO:0001583	missense	23379							g.chr5:5489358G>A																												ENST00000296564.7:c.6716G>A	5.37:g.5489358G>A	ENSP00000296564:p.Arg2239Gln						p.R2239Q	NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN			19	6938	+			2239					Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	c.6716G>A	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387637	0.82902	0.0	1.2E-4	ENSG00000164151	ENST00000296564	T	0.69040	-0.37	5.54	3.66	0.41972	.	.	.	.	.	T	0.74764	0.3759	L	0.55481	1.735	0.32186	N	0.579703	D	0.89917	1.0	D	0.80764	0.994	T	0.76495	-0.2938	9	0.59425	D	0.04	-4.7986	8.0923	0.30807	0.0891:0.1606:0.7503:0.0	.	2239	Q9Y2F5	K0947_HUMAN	Q	2239	ENSP00000296564:R2239Q	ENSP00000296564:R2239Q	R	+	2	0	KIAA0947	5542358	1.000000	0.71417	0.841000	0.33234	0.979000	0.70002	3.395000	0.52558	1.477000	0.48234	0.650000	0.86243	CGG		0.532	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			3	47	0	0	0	0.004672	0	3	47				
DNAH5	1767	broad.mit.edu	37	5	13823411	13823411	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:13823411C>A	ENST00000265104.4	-	40	6752	c.6648G>T	c.(6646-6648)aaG>aaT	p.K2216N		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2216					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGTAACCTGCCTTGTCCAGAA	0.388									Kartagener syndrome																														uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(6646-6648)AAG>AAT		dynein, axonemal, heavy chain 5							142.0	149.0	146.0					5																	13823411		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13823411C>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6648G>T	5.37:g.13823411C>A	ENSP00000265104:p.Lys2216Asn						p.K2216N	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN			40	6690	-	Lung NSC(4;0.00476)		2216					Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.6648G>T	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703377	0.48412	.	.	ENSG00000039139	ENST00000265104	T	0.39787	1.06	6.17	0.582	0.17412	.	0.000000	0.85682	D	0.000000	T	0.46092	0.1375	M	0.84326	2.69	0.58432	D	0.999999	B	0.28850	0.225	B	0.32677	0.15	T	0.45745	-0.9240	10	0.56958	D	0.05	.	11.2662	0.49112	0.0:0.4159:0.0:0.5841	.	2216	Q8TE73	DYH5_HUMAN	N	2216	ENSP00000265104:K2216N	ENSP00000265104:K2216N	K	-	3	2	DNAH5	13876411	0.459000	0.25768	0.989000	0.46669	0.954000	0.61252	-0.257000	0.08745	-0.205000	0.10219	-0.140000	0.14226	AAG		0.388	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		122	115	1	0	2.51472e-61	0.00361	5.45256e-61	122	115				
CDH9	1007	broad.mit.edu	37	5	26902674	26902674	+	Nonsense_Mutation	SNP	G	G	T	rs201926799		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:26902674G>T	ENST00000231021.4	-	7	1336	c.1164C>A	c.(1162-1164)taC>taA	p.Y388*		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	388	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CTTCTATCAAGTAAGAGACTT	0.393																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	0				ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(1162-1164)TAC>TAA		cadherin 9, type 2 preproprotein							128.0	123.0	125.0					5																	26902674		2203	4300	6503	SO:0001587	stop_gained	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26902674G>T	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1164C>A	5.37:g.26902674G>T	ENSP00000231021:p.Tyr388*						p.Y388*	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN			7	1333	-			388			Extracellular (Potential).|Cadherin 4.		Q3B7I5	Nonsense_Mutation	SNP	ENST00000231021.4	37	c.1164C>A	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.978258	0.92982	.	.	ENSG00000113100	ENST00000231021	.	.	.	5.62	1.11	0.20524	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0553	0.25095	0.6101:0.0:0.3899:0.0	.	.	.	.	X	388	.	.	Y	-	3	2	CDH9	26938431	0.932000	0.31603	0.983000	0.44433	0.711000	0.40976	1.283000	0.33237	0.278000	0.22164	-1.000000	0.02509	TAC		0.393	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		7	195	1	0	0.000274275	0.004482	0.000321873	7	195				
ADAMTS12	81792	broad.mit.edu	37	5	33616054	33616054	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:33616054C>G	ENST00000504830.1	-	15	2602	c.2267G>C	c.(2266-2268)gGg>gCg	p.G756A	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.G671A|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	756	Spacer 1.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G756V(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GATAATAAACCCTCCATTCAG	0.478										HNSCC(64;0.19)																													uc003jia.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(2266-2268)GGG>GCG		ADAM metallopeptidase with thrombospondin type 1							133.0	127.0	129.0					5																	33616054		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33616054C>G	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2267G>C	5.37:g.33616054C>G	ENSP00000422554:p.Gly756Ala	HNSCC(64;0.19)				ADAMTS12_uc010iuq.1_Missense_Mutation_p.G671A	p.G756A	NM_030955	NP_112217	P58397	ATS12_HUMAN			15	2430	-			756			Spacer 1.		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.2267G>C	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.692604	0.68271	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.50277	0.75;0.75	5.51	5.51	0.81932	ADAM-TS Spacer 1 (1);	0.227351	0.45126	D	0.000384	T	0.45856	0.1363	L	0.31804	0.96	0.80722	D	1	P;P	0.51537	0.946;0.877	P;P	0.49953	0.509;0.627	T	0.32877	-0.9890	10	0.38643	T	0.18	.	14.6129	0.68529	0.0:0.8542:0.1458:0.0	.	671;756	P58397-3;P58397	.;ATS12_HUMAN	A	756;671	ENSP00000422554:G756A;ENSP00000344847:G671A	ENSP00000344847:G671A	G	-	2	0	ADAMTS12	33651811	0.987000	0.35691	1.000000	0.80357	0.890000	0.51754	2.537000	0.45702	2.558000	0.86282	0.561000	0.74099	GGG		0.478	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		30	242	0	0	0	0.002445	0	30	242				
ADAMTS12	81792	broad.mit.edu	37	5	33649757	33649757	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:33649757C>A	ENST00000504830.1	-	8	1571	c.1236G>T	c.(1234-1236)gtG>gtT	p.V412V	ADAMTS12_ENST00000352040.3_Silent_p.V412V|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	412	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GATGTCTGCCCACAGGCTCAC	0.547										HNSCC(64;0.19)																													uc003jia.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(1234-1236)GTG>GTT		ADAM metallopeptidase with thrombospondin type 1							171.0	145.0	154.0					5																	33649757		2203	4300	6503	SO:0001819	synonymous_variant	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33649757C>A	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1236G>T	5.37:g.33649757C>A		HNSCC(64;0.19)				ADAMTS12_uc010iuq.1_Silent_p.V412V	p.V412V	NM_030955	NP_112217	P58397	ATS12_HUMAN			8	1399	-			412			Peptidase M12B.		A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	ENST00000504830.1	37	c.1236G>T	CCDS34140.1																																																																																				0.547	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		6	136	1	0	0.000157383	0.00308	0.000188254	6	136				
DNAJC21	134218	broad.mit.edu	37	5	34937456	34937456	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:34937456G>T	ENST00000342382.4	+	5	691	c.464G>T	c.(463-465)tGg>tTg	p.W155L	DNAJC21_ENST00000303525.7_Missense_Mutation_p.W155L|DNAJC21_ENST00000382021.2_Missense_Mutation_p.W155L			Q5F1R6	DJC21_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 21	155					protein folding (GO:0006457)	ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			TACGCTTATTGGCAGAGTTTC	0.373																																							uc003jjc.2		NA																	0				breast(1)|skin(1)	2						c.(463-465)TGG>TTG		DnaJ homology subfamily A member 5 isoform 2							62.0	63.0	63.0					5																	34937456		2203	4300	6503	SO:0001583	missense	134218				protein folding	ribosome	heat shock protein binding|nucleic acid binding|unfolded protein binding|zinc ion binding	g.chr5:34937456G>T		CCDS3907.2, CCDS34144.1	5p13-p12	2012-10-05			ENSG00000168724	ENSG00000168724		"""Heat shock proteins / DNAJ (HSP40)"""	27030	protein-coding gene	gene with protein product	"""JJJ1 DnaJ domain protein homolog (S. cerevisiae)"""					15067379	Standard	XM_005248250		Approved	GS3, DNAJA5, JJJ1	uc003jjc.3	Q5F1R6	OTTHUMG00000074103	ENST00000342382.4:c.464G>T	5.37:g.34937456G>T	ENSP00000343728:p.Trp155Leu					DNAJC21_uc003jjb.2_Missense_Mutation_p.W155L|DNAJC21_uc010iuu.1_Missense_Mutation_p.W39L	p.W155L	NM_001012339	NP_001012339	Q5F1R6	DJC21_HUMAN	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		5	691	+	all_lung(31;7.08e-05)		155					Q3B7J9|Q6P086|Q6ZS43|Q86VC6	Missense_Mutation	SNP	ENST00000342382.4	37	c.464G>T	CCDS34144.1	.	.	.	.	.	.	.	.	.	.	G	33	5.284004	0.95489	.	.	ENSG00000168724	ENST00000342382;ENST00000382021;ENST00000303525	T;T;T	0.69040	-0.34;-0.37;-0.36	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.87501	0.6193	H	0.95470	3.675	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.971	D;D;P	0.67231	0.928;0.95;0.779	D	0.90610	0.4551	10	0.87932	D	0	-9.3457	19.9117	0.97026	0.0:0.0:1.0:0.0	.	155;155;155	Q5F1R6-3;Q5F1R6;Q5F1R6-2	.;DJC21_HUMAN;.	L	155	ENSP00000343728:W155L;ENSP00000371451:W155L;ENSP00000306289:W155L	ENSP00000306289:W155L	W	+	2	0	DNAJC21	34973213	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.378000	0.97191	2.774000	0.95407	0.650000	0.86243	TGG		0.373	DNAJC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157337.1	NM_194283		11	107	1	0	2.80697e-09	0.000978	4.34731e-09	11	107				
PRLR	5618	broad.mit.edu	37	5	35066176	35066176	+	Missense_Mutation	SNP	G	G	T	rs565387396		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:35066176G>T	ENST00000382002.5	-	10	1310	c.884C>A	c.(883-885)gCc>gAc	p.A295D	PRLR_ENST00000509934.1_5'Flank|PRLR_ENST00000513753.1_Intron|PRLR_ENST00000231423.3_Missense_Mutation_p.A295D|PRLR_ENST00000348262.3_Intron|PRLR_ENST00000542609.1_Intron|PRLR_ENST00000397391.3_Intron|PRLR_ENST00000310101.5_Missense_Mutation_p.A295D|PRLR_ENST00000511486.1_Missense_Mutation_p.A194D|PRLR_ENST00000342362.5_Missense_Mutation_p.A194D	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	295					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	GCATCCCAAGGCACTCAGTAG	0.438																																							uc003jjm.2		NA																	0				ovary(2)|skin(1)	3						c.(883-885)GCC>GAC		prolactin receptor precursor	Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)						50.0	44.0	46.0					5																	35066176		2203	4300	6503	SO:0001583	missense	5618				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity	g.chr5:35066176G>T		CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.884C>A	5.37:g.35066176G>T	ENSP00000371432:p.Ala295Asp					PRLR_uc003jjg.1_Missense_Mutation_p.A295D|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Missense_Mutation_p.A194D	p.A295D	NM_000949	NP_000940	P16471	PRLR_HUMAN	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		10	1414	-	all_lung(31;3.83e-05)		295			Cytoplasmic (Potential).		B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	ENST00000382002.5	37	c.884C>A	CCDS3909.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354585	0.82243	.	.	ENSG00000113494	ENST00000231423;ENST00000342362;ENST00000382002;ENST00000511486;ENST00000310101	T;T;T;T;T	0.78126	-1.15;-1.01;-1.01;-1.01;-1.13	5.78	5.78	0.91487	.	0.144759	0.64402	D	0.000007	D	0.90410	0.6998	M	0.88105	2.93	0.58432	D	0.999991	D;D;D	0.76494	0.989;0.999;0.998	P;D;D	0.74674	0.845;0.961;0.984	D	0.91405	0.5146	10	0.87932	D	0	-15.6055	20.0022	0.97423	0.0:0.0:1.0:0.0	.	295;194;295	P16471;P16471-2;P16471-4	PRLR_HUMAN;.;.	D	295;194;295;194;295	ENSP00000231423:A295D;ENSP00000339213:A194D;ENSP00000371432:A295D;ENSP00000422556:A194D;ENSP00000309008:A295D	ENSP00000231423:A295D	A	-	2	0	PRLR	35101933	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	7.235000	0.78143	2.738000	0.93877	0.655000	0.94253	GCC		0.438	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207575.2			6	71	1	0	2.0095e-06	0.001984	2.71242e-06	6	71				
SPEF2	79925	broad.mit.edu	37	5	35800100	35800100	+	Nonsense_Mutation	SNP	A	A	T	rs373297347		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:35800100A>T	ENST00000356031.3	+	34	5015	c.4861A>T	c.(4861-4863)Aag>Tag	p.K1621*	SPEF2_ENST00000440995.2_Nonsense_Mutation_p.K1616*|CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000303129.4_Nonsense_Mutation_p.K418*	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1621					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGACTATGAGAAGGATCCACC	0.458																																							uc003jjo.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(4861-4863)AAG>TAG		KPL2 protein isoform 1							252.0	229.0	237.0					5																	35800100		1975	4159	6134	SO:0001587	stop_gained	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35800100A>T	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4861A>T	5.37:g.35800100A>T	ENSP00000348314:p.Lys1621*					SPEF2_uc003jjp.1_Nonsense_Mutation_p.K1107*|SPEF2_uc003jjr.2_Nonsense_Mutation_p.K676*	p.K1621*	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		34	4972	+	all_lung(31;7.56e-05)		1621					Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Nonsense_Mutation	SNP	ENST00000356031.3	37	c.4861A>T	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	A	41	8.817971	0.98966	.	.	ENSG00000152582	ENST00000356031;ENST00000440995;ENST00000303129	.	.	.	5.57	3.12	0.35913	.	0.685525	0.15712	N	0.248341	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.7349	0.12982	0.7119:0.0:0.1488:0.1393	.	.	.	.	X	1621;1616;418	.	ENSP00000303843:K418X	K	+	1	0	SPEF2	35835857	0.106000	0.21978	0.674000	0.29902	0.253000	0.25986	1.803000	0.38863	0.377000	0.24735	0.459000	0.35465	AAG		0.458	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		21	540	0	0	0	0.00333	0	21	540				
SLC1A3	6507	broad.mit.edu	37	5	36677170	36677170	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:36677170C>A	ENST00000265113.4	+	6	1220	c.744C>A	c.(742-744)gtC>gtA	p.V248V	SLC1A3_ENST00000381918.3_Silent_p.V248V|CTD-2353F22.1_ENST00000510740.1_RNA	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	248					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GTCTAGTTGTCTTCTCCATGT	0.498																																							uc003jkj.3		NA																	0					0						c.(742-744)GTC>GTA		solute carrier family 1 (glial high affinity	L-Glutamic Acid(DB00142)						173.0	162.0	166.0					5																	36677170		2203	4300	6503	SO:0001819	synonymous_variant	6507				D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity	g.chr5:36677170C>A		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.744C>A	5.37:g.36677170C>A						SLC1A3_uc011cox.1_Silent_p.V141V|SLC1A3_uc010iuy.2_Silent_p.V248V	p.V248V	NM_004172	NP_004163	P43003	EAA1_HUMAN	Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		6	1220	+	all_lung(31;0.000245)		248			Helical; (Potential).		B2R5T3|Q4JCQ8	Silent	SNP	ENST00000265113.4	37	c.744C>A	CCDS3919.1																																																																																				0.498	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172		72	57	1	0	1.93348e-29	0.00361	4.06327e-29	72	57				
C7	730	broad.mit.edu	37	5	40972553	40972553	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:40972553C>A	ENST00000313164.9	+	15	2290	c.1931C>A	c.(1930-1932)cCc>cAc	p.P644H		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	644	CCP 2.|Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				CAGAGTCACCCCCAAAAACCT	0.448																																							uc003jmh.2		NA																	0					0						c.(1930-1932)CCC>CAC		complement component 7 precursor							150.0	144.0	146.0					5																	40972553		1989	4169	6158	SO:0001583	missense	730				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex		g.chr5:40972553C>A	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1931C>A	5.37:g.40972553C>A	ENSP00000322061:p.Pro644His					C7_uc011cpn.1_RNA	p.P644H	NM_000587	NP_000578	P10643	CO7_HUMAN			15	2045	+		Ovarian(839;0.0112)	644			Sushi 2.		Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	c.1931C>A	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388059	0.82902	.	.	ENSG00000112936	ENST00000313164	T	0.64803	-0.12	5.84	5.84	0.93424	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.81823	0.4904	M	0.82630	2.6	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.81560	-0.0877	10	0.48119	T	0.1	-15.4463	19.7245	0.96157	0.0:1.0:0.0:0.0	.	644	P10643	CO7_HUMAN	H	644	ENSP00000322061:P644H	ENSP00000322061:P644H	P	+	2	0	C7	41008310	0.260000	0.24053	0.889000	0.34880	0.907000	0.53573	2.028000	0.41088	2.758000	0.94735	0.591000	0.81541	CCC		0.448	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			14	95	1	0	9.31168e-06	0.001855	1.22305e-05	14	95				
MROH2B	133558	broad.mit.edu	37	5	41038949	41038949	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:41038949G>T	ENST00000399564.4	-	21	2553	c.2103C>A	c.(2101-2103)gtC>gtA	p.V701V	MROH2B_ENST00000506092.2_Silent_p.V256V	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	701																	AGATGACCATGACATCTGTCT	0.453																																							uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(2101-2103)GTC>GTA		HEAT repeat family member 7B2							74.0	71.0	72.0					5																	41038949		1865	4097	5962	SO:0001819	synonymous_variant	133558						binding	g.chr5:41038949G>T		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2103C>A	5.37:g.41038949G>T						HEATR7B2_uc003jmi.3_Silent_p.V256V	p.V701V	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN			21	2593	-			701					Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	c.2103C>A	CCDS47202.1																																																																																				0.453	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		8	96	1	0	0.00307968	0.00308	0.00347099	8	96				
MROH2B	133558	broad.mit.edu	37	5	41054884	41054884	+	Silent	SNP	A	A	T	rs538269544		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:41054884A>T	ENST00000399564.4	-	11	1542	c.1092T>A	c.(1090-1092)ggT>ggA	p.G364G	MROH2B_ENST00000506092.2_Intron	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	364																	TACTGAGATCACCCATGACGA	0.363																																							uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(1090-1092)GGT>GGA		HEAT repeat family member 7B2							152.0	143.0	146.0					5																	41054884		1827	4073	5900	SO:0001819	synonymous_variant	133558						binding	g.chr5:41054884A>T		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1092T>A	5.37:g.41054884A>T						HEATR7B2_uc003jmi.3_Intron	p.G364G	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN			11	1582	-			364					Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	c.1092T>A	CCDS47202.1																																																																																				0.363	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		23	150	0	0	0	0.004656	0	23	150				
PLCXD3	345557	broad.mit.edu	37	5	41313735	41313735	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:41313735C>A	ENST00000377801.3	-	3	1024	c.950G>T	c.(949-951)gGa>gTa	p.G317V	PLCXD3_ENST00000328457.3_Missense_Mutation_p.G317V			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	317					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GTTGGCTTCTCCTTCATCAAA	0.403																																							uc003jmm.1		NA																	0				skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						c.(949-951)GGA>GTA		phosphatidylinositol-specific phospholipase C, X							122.0	109.0	113.0					5																	41313735		2203	4300	6503	SO:0001583	missense	345557				intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity	g.chr5:41313735C>A		CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.950G>T	5.37:g.41313735C>A	ENSP00000367032:p.Gly317Val						p.G317V	NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN			3	1052	-			317					A6NL04	Missense_Mutation	SNP	ENST00000377801.3	37	c.950G>T	CCDS34150.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417566	0.42918	.	.	ENSG00000182836	ENST00000377801;ENST00000328457	.	.	.	5.39	3.57	0.40892	.	0.326457	0.32970	N	0.005439	T	0.28101	0.0693	N	0.04880	-0.145	0.58432	D	0.999999	B	0.23058	0.079	B	0.20955	0.032	T	0.09751	-1.0660	9	0.30854	T	0.27	-13.0992	9.6429	0.39850	0.0:0.8003:0.0:0.1997	.	317	Q63HM9	PLCX3_HUMAN	V	317	.	ENSP00000333751:G317V	G	-	2	0	PLCXD3	41349492	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	2.957000	0.49137	2.528000	0.85240	0.655000	0.94253	GGA		0.403	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367109.1	XM_293875		24	119	1	0	1.42536e-11	0.004656	2.35719e-11	24	119				
ANKRD55	79722	broad.mit.edu	37	5	55407117	55407117	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:55407117G>T	ENST00000341048.4	-	10	1609	c.1458C>A	c.(1456-1458)tgC>tgA	p.C486*	ANKRD55_ENST00000504958.2_Nonsense_Mutation_p.C443*|ANKRD55_ENST00000505970.2_5'Flank|ANKRD55_ENST00000434982.2_Nonsense_Mutation_p.C198*	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	486										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				GTAACATCTGGCAGCCAGTTC	0.453																																							uc003jqu.2		NA																	0				skin(1)	1						c.(1456-1458)TGC>TGA		ankyrin repeat domain 55 isoform 1							123.0	130.0	127.0					5																	55407117		2203	4300	6503	SO:0001587	stop_gained	79722							g.chr5:55407117G>T	AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.1458C>A	5.37:g.55407117G>T	ENSP00000342295:p.Cys486*					ANKRD55_uc003jqt.2_Nonsense_Mutation_p.C198*	p.C486*	NM_024669	NP_078945	Q3KP44	ANR55_HUMAN			10	1610	-		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)	485					B3KVT8|Q3KP45|Q9HAD3	Nonsense_Mutation	SNP	ENST00000341048.4	37	c.1458C>A	CCDS34161.1	.	.	.	.	.	.	.	.	.	.	.	34	5.376048	0.95923	.	.	ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000504958;ENST00000434982	.	.	.	5.63	2.81	0.32909	.	0.314503	0.33959	N	0.004383	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.7547	0.13077	0.1349:0.121:0.6192:0.125	.	.	.	.	X	486;486;443;198	.	ENSP00000342295:C486X	C	-	3	2	ANKRD55	55442874	1.000000	0.71417	0.998000	0.56505	0.822000	0.46500	1.235000	0.32671	0.818000	0.34468	0.655000	0.94253	TGC		0.453	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	NM_024669		50	128	1	0	6.14515e-18	0.00361	1.18229e-17	50	128				
SV2C	22987	broad.mit.edu	37	5	75427578	75427578	+	Start_Codon_SNP	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:75427578G>T	ENST00000502798.2	+	2	445	c.3G>T	c.(1-3)atG>atT	p.M1I	SV2C_ENST00000322285.7_Start_Codon_SNP_p.M1I	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	1	Interaction with SYT1. {ECO:0000250}.				neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GAGATAAGATGGAAGACTCTT	0.443																																							uc003kei.1		NA																	0				skin(1)	1						c.(1-3)ATG>ATT		synaptic vesicle glycoprotein 2C							94.0	88.0	90.0					5																	75427578		1926	4153	6079	SO:0001582	initiator_codon_variant	22987				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr5:75427578G>T	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.3G>T	5.37:g.75427578G>T	ENSP00000423541:p.Met1Ile						p.M1I	NM_014979	NP_055794	Q496J9	SV2C_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)	2	137	+		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)	1			Interaction with SYT1 (By similarity).|Cytoplasmic (Potential).		Q496K1|Q9UPU8	Missense_Mutation	SNP	ENST00000502798.2	37	c.3G>T	CCDS43331.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875664	0.91664	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	T;D	0.81499	-1.12;-1.5	5.76	5.76	0.90799	Major facilitator superfamily domain, general substrate transporter (1);	0.123445	0.64402	D	0.000014	D	0.90638	0.7064	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	D	0.91094	0.4909	9	0.87932	D	0	-32.5574	19.9694	0.97278	0.0:0.0:1.0:0.0	.	1	Q496J9	SV2C_HUMAN	I	1	ENSP00000423541:M1I;ENSP00000316983:M1I	ENSP00000316983:M1I	M	+	3	0	SV2C	75463334	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	9.869000	0.99810	2.719000	0.93026	0.655000	0.94253	ATG		0.443	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4		Missense_Mutation	8	25	1	0	5.4927e-09	0.004482	8.41147e-09	8	25				
DMGDH	29958	broad.mit.edu	37	5	78328549	78328549	+	Missense_Mutation	SNP	G	G	T	rs148916205	byFrequency	TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:78328549G>T	ENST00000255189.3	-	9	1506	c.1478C>A	c.(1477-1479)cCg>cAg	p.P493Q	DMGDH_ENST00000540686.1_Missense_Mutation_p.P113Q|DMGDH_ENST00000380311.4_Missense_Mutation_p.P292Q	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	493					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		GAACCAGTGCGGCTGCTCCCA	0.562																																							uc003kfs.2		NA																	0				ovary(2)|liver(1)|skin(1)	4						c.(1477-1479)CCG>CAG		dimethylglycine dehydrogenase precursor							128.0	130.0	129.0					5																	78328549		2203	4300	6503	SO:0001583	missense	29958				choline metabolic process|glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|dimethylglycine dehydrogenase activity|electron carrier activity	g.chr5:78328549G>T	AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.1478C>A	5.37:g.78328549G>T	ENSP00000255189:p.Pro493Gln					DMGDH_uc011cte.1_Missense_Mutation_p.P343Q|DMGDH_uc011ctf.1_Missense_Mutation_p.P292Q|DMGDH_uc011ctg.1_Missense_Mutation_p.P113Q	p.P493Q	NM_013391	NP_037523	Q9UI17	M2GD_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)	9	1484	-		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)	493					B2RBN0|B4E1J9	Missense_Mutation	SNP	ENST00000255189.3	37	c.1478C>A	CCDS4044.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.008920	0.93346	.	.	ENSG00000132837	ENST00000255189;ENST00000523732;ENST00000380311;ENST00000540686;ENST00000539598	D;D;D;D	0.94457	-3.43;-3.43;-3.43;-3.43	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.97882	0.9304	M	0.90425	3.115	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.995;0.999;0.998;0.995	D	0.98448	1.0590	10	0.87932	D	0	.	19.597	0.95544	0.0:0.0:1.0:0.0	.	113;292;343;493	B4E1J9;F8W6P8;F5H1C7;Q9UI17	.;.;.;M2GD_HUMAN	Q	493;332;292;113;343	ENSP00000255189:P493Q;ENSP00000430972:P332Q;ENSP00000369667:P292Q;ENSP00000439478:P113Q	ENSP00000255189:P493Q	P	-	2	0	DMGDH	78364305	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.718000	0.98758	2.639000	0.89480	0.655000	0.94253	CCG		0.562	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226963.3	NM_013391		48	119	1	0	2.29192e-23	0.00361	4.60405e-23	48	119				
VCAN	1462	broad.mit.edu	37	5	82834365	82834365	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:82834365C>G	ENST00000265077.3	+	8	6108	c.5543C>G	c.(5542-5544)aCt>aGt	p.T1848S	VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.T861S|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1848	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GAAACCACCACTGTTTCTTCA	0.507																																							uc003kii.3		NA																	0				ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16						c.(5542-5544)ACT>AGT		versican isoform 1 precursor							105.0	117.0	113.0					5																	82834365		2203	4299	6502	SO:0001583	missense	1462				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr5:82834365C>G	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5543C>G	5.37:g.82834365C>G	ENSP00000265077:p.Thr1848Ser					VCAN_uc003kij.3_Missense_Mutation_p.T861S|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Missense_Mutation_p.T512S	p.T1848S	NM_004385	NP_004376	P13611	CSPG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	8	5899	+		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)	1848			GAG-beta.		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	c.5543C>G	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929223	0.52759	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.88431	-2.38;-2.37;2.81	5.82	4.94	0.65067	.	0.190130	0.37715	N	0.001963	D	0.83041	0.5168	L	0.60455	1.87	0.80722	D	1	P;P	0.38535	0.513;0.635	B;B	0.32090	0.103;0.14	T	0.79085	-0.1948	10	0.15952	T	0.53	.	10.1253	0.42646	0.0:0.7903:0.1382:0.0715	.	861;1848	P13611-2;P13611	.;CSPG2_HUMAN	S	1848;861;861	ENSP00000265077:T1848S;ENSP00000340062:T861S;ENSP00000426251:T861S	ENSP00000265077:T1848S	T	+	2	0	VCAN	82870121	0.023000	0.18921	0.694000	0.30210	0.907000	0.53573	1.981000	0.40628	1.449000	0.47699	0.655000	0.94253	ACT		0.507	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		40	129	0	0	0	0.007835	0	40	129				
KCNN2	3781	broad.mit.edu	37	5	113831760	113831760	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:113831760G>T	ENST00000512097.3	+	9	2639	c.1621G>T	c.(1621-1623)Gag>Tag	p.E541*	KCNN2_ENST00000264773.3_Nonsense_Mutation_p.E541*|KCNN2_ENST00000503706.1_Nonsense_Mutation_p.E193*|RP11-492A10.1_ENST00000514115.1_RNA			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	541					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	AGATTTCATTGAGGCTCAGAT	0.552																																							uc003kqo.2		NA																	0				ovary(2)	2						c.(1621-1623)GAG>TAG		small conductance calcium-activated potassium							123.0	120.0	121.0					5																	113831760		2202	4300	6502	SO:0001587	stop_gained	3781					integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity	g.chr5:113831760G>T	AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.1621G>T	5.37:g.113831760G>T	ENSP00000427120:p.Glu541*					KCNN2_uc003kqp.2_Nonsense_Mutation_p.E193*|KCNN2_uc010jcg.2_RNA|uc003kqr.1_Intron	p.E541*	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	8	2078	+		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)	541					A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Nonsense_Mutation	SNP	ENST00000512097.3	37	c.1621G>T	CCDS4114.1	.	.	.	.	.	.	.	.	.	.	G	38	7.063642	0.98036	.	.	ENSG00000080709	ENST00000264773;ENST00000503706	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	18.5437	0.91039	0.0:0.0:1.0:0.0	.	.	.	.	X	541;193	.	ENSP00000264773:E541X	E	+	1	0	KCNN2	113859659	1.000000	0.71417	0.946000	0.38457	0.939000	0.58152	9.348000	0.97062	2.481000	0.83766	0.643000	0.83706	GAG		0.552	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250775.2	NM_021614		38	77	1	0	3.33393e-15	0.004878	6.08844e-15	38	77				
PCDHB6	56130	broad.mit.edu	37	5	140530589	140530589	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:140530589C>T	ENST00000231136.1	+	1	751	c.751C>T	c.(751-753)Cct>Tct	p.P251S	PCDHB6_ENST00000543635.1_Missense_Mutation_p.P115S	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	251	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCACAAGTCCCTGAGAACAA	0.527																																							uc003lir.2		NA																	0				skin(1)	1						c.(751-753)CCT>TCT		protocadherin beta 6 precursor							51.0	54.0	53.0					5																	140530589		2203	4300	6503	SO:0001583	missense	56130				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140530589C>T	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.751C>T	5.37:g.140530589C>T	ENSP00000231136:p.Pro251Ser					PCDHB6_uc011dah.1_Missense_Mutation_p.P115S	p.P251S	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	751	+			251			Cadherin 3.|Extracellular (Potential).		B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	c.751C>T	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	C	2.370	-0.344624	0.05208	.	.	ENSG00000113211	ENST00000543635;ENST00000231136;ENST00000542861	T;T	0.01584	4.75;4.75	4.85	0.964	0.19655	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01558	0.0050	L	0.28608	0.87	0.09310	N	1	B	0.24920	0.114	B	0.31869	0.137	T	0.49495	-0.8934	9	0.29301	T	0.29	.	0.9937	0.01462	0.4053:0.2522:0.1108:0.2317	.	251	Q9Y5E3	PCDB6_HUMAN	S	115;251;36	ENSP00000438466:P115S;ENSP00000231136:P251S	ENSP00000231136:P251S	P	+	1	0	PCDHB6	140510773	0.000000	0.05858	0.004000	0.12327	0.229000	0.25112	-2.911000	0.00698	0.188000	0.20168	0.561000	0.74099	CCT		0.527	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939		7	40	0	0	0	0.001984	0	7	40				
PCDHB10	56126	broad.mit.edu	37	5	140572143	140572143	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:140572143G>T	ENST00000239446.4	+	1	202	c.18G>T	c.(16-18)ttG>ttT	p.L6F		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	6					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCAGAGAGTTGTGCTTCCCAA	0.478																																							uc003lix.2		NA																	0				ovary(1)|skin(1)	2						c.(16-18)TTG>TTT		protocadherin beta 10 precursor							106.0	111.0	109.0					5																	140572143		2203	4300	6503	SO:0001583	missense	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140572143G>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.18G>T	5.37:g.140572143G>T	ENSP00000239446:p.Leu6Phe						p.L6F	NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	192	+			6					Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	c.18G>T	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	G	9.191	1.026070	0.19512	.	.	ENSG00000120324	ENST00000239446	T	0.49432	0.78	3.01	-0.888	0.10583	.	.	.	.	.	T	0.19327	0.0464	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14727	-1.0462	9	0.44086	T	0.13	.	0.5976	0.00739	0.2105:0.2392:0.346:0.2043	.	6	Q9UN67	PCDBA_HUMAN	F	6	ENSP00000239446:L6F	ENSP00000239446:L6F	L	+	3	2	PCDHB10	140552327	0.000000	0.05858	0.000000	0.03702	0.168000	0.22595	-0.745000	0.04834	-0.166000	0.10890	-0.345000	0.07892	TTG		0.478	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		30	97	1	0	1.08312e-15	0.009535	2.01572e-15	30	97				
PCDHB11	56125	broad.mit.edu	37	5	140580956	140580956	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:140580956G>A	ENST00000354757.3	+	1	1609	c.1609G>A	c.(1609-1611)Ggc>Agc	p.G537S	PCDHB11_ENST00000536699.1_Missense_Mutation_p.G172S	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	537	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACAGACCGCGGCTCCCCGGC	0.672																																							uc003liy.2		NA																	0				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(1609-1611)GGC>AGC		protocadherin beta 11 precursor							39.0	52.0	48.0					5																	140580956		2202	4299	6501	SO:0001583	missense	56125				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140580956G>A	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1609G>A	5.37:g.140580956G>A	ENSP00000346802:p.Gly537Ser					PCDHB11_uc011daj.1_Missense_Mutation_p.G172S	p.G537S	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1609	+			537			Extracellular (Potential).|Cadherin 5.		B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	c.1609G>A	CCDS4253.1	.	.	.	.	.	.	.	.	.	.	g	26.3	4.728236	0.89390	.	.	ENSG00000197479	ENST00000536699;ENST00000354757	T;T	0.01647	4.71;4.71	2.51	2.51	0.30379	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.13670	0.0331	M	0.93420	3.415	0.42316	D	0.992239	D	0.76494	0.999	D	0.77004	0.989	T	0.09818	-1.0657	9	0.87932	D	0	.	13.0572	0.58988	0.0:0.0:1.0:0.0	.	537	Q9Y5F2	PCDBB_HUMAN	S	172;537	ENSP00000440344:G172S;ENSP00000346802:G537S	ENSP00000346802:G537S	G	+	1	0	PCDHB11	140561140	1.000000	0.71417	0.008000	0.14137	0.054000	0.15201	7.451000	0.80668	1.412000	0.46977	0.298000	0.19748	GGC		0.672	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		24	74	0	0	0	0.003954	0	24	74				
PCDHB14	56122	broad.mit.edu	37	5	140603183	140603183	+	Missense_Mutation	SNP	G	G	T	rs572749343	byFrequency	TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:140603183G>T	ENST00000239449.4	+	1	106	c.106G>T	c.(106-108)Gca>Tca	p.A36S	PCDHB14_ENST00000515856.2_Intron	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	36	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTATTCTGTGGCAGAGGAAAC	0.512													g|||	2	0.000399361	0.0	0.0029	5008	,	,		19221	0.0		0.0	False		,,,				2504	0.0				Ovarian(141;50 1831 27899 33809 37648)	Ovarian(141;50 1831 27899 33809 37648)	uc003ljb.2		NA																	0				ovary(1)	1						c.(106-108)GCA>TCA		protocadherin beta 14 precursor							91.0	87.0	89.0					5																	140603183		2203	4300	6503	SO:0001583	missense	56122				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140603183G>T	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.106G>T	5.37:g.140603183G>T	ENSP00000239449:p.Ala36Ser					PCDHB14_uc011dal.1_Intron	p.A36S	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	106	+			36			Extracellular (Potential).|Cadherin 1.		B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	c.106G>T	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	14.44	2.537283	0.45176	.	.	ENSG00000120327	ENST00000239449	T	0.14266	2.52	4.93	3.0	0.34707	Cadherin, N-terminal (1);Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.10637	0.0260	L	0.31371	0.925	0.25367	N	0.988737	B	0.21520	0.057	B	0.32149	0.141	T	0.33574	-0.9863	9	0.30078	T	0.28	.	4.9769	0.14146	0.0822:0.2282:0.5587:0.1309	.	36	Q9Y5E9	PCDBE_HUMAN	S	36	ENSP00000239449:A36S	ENSP00000239449:A36S	A	+	1	0	PCDHB14	140583367	0.000000	0.05858	0.883000	0.34634	0.825000	0.46686	0.321000	0.19558	1.205000	0.43262	0.655000	0.94253	GCA		0.512	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934		14	34	1	0	0.000219431	0.00245	0.000259743	14	34				
PCDHGA1	56114	broad.mit.edu	37	5	140712430	140712430	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:140712430G>T	ENST00000517417.1	+	1	2179	c.2179G>T	c.(2179-2181)Gct>Tct	p.A727S	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.A727S	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	727					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTGCTACAGGCTTCGGGAGG	0.667																																							uc003lji.1		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(2179-2181)GCT>TCT		protocadherin gamma subfamily A, 1 isoform 1							64.0	70.0	68.0					5																	140712430		2203	4300	6503	SO:0001583	missense	56114				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140712430G>T	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.2179G>T	5.37:g.140712430G>T	ENSP00000431083:p.Ala727Ser					PCDHGA1_uc011dan.1_Missense_Mutation_p.A727S	p.A727S	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2179	+			727			Cytoplasmic (Potential).		Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	c.2179G>T	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	G	8.534	0.871795	0.17322	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.48836	0.82;0.8	4.04	-4.51	0.03483	.	0.495809	0.16712	N	0.202658	T	0.29389	0.0732	L	0.48935	1.535	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.17979	0.02;0.009	T	0.14117	-1.0484	10	0.38643	T	0.18	.	1.5974	0.02667	0.4433:0.106:0.2366:0.214	.	727;727	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	S	727	ENSP00000431083:A727S;ENSP00000367345:A727S	ENSP00000367345:A727S	A	+	1	0	PCDHGA1	140692614	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-1.069000	0.03444	-0.785000	0.04522	-0.291000	0.09656	GCT		0.667	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		22	75	1	0	1.96292e-10	0.010504	3.14713e-10	22	75				
PCDHGB4	8641	broad.mit.edu	37	5	140769608	140769608	+	Silent	SNP	C	C	T	rs373243233		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:140769608C>T	ENST00000519479.1	+	1	2157	c.2157C>T	c.(2155-2157)ccC>ccT	p.P719P	PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA8_ENST00000398604.2_5'Flank	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	719					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTCCAGCCCCGCCTCCTGGA	0.562																																							uc003lkc.1		NA																	0					0						c.(2155-2157)CCC>CCT		protocadherin gamma subfamily B, 4 isoform 1							142.0	158.0	153.0					5																	140769608		2037	4194	6231	SO:0001819	synonymous_variant	8641				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140769608C>T	AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.2157C>T	5.37:g.140769608C>T						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Silent_p.P719P	p.P719P	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2157	+			719			Cytoplasmic (Potential).		O15099|Q2M267|Q9UN64	Silent	SNP	ENST00000519479.1	37	c.2157C>T	CCDS54928.1																																																																																				0.562	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736		46	152	0	0	0	0.002852	0	46	152				
PCDHGA8	9708	broad.mit.edu	37	5	140774427	140774427	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:140774427G>T	ENST00000398604.2	+	1	2047	c.2047G>T	c.(2047-2049)Gac>Tac	p.D683Y	PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	683					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTTCGGTCGACCCGAACGA	0.617																																							uc003lkd.1		NA																	0					0						c.(2047-2049)GAC>TAC		protocadherin gamma subfamily A, 8 isoform 1							41.0	47.0	45.0					5																	140774427		2198	4295	6493	SO:0001583	missense	9708				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140774427G>T	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.2047G>T	5.37:g.140774427G>T	ENSP00000381605:p.Asp683Tyr					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.D683Y	p.D683Y	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2945	+			683			Extracellular (Potential).		A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	37	c.2047G>T	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	12.21	1.869349	0.32977	.	.	ENSG00000253767	ENST00000398604	T	0.49432	0.78	4.5	-7.1	0.01547	.	7.337380	0.02436	U	0.084081	T	0.52709	0.1751	M	0.83692	2.655	0.09310	N	1	P;P	0.37708	0.471;0.606	B;B	0.39706	0.077;0.307	T	0.62464	-0.6849	10	0.87932	D	0	.	10.9425	0.47281	0.3365:0.0:0.5656:0.0978	.	683;683	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	Y	683	ENSP00000381605:D683Y	ENSP00000381605:D683Y	D	+	1	0	PCDHGA8	140754611	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.451000	0.02387	-1.163000	0.02793	-0.345000	0.07892	GAC		0.617	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088		7	17	1	0	2.0095e-06	0.001984	2.71242e-06	7	17				
JAKMIP2	9832	broad.mit.edu	37	5	147027984	147027984	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:147027984T>A	ENST00000265272.5	-	5	1358	c.891A>T	c.(889-891)aaA>aaT	p.K297N	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.K255N|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.K297N	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	297						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCTTCTAATTTTCTTATAG	0.308																																							uc003loq.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(889-891)AAA>AAT		janus kinase and microtubule interacting protein							192.0	185.0	188.0					5																	147027984		2202	4298	6500	SO:0001583	missense	9832					Golgi apparatus		g.chr5:147027984T>A	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.891A>T	5.37:g.147027984T>A	ENSP00000265272:p.Lys297Asn					JAKMIP2_uc011dbx.1_Missense_Mutation_p.K255N|JAKMIP2_uc003lor.1_Missense_Mutation_p.K297N|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Missense_Mutation_p.K297N	p.K297N	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		5	1273	-			297			Potential.		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	c.891A>T	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	T	19.80	3.894420	0.72639	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	D;D;D	0.82803	-1.65;-1.65;-1.65	5.3	2.89	0.33648	.	0.000000	0.85682	D	0.000000	T	0.81456	0.4826	M	0.76838	2.35	0.48632	D	0.999686	P;P;P;P	0.40731	0.728;0.728;0.728;0.728	B;B;B;B	0.41174	0.349;0.349;0.349;0.349	T	0.78178	-0.2305	10	0.33141	T	0.24	.	9.2942	0.37804	0.0:0.2632:0.0:0.7368	.	255;297;297;297	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	N	297;297;255;297	ENSP00000421398:K297N;ENSP00000265272:K297N;ENSP00000328989:K255N	ENSP00000265272:K297N	K	-	3	2	JAKMIP2	147008177	0.994000	0.37717	1.000000	0.80357	0.995000	0.86356	0.208000	0.17415	0.966000	0.38159	0.482000	0.46254	AAA		0.308	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790		32	126	0	0	0	0.003271	0	32	126				
SH3TC2	79628	broad.mit.edu	37	5	148408068	148408068	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:148408068C>T	ENST00000515425.1	-	11	1328	c.1227G>A	c.(1225-1227)gaG>gaA	p.E409E	SH3TC2_ENST00000513340.1_5'UTR|SH3TC2_ENST00000394358.2_Silent_p.E294E|SH3TC2_ENST00000512049.1_Silent_p.E402E|SH3TC2_ENST00000538184.1_5'UTR	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	409					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGATGCTCCTCCCAGGCTC	0.622																																							uc003lpu.2		NA																	0				ovary(2)	2						c.(1225-1227)GAG>GAA		SH3 domain and tetratricopeptide repeats 2							28.0	31.0	30.0					5																	148408068		2203	4298	6501	SO:0001819	synonymous_variant	79628						binding	g.chr5:148408068C>T	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.1227G>A	5.37:g.148408068C>T						SH3TC2_uc003lpp.1_RNA|SH3TC2_uc010jgw.2_Silent_p.E53E|SH3TC2_uc003lps.2_RNA|SH3TC2_uc003lpt.2_5'UTR|SH3TC2_uc010jgx.2_Silent_p.E402E|SH3TC2_uc003lpv.1_5'UTR|SH3TC2_uc011dbz.1_Silent_p.E294E	p.E409E	NM_024577	NP_078853	Q8TF17	S3TC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		11	1379	-			409					B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Silent	SNP	ENST00000515425.1	37	c.1227G>A	CCDS4293.1																																																																																				0.622	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577		11	43	0	0	0	0.001855	0	11	43				
FAT2	2196	broad.mit.edu	37	5	150921889	150921889	+	Silent	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:150921889A>T	ENST00000261800.5	-	9	8811	c.8799T>A	c.(8797-8799)gcT>gcA	p.A2933A		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2933	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGAAATGTCAGCATCCAGGG	0.498																																							uc003lue.3		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(8797-8799)GCT>GCA		FAT tumor suppressor 2 precursor							140.0	134.0	136.0					5																	150921889		2203	4300	6503	SO:0001819	synonymous_variant	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150921889A>T	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.8799T>A	5.37:g.150921889A>T						GM2A_uc011dcs.1_Intron	p.A2933A	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		9	8812	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	2933			Extracellular (Potential).|Cadherin 26.		O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	c.8799T>A	CCDS4317.1																																																																																				0.498	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		41	124	0	0	0	0.007835	0	41	124				
LARP1	23367	broad.mit.edu	37	5	154179189	154179189	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:154179189G>C	ENST00000336314.4	+	9	1209	c.1185G>C	c.(1183-1185)gaG>gaC	p.E395D		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	472					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCGTTGATGAGAAAGTTCGTA	0.473																																							uc003lvp.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1414-1416)GAG>GAC		la related protein isoform 2							107.0	108.0	108.0					5																	154179189		2203	4300	6503	SO:0001583	missense	23367						protein binding|RNA binding	g.chr5:154179189G>C	AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.1185G>C	5.37:g.154179189G>C	ENSP00000336721:p.Glu395Asp					LARP1_uc003lvo.2_Missense_Mutation_p.E395D|LARP1_uc010jie.1_Missense_Mutation_p.E267D	p.E472D	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		9	1845	+	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	472			HTH La-type RNA-binding.		O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	ENST00000336314.4	37	c.1416G>C	CCDS4328.1	.	.	.	.	.	.	.	.	.	.	G	12.54	1.969654	0.34754	.	.	ENSG00000155506	ENST00000336314;ENST00000518297;ENST00000524248;ENST00000523163;ENST00000518742	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.77	2.87	0.33458	Winged helix-turn-helix transcription repressor DNA-binding (1);RNA-binding protein Lupus La (2);	0.241878	0.43260	D	0.000600	T	0.16300	0.0392	N	0.11364	0.135	0.40417	D	0.979804	B;B	0.15473	0.013;0.007	B;B	0.15484	0.007;0.013	T	0.19192	-1.0313	10	0.02654	T	1	-25.8912	11.2035	0.48756	0.2098:0.0:0.7902:0.0	.	472;395	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	D	395;472;267;180;79	ENSP00000336721:E395D;ENSP00000428589:E472D;ENSP00000429904:E267D;ENSP00000430438:E180D;ENSP00000431072:E79D	ENSP00000336721:E395D	E	+	3	2	LARP1	154159382	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.726000	0.61986	0.289000	0.22422	0.655000	0.94253	GAG		0.473	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551		10	105	0	0	0	0.000978	0	10	105				
HAVCR2	84868	broad.mit.edu	37	5	156533689	156533689	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:156533689G>C	ENST00000307851.4	-	2	1073	c.343C>G	c.(343-345)Cca>Gca	p.P115A	HAVCR2_ENST00000522593.1_Missense_Mutation_p.P115A|CTB-120L21.1_ENST00000517708.1_RNA|HAVCR2_ENST00000517358.1_5'UTR	NM_032782.4	NP_116171.3	Q8TDQ0	HAVR2_HUMAN	hepatitis A virus cellular receptor 2	115	Ig-like V-type.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				cervix(1)|large_intestine(4)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	22	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATTATGCCTGGGATTTGGATC	0.428																																							uc003lwk.1		NA																	0					0						c.(343-345)CCA>GCA		T cell immunoglobulin mucin 3 precursor							114.0	104.0	107.0					5																	156533689		2203	4300	6503	SO:0001583	missense	84868					integral to membrane		g.chr5:156533689G>C	AK027334	CCDS4333.1	5q34	2014-01-14			ENSG00000135077	ENSG00000135077		"""Immunoglobulin superfamily / V-set domain containing"""	18437	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 3"""	606652				11823861	Standard	NM_032782		Approved	Tim-3, TIM3, FLJ14428, TIMD3	uc003lwk.2	Q8TDQ0	OTTHUMG00000130249	ENST00000307851.4:c.343C>G	5.37:g.156533689G>C	ENSP00000312002:p.Pro115Ala					HAVCR2_uc003lwl.2_Missense_Mutation_p.P115A	p.P115A	NM_032782	NP_116171	Q8TDQ0	HAVR2_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		2	487	-	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	115			Ig-like V-type.|Extracellular (Potential).		B2RAY2|Q8WW60|Q96K94	Missense_Mutation	SNP	ENST00000307851.4	37	c.343C>G	CCDS4333.1	.	.	.	.	.	.	.	.	.	.	G	6.529	0.465759	0.12402	.	.	ENSG00000135077	ENST00000307851;ENST00000522593	T;T	0.65178	-0.14;-0.14	5.48	3.55	0.40652	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.386955	0.22298	N	0.061919	T	0.56601	0.1996	M	0.75150	2.29	0.09310	N	0.999997	B;P	0.48589	0.297;0.912	B;B	0.39805	0.04;0.31	T	0.51513	-0.8696	10	0.20519	T	0.43	-7.6773	10.0025	0.41938	0.0:0.1285:0.6421:0.2293	.	115;115	Q8TDQ0-2;Q8TDQ0	.;HAVR2_HUMAN	A	115	ENSP00000312002:P115A;ENSP00000430873:P115A	ENSP00000312002:P115A	P	-	1	0	HAVCR2	156466267	0.986000	0.35501	0.898000	0.35279	0.010000	0.07245	0.555000	0.23422	1.416000	0.47057	0.655000	0.94253	CCA		0.428	HAVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252574.2			6	99	0	0	0	0.001168	0	6	99				
TENM2	57451	broad.mit.edu	37	5	167653121	167653121	+	Missense_Mutation	SNP	G	G	A	rs369050319		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:167653121G>A	ENST00000518659.1	+	24	5176	c.5137G>A	c.(5137-5139)Gtg>Atg	p.V1713M	TENM2_ENST00000403607.2_Missense_Mutation_p.V1537M|TENM2_ENST00000545108.1_Missense_Mutation_p.V1712M|TENM2_ENST00000519204.1_Missense_Mutation_p.V1592M|TENM2_ENST00000520394.1_Missense_Mutation_p.V1474M	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1713					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CCTGACCAACGTGACGCGCCC	0.527																																							uc010jjd.2		NA																	0				ovary(6)|central_nervous_system(4)	10						c.(5110-5112)GTG>ATG		odz, odd Oz/ten-m homolog 2		G	MET/VAL	0,3924		0,0,1962	37.0	40.0	39.0		5110	5.1	1.0	5		39	1,8283		0,1,4141	no	missense	ODZ2	NM_001122679.1	21	0,1,6103	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging	1704/2766	167653121	1,12207	1962	4142	6104	SO:0001583	missense	57451							g.chr5:167653121G>A	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.5137G>A	5.37:g.167653121G>A	ENSP00000429430:p.Val1713Met					ODZ2_uc003lzr.3_Missense_Mutation_p.V1474M|ODZ2_uc003lzt.3_Missense_Mutation_p.V1077M|ODZ2_uc010jje.2_Missense_Mutation_p.V968M	p.V1704M	NM_001122679	NP_001116151			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	24	5110	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37	c.5110G>A		.	.	.	.	.	.	.	.	.	.	G	23.4	4.406903	0.83230	0.0	1.21E-4	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;T;D;D;D	0.90844	-2.27;0.47;-2.37;-2.72;-2.74	5.08	5.08	0.68730	.	0.052836	0.85682	D	0.000000	D	0.95664	0.8590	M	0.82630	2.6	0.54753	D	0.999986	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.994	D	0.95548	0.8618	10	0.52906	T	0.07	.	18.8316	0.92143	0.0:0.0:1.0:0.0	.	1712;1713;1474	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	M	1713;1712;1592;1474;1537	ENSP00000429430:V1713M;ENSP00000438635:V1712M;ENSP00000428964:V1592M;ENSP00000427874:V1474M;ENSP00000384905:V1537M	ENSP00000384905:V1537M	V	+	1	0	ODZ2	167585699	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	7.957000	0.87870	2.543000	0.85770	0.555000	0.69702	GTG		0.527	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		4	37	0	0	0	0.009096	0	4	37				
CDHR2	54825	broad.mit.edu	37	5	176003034	176003034	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr5:176003034G>T	ENST00000510636.1	+	12	1316	c.1042G>T	c.(1042-1044)Gac>Tac	p.D348Y	CDHR2_ENST00000261944.5_Missense_Mutation_p.D348Y|CDHR2_ENST00000506348.1_Missense_Mutation_p.D348Y	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	348	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						GGACGTCAATGACCACAAACC	0.577																																							uc003mem.1		NA																	0				ovary(2)	2						c.(1042-1044)GAC>TAC		protocadherin LKC precursor							140.0	115.0	123.0					5																	176003034		2203	4300	6503	SO:0001583	missense	54825				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding	g.chr5:176003034G>T	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.1042G>T	5.37:g.176003034G>T	ENSP00000424565:p.Asp348Tyr					CDHR2_uc003men.1_Missense_Mutation_p.D348Y	p.D348Y	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN			12	1108	+			348			Extracellular (Potential).|Cadherin 3.		A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	c.1042G>T	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.455079	0.63290	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.67345	-0.26;-0.26;-0.26	4.54	4.54	0.55810	Cadherin (3);Cadherin conserved site (1);Cadherin-like (2);	.	.	.	.	D	0.87888	0.6291	H	0.97707	4.06	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92119	0.5702	9	0.87932	D	0	-36.5742	15.2604	0.73617	0.0:0.0:1.0:0.0	.	348	Q9BYE9	CDHR2_HUMAN	Y	348	ENSP00000424565:D348Y;ENSP00000261944:D348Y;ENSP00000421078:D348Y	ENSP00000261944:D348Y	D	+	1	0	CDHR2	175935640	1.000000	0.71417	0.997000	0.53966	0.609000	0.37215	6.827000	0.75303	2.355000	0.79922	0.549000	0.68633	GAC		0.577	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675		10	25	1	0	1.58986e-06	0.008291	2.1588e-06	10	25				
BMP6	654	broad.mit.edu	37	6	7862687	7862687	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:7862687G>C	ENST00000283147.6	+	4	1319	c.1160G>C	c.(1159-1161)cGc>cCc	p.R387P		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	387					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					AGTCGTAATCGCTCTACCCAG	0.592																																							uc003mxu.3		NA																	0				large_intestine(2)|ovary(1)	3						c.(1159-1161)CGC>CCC		bone morphogenetic protein 6 preproprotein							63.0	60.0	61.0					6																	7862687		2203	4300	6503	SO:0001583	missense	654				BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity	g.chr6:7862687G>C	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.1160G>C	6.37:g.7862687G>C	ENSP00000283147:p.Arg387Pro						p.R387P	NM_001718	NP_001709	P22004	BMP6_HUMAN			4	1338	+	Ovarian(93;0.0721)		387					Q5TCP3	Missense_Mutation	SNP	ENST00000283147.6	37	c.1160G>C	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.819184	0.90873	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.74842	-0.88	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.82893	0.5136	M	0.65975	2.015	0.80722	D	1	D	0.71674	0.998	D	0.65443	0.935	T	0.82816	-0.0270	10	0.59425	D	0.04	.	20.063	0.97692	0.0:0.0:1.0:0.0	.	387	P22004	BMP6_HUMAN	P	309;387;350	ENSP00000283147:R387P	ENSP00000283147:R387P	R	+	2	0	BMP6	7807686	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.779000	0.85648	2.735000	0.93741	0.655000	0.94253	CGC		0.592	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718		4	69	0	0	0	0.000602	0	4	69				
GCM2	9247	broad.mit.edu	37	6	10874470	10874470	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:10874470G>T	ENST00000379491.4	-	5	1426	c.1279C>A	c.(1279-1281)Cca>Aca	p.P427T	SYCP2L_ENST00000543878.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	427					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.P427A(2)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				CAGGGTTCTGGATAGACAGAC	0.552																																							uc003mzn.3		NA																	2	Substitution - Missense(2)		breast(2)	ovary(2)|central_nervous_system(1)	3						c.(1279-1281)CCA>ACA		glial cells missing homolog 2							55.0	56.0	56.0					6																	10874470		2203	4300	6503	SO:0001583	missense	9247				cellular calcium ion homeostasis|cellular phosphate ion homeostasis|parathyroid gland development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|sequence-specific DNA binding	g.chr6:10874470G>T	AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.1279C>A	6.37:g.10874470G>T	ENSP00000368805:p.Pro427Thr					SYCP2L_uc011dim.1_Intron	p.P427T	NM_004752	NP_004743	O75603	GCM2_HUMAN			5	1351	-	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	427					D3GDV6|Q5THN5	Missense_Mutation	SNP	ENST00000379491.4	37	c.1279C>A	CCDS4517.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983466	0.53827	.	.	ENSG00000124827	ENST00000379491	T	0.69685	-0.42	5.61	3.78	0.43462	.	0.278457	0.36815	N	0.002399	T	0.46171	0.1379	M	0.68952	2.095	0.40238	D	0.977928	B	0.31680	0.335	B	0.26614	0.071	T	0.57843	-0.7741	10	0.72032	D	0.01	-2.5988	8.1709	0.31254	0.1245:0.0:0.734:0.1415	.	427	O75603	GCM2_HUMAN	T	427	ENSP00000368805:P427T	ENSP00000368805:P427T	P	-	1	0	GCM2	10982456	0.995000	0.38212	0.025000	0.17156	0.012000	0.07955	1.194000	0.32174	1.474000	0.48178	0.655000	0.94253	CCA		0.552	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039844.1			9	39	1	0	2.17888e-05	0.006214	2.75588e-05	9	39				
KIF13A	63971	broad.mit.edu	37	6	17781518	17781518	+	Missense_Mutation	SNP	C	C	A	rs377483649		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:17781518C>A	ENST00000259711.6	-	30	3664	c.3559G>T	c.(3559-3561)Gcc>Tcc	p.A1187S	KIF13A_ENST00000378843.2_Missense_Mutation_p.A1174S|KIF13A_ENST00000378826.2_Missense_Mutation_p.A1187S|KIF13A_ENST00000378816.5_Missense_Mutation_p.A1187S|KIF13A_ENST00000378814.5_Missense_Mutation_p.A1174S	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1187					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TGCTCATTGGCACTGAGGTCA	0.463																																							uc003ncg.3		NA																	0				large_intestine(2)|ovary(2)	4						c.(3559-3561)GCC>TCC		kinesin family member 13A isoform a							62.0	62.0	62.0					6																	17781518		1963	4148	6111	SO:0001583	missense	63971				cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding	g.chr6:17781518C>A	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.3559G>T	6.37:g.17781518C>A	ENSP00000259711:p.Ala1187Ser					KIF13A_uc003ncf.2_Missense_Mutation_p.A1174S|KIF13A_uc003nch.3_Missense_Mutation_p.A1187S|KIF13A_uc003nci.3_Missense_Mutation_p.A1174S|KIF13A_uc003nce.1_5'Flank	p.A1187S	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	all cancers(50;0.0865)|Epithelial(50;0.0974)		30	3664	-	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	1187					A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	c.3559G>T	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.607567	0.28623	.	.	ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816;ENST00000506044	T;T;T;T;T;T	0.70749	-0.48;1.97;-0.51;-0.49;-0.48;-0.49	5.14	5.14	0.70334	.	0.166530	0.52532	D	0.000061	T	0.37046	0.0989	N	0.12182	0.205	0.40507	D	0.980705	B;P;B;P	0.47302	0.003;0.629;0.015;0.893	B;B;B;B	0.41510	0.01;0.173;0.028;0.359	T	0.51601	-0.8685	10	0.06236	T	0.91	.	18.5555	0.91083	0.0:1.0:0.0:0.0	.	1174;1187;1187;1174	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	S	1174;191;1187;1187;1174;1187;185	ENSP00000368091:A1174S;ENSP00000425616:A191S;ENSP00000259711:A1187S;ENSP00000368103:A1187S;ENSP00000368120:A1174S;ENSP00000368093:A1187S	ENSP00000259711:A1187S	A	-	1	0	KIF13A	17889497	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	3.832000	0.55783	2.554000	0.86153	0.561000	0.74099	GCC		0.463	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4			7	51	1	0	7.48243e-07	0.006214	1.03872e-06	7	51				
SLC17A4	10050	broad.mit.edu	37	6	25777124	25777124	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:25777124C>T	ENST00000377905.4	+	10	1324	c.1205C>T	c.(1204-1206)tCt>tTt	p.S402F	SLC17A4_ENST00000439485.2_Missense_Mutation_p.S172F|SLC17A4_ENST00000397076.2_Missense_Mutation_p.S200F	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	402					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TTGGTGCTGTCTTCTGCCATC	0.537																																							uc003nfe.2		NA																	0				skin(1)	1						c.(1204-1206)TCT>TTT		solute carrier family 17 (sodium phosphate),							149.0	129.0	136.0					6																	25777124		2203	4300	6503	SO:0001583	missense	10050				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity	g.chr6:25777124C>T	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1205C>T	6.37:g.25777124C>T	ENSP00000367137:p.Ser402Phe					SLC17A4_uc011djx.1_Missense_Mutation_p.S172F|SLC17A4_uc003nff.1_Missense_Mutation_p.S191F|SLC17A4_uc003nfg.2_Missense_Mutation_p.S339F|SLC17A4_uc010jqa.2_Intron	p.S402F	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN			10	1324	+			402			Helical; (Potential).		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	37	c.1205C>T	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.200546	0.58126	.	.	ENSG00000146039	ENST00000377905;ENST00000439485;ENST00000397076	T;T;T	0.74421	0.51;0.28;-0.84	5.62	1.77	0.24775	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.963463	0.08548	N	0.929427	T	0.57607	0.2065	M	0.65677	2.01	0.09310	N	1	B;B;B	0.31611	0.035;0.331;0.052	B;B;B	0.39094	0.059;0.29;0.111	T	0.58707	-0.7589	10	0.59425	D	0.04	.	4.7512	0.13061	0.1405:0.4705:0.3102:0.0788	.	172;200;402	E7EPE8;E7EU17;Q9Y2C5	.;.;S17A4_HUMAN	F	402;172;200	ENSP00000367137:S402F;ENSP00000391345:S172F;ENSP00000380266:S200F	ENSP00000367137:S402F	S	+	2	0	SLC17A4	25885103	0.000000	0.05858	0.000000	0.03702	0.657000	0.38888	0.543000	0.23237	0.092000	0.17331	-0.172000	0.13284	TCT		0.537	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1			26	103	0	0	0	0.004656	0	26	103				
SLC17A4	10050	broad.mit.edu	37	6	25779404	25779404	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:25779404C>A	ENST00000377905.4	+	12	1601	c.1482C>A	c.(1480-1482)ttC>ttA	p.F494L	SLC17A4_ENST00000439485.2_Missense_Mutation_p.F264L|SLC17A4_ENST00000397076.2_3'UTR	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	494					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AGCAGACATTCACCCACCTCT	0.473																																							uc003nfe.2		NA																	0				skin(1)	1						c.(1480-1482)TTC>TTA		solute carrier family 17 (sodium phosphate),							170.0	162.0	165.0					6																	25779404		2203	4300	6503	SO:0001583	missense	10050				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity	g.chr6:25779404C>A	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1482C>A	6.37:g.25779404C>A	ENSP00000367137:p.Phe494Leu					SLC17A4_uc011djx.1_Missense_Mutation_p.F264L|SLC17A4_uc003nfg.2_Missense_Mutation_p.F431L|SLC17A4_uc010jqa.2_3'UTR	p.F494L	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN			12	1601	+			494					B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	37	c.1482C>A	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	C	2.451	-0.326452	0.05350	.	.	ENSG00000146039	ENST00000377905;ENST00000439485	T;T	0.72615	-0.04;-0.67	4.18	2.39	0.29439	.	2.879290	0.01051	N	0.004480	T	0.10035	0.0246	N	0.00119	-2.075	0.24406	N	0.994683	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41928	-0.9481	10	0.08837	T	0.75	.	5.3512	0.16036	0.1984:0.699:0.0:0.1026	.	264;494	E7EPE8;Q9Y2C5	.;S17A4_HUMAN	L	494;264	ENSP00000367137:F494L;ENSP00000391345:F264L	ENSP00000367137:F494L	F	+	3	2	SLC17A4	25887383	0.002000	0.14202	0.053000	0.19242	0.279000	0.26890	-0.024000	0.12435	0.692000	0.31613	-0.224000	0.12420	TTC		0.473	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1			18	98	1	0	1.2644e-06	0.010504	1.73779e-06	18	98				
HIST1H2BK	85236	broad.mit.edu	37	6	27114507	27114507	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:27114507T>A	ENST00000356950.1	-	1	70	c.71A>T	c.(70-72)aAg>aTg	p.K24M	HIST1H2BK_ENST00000396891.4_Missense_Mutation_p.K24M|HIST1H2AH_ENST00000377459.1_5'Flank|MIR3143_ENST00000584253.1_RNA			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	24					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						GCCGTCCTTCTTCTGCGCCTT	0.602																																							uc003nix.1		NA																	0					0						c.(70-72)AAG>ATG		histone cluster 1, H2bk							170.0	140.0	150.0					6																	27114507		2203	4300	6503	SO:0001583	missense	85236				defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27114507T>A	AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.71A>T	6.37:g.27114507T>A	ENSP00000349430:p.Lys24Met					HIST1H2AH_uc003niz.2_5'Flank|hsa-mir-3143|MI0014167_5'Flank	p.K24M	NM_080593	NP_542160	O60814	H2B1K_HUMAN			1	113	-			24					A8K7P7|Q2VPI7	Missense_Mutation	SNP	ENST00000356950.1	37	c.71A>T	CCDS4621.1	.	.	.	.	.	.	.	.	.	.	T	12.21	1.871005	0.33069	.	.	ENSG00000197903	ENST00000396891;ENST00000356950	T;T	0.24908	1.83;1.83	3.82	3.82	0.43975	Histone-fold (2);	.	.	.	.	T	0.19248	0.0462	M	0.83603	2.65	0.35989	D	0.836559	B	0.16396	0.017	B	0.08055	0.003	T	0.16867	-1.0388	9	0.72032	D	0.01	.	11.2029	0.48751	0.0:0.0:0.0:1.0	.	24	O60814	H2B1K_HUMAN	M	24	ENSP00000380100:K24M;ENSP00000349430:K24M	ENSP00000349430:K24M	K	-	2	0	HIST1H2BK	27222486	1.000000	0.71417	1.000000	0.80357	0.066000	0.16364	1.581000	0.36558	1.692000	0.51112	0.528000	0.53228	AAG		0.602	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040141.1	NM_080593		24	128	0	0	0	0.003954	0	24	128				
HIST1H2BL	8340	broad.mit.edu	37	6	27775425	27775425	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:27775425C>G	ENST00000377401.2	-	1	284	c.260G>C	c.(259-261)cGc>cCc	p.R87P	HIST1H2AI_ENST00000358739.3_5'Flank|HIST1H3H_ENST00000369163.2_5'Flank	NM_003519.3	NP_003510.1	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl	87					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						GATGGTCGAGCGCTTGTTGTA	0.632																																							uc003njl.2		NA																	0					0						c.(259-261)CGC>CCC		histone cluster 1, H2bl							109.0	107.0	107.0					6																	27775425		2203	4300	6503	SO:0001583	missense	8340				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27775425C>G	Z83740	CCDS4625.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000185130	ENSG00000185130		"""Histones / Replication-dependent"""	4748	protein-coding gene	gene with protein product		602800	"""H2B histone family, member C"", ""histone 1, H2bl"""	H2BFC		9439656, 12408966	Standard	NM_003519		Approved	H2B/c, dJ97D16.4	uc003njl.3	Q99880	OTTHUMG00000014485	ENST00000377401.2:c.260G>C	6.37:g.27775425C>G	ENSP00000366618:p.Arg87Pro					HIST1H3H_uc003njm.2_5'Flank	p.R87P	NM_003519	NP_003510	Q99880	H2B1L_HUMAN			1	285	-			87					B2R5A3|Q52LW9	Missense_Mutation	SNP	ENST00000377401.2	37	c.260G>C	CCDS4625.1	.	.	.	.	.	.	.	.	.	.	.	21.3	4.129351	0.77549	.	.	ENSG00000185130	ENST00000377401	T	0.77620	-1.11	4.35	4.35	0.52113	Histone-fold (2);Histone core (1);	0.320656	0.16805	U	0.198804	D	0.89842	0.6832	H	0.98238	4.18	0.44843	D	0.997852	P	0.49090	0.919	P	0.55260	0.772	D	0.93247	0.6631	10	0.72032	D	0.01	.	16.7577	0.85504	0.0:1.0:0.0:0.0	.	87	Q99880	H2B1L_HUMAN	P	87	ENSP00000366618:R87P	ENSP00000366618:R87P	R	-	2	0	HIST1H2BL	27883404	1.000000	0.71417	1.000000	0.80357	0.491000	0.33493	4.362000	0.59467	2.335000	0.79485	0.655000	0.94253	CGC		0.632	HIST1H2BL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040153.1	NM_003519		23	131	0	0	0	0.003954	0	23	131				
OR2H1	26716	broad.mit.edu	37	6	29429716	29429716	+	Missense_Mutation	SNP	T	T	C	rs374947503		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:29429716T>C	ENST00000377136.1	+	4	635	c.170T>C	c.(169-171)aTg>aCg	p.M57T	OR2H1_ENST00000377133.1_Missense_Mutation_p.M57T|OR2H1_ENST00000473369.1_Intron|OR2H1_ENST00000442615.1_Missense_Mutation_p.M57T|OR2H1_ENST00000396792.2_Missense_Mutation_p.M57T|OR2H1_ENST00000377132.1_Missense_Mutation_p.M57T			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(12)	17						CACTCTCCAATGTACTTTTTC	0.517																																							uc003nmi.2		NA																	0					0						c.(169-171)ATG>ACG		olfactory receptor, family 2, subfamily H,							155.0	151.0	152.0					6																	29429716		1511	2709	4220	SO:0001583	missense	26716				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29429716T>C	AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.170T>C	6.37:g.29429716T>C	ENSP00000366340:p.Met57Thr					OR2H1_uc003nmj.1_Missense_Mutation_p.M57T|OR2H1_uc010jri.1_Intron	p.M57T	NM_030883	NP_112145	Q9GZK4	OR2H1_HUMAN			3	613	+			57			Helical; Name=2; (Potential).		B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Missense_Mutation	SNP	ENST00000377136.1	37	c.170T>C	CCDS4660.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.481218	0.63849	.	.	ENSG00000204688	ENST00000377136;ENST00000377133;ENST00000442615;ENST00000377132;ENST00000396792	T;T;T;T;T	0.09817	2.94;2.94;2.94;2.94;2.94	2.88	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000145	T	0.17577	0.0422	H	0.96080	3.765	0.36122	D	0.845537	P	0.48911	0.917	P	0.44477	0.451	T	0.34477	-0.9827	10	0.87932	D	0	.	11.6835	0.51472	0.0:0.0:0.0:1.0	.	57	Q9GZK4	OR2H1_HUMAN	T	57	ENSP00000366340:M57T;ENSP00000366337:M57T;ENSP00000393254:M57T;ENSP00000366336:M57T;ENSP00000380010:M57T	ENSP00000366336:M57T	M	+	2	0	OR2H1	29537695	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	5.105000	0.64591	1.556000	0.49512	0.491000	0.48974	ATG		0.517	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194014.3			28	75	0	0	0	0.00632	0	28	75				
OR2H2	7932	broad.mit.edu	37	6	29556084	29556084	+	Silent	SNP	C	C	T	rs185177549		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:29556084C>T	ENST00000383640.2	+	1	402	c.363C>T	c.(361-363)taC>taT	p.Y121Y	GABBR1_ENST00000355973.3_Intron	NM_007160.3	NP_009091.3	O95918	OR2H2_HUMAN	olfactory receptor, family 2, subfamily H, member 2	121					defense response (GO:0006952)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|mating (GO:0007618)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	14						TTGATCGCTACGTGGCTGTCT	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		17847	0.001		0.0	False		,,,				2504	0.0						uc003nmr.1		NA																	0					0						c.(361-363)TAC>TAT		olfactory receptor, family 2, subfamily H,							131.0	134.0	133.0					6																	29556084		1511	2709	4220	SO:0001819	synonymous_variant	7932				defense response|mating|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29556084C>T		CCDS34365.1	6p22.2-p21.31	2012-08-09				ENSG00000204657		"""GPCR / Class A : Olfactory receptors"""	8253	protein-coding gene	gene with protein product		600578					Standard	XM_005249407		Approved	hs6M1-12	uc003nmr.1	O95918		ENST00000383640.2:c.363C>T	6.37:g.29556084C>T						GABBR1_uc003nmp.3_Intron	p.Y121Y	NM_007160	NP_009091	O95918	OR2H2_HUMAN			1	402	+			121			Cytoplasmic (Potential).		Q15062|Q2M1Y3|Q5STL8|Q5SUK1|Q6IFN7|Q6NTB7|Q96R14	Silent	SNP	ENST00000383640.2	37	c.363C>T	CCDS34365.1																																																																																				0.577	OR2H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076057.2			8	89	0	0	0	0.006214	0	8	89				
LY6G5B	58496	broad.mit.edu	37	6	31638977	31638977	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:31638977G>T	ENST00000375864.4	+	2	887	c.103G>T	c.(103-105)Gac>Tac	p.D35Y	LY6G5B_ENST00000409525.1_5'UTR|CSNK2B-LY6G5B-1181_ENST00000375880.2_Missense_Mutation_p.R201I	NM_021221.2	NP_067044.2	Q8NDX9	LY65B_HUMAN	lymphocyte antigen 6 complex, locus G5B	35	UPAR/Ly6.					extracellular region (GO:0005576)				lung(4)	4						CCTCGTAGAAGACCCTTCTGT	0.537																																							uc003nvs.1		NA																	0					0						c.(601-603)AGA>ATA		casein kinase 2, beta polypeptide							265.0	256.0	259.0					6																	31638977		1511	2708	4219	SO:0001583	missense	1460				adiponectin-mediated signaling pathway|axon guidance|cellular protein complex assembly|negative regulation of cell proliferation|regulation of DNA binding|Wnt receptor signaling pathway	cytosol|nucleus|protein kinase CK2 complex	identical protein binding|protein domain specific binding|protein kinase regulator activity|receptor binding|transcription factor binding	g.chr6:31638977G>T	AF129756	CCDS34400.1	6p21.3	2008-08-01	2002-07-29	2002-08-01	ENSG00000240053	ENSG00000240053			13931	protein-coding gene	gene with protein product		610433	"""chromosome 6 open reading frame 19"""	C6orf19		8812450, 12079290, 17008713	Standard	NM_021221		Approved	G5b		Q8NDX9	OTTHUMG00000031227	ENST00000375864.4:c.103G>T	6.37:g.31638977G>T	ENSP00000365024:p.Asp35Tyr					LY6G5B_uc003nvt.1_Missense_Mutation_p.D35Y	p.R201I	NM_001320	NP_001311	P67870	CSK2B_HUMAN			7	942	+			Error:Variant_position_missing_in_P67870_after_alignment					B0UXB2|B0UZ65|B0UZP8|B7ZCA3|Q5SQ62|Q5SST3|Q9UKT0|Q9UMQ0	Missense_Mutation	SNP	ENST00000375864.4	37	c.602G>T	CCDS34400.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.24|19.24	3.790366|3.790366	0.70337|0.70337	.|.	.|.	ENSG00000240053|ENSG00000204435	ENST00000409691;ENST00000375864|ENST00000375880	T|.	0.29142|.	1.58|.	4.44|4.44	3.57|3.57	0.40892|0.40892	.|.	.|.	.|.	.|.	.|.	T|T	0.18425|0.18425	0.0442|0.0442	L|L	0.29908|0.29908	0.895|0.895	.|.	.|.	.|.	D|B	0.89917|0.26258	1.0|0.145	D|B	0.71870|0.25884	0.975|0.064	T|T	0.07731|0.07731	-1.0757|-1.0757	8|7	0.72032|0.56958	D|D	0.01|0.05	-5.9271|-5.9271	8.5503|8.5503	0.33447|0.33447	0.1063:0.0:0.8937:0.0|0.1063:0.0:0.8937:0.0	.|.	35|201	Q8NDX9|Q5SRQ3	LY65B_HUMAN|.	Y|I	32;35|201	ENSP00000365024:D35Y|.	ENSP00000365024:D35Y|ENSP00000365040:R201I	D|R	+|+	1|2	0|0	LY6G5B|CSNK2B	31746956|31746956	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	2.634000|2.634000	0.46528|0.46528	1.234000|1.234000	0.43709|0.43709	0.561000|0.561000	0.74099|0.74099	GAC|AGA		0.537	LY6G5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000124389.4			38	185	1	0	6.19805e-25	0.005524	1.27125e-24	38	185				
HLA-DQB1	3119	broad.mit.edu	37	6	32629750	32629750	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:32629750C>A	ENST00000399082.3	-	2	429	c.385G>T	c.(385-387)Gag>Tag	p.E129*	HLA-DQB1_ENST00000374943.4_Nonsense_Mutation_p.E219*|HLA-DQB1_ENST00000399079.3_Nonsense_Mutation_p.E219*|XXbac-BPG254F23.6_ENST00000443574.1_RNA|HLA-DQB1_ENST00000434651.2_Nonsense_Mutation_p.E219*|HLA-DQB1_ENST00000460185.1_5'Flank|HLA-DQB1-AS1_ENST00000419852.1_RNA|HLA-DQB1_ENST00000399084.1_Nonsense_Mutation_p.E219*			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	219	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	TTACGCCACTCCACGGTGATG	0.537									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												Esophageal Squamous(151;720 1825 15000 40336 43415)	Esophageal Squamous(151;720 1825 15000 40336 43415)	uc003obw.2		NA																	0					0						c.(655-657)GAG>TAG		major histocompatibility complex, class II, DQ	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						53.0	57.0	56.0					6																	32629750		2194	4293	6487	SO:0001587	stop_gained	3119	Melanoma_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia|T-cell_Lymphoma_(Cutaneous)__Familial_Clustering_of|Sj_gren_syndrome	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial	antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity	g.chr6:32629750C>A		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399082.3:c.385G>T	6.37:g.32629750C>A	ENSP00000382032:p.Glu129*					HLA-DQB1_uc010juc.1_Nonsense_Mutation_p.E174*|HLA-DQB1_uc003obv.2_Nonsense_Mutation_p.E219*|HLA-DQB1_uc011dqd.1_Nonsense_Mutation_p.E219*|HLA-DQB1_uc011dqe.1_3'UTR	p.E219*	NM_002123	NP_002114	P01920	DQB1_HUMAN			3	737	-			219			Extracellular (Potential).|Beta-2.|Ig-like C1-type.		A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Nonsense_Mutation	SNP	ENST00000399082.3	37	c.655G>T		.	.	.	.	.	.	.	.	.	.	.	15.25	2.777017	0.49786	.	.	ENSG00000179344	ENST00000399082;ENST00000399079;ENST00000374943;ENST00000434651;ENST00000399084	.	.	.	4.52	1.62	0.23740	.	0.270973	0.34959	N	0.003549	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.0221	0.30415	0.0:0.4363:0.4728:0.0909	.	.	.	.	X	129;219;219;219;219	.	ENSP00000364080:E219X	E	-	1	0	HLA-DQB1	32737728	0.000000	0.05858	0.993000	0.49108	0.504000	0.33889	0.180000	0.16860	0.015000	0.14971	0.313000	0.20887	GAG		0.537	HLA-DQB1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000276131.1	NM_002123		7	49	1	0	3.35478e-16	0.003163	6.38248e-16	7	49				
ITPR3	3710	broad.mit.edu	37	6	33652441	33652441	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:33652441G>T	ENST00000374316.5	+	39	6173	c.5113G>T	c.(5113-5115)Gac>Tac	p.D1705Y	ITPR3_ENST00000605930.1_Missense_Mutation_p.D1705Y			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1705					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CTCGCGGGGGGACCTTCCCGA	0.642																																							uc011drk.1		NA																	0				ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						c.(5113-5115)GAC>TAC		inositol 1,4,5-triphosphate receptor, type 3							72.0	77.0	75.0					6																	33652441		2203	4300	6503	SO:0001583	missense	3710				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding	g.chr6:33652441G>T	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.5113G>T	6.37:g.33652441G>T	ENSP00000363435:p.Asp1705Tyr					ITPR3_uc003oey.2_5'Flank	p.D1705Y	NM_002224	NP_002215	Q14573	ITPR3_HUMAN			38	5332	+			1705			Cytoplasmic (Potential).		Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	c.5113G>T	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072097	0.76415	.	.	ENSG00000096433	ENST00000374316	D	0.91945	-2.94	5.05	5.05	0.67936	.	0.602795	0.17848	N	0.159947	D	0.82403	0.5029	N	0.03608	-0.345	0.44227	D	0.997069	P	0.43352	0.804	P	0.46758	0.526	D	0.87377	0.2354	10	0.59425	D	0.04	-28.093	16.9707	0.86298	0.0:0.0:1.0:0.0	.	1705	Q14573	ITPR3_HUMAN	Y	1705	ENSP00000363435:D1705Y	ENSP00000363435:D1705Y	D	+	1	0	ITPR3	33760419	1.000000	0.71417	0.998000	0.56505	0.609000	0.37215	8.154000	0.89641	2.505000	0.84491	0.655000	0.94253	GAC		0.642	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224		18	60	1	0	6.94344e-10	0.006122	1.09524e-09	18	60				
PI16	221476	broad.mit.edu	37	6	36931029	36931029	+	Missense_Mutation	SNP	C	C	A	rs560570488		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:36931029C>A	ENST00000373674.3	+	5	1239	c.911C>A	c.(910-912)cCa>cAa	p.P304Q	PI16_ENST00000491324.1_Intron	NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	304					negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GATGAGGAGCCAGTTACCTTC	0.527																																							uc003ona.2		NA																	0					0						c.(910-912)CCA>CAA		protease inhibitor 16 precursor							79.0	67.0	71.0					6																	36931029		2203	4300	6503	SO:0001583	missense	221476					extracellular region|integral to membrane	peptidase inhibitor activity	g.chr6:36931029C>A		CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.911C>A	6.37:g.36931029C>A	ENSP00000362778:p.Pro304Gln					PI16_uc003omz.1_Intron|PI16_uc003onb.2_Intron|PI16_uc011dts.1_Missense_Mutation_p.P75Q	p.P304Q	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN			5	1239	+			304			Extracellular (Potential).		Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Missense_Mutation	SNP	ENST00000373674.3	37	c.911C>A	CCDS34440.1	.	.	.	.	.	.	.	.	.	.	C	10.34	1.322539	0.23994	.	.	ENSG00000164530	ENST00000373674;ENST00000539035	T	0.08634	3.07	5.38	3.61	0.41365	.	0.424609	0.20864	N	0.084287	T	0.04318	0.0119	L	0.29908	0.895	0.19775	N	0.99995	P	0.52316	0.952	P	0.52267	0.694	T	0.26538	-1.0100	10	0.54805	T	0.06	.	7.9766	0.30159	0.0:0.8177:0.0:0.1823	.	304	Q6UXB8	PI16_HUMAN	Q	304;156	ENSP00000362778:P304Q	ENSP00000362778:P304Q	P	+	2	0	PI16	37039007	0.005000	0.15991	0.002000	0.10522	0.029000	0.11900	1.803000	0.38863	0.846000	0.35142	-0.140000	0.14226	CCA		0.527	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040380.1	NM_153370		18	43	1	0	1.00905e-13	0.008871	1.78082e-13	18	43				
PIM1	5292	broad.mit.edu	37	6	37138394	37138394	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:37138394G>T	ENST00000373509.5	+	1	416	c.43G>T	c.(43-45)Gcg>Tcg	p.A15S		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	106					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CCTGCGCGCCGCGCCCTGCAA	0.721			T	BCL6	NHL																																		uc003onk.2		NA		Dom	yes		6	6p21.2	5292	T	pim-1 oncogene			L	BCL6		NHL		0				large_intestine(1)|central_nervous_system(1)	2						c.(43-45)GCG>TCG		non-specific serine/threonine protein kinase	Adenosine monophosphate(DB00131)						27.0	28.0	28.0					6																	37138394		2201	4297	6498	SO:0001583	missense	5292				cell cycle|cell proliferation|multicellular organismal development|negative regulation of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|protein autophosphorylation	cytoplasm|nucleus|plasma membrane	ATP binding|manganese ion binding|protein binding|protein binding|protein serine/threonine kinase activity|transcription factor binding	g.chr6:37138394G>T		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.43G>T	6.37:g.37138394G>T	ENSP00000362608:p.Ala15Ser					PIM1_uc011dtw.1_5'Flank	p.A15S	NM_002648	NP_002639	P11309	PIM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(102;0.241)		1	473	+			106	AP -> RA (in Ref. 2; AAA60089).				Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	c.43G>T	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	9.672	1.147016	0.21288	.	.	ENSG00000137193	ENST00000373509	T	0.69040	-0.37	4.2	3.33	0.38152	.	0.431327	0.20163	N	0.097903	T	0.20536	0.0494	N	0.08118	0	0.28032	N	0.934105	B	0.33512	0.415	B	0.25614	0.062	T	0.08086	-1.0739	10	0.22109	T	0.4	.	10.7806	0.46376	0.0926:0.0:0.9074:0.0	.	106	P11309	PIM1_HUMAN	S	15	ENSP00000362608:A15S	ENSP00000362608:A15S	A	+	1	0	PIM1	37246372	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.842000	0.55858	1.080000	0.41073	0.542000	0.68232	GCG		0.721	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1			9	35	1	0	7.48243e-07	0.006214	1.03872e-06	9	35				
PTK7	5754	broad.mit.edu	37	6	43098158	43098158	+	Splice_Site	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:43098158G>A	ENST00000230419.4	+	4	882	c.661G>A	c.(661-663)Gat>Aat	p.D221N	PTK7_ENST00000349241.2_Splice_Site_p.D221N|PTK7_ENST00000352931.2_Splice_Site_p.D221N|PTK7_ENST00000481273.1_Splice_Site_p.D229N|PTK7_ENST00000345201.2_Splice_Site_p.D221N|PTK7_ENST00000471863.1_Splice_Site_p.D221N	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	221					actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GAGCATTGCTGGTGAGCCTGG	0.612																																							uc003oub.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(661-663)GAT>AAT		PTK7 protein tyrosine kinase 7 isoform a							38.0	38.0	38.0					6																	43098158		2203	4300	6503	SO:0001630	splice_region_variant	5754				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr6:43098158G>A	AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.661+1G>A	6.37:g.43098158G>A						PTK7_uc003ouc.1_Missense_Mutation_p.D221N|PTK7_uc003oud.1_Missense_Mutation_p.D221N|PTK7_uc003oue.1_Missense_Mutation_p.D221N|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_Intron|PTK7_uc011dve.1_Missense_Mutation_p.D229N|PTK7_uc010jyj.1_5'Flank|PTK7_uc003oua.2_Missense_Mutation_p.D221N	p.D221N	NM_002821	NP_002812	Q13308	PTK7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)		4	859	+			221			Extracellular (Potential).		A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	ENST00000230419.4	37	c.661G>A	CCDS4884.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020253	0.93462	.	.	ENSG00000112655	ENST00000230419;ENST00000471863;ENST00000349241;ENST00000352931;ENST00000345201;ENST00000481273;ENST00000419972	T;T;T;T;T;T	0.74421	-0.72;0.2;-0.84;-0.68;-0.75;-0.75	5.52	5.52	0.82312	.	0.089222	0.85682	D	0.000000	T	0.79896	0.4525	L	0.56769	1.78	0.80722	D	1	P;D;D;D;P;D	0.76494	0.609;0.966;0.994;0.985;0.897;0.999	B;P;P;P;P;D	0.66979	0.119;0.747;0.895;0.868;0.562;0.948	T	0.74937	-0.3494	10	0.26408	T	0.33	.	19.5004	0.95091	0.0:0.0:1.0:0.0	.	229;221;221;221;221;221	E9PFZ5;Q13308-3;Q13308-2;Q13308-4;Q13308;Q86X91	.;.;.;.;PTK7_HUMAN;.	N	221;221;221;221;221;229;229	ENSP00000230419:D221N;ENSP00000419037:D221N;ENSP00000325462:D221N;ENSP00000326029:D221N;ENSP00000325992:D221N;ENSP00000418754:D229N	ENSP00000230418:D221N	D	+	1	0	PTK7	43206136	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	8.693000	0.91288	2.603000	0.88011	0.558000	0.71614	GAT		0.612	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2		Missense_Mutation	3	43	0	0	0	0.004672	0	3	43				
TMEM63B	55362	broad.mit.edu	37	6	44122119	44122119	+	Silent	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:44122119A>T	ENST00000259746.9	+	23	2427	c.2244A>T	c.(2242-2244)acA>acT	p.T748T	TMEM63B_ENST00000323267.6_Silent_p.T748T			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	748					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			ACACGGAGACAGATACTGTGG	0.622																																							uc003owr.2		NA																	0				pancreas(2)|central_nervous_system(1)	3						c.(2242-2244)ACA>ACT		transmembrane protein 63B							102.0	105.0	104.0					6																	44122119		2203	4300	6503	SO:0001819	synonymous_variant	55362					integral to membrane	nucleotide binding|protein binding	g.chr6:44122119A>T	BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.2244A>T	6.37:g.44122119A>T						TMEM63B_uc003ows.2_Silent_p.T651T|TMEM63B_uc010jyz.2_RNA	p.T748T	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)		23	2308	+	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		748					B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Silent	SNP	ENST00000259746.9	37	c.2244A>T	CCDS34461.1	.	.	.	.	.	.	.	.	.	.	A	9.988	1.230108	0.22542	.	.	ENSG00000137216	ENST00000371893	.	.	.	4.99	2.36	0.29203	.	.	.	.	.	T	0.30823	0.0777	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31779	-0.9931	4	.	.	.	.	3.0059	0.06028	0.63:0.0:0.1772:0.1928	.	.	.	.	L	677	.	.	Q	+	2	0	TMEM63B	44230097	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.303000	0.43646	1.900000	0.55004	0.454000	0.30748	CAG		0.622	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040712.2	XM_166410		18	66	0	0	0	0.00499	0	18	66				
PTCHD4	442213	broad.mit.edu	37	6	47846149	47846149	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:47846149G>T	ENST00000339488.4	-	3	2464	c.2431C>A	c.(2431-2433)Ccc>Acc	p.P811T		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	811						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										TTGGAAGGGGGGAAAAACGTT	0.448																																							uc011dwm.1		NA																	0				central_nervous_system(1)	1						c.(2380-2382)CCC>ACC		hypothetical protein LOC442213							102.0	103.0	103.0					6																	47846149		2203	4300	6503	SO:0001583	missense	442213					integral to membrane	hedgehog receptor activity	g.chr6:47846149G>T		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.2431C>A	6.37:g.47846149G>T	ENSP00000341914:p.Pro811Thr					C6orf138_uc011dwn.1_Missense_Mutation_p.P558T	p.P794T	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN			3	2465	-			811					B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	c.2380C>A	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	G	17.94	3.511584	0.64522	.	.	ENSG00000244694	ENST00000339488	D	0.92249	-3.0	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.87241	0.6128	L	0.29908	0.895	0.80722	D	1	B	0.27013	0.166	B	0.37267	0.245	T	0.82954	-0.0201	10	0.34782	T	0.22	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	811	Q6ZW05	CF138_HUMAN	T	811	ENSP00000341914:P811T	ENSP00000341914:P811T	P	-	1	0	C6orf138	47954108	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.879000	0.98667	0.650000	0.86243	CCC		0.448	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732		18	90	1	0	3.41278e-10	0.00499	5.40819e-10	18	90				
PTCHD4	442213	broad.mit.edu	37	6	47847065	47847065	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:47847065G>T	ENST00000339488.4	-	3	1548	c.1515C>A	c.(1513-1515)gcC>gcA	p.A505A		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	505						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										GCTGAACCATGGCATAGGAAA	0.468																																							uc011dwm.1		NA																	0				central_nervous_system(1)	1						c.(1462-1464)GCC>GCA		hypothetical protein LOC442213							71.0	63.0	66.0					6																	47847065		2203	4300	6503	SO:0001819	synonymous_variant	442213					integral to membrane	hedgehog receptor activity	g.chr6:47847065G>T		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1515C>A	6.37:g.47847065G>T						C6orf138_uc011dwn.1_Silent_p.A252A	p.A488A	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN			3	1549	-			505					B0QZ29|B4DRK3|Q5T884	Silent	SNP	ENST00000339488.4	37	c.1464C>A	CCDS34473.2																																																																																				0.468	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732		9	25	1	0	1.12685e-05	0.004482	1.46598e-05	9	25				
TFAP2D	83741	broad.mit.edu	37	6	50696992	50696992	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:50696992G>C	ENST00000008391.3	+	5	1078	c.850G>C	c.(850-852)Gct>Cct	p.A284P	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					ACGGAAAGCAGCTAATGTCAC	0.428																																							uc003paf.2		NA																	0				ovary(6)|breast(1)	7						c.(850-852)GCT>CCT		transcription factor AP-2 beta-like 1							169.0	148.0	155.0					6																	50696992		2203	4300	6503	SO:0001583	missense	83741						DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:50696992G>C	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.850G>C	6.37:g.50696992G>C	ENSP00000008391:p.Ala284Pro					TFAP2D_uc011dwt.1_RNA	p.A284P	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN			5	1362	+	Lung NSC(77;0.0334)		284			H-S-H (helix-span-helix), dimerization.			Missense_Mutation	SNP	ENST00000008391.3	37	c.850G>C	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	G	35	5.493709	0.96339	.	.	ENSG00000008197	ENST00000008391	D	0.97831	-4.56	6.08	6.08	0.98989	Transcription factor AP-2, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.99202	0.9723	M	0.93594	3.435	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99187	1.0869	10	0.87932	D	0	-24.9081	20.6721	0.99693	0.0:0.0:1.0:0.0	.	284	Q7Z6R9	AP2D_HUMAN	P	284	ENSP00000008391:A284P	ENSP00000008391:A284P	A	+	1	0	TFAP2D	50804951	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.894000	0.99253	0.591000	0.81541	GCT		0.428	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238		6	152	0	0	0	0.001984	0	6	152				
PKHD1	5314	broad.mit.edu	37	6	51889991	51889991	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:51889991C>A	ENST00000371117.3	-	32	4892	c.4617G>T	c.(4615-4617)caG>caT	p.Q1539H	PKHD1_ENST00000340994.4_Missense_Mutation_p.Q1539H	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1539	IPT/TIG 10.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGTCTCTTGTCTGGCACACAA	0.443																																							uc003pah.1		NA																	0				lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44						c.(4615-4617)CAG>CAT		fibrocystin isoform 1							62.0	62.0	62.0					6																	51889991		2203	4300	6503	SO:0001583	missense	5314				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	g.chr6:51889991C>A	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4617G>T	6.37:g.51889991C>A	ENSP00000360158:p.Gln1539His					PKHD1_uc003pai.2_Missense_Mutation_p.Q1539H	p.Q1539H	NM_138694	NP_619639	P08F94	PKHD1_HUMAN			32	4893	-	Lung NSC(77;0.0605)		1539			Extracellular (Potential).|IPT/TIG 10.		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	c.4617G>T	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	0.126	-1.119906	0.01785	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.78126	-1.15;-1.15	5.66	-0.773	0.10995	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.957729	0.08763	N	0.897447	T	0.35799	0.0944	L	0.27053	0.805	0.09310	N	1	B;B	0.14012	0.002;0.009	B;B	0.14023	0.008;0.01	T	0.09840	-1.0656	10	0.25106	T	0.35	.	1.5136	0.02501	0.3378:0.3575:0.1098:0.1949	.	1539;1539	P08F94-2;P08F94	.;PKHD1_HUMAN	H	1539	ENSP00000360158:Q1539H;ENSP00000341097:Q1539H	ENSP00000341097:Q1539H	Q	-	3	2	PKHD1	51997950	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	-0.432000	0.06956	-0.188000	0.10499	0.650000	0.86243	CAG		0.443	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		21	71	1	0	2.54575e-18	0.010504	4.91171e-18	21	71				
COL9A1	1297	broad.mit.edu	37	6	71011744	71011744	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:71011744G>A	ENST00000357250.6	-	2	206	c.48C>T	c.(46-48)ttC>ttT	p.F16F	COL9A1_ENST00000370496.3_Silent_p.F16F	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	16					axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						AGGGTTCCAGGAAACTGCACA	0.448																																							uc003pfg.3		NA																	0				ovary(4)	4						c.(46-48)TTC>TTT		alpha 1 type IX collagen isoform 1 precursor							41.0	41.0	41.0					6																	71011744		2203	4300	6503	SO:0001819	synonymous_variant	1297				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding	g.chr6:71011744G>A		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.48C>T	6.37:g.71011744G>A							p.F16F	NM_001851	NP_001842	P20849	CO9A1_HUMAN			2	207	-			16					Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Silent	SNP	ENST00000357250.6	37	c.48C>T	CCDS4971.1																																																																																				0.448	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			4	14	0	0	0	0.001168	0	4	14				
CD109	135228	broad.mit.edu	37	6	74530266	74530266	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:74530266A>G	ENST00000287097.5	+	32	4253	c.4141A>G	c.(4141-4143)Ata>Gta	p.I1381V	CD109_ENST00000437994.2_Missense_Mutation_p.I1364V|CD109_ENST00000422508.2_Missense_Mutation_p.I1304V			Q6YHK3	CD109_HUMAN	CD109 molecule	1381					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TTCAGTGTCCATAGTGGATTA	0.353																																							uc003php.2		NA																	0				large_intestine(2)|ovary(2)	4						c.(4141-4143)ATA>GTA		CD109 antigen isoform 1 precursor							87.0	86.0	87.0					6																	74530266		2203	4300	6503	SO:0001583	missense	135228					anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	g.chr6:74530266A>G	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.4141A>G	6.37:g.74530266A>G	ENSP00000287097:p.Ile1381Val					CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Missense_Mutation_p.I1364V|CD109_uc010kba.2_Missense_Mutation_p.I1304V	p.I1381V	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN			32	4566	+			1381					A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	c.4141A>G	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	A	1.587	-0.530192	0.04112	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.20200	2.09;2.09;2.09	4.8	3.65	0.41850	Alpha-macroglobulin, receptor-binding (3);	0.275254	0.37348	N	0.002127	T	0.01905	0.0060	N	0.05554	-0.025	0.29032	N	0.885624	B;B;B	0.19331	0.035;0.006;0.001	B;B;B	0.18263	0.021;0.011;0.006	T	0.46119	-0.9214	10	0.02654	T	1	.	5.2456	0.15494	0.6507:0.0:0.3493:0.0	.	1304;1364;1381	Q6YHK3-2;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	V	1364;1304;1381	ENSP00000388062:I1364V;ENSP00000404475:I1304V;ENSP00000287097:I1381V	ENSP00000287097:I1381V	I	+	1	0	CD109	74586986	0.999000	0.42202	0.997000	0.53966	0.935000	0.57460	1.210000	0.32370	0.871000	0.35750	0.459000	0.35465	ATA		0.353	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493		13	42	0	0	0	0.00245	0	13	42				
MRAP2	112609	broad.mit.edu	37	6	84765060	84765061	+	Nonsense_Mutation	DNP	CT	CT	AA			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:84765060_84765061CT>AA	ENST00000257776.4	+	2	158_159	c.23_24CT>AA	c.(22-24)tCT>tAA	p.S8*		NM_138409.2	NP_612418.2	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2	8					energy homeostasis (GO:0097009)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|positive regulation of cAMP biosynthetic process (GO:0030819)|protein localization to cell surface (GO:0034394)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	corticotropin hormone receptor binding (GO:0031780)|identical protein binding (GO:0042802)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)|type 5 melanocortin receptor binding (GO:0031783)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(4)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	19						AGGTTAATTTCTAACAGAACCT	0.431																																							uc003pkg.3		NA																	0				skin(2)	2						c.(22-24)TCT>TAA		melanocortin 2 receptor accessory protein 2																																				SO:0001587	stop_gained	112609				positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding	g.chr6:84765060_84765061CT>AA	AK090775	CCDS5001.1	6q14.3	2009-10-06	2008-07-16	2008-07-16	ENSG00000135324	ENSG00000135324			21232	protein-coding gene	gene with protein product		615410	"""chromosome 6 open reading frame 117"""	C6orf117			Standard	NM_138409		Approved	bA51G5.2	uc003pkg.4	Q96G30	OTTHUMG00000015121	Exception_encountered	6.37:g.84765060_84765061delinsAA	ENSP00000257776:p.Ser8*					MRAP2_uc010kbo.2_5'UTR	p.S8*	NM_138409	NP_612418	Q96G30	MRAP2_HUMAN			2	213_214	+			8					A8K9M1|Q8IXM9|Q8N2D1	Nonsense_Mutation	DNP	ENST00000257776.4	37	c.23_24CT>AA	CCDS5001.1																																																																																				0.431	MRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041367.1	NM_138409		19	76	0	0	0	0.004672	0	19	76				
HACE1	57531	broad.mit.edu	37	6	105192070	105192070	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:105192070C>T	ENST00000262903.4	-	22	2754	c.2478G>A	c.(2476-2478)gaG>gaA	p.E826E	HACE1_ENST00000517995.1_5'UTR|HACE1_ENST00000369125.2_Silent_p.E611E	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	826	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		GAACTCTCTCCTCTTGAGTAA	0.343																																							uc003pqu.1		NA																	0				ovary(5)|lung(2)	7						c.(2476-2478)GAG>GAA		HECT domain and ankyrin repeat containing, E3							77.0	84.0	82.0					6																	105192070		2203	4299	6502	SO:0001819	synonymous_variant	57531				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity	g.chr6:105192070C>T	BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.2478G>A	6.37:g.105192070C>T						HACE1_uc010kcy.1_Silent_p.E308E|HACE1_uc010kcz.1_Silent_p.E611E|HACE1_uc010kcx.1_Silent_p.E235E|HACE1_uc003pqt.1_Silent_p.E479E	p.E826E	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)	22	2755	-		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)	826			HECT.		A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Silent	SNP	ENST00000262903.4	37	c.2478G>A	CCDS5050.1	.	.	.	.	.	.	.	.	.	.	C	6.757	0.508543	0.12883	.	.	ENSG00000085382	ENST00000518402	.	.	.	5.38	2.31	0.28768	.	.	.	.	.	T	0.41971	0.1182	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33929	-0.9849	4	.	.	.	.	7.3581	0.26731	0.0:0.5424:0.0:0.4576	.	.	.	.	R	217	.	.	G	-	1	0	HACE1	105298763	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.766000	0.26560	1.090000	0.41315	0.563000	0.77884	GGA		0.343	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095		14	76	0	0	0	0.004007	0	14	76				
CEP57L1	285753	broad.mit.edu	37	6	109480491	109480491	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:109480491C>T	ENST00000517392.1	+	9	1268	c.842C>T	c.(841-843)cCa>cTa	p.P281L	CEP57L1_ENST00000368970.2_Missense_Mutation_p.P298L|CEP57L1_ENST00000407272.1_Missense_Mutation_p.P281L|CEP57L1_ENST00000359793.3_Missense_Mutation_p.P281L|CEP57L1_ENST00000520883.1_Intron|CEP57L1_ENST00000523787.1_Missense_Mutation_p.P284L|CEP57L1_ENST00000521522.1_Intron|CEP57L1_ENST00000336977.4_Intron|CEP57L1_ENST00000368968.2_Missense_Mutation_p.P281L	NM_001271852.1|NM_001271853.1	NP_001258781.1|NP_001258782.1	Q8IYX8	CE57L_HUMAN	centrosomal protein 57kDa-like 1	281					microtubule anchoring (GO:0034453)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)	11						CATCGTGACCCACATATCCTT	0.418																																							uc010kdk.2		NA																	0					0						c.(841-843)CCA>CTA		hypothetical protein LOC285753							107.0	97.0	100.0					6																	109480491		2203	4300	6503	SO:0001583	missense	285753					microtubule|microtubule organizing center		g.chr6:109480491C>T	AK092723	CCDS5071.1, CCDS64491.1	6q21	2014-01-28	2010-09-30	2010-09-30	ENSG00000183137	ENSG00000183137			21561	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 182"""	C6orf182			Standard	NM_001083535		Approved	bA487F23.2, MGC21731	uc003psy.4	Q8IYX8	OTTHUMG00000015336	ENST00000517392.1:c.842C>T	6.37:g.109480491C>T	ENSP00000427844:p.Pro281Leu					C6orf182_uc003psx.3_Missense_Mutation_p.P281L|C6orf182_uc010kdl.2_Missense_Mutation_p.P281L|C6orf182_uc003psy.3_Missense_Mutation_p.P281L	p.P281L	NM_001083535	NP_001077004	Q8IYX8	CE57L_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.00123)|Epithelial(106;0.0022)|all cancers(137;0.00405)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)	11	1419	+		all_cancers(87;4.45e-07)|Acute lymphoblastic leukemia(125;2.15e-10)|all_hematologic(75;3.25e-08)|all_epithelial(87;0.000254)|Colorectal(196;0.0293)|all_lung(197;0.11)	281					G5E992	Missense_Mutation	SNP	ENST00000517392.1	37	c.842C>T	CCDS5071.1	.	.	.	.	.	.	.	.	.	.	C	11.77	1.739078	0.30774	.	.	ENSG00000183137	ENST00000517392;ENST00000407272;ENST00000368968;ENST00000522490;ENST00000368970;ENST00000523787;ENST00000359793;ENST00000523174	T;T;T;T;T;T;T	0.63255	0.94;0.94;0.95;-0.03;0.63;0.94;0.94	4.86	0.651	0.17817	.	1.065720	0.07238	N	0.863723	T	0.17450	0.0419	N	0.08118	0	0.29160	N	0.877828	B;B	0.18310	0.027;0.001	B;B	0.17433	0.018;0.006	T	0.09164	-1.0687	10	0.34782	T	0.22	0.1634	5.0614	0.14559	0.142:0.5925:0.0:0.2654	.	281;281	Q8IYX8;G5E992	CE57L_HUMAN;.	L	281;281;281;160;298;284;281;62	ENSP00000427844:P281L;ENSP00000383936:P281L;ENSP00000357964:P281L;ENSP00000429957:P160L;ENSP00000357966:P298L;ENSP00000430529:P284L;ENSP00000352841:P281L	ENSP00000352841:P281L	P	+	2	0	CEP57L1	109587184	0.001000	0.12720	0.001000	0.08648	0.025000	0.11179	0.469000	0.22067	-0.054000	0.13266	-0.145000	0.13849	CCA		0.418	CEP57L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041734.4	NM_173830		22	93	0	0	0	0.00333	0	22	93				
GPRC6A	222545	broad.mit.edu	37	6	117127989	117127989	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:117127989C>T	ENST00000310357.3	-	3	900	c.879G>A	c.(877-879)atG>atA	p.M293I	GPRC6A_ENST00000368549.3_Missense_Mutation_p.M293I|GPRC6A_ENST00000530250.1_Intron	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	293					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		TATTTATATTCATTTCAATGG	0.353																																							uc003pxj.1		NA																	0				ovary(4)|skin(2)	6						c.(877-879)ATG>ATA		G protein-coupled receptor, family C, group 6,							89.0	92.0	91.0					6																	117127989		2203	4299	6502	SO:0001583	missense	222545				response to amino acid stimulus		G-protein coupled receptor activity	g.chr6:117127989C>T	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.879G>A	6.37:g.117127989C>T	ENSP00000309493:p.Met293Ile					GPRC6A_uc003pxk.1_Intron|GPRC6A_uc003pxl.1_Missense_Mutation_p.M293I	p.M293I	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)	3	901	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	293			Extracellular (Potential).		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	c.879G>A	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.565021	0.27915	.	.	ENSG00000173612	ENST00000310357;ENST00000368549	D;D	0.83755	-1.76;-1.76	5.64	4.77	0.60923	Extracellular ligand-binding receptor (1);	0.428762	0.21919	N	0.067190	T	0.58323	0.2114	N	0.19112	0.55	0.80722	D	1	B;B	0.23891	0.03;0.093	B;B	0.27380	0.031;0.079	T	0.57236	-0.7846	10	0.22706	T	0.39	.	12.4456	0.55649	0.0:0.862:0.0:0.138	.	293;293	Q5T6X5-3;Q5T6X5	.;GPC6A_HUMAN	I	293	ENSP00000309493:M293I;ENSP00000357537:M293I	ENSP00000309493:M293I	M	-	3	0	GPRC6A	117234682	0.207000	0.23482	0.987000	0.45799	0.543000	0.35085	0.693000	0.25497	1.616000	0.50265	0.650000	0.86243	ATG		0.353	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			5	94	0	0	0	0.000602	0	5	94				
ROS1	6098	broad.mit.edu	37	6	117632220	117632220	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:117632220C>A	ENST00000368508.3	-	39	6394	c.6196G>T	c.(6196-6198)Ggc>Tgc	p.G2066C	ROS1_ENST00000368507.3_Missense_Mutation_p.G2060C	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	2066	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TAGACACAGCCTTTTGAAATA	0.378			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		uc003pxp.1		NA		Dom	yes		6	6q22	6098	T	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)			"""O, E"""	GOPC|ROS1		glioblastoma|NSCLC		0				lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25						c.(6196-6198)GGC>TGC		proto-oncogene c-ros-1 protein precursor							143.0	135.0	138.0					6																	117632220		2203	4300	6503	SO:0001583	missense	6098				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr6:117632220C>A	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.6196G>T	6.37:g.117632220C>A	ENSP00000357494:p.Gly2066Cys					ROS1_uc011ebi.1_RNA	p.G2066C	NM_002944	NP_002935	P08922	ROS_HUMAN		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)	39	6395	-		all_cancers(87;0.00846)|all_epithelial(87;0.0242)	2066			Protein kinase.|Cytoplasmic (Potential).		Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	c.6196G>T	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605258	0.87157	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	D;D	0.94138	-3.36;-3.36	5.85	5.85	0.93711	.	0.000000	0.64402	D	0.000003	D	0.98327	0.9445	H	0.98629	4.285	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.99357	1.0916	10	0.87932	D	0	.	19.1393	0.93441	0.0:1.0:0.0:0.0	.	2066	P08922	ROS1_HUMAN	C	2066;2060	ENSP00000357494:G2066C;ENSP00000357493:G2060C	ENSP00000357493:G2060C	G	-	1	0	ROS1	117738913	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.084000	0.71335	2.766000	0.95052	0.655000	0.94253	GGC		0.378	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1			14	67	1	0	3.45872e-05	0.004007	4.3345e-05	14	67				
CLVS2	134829	broad.mit.edu	37	6	123332169	123332169	+	Silent	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:123332169T>C	ENST00000275162.5	+	3	1764	c.429T>C	c.(427-429)tcT>tcC	p.S143S	CLVS2_ENST00000368438.1_5'UTR	NM_001010852.3	NP_001010852.2	Q5SYC1	CLVS2_HUMAN	clavesin 2	143	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	40						TCTTACTTTCTTTAGAAGCCA	0.393																																							uc003pzi.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						c.(427-429)TCT>TCC		retinaldehyde binding protein 1-like 2							152.0	140.0	145.0					6																	123332169		2203	4300	6503	SO:0001819	synonymous_variant	134829				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity	g.chr6:123332169T>C	AK095527	CCDS34525.1	6q22.31	2009-10-14	2009-10-14	2009-10-14	ENSG00000146352	ENSG00000146352			23046	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 212"", ""chromosome 6 open reading frame 213"", ""retinaldehyde binding protein 1-like 2"""	C6orf212, C6orf213, RLBP1L2		19651769	Standard	NM_001010852		Approved	bA160A10.4	uc003pzi.1	Q5SYC1	OTTHUMG00000015495	ENST00000275162.5:c.429T>C	6.37:g.123332169T>C							p.S143S	NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN			3	1298	+			143			CRAL-TRIO.		B3KTG5|B4DHL0|C8UZT4|Q5SYC0	Silent	SNP	ENST00000275162.5	37	c.429T>C	CCDS34525.1																																																																																				0.393	CLVS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042042.2	NM_001010852		16	100	0	0	0	0.004007	0	16	100				
LAMA2	3908	broad.mit.edu	37	6	129748969	129748969	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:129748969G>A	ENST00000421865.2	+	41	5987	c.5938G>A	c.(5938-5940)Gaa>Aaa	p.E1980K		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1980	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GATTCTTAACGAAGCCAAGAA	0.383																																							uc003qbn.2		NA																	0		p.E1980V(1)		ovary(8)|breast(1)|skin(1)	10						c.(5938-5940)GAA>AAA		laminin alpha 2 subunit isoform a precursor							114.0	112.0	112.0					6																	129748969		2203	4300	6503	SO:0001583	missense	3908				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr6:129748969G>A	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.5938G>A	6.37:g.129748969G>A	ENSP00000400365:p.Glu1980Lys					LAMA2_uc003qbo.2_Missense_Mutation_p.E1980K	p.E1980K	NM_000426	NP_000417	P24043	LAMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)	41	6043	+			1980			Domain II and I.|Potential.		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	c.5938G>A	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.726326	0.69074	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.23147	1.92	5.92	5.92	0.95590	.	0.163736	0.53938	D	0.000052	T	0.14442	0.0349	M	0.62723	1.935	0.33281	D	0.562277	P;P	0.36412	0.552;0.552	B;B	0.28385	0.089;0.089	T	0.11817	-1.0572	10	0.54805	T	0.06	.	13.724	0.62748	0.0727:0.0:0.9273:0.0	.	1980;1980	A6NF00;P24043	.;LAMA2_HUMAN	K	1980	ENSP00000400365:E1980K	ENSP00000346769:E1980K	E	+	1	0	LAMA2	129790662	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.039000	0.49791	2.810000	0.96702	0.585000	0.79938	GAA		0.383	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			8	96	0	0	0	0.00308	0	8	96				
EYA4	2070	broad.mit.edu	37	6	133783546	133783546	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:133783546G>T	ENST00000367895.5	+	8	975	c.511G>T	c.(511-513)Ggg>Tgg	p.G171W	EYA4_ENST00000452339.2_Missense_Mutation_p.G117W|EYA4_ENST00000525849.1_Missense_Mutation_p.G148W|EYA4_ENST00000355167.3_Missense_Mutation_p.G171W|EYA4_ENST00000355286.6_Missense_Mutation_p.G148W|EYA4_ENST00000531901.1_Missense_Mutation_p.G171W|EYA4_ENST00000431403.2_Missense_Mutation_p.G171W|EYA4_ENST00000430974.2_Missense_Mutation_p.G117W	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	171					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)	p.G171W(2)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TCAGTATTCGGGGATGCAGCA	0.473																																					Melanoma(57;398 1237 3528 4702 7415)	Melanoma(57;398 1237 3528 4702 7415)	uc003qec.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(2)	2						c.(511-513)GGG>TGG		eyes absent 4 isoform a							159.0	144.0	149.0					6																	133783546		2203	4300	6503	SO:0001583	missense	2070				anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	g.chr6:133783546G>T	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.511G>T	6.37:g.133783546G>T	ENSP00000356870:p.Gly171Trp					EYA4_uc011ecq.1_Missense_Mutation_p.G117W|EYA4_uc011ecr.1_Missense_Mutation_p.G117W|EYA4_uc003qed.3_Missense_Mutation_p.G171W|EYA4_uc003qee.3_Missense_Mutation_p.G148W|EYA4_uc011ecs.1_Missense_Mutation_p.G171W|uc003qef.1_Intron	p.G171W	NM_004100	NP_004091	O95677	EYA4_HUMAN		GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)	8	969	+	Colorectal(23;0.221)		171					B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	ENST00000367895.5	37	c.511G>T	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.379800	0.82682	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29	5.96	5.96	0.96718	.	0.043463	0.85682	D	0.000000	D	0.91566	0.7336	L	0.54323	1.7	0.58432	D	0.999994	D;D;D;D;D;D	0.89917	0.999;1.0;0.993;0.997;0.999;0.999	D;D;P;D;D;D	0.78314	0.967;0.991;0.724;0.924;0.985;0.985	D	0.91118	0.4927	10	0.66056	D	0.02	-13.5145	20.4192	0.99033	0.0:0.0:1.0:0.0	.	171;117;117;148;171;171	F2Z2Y1;E7ESD5;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;.;EYA4_HUMAN	W	117;117;171;171;148;171;148;171	ENSP00000395916:G117W;ENSP00000388670:G117W;ENSP00000356870:G171W;ENSP00000347294:G171W;ENSP00000347434:G148W;ENSP00000432770:G171W;ENSP00000433219:G148W;ENSP00000404558:G171W	ENSP00000347294:G171W	G	+	1	0	EYA4	133825239	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.204000	0.77872	2.831000	0.97527	0.650000	0.86243	GGG		0.473	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100		29	100	1	0	1.39806e-14	0.008361	2.51945e-14	29	100				
ECT2L	345930	broad.mit.edu	37	6	139170499	139170499	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:139170499C>A	ENST00000423192.1	+	8	1158	c.997C>A	c.(997-999)Ctg>Atg	p.L333M	ECT2L_ENST00000367682.2_Missense_Mutation_p.L333M|ECT2L_ENST00000541398.1_Missense_Mutation_p.L264M			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	333							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						AGAAAAAGCTCTGGATGGGCA	0.463			"""N, Splice, Mis"""		ETP ALL																																		uc003qif.1		NA		Rec	yes		6	6q24.1	345930		epithelial cell transforming sequence 2 oncogene-like			L					0					0						c.(997-999)CTG>ATG		epithelial cell transforming sequence 2							138.0	128.0	131.0					6																	139170499		1885	4127	6012	SO:0001583	missense	345930				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr6:139170499C>A		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.997C>A	6.37:g.139170499C>A	ENSP00000387388:p.Leu333Met					ECT2L_uc011edq.1_Missense_Mutation_p.L264M	p.L333M	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN			7	1100	+			333					B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Missense_Mutation	SNP	ENST00000423192.1	37	c.997C>A	CCDS43508.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.460970	0.43736	.	.	ENSG00000203734	ENST00000423192;ENST00000367682;ENST00000541398	T;T;T	0.79554	-0.21;-0.21;-1.28	5.53	5.53	0.82687	.	0.219310	0.20043	U	0.100466	D	0.87779	0.6263	M	0.74258	2.255	0.34182	D	0.671098	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.88810	0.3291	10	0.87932	D	0	-4.0273	16.7427	0.85464	0.0:1.0:0.0:0.0	.	264;333	F5H7S9;Q008S8	.;ECT2L_HUMAN	M	333;333;264	ENSP00000387388:L333M;ENSP00000356655:L333M;ENSP00000442307:L264M	ENSP00000356655:L333M	L	+	1	2	ECT2L	139212192	0.997000	0.39634	0.973000	0.42090	0.055000	0.15305	1.773000	0.38563	2.758000	0.94735	0.591000	0.81541	CTG		0.463	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706		18	71	1	0	9.7654e-05	0.007413	0.000118679	18	71				
STX11	8676	broad.mit.edu	37	6	144508591	144508591	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:144508591G>T	ENST00000367568.4	+	2	1010	c.827G>T	c.(826-828)cGg>cTg	p.R276L		NM_003764.3	NP_003755.2	O75558	STX11_HUMAN	syntaxin 11	276					cytotoxic T cell degranulation (GO:0043316)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|natural killer cell degranulation (GO:0043320)|neutrophil degranulation (GO:0043312)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	12				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)		AACCCCTGCCGGACCCTCTGC	0.657									Familial Hemophagocytic Lymphohistiocytosis																														uc003qks.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(826-828)CGG>CTG		syntaxin 11							37.0	32.0	34.0					6																	144508591		2202	4299	6501	SO:0001583	missense	8676	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	cellular membrane fusion|intracellular protein transport|vesicle-mediated transport	Golgi apparatus|membrane	SNAP receptor activity	g.chr6:144508591G>T	AF044309	CCDS5205.1	6q24.1	2014-09-17			ENSG00000135604	ENSG00000135604			11429	protein-coding gene	gene with protein product		605014				9553086	Standard	NM_003764		Approved		uc003qks.4	O75558	OTTHUMG00000015739	ENST00000367568.4:c.827G>T	6.37:g.144508591G>T	ENSP00000356540:p.Arg276Leu						p.R276L	NM_003764	NP_003755	O75558	STX11_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)	2	1019	+			276					E1P598|O75378|O95148|Q5TCL6	Missense_Mutation	SNP	ENST00000367568.4	37	c.827G>T	CCDS5205.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.170518	0.57584	.	.	ENSG00000135604	ENST00000367568	T	0.46451	0.87	5.62	5.62	0.85841	.	0.311639	0.31246	N	0.007996	T	0.34600	0.0903	L	0.58669	1.825	0.47698	D	0.999494	P	0.48089	0.905	B	0.42495	0.389	T	0.15694	-1.0428	10	0.41790	T	0.15	-29.7433	19.2708	0.94008	0.0:0.0:1.0:0.0	.	276	O75558	STX11_HUMAN	L	276	ENSP00000356540:R276L	ENSP00000356540:R276L	R	+	2	0	STX11	144550284	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	4.341000	0.59335	2.648000	0.89879	0.655000	0.94253	CGG		0.657	STX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042544.1			7	22	1	0	2.0095e-06	0.001984	2.71242e-06	7	22				
FNDC1	84624	broad.mit.edu	37	6	159655446	159655446	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:159655446G>C	ENST00000297267.9	+	11	4102	c.3902G>C	c.(3901-3903)aGg>aCg	p.R1301T	FNDC1_ENST00000340366.6_Missense_Mutation_p.R1238T	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1301					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R1301M(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		TTGCGCCAGAGGATGATGCAT	0.587																																							uc010kjv.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	large_intestine(4)|ovary(3)|central_nervous_system(1)	8						c.(3901-3903)AGG>ACG		fibronectin type III domain containing 1							28.0	30.0	29.0					6																	159655446		2065	4154	6219	SO:0001583	missense	84624					extracellular region		g.chr6:159655446G>C	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.3902G>C	6.37:g.159655446G>C	ENSP00000297267:p.Arg1301Thr					FNDC1_uc010kjw.1_Missense_Mutation_p.R1186T	p.R1301T	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)	11	4102	+		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)	1301					A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	c.3902G>C	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.56|14.56	2.570427|2.570427	0.45798|0.45798	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000329629|ENST00000297267;ENST00000340366	.|T;T	.|0.12569	.|2.67;3.45	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	.|0.340357	.|0.27591	.|N	.|0.018700	T|T	0.16557|0.16557	0.0398|0.0398	L|L	0.34521|0.34521	1.04|1.04	0.33508|0.33508	D|D	0.590713|0.590713	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.74348	.|0.983;0.915	T|T	0.01998|0.01998	-1.1232|-1.1232	5|10	.|0.36615	.|T	.|0.2	-24.0719|-24.0719	15.5087|15.5087	0.75764|0.75764	0.0:0.1386:0.8613:0.0|0.0:0.1386:0.8613:0.0	.|.	.|1238;1301	.|Q4ZHG4-2;Q4ZHG4	.|.;FNDC1_HUMAN	D|T	1196|1301;1238	.|ENSP00000297267:R1301T;ENSP00000342460:R1238T	.|ENSP00000297267:R1301T	E|R	+|+	3|2	2|0	FNDC1|FNDC1	159575436|159575436	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.425000|0.425000	0.31504|0.31504	4.356000|4.356000	0.59430|0.59430	2.612000|2.612000	0.88384|0.88384	0.650000|0.650000	0.86243|0.86243	GAG|AGG		0.587	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532		4	35	0	0	0	0.000602	0	4	35				
WTAP	9589	broad.mit.edu	37	6	160176510	160176510	+	Nonsense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:160176510C>G	ENST00000358372.4	+	8	2815	c.1058C>G	c.(1057-1059)tCa>tGa	p.S353*	SOD2_ENST00000546087.1_Intron	NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	Q15007	FL2D_HUMAN	Wilms tumor 1 associated protein	353					cell cycle (GO:0007049)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	MIS complex (GO:0036396)|nuclear membrane (GO:0031965)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	18		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		ACACACCAATCAAATGACACA	0.502																																							uc003qsl.2		NA																	0					0						c.(1057-1059)TCA>TGA		Wilms' tumour 1-associating protein isoform 1							99.0	100.0	100.0					6																	160176510		2203	4300	6503	SO:0001587	stop_gained	9589				cell cycle|mRNA processing|RNA splicing	nuclear membrane|nucleolus		g.chr6:160176510C>G	AJ276706	CCDS5266.1, CCDS5267.1, CCDS75542.1	6q25-q27	2008-02-05			ENSG00000146457	ENSG00000146457			16846	protein-coding gene	gene with protein product		605442				7788527, 11001926	Standard	NM_004906		Approved	KIAA0105, MGC3925	uc003qsl.4	Q15007	OTTHUMG00000015933	ENST00000358372.4:c.1058C>G	6.37:g.160176510C>G	ENSP00000351141:p.Ser353*					WTAP_uc003qso.2_Nonsense_Mutation_p.S234*	p.S353*	NM_004906	NP_004897	Q15007	FL2D_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)	8	1280	+		Breast(66;0.000776)|Ovarian(120;0.0303)	353					Q5TCL8|Q5TCL9|Q96T28|Q9BYJ7|Q9H4E2	Nonsense_Mutation	SNP	ENST00000358372.4	37	c.1058C>G	CCDS5266.1	.	.	.	.	.	.	.	.	.	.	C	51	17.346755	0.99884	.	.	ENSG00000146457	ENST00000358372	.	.	.	6.17	5.31	0.75309	.	0.062472	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-1.3633	15.5968	0.76590	0.0:0.9345:0.0:0.0655	.	.	.	.	X	353	.	ENSP00000351141:S353X	S	+	2	0	WTAP	160096500	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.679000	0.68160	1.627000	0.50400	0.655000	0.94253	TCA		0.502	WTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042905.1	NM_152857		13	90	0	0	0	0.001368	0	13	90				
LPA	4018	broad.mit.edu	37	6	160977168	160977168	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:160977168C>A	ENST00000316300.5	-	30	4906	c.4862G>T	c.(4861-4863)gGc>gTc	p.G1621V	LPA_ENST00000447678.1_Missense_Mutation_p.G1621V			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4129	Kringle 15. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	ATAACTCTGGCCATTACCATG	0.488																																							uc003qtl.2		NA																	0				ovary(3)|skin(2)|pancreas(1)	6						c.(4861-4863)GGC>GTC		lipoprotein Lp(a) precursor	Aminocaproic Acid(DB00513)						152.0	154.0	153.0					6																	160977168		2188	4300	6488	SO:0001583	missense	4018				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	g.chr6:160977168C>A	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4862G>T	6.37:g.160977168C>A	ENSP00000321334:p.Gly1621Val						p.G1621V	NM_005577	NP_005568	P08519	APOA_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	31	4982	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	4129			Kringle 37.		Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	c.4862G>T	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	c	11.15	1.555315	0.27739	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	D;D	0.85171	-1.95;-1.95	2.77	2.77	0.32553	Kringle (4);Kringle-like fold (1);	.	.	.	.	D	0.95198	0.8443	H	0.99689	4.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96149	0.9106	9	0.87932	D	0	.	12.6811	0.56922	0.0:1.0:0.0:0.0	.	4129	P08519	APOA_HUMAN	V	1621	ENSP00000321334:G1621V;ENSP00000395608:G1621V	ENSP00000321334:G1621V	G	-	2	0	LPA	160897158	0.998000	0.40836	0.008000	0.14137	0.004000	0.04260	5.825000	0.69286	1.550000	0.49438	0.491000	0.48974	GGC		0.488	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577		30	128	1	0	3.1745e-13	0.008361	5.46141e-13	30	128				
TCP10L2	401285	broad.mit.edu	37	6	167591903	167591903	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:167591903C>G	ENST00000366832.2	+	5	661	c.530C>G	c.(529-531)tCg>tGg	p.S177W		NM_001145121.1	NP_001138593.1	B9ZVM9	TCP2L_HUMAN	t-complex 10-like 2	177										endometrium(1)|kidney(2)|lung(3)	6						AGAATTAACTCGGGGAAAACA	0.433																																							uc010kkp.2		NA																	0					0						c.(529-531)TCG>TGG		t-complex 10-like 2							9.0	10.0	10.0					6																	167591903		673	1544	2217	SO:0001583	missense	401285							g.chr6:167591903C>G		CCDS47514.1	6q27	2012-09-20	2012-09-20		ENSG00000166984	ENSG00000166984			21254	protein-coding gene	gene with protein product			"""t-complex 10-like 2 (mouse)"""				Standard	NM_001145121		Approved	bA517H2.3	uc010kkp.3	B9ZVM9	OTTHUMG00000016014	ENST00000366832.2:c.530C>G	6.37:g.167591903C>G	ENSP00000355797:p.Ser177Trp						p.S177W	NM_001145121	NP_001138593	B9ZVM9	B9ZVM9_HUMAN			5	661	+			177						Missense_Mutation	SNP	ENST00000366832.2	37	c.530C>G	CCDS47514.1	.	.	.	.	.	.	.	.	.	.	c	10.12	1.263564	0.23136	.	.	ENSG00000166984	ENST00000366832	T	0.18810	2.19	2.09	0.0916	0.14469	.	.	.	.	.	T	0.12944	0.0314	L	0.48642	1.525	0.09310	N	1	D	0.67145	0.996	P	0.55112	0.769	T	0.07233	-1.0783	9	0.87932	D	0	.	5.4485	0.16550	0.0:0.6728:0.0:0.3272	.	177	B9ZVM9	TCP2L_HUMAN	W	177	ENSP00000355797:S177W	ENSP00000283507:S177W	S	+	2	0	TCP10L2	167511893	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	0.134000	0.15932	-0.268000	0.09312	-1.252000	0.01501	TCG		0.433	TCP10L2-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043112.5	XR_040749		6	45	0	0	0	0.004482	0	6	45				
KIF25	3834	broad.mit.edu	37	6	168443325	168443325	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:168443325C>A	ENST00000443060.2	+	9	1305	c.914C>A	c.(913-915)gCt>gAt	p.A305D	KIF25_ENST00000351261.3_Intron|KIF25_ENST00000354419.2_Missense_Mutation_p.A305D			Q9UIL4	KIF25_HUMAN	kinesin family member 25	305	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GTCCTGGGGGCTTTGTTGGAG	0.652																																							uc003qwk.1		NA																	0				ovary(1)|pancreas(1)	2						c.(913-915)GCT>GAT		kinesin family member 25 isoform 1							101.0	98.0	99.0					6																	168443325		2203	4300	6503	SO:0001583	missense	3834				microtubule-based movement|mitotic sister chromatid segregation	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity	g.chr6:168443325C>A	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.914C>A	6.37:g.168443325C>A	ENSP00000388878:p.Ala305Asp					KIF25_uc003qwl.1_Intron	p.A305D	NM_030615	NP_085118	Q9UIL4	KIF25_HUMAN		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)	8	1176	+		Breast(66;1.07e-05)|Ovarian(120;0.0728)	305					O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	37	c.914C>A	CCDS5305.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.511070	0.44660	.	.	ENSG00000125337	ENST00000443060;ENST00000354419	T;T	0.78003	-1.14;-1.14	4.13	3.24	0.37175	Kinesin, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.85128	0.5626	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86616	0.1876	10	0.87932	D	0	-12.5699	9.7087	0.40231	0.0:0.8958:0.0:0.1042	.	305	Q9UIL4	KIF25_HUMAN	D	305	ENSP00000388878:A305D;ENSP00000346401:A305D	ENSP00000346401:A305D	A	+	2	0	KIF25	168186174	1.000000	0.71417	0.745000	0.31077	0.044000	0.14063	4.009000	0.57110	0.839000	0.34971	0.543000	0.68304	GCT		0.652	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1			15	49	1	0	2.61681e-11	0.00245	4.2758e-11	15	49				
CYP2W1	54905	broad.mit.edu	37	7	1027059	1027059	+	Silent	SNP	C	C	A	rs377096714		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:1027059C>A	ENST00000308919.7	+	7	1048	c.1035C>A	c.(1033-1035)ccC>ccA	p.P345P	CYP2W1_ENST00000340150.6_Silent_p.P289P	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	345					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		AGGCTCTGCCCTACACAAGCG	0.721																																							uc003sjq.1		NA																	0					0						c.(1033-1035)CCC>CCA		cytochrome P450, family 2, subfamily W,							11.0	13.0	12.0					7																	1027059		2162	4271	6433	SO:0001819	synonymous_variant	54905				xenobiotic metabolic process	endoplasmic reticulum membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen	g.chr7:1027059C>A	AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.1035C>A	7.37:g.1027059C>A						CYP2W1_uc003sjr.1_Silent_p.P345P	p.P345P	NM_017781	NP_060251	Q8TAV3	CP2W1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)	7	1048	+		Ovarian(82;0.0112)	345						Silent	SNP	ENST00000308919.7	37	c.1035C>A	CCDS5319.2																																																																																				0.721	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157249.1	NM_017781		4	9	1	0	0.000602214	0.000602	0.00070551	4	9				
DAGLB	221955	broad.mit.edu	37	7	6449644	6449644	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:6449644G>A	ENST00000297056.6	-	15	2012	c.1843C>T	c.(1843-1845)Cac>Tac	p.H615Y	DAGLB_ENST00000436575.1_Missense_Mutation_p.H574Y|DAGLB_ENST00000425398.2_Missense_Mutation_p.H486Y|DAGLB_ENST00000428902.2_3'UTR	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	615					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		GCGCTATAGTGAGCAGCAGAG	0.597																																							uc003sqa.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1843-1845)CAC>TAC		diacylglycerol lipase, beta isoform 1							79.0	81.0	80.0					7																	6449644		2203	4300	6503	SO:0001583	missense	221955				lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity	g.chr7:6449644G>A	AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.1843C>T	7.37:g.6449644G>A	ENSP00000297056:p.His615Tyr					DAGLB_uc003spy.2_Missense_Mutation_p.H161Y|DAGLB_uc003spz.2_Missense_Mutation_p.H312Y|DAGLB_uc011jwt.1_Missense_Mutation_p.H429Y|DAGLB_uc011jwu.1_Missense_Mutation_p.H486Y|DAGLB_uc003sqb.2_Missense_Mutation_p.H334Y|DAGLB_uc003sqc.2_Missense_Mutation_p.H334Y|DAGLB_uc011jwv.1_RNA|DAGLB_uc003sqd.3_Missense_Mutation_p.H574Y	p.H615Y	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)	15	2013	-		Ovarian(82;0.232)	615			Cytoplasmic (Potential).		A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Missense_Mutation	SNP	ENST00000297056.6	37	c.1843C>T	CCDS5350.1	.	.	.	.	.	.	.	.	.	.	.	21.6	4.170509	0.78452	.	.	ENSG00000164535	ENST00000297056;ENST00000425398;ENST00000436575	T;T;T	0.43294	0.95;0.96;0.95	5.51	4.56	0.56223	.	0.788496	0.11999	N	0.509020	T	0.27027	0.0662	N	0.22421	0.69	0.42086	D	0.991275	P;B;B;B	0.48834	0.916;0.13;0.275;0.022	B;B;B;B	0.35607	0.206;0.04;0.04;0.016	T	0.13335	-1.0513	10	0.62326	D	0.03	-22.7775	11.0549	0.47911	0.0:0.0:0.5885:0.4115	.	486;429;615;312	B4DQU0;B4DQQ6;Q8NCG7;B3KRA0	.;.;DGLB_HUMAN;.	Y	615;486;574	ENSP00000297056:H615Y;ENSP00000391171:H486Y;ENSP00000404785:H574Y	ENSP00000297056:H615Y	H	-	1	0	DAGLB	6416169	0.260000	0.24053	0.024000	0.17045	0.977000	0.68977	3.343000	0.52167	2.590000	0.87494	0.650000	0.86243	CAC		0.597	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	NM_139179		5	66	0	0	0	0.001168	0	5	66				
DGKB	1607	broad.mit.edu	37	7	14758281	14758281	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:14758281G>T	ENST00000403951.2	-	6	771	c.352C>A	c.(352-354)Cct>Act	p.P118T	DGKB_ENST00000407950.1_Missense_Mutation_p.P111T|DGKB_ENST00000444700.2_Missense_Mutation_p.P111T|DGKB_ENST00000406247.3_Missense_Mutation_p.P118T|DGKB_ENST00000258767.5_Missense_Mutation_p.P118T|DGKB_ENST00000402815.1_Missense_Mutation_p.P118T|DGKB_ENST00000399322.3_Missense_Mutation_p.P118T|DGKB_ENST00000403963.1_5'UTR			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	118					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						GTCCGGGGAGGGGTGATGGCA	0.383																																							uc003ssz.2		NA																	0				lung(5)|ovary(4)|breast(2)|skin(1)	12						c.(352-354)CCT>ACT		diacylglycerol kinase, beta isoform 1	Phosphatidylserine(DB00144)						80.0	76.0	77.0					7																	14758281		1838	4093	5931	SO:0001583	missense	1607				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding	g.chr7:14758281G>T	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.352C>A	7.37:g.14758281G>T	ENSP00000385780:p.Pro118Thr					DGKB_uc011jxt.1_Missense_Mutation_p.P111T|DGKB_uc003sta.2_Missense_Mutation_p.P118T|DGKB_uc011jxu.1_Missense_Mutation_p.P118T|DGKB_uc011jxv.1_Missense_Mutation_p.P118T	p.P118T	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN			5	539	-			118					A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	c.352C>A	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	G	8.553	0.876022	0.17395	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.79033	-1.11;-1.11;-1.11;-1.11;-1.11;-1.12;-1.23	5.11	2.32	0.28847	.	0.530450	0.20743	N	0.086515	T	0.61311	0.2337	L	0.34521	1.04	0.30612	N	0.759431	B;B;B;B	0.23377	0.001;0.0;0.0;0.084	B;B;B;B	0.23018	0.002;0.001;0.001;0.043	T	0.51309	-0.8722	10	0.11182	T	0.66	.	7.4868	0.27439	0.3439:0.0:0.6561:0.0	.	118;111;118;118	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	T	118;118;118;118;111;111;118	ENSP00000385780:P118T;ENSP00000382260:P118T;ENSP00000258767:P118T;ENSP00000384909:P118T;ENSP00000385031:P111T;ENSP00000388451:P111T;ENSP00000386066:P118T	ENSP00000258767:P118T	P	-	1	0	DGKB	14724806	1.000000	0.71417	0.960000	0.40013	0.853000	0.48598	2.599000	0.46231	0.549000	0.28973	0.655000	0.94253	CCT		0.383	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080		11	34	1	0	1.58986e-06	0.008291	2.1588e-06	11	34				
HDAC9	9734	broad.mit.edu	37	7	18625115	18625115	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:18625115G>A	ENST00000432645.2	+	2	234	c.234G>A	c.(232-234)caG>caA	p.Q78Q	HDAC9_ENST00000406072.1_Silent_p.Q106Q|HDAC9_ENST00000441542.2_Silent_p.Q78Q|HDAC9_ENST00000428307.2_Silent_p.Q78Q|HDAC9_ENST00000456174.2_Silent_p.Q47Q|HDAC9_ENST00000401921.1_Silent_p.Q78Q|HDAC9_ENST00000406451.4_Silent_p.Q78Q|HDAC9_ENST00000405010.3_Silent_p.Q78Q|HDAC9_ENST00000524023.1_Silent_p.Q47Q|HDAC9_ENST00000476135.1_3'UTR|HDAC9_ENST00000417496.2_Silent_p.Q120Q	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	78					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	TGACACGGCAGCACCAGGCTC	0.483																																							uc003suh.2		NA																	0				lung(2)|central_nervous_system(2)|kidney(1)	5						c.(232-234)CAG>CAA		histone deacetylase 9 isoform 1	Valproic Acid(DB00313)						45.0	47.0	46.0					7																	18625115		2101	4232	6333	SO:0001819	synonymous_variant	9734				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity	g.chr7:18625115G>A	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.234G>A	7.37:g.18625115G>A						HDAC9_uc003sue.2_Silent_p.Q78Q|HDAC9_uc011jyd.1_Silent_p.Q78Q|HDAC9_uc003sui.2_Silent_p.Q78Q|HDAC9_uc003suj.2_Silent_p.Q78Q|HDAC9_uc011jya.1_Silent_p.Q119Q|HDAC9_uc003sua.1_Silent_p.Q97Q|HDAC9_uc011jyb.1_Silent_p.Q78Q|HDAC9_uc003sud.1_Silent_p.Q78Q|HDAC9_uc011jyc.1_Silent_p.Q78Q|HDAC9_uc003suf.1_Silent_p.Q106Q|HDAC9_uc010kud.1_Silent_p.Q78Q|HDAC9_uc011jye.1_Silent_p.Q47Q|HDAC9_uc011jyf.1_Silent_p.Q47Q	p.Q78Q	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN			2	275	+	all_lung(11;0.187)		78					A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Silent	SNP	ENST00000432645.2	37	c.234G>A	CCDS47555.1																																																																																				0.483	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1			8	35	0	0	0	0.006214	0	8	35				
SP8	221833	broad.mit.edu	37	7	20825372	20825372	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:20825372C>A	ENST00000361443.4	-	3	247	c.10G>T	c.(10-12)Gct>Tct	p.A4S	SP8_ENST00000418710.2_Missense_Mutation_p.A22S	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	4					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						TTACAGGTAGCGGCAAGCATG	0.627																																							uc003suy.2		NA																	0				pancreas(1)	1						c.(10-12)GCT>TCT		Sp8 transcription factor isoform 2							33.0	36.0	35.0					7																	20825372		2203	4300	6503	SO:0001583	missense	221833				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:20825372C>A		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.10G>T	7.37:g.20825372C>A	ENSP00000354482:p.Ala4Ser					SP8_uc003suz.2_Missense_Mutation_p.A22S	p.A4S	NM_198956	NP_945194	Q8IXZ3	SP8_HUMAN			3	251	-			4					Q7Z615|Q7Z616|Q96MJ1	Missense_Mutation	SNP	ENST00000361443.4	37	c.10G>T	CCDS5372.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.386863	0.82902	.	.	ENSG00000164651	ENST00000297210;ENST00000418710;ENST00000361443	T;T	0.61980	0.06;0.4	3.67	3.67	0.42095	.	0.000000	0.85682	U	0.000000	T	0.73969	0.3655	L	0.54323	1.7	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.74023	0.982;0.982	T	0.78193	-0.2299	10	0.87932	D	0	.	15.1605	0.72782	0.0:1.0:0.0:0.0	.	4;4	Q7Z615;Q8IXZ3	.;SP8_HUMAN	S	22;22;4	ENSP00000408792:A22S;ENSP00000354482:A4S	ENSP00000297210:A22S	A	-	1	0	SP8	20791897	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.469000	0.66749	1.856000	0.53863	0.455000	0.32223	GCT		0.627	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2			18	31	1	0	1.67942e-08	0.006122	2.51544e-08	18	31				
CREB5	9586	broad.mit.edu	37	7	28848929	28848929	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:28848929G>A	ENST00000357727.2	+	9	1542	c.1152G>A	c.(1150-1152)cgG>cgA	p.R384R	CREB5_ENST00000396300.2_Silent_p.R377R|CREB5_ENST00000396298.2_Silent_p.R245R|CREB5_ENST00000409603.1_Silent_p.R351R|CREB5_ENST00000396299.2_Silent_p.R351R	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	384	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						TTCTGGAACGGAACCGGGCAG	0.592																																							uc003szq.2		NA																	0				skin(2)	2						c.(1150-1152)CGG>CGA		cAMP responsive element binding protein 5							51.0	56.0	54.0					7																	28848929		2203	4300	6503	SO:0001819	synonymous_variant	9586				positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:28848929G>A	L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.1152G>A	7.37:g.28848929G>A						CREB5_uc003szo.2_Silent_p.R351R|CREB5_uc003szr.2_Silent_p.R377R|CREB5_uc003szs.2_Silent_p.R245R	p.R384R	NM_182898	NP_878901	Q02930	CREB5_HUMAN			9	1542	+			384			Basic motif.		A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Silent	SNP	ENST00000357727.2	37	c.1152G>A	CCDS5417.1																																																																																				0.592	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214204.4	NM_004904		13	49	0	0	0	0.001855	0	13	49				
KBTBD2	25948	broad.mit.edu	37	7	32909054	32909054	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:32909054T>A	ENST00000304056.4	-	4	2474	c.1775A>T	c.(1774-1776)gAa>gTa	p.E592V	KBTBD2_ENST00000485611.1_5'Flank|AVL9_ENST00000404479.1_Intron	NM_015483.2	NP_056298.2	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	592										endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|urinary_tract(1)	17			GBM - Glioblastoma multiforme(11;0.0499)			TGGAGACTCTTCAAGGCAGGA	0.483																																							uc003tdb.2		NA																	0					0						c.(1774-1776)GAA>GTA		kelch repeat and BTB (POZ) domain containing 2							130.0	122.0	124.0					7																	32909054		2203	4300	6503	SO:0001583	missense	25948							g.chr7:32909054T>A	AB040922	CCDS34614.1	7p14.3	2013-01-08	2003-12-12	2003-12-12	ENSG00000170852	ENSG00000170852		"""BTB/POZ domain containing"""	21751	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 1"""	BKLHD1		10819331	Standard	NM_015483		Approved	DKFZP566C134	uc003tdb.2	Q8IY47	OTTHUMG00000152984	ENST00000304056.4:c.1775A>T	7.37:g.32909054T>A	ENSP00000302586:p.Glu592Val					AVL9_uc011kai.1_Intron	p.E592V	NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	GBM - Glioblastoma multiforme(11;0.0499)		4	2434	-			592					A8K9T7|Q86Y62|Q9P239|Q9UFM7|Q9Y382	Missense_Mutation	SNP	ENST00000304056.4	37	c.1775A>T	CCDS34614.1	.	.	.	.	.	.	.	.	.	.	T	13.31	2.198289	0.38806	.	.	ENSG00000170852	ENST00000304056	T	0.69561	-0.41	5.52	5.52	0.82312	.	0.047886	0.85682	D	0.000000	T	0.52306	0.1726	N	0.19112	0.55	0.54753	D	0.999989	P	0.47762	0.9	B	0.38954	0.286	T	0.59456	-0.7451	10	0.52906	T	0.07	.	15.6365	0.76958	0.0:0.0:0.0:1.0	.	592	Q8IY47	KBTB2_HUMAN	V	592	ENSP00000302586:E592V	ENSP00000302586:E592V	E	-	2	0	KBTBD2	32875579	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.186000	0.72026	2.110000	0.64415	0.482000	0.46254	GAA		0.483	KBTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328890.1	XM_291224		29	84	0	0	0	0.007291	0	29	84				
DPY19L1	23333	broad.mit.edu	37	7	34971203	34971203	+	Silent	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:34971203T>A	ENST00000310974.4	-	22	2154	c.2010A>T	c.(2008-2010)ctA>ctT	p.L670L		NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	670						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						TTACAACTTCTAGGACTTTGT	0.413																																							uc003tem.3		NA																	0					0						c.(2008-2010)CTA>CTT		dpy-19-like 1							74.0	67.0	69.0					7																	34971203		1815	4061	5876	SO:0001819	synonymous_variant	23333					integral to membrane		g.chr7:34971203T>A	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.2010A>T	7.37:g.34971203T>A						DPY19L1_uc003tel.1_RNA	p.L670L	NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN			22	2155	-			670					O94954|Q4G151	Silent	SNP	ENST00000310974.4	37	c.2010A>T	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	T	9.674	1.147382	0.21288	.	.	ENSG00000173852	ENST00000428054	.	.	.	5.44	-2.78	0.05859	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.4972	13.6027	0.62029	0.0:0.7536:0.0:0.2464	.	.	.	.	X	78	.	.	R	-	1	2	DPY19L1	34937728	0.811000	0.29063	0.990000	0.47175	0.998000	0.95712	-0.093000	0.11111	-0.431000	0.07307	0.523000	0.50628	AGA		0.413	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1			22	87	0	0	0	0.004656	0	22	87				
ADCY1	107	broad.mit.edu	37	7	45650001	45650001	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:45650001G>T	ENST00000297323.7	+	3	835	c.813G>T	c.(811-813)ctG>ctT	p.L271L	ADCY1_ENST00000432715.1_Silent_p.L46L	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	271					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGAGCCTCCTGCCCCGGAACG	0.592																																							uc003tne.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(811-813)CTG>CTT		adenylate cyclase 1	Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						68.0	73.0	72.0					7																	45650001		2203	4300	6503	SO:0001819	synonymous_variant	107				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding	g.chr7:45650001G>T	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.813G>T	7.37:g.45650001G>T						ADCY1_uc003tnd.2_Silent_p.L46L	p.L271L	NM_021116	NP_066939	Q08828	ADCY1_HUMAN			3	831	+			271			Cytoplasmic (Potential).		A4D2L8|Q75MI1	Silent	SNP	ENST00000297323.7	37	c.813G>T	CCDS34631.1																																																																																				0.592	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116		22	95	1	0	2.39556e-15	0.00278	4.38652e-15	22	95				
SUN3	256979	broad.mit.edu	37	7	48026950	48026950	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:48026950C>A	ENST00000297325.4	-	10	1210	c.1051G>T	c.(1051-1053)Ggc>Tgc	p.G351C	SUN3_ENST00000412142.1_Missense_Mutation_p.G263C|SUN3_ENST00000453192.2_Missense_Mutation_p.G339C|SUN3_ENST00000473723.1_5'UTR|SUN3_ENST00000395572.2_Missense_Mutation_p.G351C	NM_001030019.1	NP_001025190.1	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 3	351	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.					integral component of membrane (GO:0016021)|SUN-KASH complex (GO:0034993)				central_nervous_system(1)|endometrium(3)|large_intestine(8)|liver(1)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCTGGTGTGCCATGGACCCTG	0.413																																							uc003tof.2		NA																	0				central_nervous_system(1)	1						c.(1051-1053)GGC>TGC		Sad1 and UNC84 domain containing 1							179.0	169.0	172.0					7																	48026950		2203	4300	6503	SO:0001583	missense	256979					integral to membrane		g.chr7:48026950C>A	AF429967	CCDS34636.1, CCDS64647.1	7p12.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164744	ENSG00000164744			22429	protein-coding gene	gene with protein product			"""Sad1 and UNC84 domain containing 1"""	SUNC1			Standard	NM_001284350		Approved	MGC33329	uc003tof.3	Q8TAQ9	OTTHUMG00000155646	ENST00000297325.4:c.1051G>T	7.37:g.48026950C>A	ENSP00000297325:p.Gly351Cys					SUN3_uc010kyq.2_Missense_Mutation_p.G263C|SUN3_uc003tog.2_Missense_Mutation_p.G351C|SUN3_uc011kcf.1_Missense_Mutation_p.G339C	p.G351C	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN			11	1148	-			351			SUN.		A4D2F3|B4DXK1|D3DVM3|E7EWC8|Q4F965|Q7Z4U8	Missense_Mutation	SNP	ENST00000297325.4	37	c.1051G>T	CCDS34636.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.70|17.70|17.70	3.454214|3.454214|3.454214	0.63290|0.63290|0.63290	.|.|.	.|.|.	ENSG00000164744|ENSG00000164744|ENSG00000164744	ENST00000297325;ENST00000412142;ENST00000395572;ENST00000453192;ENST00000438771|ENST00000453071|ENST00000412371	T;T;T;T;T|.|T	0.72942|.|0.39592	-0.7;-0.7;-0.7;-0.7;-0.7|.|1.07	5.64|5.64|5.64	5.64|5.64|5.64	0.86602|0.86602|0.86602	Sad1/UNC-like, C-terminal (2);|.|.	0.112616|.|.	0.64402|.|.	D|.|.	0.000012|.|.	T|T|T	0.71813|0.71813|0.71813	0.3384|0.3384|0.3384	H|H|H	0.94658|0.94658|0.94658	3.565|3.565|3.565	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D|.|.	0.89917|.|.	1.0;1.0;1.0|.|.	D;D;D|.|.	0.97110|.|.	1.0;0.988;1.0|.|.	T|T|T	0.74957|0.74957|0.74957	-0.3487|-0.3487|-0.3487	10|5|7	0.87932|.|0.25751	D|.|T	0|.|0.34	.|.|.	17.2027|17.2027|17.2027	0.86910|0.86910|0.86910	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	339;263;351|.|.	E7EWC8;Q8TAQ9-2;Q8TAQ9|.|.	.;.;SUN3_HUMAN|.|.	C|I|L	351;263;351;339;263|274|143	ENSP00000297325:G351C;ENSP00000410204:G263C;ENSP00000378939:G351C;ENSP00000387525:G339C;ENSP00000409077:G263C|.|ENSP00000406887:W143L	ENSP00000297325:G351C|.|ENSP00000406887:W143L	G|M|W	-|-|-	1|3|2	0|0|0	SUN3|SUN3|SUN3	47993475|47993475|47993475	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.369000|0.369000|0.369000	0.25952|0.25952|0.25952	0.159000|0.159000|0.159000	0.22180|0.22180|0.22180	7.203000|7.203000|7.203000	0.77864|0.77864|0.77864	2.663000|2.663000|2.663000	0.90544|0.90544|0.90544	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	GGC|ATG|TGG		0.413	SUN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340962.1	NM_152782		32	146	1	0	6.97489e-18	0.004878	1.33816e-17	32	146				
COBL	23242	broad.mit.edu	37	7	51095655	51095655	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:51095655G>A	ENST00000265136.7	-	10	3303	c.3138C>T	c.(3136-3138)caC>caT	p.H1046H	COBL_ENST00000395542.2_Silent_p.H1128H	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	1046					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					AAGGCTCGCCGTGGCCTGGGG	0.587																																					NSCLC(189;2119 2138 12223 30818 34679)	NSCLC(189;2119 2138 12223 30818 34679)	uc003tpr.3		NA																	0				skin(3)|ovary(2)	5						c.(3136-3138)CAC>CAT		cordon-bleu homolog							70.0	71.0	71.0					7																	51095655		2203	4300	6503	SO:0001819	synonymous_variant	23242							g.chr7:51095655G>A	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.3138C>T	7.37:g.51095655G>A						COBL_uc003tps.2_Silent_p.H1103H|COBL_uc011kcl.1_Silent_p.H1046H|COBL_uc003tpp.3_Silent_p.H832H|COBL_uc003tpq.3_Silent_p.H987H|COBL_uc003tpo.3_Silent_p.H588H	p.H1046H	NM_015198	NP_056013	O75128	COBL_HUMAN			10	3323	-	Glioma(55;0.08)		1046					A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	ENST00000265136.7	37	c.3138C>T	CCDS34637.1																																																																																				0.587	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198		12	51	0	0	0	0.000978	0	12	51				
GTF2IRD1	9569	broad.mit.edu	37	7	73927187	73927187	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:73927187G>T	ENST00000265755.3	+	3	544	c.151G>T	c.(151-153)Gag>Tag	p.E51*	GTF2IRD1_ENST00000489094.1_3'UTR|GTF2IRD1_ENST00000424337.2_Nonsense_Mutation_p.E51*|GTF2IRD1_ENST00000476977.1_Nonsense_Mutation_p.E51*|GTF2IRD1_ENST00000455841.2_Nonsense_Mutation_p.E51*	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	51					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ACTGAACGCCGAGGTGGCCTG	0.597																																							uc003uaq.2		NA																	0				ovary(4)	4						c.(151-153)GAG>TAG		GTF2I repeat domain containing 1 isoform 1							86.0	76.0	79.0					7																	73927187		2203	4300	6503	SO:0001587	stop_gained	9569					nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr7:73927187G>T	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.151G>T	7.37:g.73927187G>T	ENSP00000265755:p.Glu51*					GTF2IRD1_uc010lbq.2_Nonsense_Mutation_p.E51*|GTF2IRD1_uc003uap.2_Nonsense_Mutation_p.E51*|GTF2IRD1_uc003uar.1_Nonsense_Mutation_p.E51*	p.E51*	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN			3	544	+			51					O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Nonsense_Mutation	SNP	ENST00000265755.3	37	c.151G>T	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	G	51	18.302126	0.99902	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	.	.	.	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.4595	17.1174	0.86692	0.0:0.0:1.0:0.0	.	.	.	.	X	51	.	ENSP00000265755:E51X	E	+	1	0	GTF2IRD1	73565123	1.000000	0.71417	0.611000	0.29010	0.912000	0.54170	8.865000	0.92300	2.443000	0.82685	0.650000	0.86243	GAG		0.597	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328		7	44	1	0	8.12818e-05	0.001984	9.89581e-05	7	44				
CACNA2D1	781	broad.mit.edu	37	7	81599236	81599236	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:81599236C>A	ENST00000356253.5	-	28	2560	c.2305G>T	c.(2305-2307)Gat>Tat	p.D769Y	CACNA2D1_ENST00000535308.1_Intron|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.D757Y			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	769					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TTATCATTATCTAGGCTCCTT	0.338																																							uc003uhr.1		NA																	0				ovary(5)|pancreas(1)	6						c.(2269-2271)GAT>TAT		calcium channel, voltage-dependent, alpha	Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)						146.0	143.0	144.0					7																	81599236		2203	4299	6502	SO:0001583	missense	781					voltage-gated calcium channel complex	metal ion binding	g.chr7:81599236C>A	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2305G>T	7.37:g.81599236C>A	ENSP00000348589:p.Asp769Tyr					CACNA2D1_uc011kgy.1_Intron	p.D757Y	NM_000722	NP_000713	P54289	CA2D1_HUMAN			28	2525	-			769			Extracellular (Potential).		Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37	c.2269G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.3|27.3	4.815937|4.815937	0.90790|0.90790	.|.	.|.	ENSG00000153956|ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253|ENST00000443883	T;T|.	0.78707|.	-1.2;-1.2|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.78874|.	0.4352|.	M|M	0.78801|0.78801	2.425|2.425	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	T|.	0.77629|.	-0.2516|.	10|.	0.51188|.	T|.	0.08|.	-30.4503|-30.4503	20.0896|20.0896	0.97814|0.97814	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	757|.	P54289-2|.	.|.	Y|Y	757;776;769|267	ENSP00000349320:D757Y;ENSP00000348589:D769Y|.	ENSP00000284088:D776Y|.	D|X	-|-	1|3	0|2	CACNA2D1|CACNA2D1	81437172|81437172	1.000000|1.000000	0.71417|0.71417	0.979000|0.979000	0.43373|0.43373	0.998000|0.998000	0.95712|0.95712	7.374000|7.374000	0.79633|0.79633	2.741000|2.741000	0.93983|0.93983	0.650000|0.650000	0.86243|0.86243	GAT|TAG		0.338	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				15	62	1	0	2.23348e-06	0.004007	3.00289e-06	15	62				
GRM3	2913	broad.mit.edu	37	7	86468419	86468419	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:86468419T>A	ENST00000361669.2	+	4	2688	c.1589T>A	c.(1588-1590)aTt>aAt	p.I530N	GRM3_ENST00000536043.1_Missense_Mutation_p.I402N|GRM3_ENST00000439827.1_Intron|GRM3_ENST00000394720.2_Intron|GRM3_ENST00000546348.1_Missense_Mutation_p.I122N	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	530					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TGCTGCTGGATTTGCATCCCC	0.537																																					GBM(52;969 1098 3139 52280)	GBM(52;969 1098 3139 52280)	uc003uid.2		NA																	0				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13						c.(1588-1590)ATT>AAT		glutamate receptor, metabotropic 3 precursor	Acamprosate(DB00659)|Nicotine(DB00184)						142.0	125.0	131.0					7																	86468419		2203	4300	6503	SO:0001583	missense	2913				synaptic transmission	integral to plasma membrane		g.chr7:86468419T>A		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1589T>A	7.37:g.86468419T>A	ENSP00000355316:p.Ile530Asn					GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Missense_Mutation_p.I402N|GRM3_uc010leh.2_Missense_Mutation_p.I122N	p.I530N	NM_000840	NP_000831	Q14832	GRM3_HUMAN			4	2688	+	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)		530			Extracellular (Potential).		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	37	c.1589T>A	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	T	17.88	3.498085	0.64186	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.89196	-2.48;-2.48;-2.48	6.17	6.17	0.99709	GPCR, family 3, conserved site (1);GPCR, family 3, nine cysteines domain (1);	0.000000	0.85682	D	0.000000	D	0.90796	0.7110	L	0.35542	1.07	0.80722	D	1	D;D;D	0.61080	0.989;0.985;0.988	D;D;D	0.66602	0.929;0.925;0.945	D	0.90474	0.4455	10	0.41790	T	0.15	.	16.0034	0.80327	0.0:0.0:0.0:1.0	.	122;402;530	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	N	530;122;402	ENSP00000355316:I530N;ENSP00000444064:I122N;ENSP00000441407:I402N	ENSP00000355316:I530N	I	+	2	0	GRM3	86306355	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	ATT		0.537	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2			7	141	0	0	0	0.00308	0	7	141				
CALCR	799	broad.mit.edu	37	7	93072917	93072917	+	Splice_Site	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:93072917C>G	ENST00000394441.1	-	8	1116	c.801G>C	c.(799-801)tgG>tgC	p.W267C	CALCR_ENST00000421592.1_Splice_Site_p.W283C|CALCR_ENST00000360249.4_Splice_Site_p.W283C|CALCR_ENST00000426151.1_Splice_Site_p.W267C|CALCR_ENST00000359558.2_Splice_Site_p.W301C	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	301					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	AATACATACCCCAGCCCAAGA	0.438																																							uc003umv.1		NA																	0				ovary(3)|lung(3)|skin(2)|pancreas(1)	9						c.(901-903)TGG>TGC		calcitonin receptor isoform 2 precursor	Salmon Calcitonin(DB00017)						100.0	95.0	97.0					7																	93072917		2203	4300	6503	SO:0001630	splice_region_variant	799				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding	g.chr7:93072917C>G	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.802+1G>C	7.37:g.93072917C>G						CALCR_uc011kia.1_Missense_Mutation_p.W81C|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.W267C|CALCR_uc003umw.2_Missense_Mutation_p.W267C	p.W301C	NM_001742	NP_001733	P30988	CALCR_HUMAN	STAD - Stomach adenocarcinoma(171;0.000244)		10	1164	-	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		283			Helical; Name=4; (Potential).		A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	ENST00000394441.1	37	c.903G>C	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103349	0.76983	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000394441;ENST00000426151	T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0	4.94	4.94	0.65067	.	.	.	.	.	D	0.85323	0.5670	H	0.94847	3.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89237	0.3581	9	0.87932	D	0	.	18.7491	0.91806	0.0:1.0:0.0:0.0	.	301;267	F5H605;A4D1G6	.;.	C	301;283;283;267;267	ENSP00000352561:W301C;ENSP00000353385:W283C;ENSP00000399552:W283C;ENSP00000377959:W267C;ENSP00000389295:W267C	ENSP00000352561:W301C	W	-	3	0	CALCR	92910853	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	7.651000	0.83577	2.753000	0.94483	0.557000	0.71058	TGG		0.438	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742	Missense_Mutation	12	53	0	0	0	0.000978	0	12	53				
NPTX2	4885	broad.mit.edu	37	7	98254454	98254454	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:98254454C>A	ENST00000265634.3	+	3	1029	c.864C>A	c.(862-864)ccC>ccA	p.P288P		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	288	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GCAACAACCCCATCGAGCTGC	0.667																																							uc003upl.2		NA																	0				central_nervous_system(2)|skin(1)	3						c.(862-864)CCC>CCA		neuronal pentraxin II precursor							77.0	64.0	68.0					7																	98254454		2203	4300	6503	SO:0001819	synonymous_variant	4885				synaptic transmission	extracellular region	metal ion binding|sugar binding	g.chr7:98254454C>A		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.864C>A	7.37:g.98254454C>A							p.P288P	NM_002523	NP_002514	P47972	NPTX2_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		3	1041	+	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		288			Pentaxin.		A4D267|Q86XV7|Q96G70	Silent	SNP	ENST00000265634.3	37	c.864C>A	CCDS5657.1																																																																																				0.667	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523		11	57	1	0	1.08611e-07	0.000978	1.55843e-07	11	57				
ZSCAN21	7589	broad.mit.edu	37	7	99654701	99654701	+	Silent	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:99654701G>C	ENST00000292450.4	+	2	236	c.72G>C	c.(70-72)ctG>ctC	p.L24L	ZSCAN21_ENST00000477297.1_3'UTR|ZSCAN21_ENST00000543588.1_Silent_p.L24L|ZSCAN21_ENST00000456748.2_Silent_p.L24L	NM_145914.2	NP_666019.1	Q9Y5A6	ZSC21_HUMAN	zinc finger and SCAN domain containing 21	24					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|skin(1)	21	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TGGGGCCTCTGATGGTAAAAG	0.542																																							uc003uso.2		NA																	0				ovary(3)	3						c.(70-72)CTG>CTC		zinc finger protein 38							128.0	136.0	133.0					7																	99654701		2203	4300	6503	SO:0001819	synonymous_variant	7589				positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:99654701G>C	AL136865	CCDS5681.1	7q11.1	2013-01-08	2006-10-06	2006-10-06	ENSG00000166529	ENSG00000166529		"""-"", ""Zinc fingers, C2H2-type"""	13104	protein-coding gene	gene with protein product		601261	"""zinc finger protein 38 (KOX 25)"", ""zinc finger protein 38"""	ZNF38		2288909, 2014798	Standard	NM_145914		Approved	DKFZp434L134, NY-REN-21, Zipro1	uc003uso.3	Q9Y5A6	OTTHUMG00000154583	ENST00000292450.4:c.72G>C	7.37:g.99654701G>C						ZSCAN21_uc011kje.1_Silent_p.L23L|ZSCAN21_uc003usn.1_Silent_p.L23L	p.L24L	NM_145914	NP_666019	Q9Y5A6	ZSC21_HUMAN	STAD - Stomach adenocarcinoma(171;0.129)		2	216	+	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		24					A4D2A6|D6W5T9|Q9H0B5	Silent	SNP	ENST00000292450.4	37	c.72G>C	CCDS5681.1																																																																																				0.542	ZSCAN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336166.1	NM_145914		8	247	0	0	0	0.00308	0	8	247				
SERPINE1	5054	broad.mit.edu	37	7	100771685	100771685	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:100771685C>G	ENST00000223095.4	+	2	168	c.11C>G	c.(10-12)tCt>tGt	p.S4C	SERPINE1_ENST00000445463.2_Missense_Mutation_p.S4C	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	4					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	ATGCAGATGTCTCCAGCCCTC	0.622																																							uc003uxt.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(10-12)TCT>TGT		plasminogen activator inhibitor-1 isoform 1	Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)						119.0	93.0	102.0					7																	100771685		2203	4300	6503	SO:0001583	missense	5054				angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity	g.chr7:100771685C>G	M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.11C>G	7.37:g.100771685C>G	ENSP00000223095:p.Ser4Cys					SERPINE1_uc011kkj.1_Missense_Mutation_p.S4C	p.S4C	NM_000602	NP_000593	P05121	PAI1_HUMAN			2	159	+	Lung NSC(181;0.136)|all_lung(186;0.182)		4					B7Z4S0|F8WD53	Missense_Mutation	SNP	ENST00000223095.4	37	c.11C>G	CCDS5711.1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.330178	0.41297	.	.	ENSG00000106366	ENST00000223095;ENST00000445463;ENST00000441467	D;D	0.86627	-1.92;-2.15	5.27	3.36	0.38483	Serpin domain (1);	0.583371	0.16635	N	0.205884	T	0.81531	0.4842	N	0.08118	0	0.09310	N	1	B;D	0.62365	0.005;0.991	B;P	0.52710	0.005;0.707	T	0.74396	-0.3679	10	0.87932	D	0	.	11.9805	0.53117	0.0:0.6635:0.3365:0.0	.	4;4	F8WD53;P05121	.;PAI1_HUMAN	C	4	ENSP00000223095:S4C;ENSP00000396766:S4C	ENSP00000223095:S4C	S	+	2	0	SERPINE1	100558405	0.006000	0.16342	0.043000	0.18650	0.542000	0.35054	1.650000	0.37292	0.633000	0.30452	0.655000	0.94253	TCT		0.622	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602		18	68	0	0	0	0.006122	0	18	68				
SLC26A5	375611	broad.mit.edu	37	7	103051925	103051925	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:103051925C>G	ENST00000306312.3	-	6	773	c.512G>C	c.(511-513)aGa>aCa	p.R171T	SLC26A5_ENST00000393729.1_Missense_Mutation_p.R134T|SLC26A5_ENST00000356767.4_Missense_Mutation_p.R171T|SLC26A5_ENST00000393735.2_Missense_Mutation_p.R171T|SLC26A5_ENST00000393730.1_Missense_Mutation_p.R171T|SLC26A5_ENST00000393727.1_Missense_Mutation_p.R171T|SLC26A5_ENST00000339444.6_Missense_Mutation_p.R171T|SLC26A5_ENST00000393723.1_Missense_Mutation_p.R171T|SLC26A5_ENST00000432958.2_Missense_Mutation_p.R171T|SLC26A5_ENST00000354356.4_5'UTR	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	171					regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						CAAGGCATCTCTGGCCTCTGT	0.448																																							uc003vbz.2		NA																	0				ovary(1)	1						c.(511-513)AGA>ACA		prestin isoform a							206.0	169.0	181.0					7																	103051925		2203	4300	6503	SO:0001583	missense	375611				regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity	g.chr7:103051925C>G	AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.512G>C	7.37:g.103051925C>G	ENSP00000304783:p.Arg171Thr					SLC26A5_uc003vbt.1_Missense_Mutation_p.R171T|SLC26A5_uc003vbu.1_Missense_Mutation_p.R171T|SLC26A5_uc003vbv.1_Missense_Mutation_p.R171T|SLC26A5_uc003vbw.2_RNA|SLC26A5_uc003vbx.2_Missense_Mutation_p.R171T|SLC26A5_uc003vby.2_RNA|SLC26A5_uc010liy.2_RNA	p.R171T	NM_198999	NP_945350	P58743	S26A5_HUMAN			6	748	-			171			Extracellular (Potential).		Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Missense_Mutation	SNP	ENST00000306312.3	37	c.512G>C	CCDS5733.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996378	0.93167	.	.	ENSG00000170615	ENST00000339444;ENST00000356767;ENST00000393735;ENST00000306312;ENST00000393730;ENST00000432958;ENST00000393729;ENST00000393727;ENST00000393723	D;D;D;D;D;D;D;D;D	0.93547	-3.19;-2.62;-3.24;-3.23;-3.16;-3.16;-3.12;-3.23;-3.16	5.49	5.49	0.81192	.	0.047733	0.85682	D	0.000000	D	0.96682	0.8917	M	0.74881	2.28	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.986;0.997;0.996;0.998;0.999	D	0.96782	0.9576	10	0.87932	D	0	.	19.7347	0.96198	0.0:1.0:0.0:0.0	.	171;171;171;171;171	P58743;Q496J2;P58743-4;P58743-3;P58743-2	S26A5_HUMAN;.;.;.;.	T	171;171;171;171;171;171;134;171;171	ENSP00000342396:R171T;ENSP00000349210:R171T;ENSP00000377336:R171T;ENSP00000304783:R171T;ENSP00000377331:R171T;ENSP00000389733:R171T;ENSP00000377330:R134T;ENSP00000377328:R171T;ENSP00000377324:R171T	ENSP00000304783:R171T	R	-	2	0	SLC26A5	102839161	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.446000	0.66600	2.746000	0.94184	0.655000	0.94253	AGA		0.448	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313860.1	NM_198999		31	77	0	0	0	0.009535	0	31	77				
LAMB1	3912	broad.mit.edu	37	7	107564713	107564713	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:107564713A>T	ENST00000222399.6	-	33	5416	c.5186T>A	c.(5185-5187)cTt>cAt	p.L1729H	LAMB1_ENST00000393561.1_Missense_Mutation_p.L1753H	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1729	Domain I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TTGAGCTAAAAGAGTTTTTGC	0.333																																							uc003vew.2		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(5185-5187)CTT>CAT		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						90.0	90.0	90.0					7																	107564713		2203	4300	6503	SO:0001583	missense	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107564713A>T	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.5186T>A	7.37:g.107564713A>T	ENSP00000222399:p.Leu1729His					LAMB1_uc003vev.2_Missense_Mutation_p.L1753H|LAMB1_uc003veu.2_Missense_Mutation_p.L212H	p.L1729H	NM_002291	NP_002282	P07942	LAMB1_HUMAN			33	5521	-			1729			Potential.|Domain I.		Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	c.5186T>A	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.837521	0.91117	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	D;D	0.94966	-3.57;-3.57	5.98	5.98	0.97165	.	.	.	.	.	D	0.97151	0.9069	M	0.77313	2.365	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97707	1.0188	9	0.87932	D	0	.	16.4781	0.84144	1.0:0.0:0.0:0.0	.	1729;1753;1026	P07942;G3XAI2;Q8TAS6	LAMB1_HUMAN;.;.	H	1753;1729	ENSP00000377191:L1753H;ENSP00000222399:L1729H	ENSP00000222399:L1729H	L	-	2	0	LAMB1	107351949	1.000000	0.71417	0.978000	0.43139	0.967000	0.64934	8.671000	0.91174	2.288000	0.76882	0.528000	0.53228	CTT		0.333	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		16	74	0	0	0	0.008871	0	16	74				
LAMB1	3912	broad.mit.edu	37	7	107626637	107626637	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:107626637G>C	ENST00000222399.6	-	6	825	c.595C>G	c.(595-597)Ccc>Gcc	p.P199A	LAMB1_ENST00000393561.1_Missense_Mutation_p.P223A|LAMB1_ENST00000393560.1_Missense_Mutation_p.P199A	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	199	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TCAGTTGAGGGTTCAATGTCA	0.393																																							uc003vew.2		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(595-597)CCC>GCC		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						118.0	115.0	116.0					7																	107626637		2203	4300	6503	SO:0001583	missense	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107626637G>C	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.595C>G	7.37:g.107626637G>C	ENSP00000222399:p.Pro199Ala					LAMB1_uc003vev.2_Missense_Mutation_p.P223A|LAMB1_uc003vex.2_Missense_Mutation_p.P199A|LAMB1_uc010ljn.1_Missense_Mutation_p.P285A	p.P199A	NM_002291	NP_002282	P07942	LAMB1_HUMAN			6	930	-			199			Laminin N-terminal.		Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	c.595C>G	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700320	0.88924	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	D;D;D	0.87029	-2.2;-2.2;-2.2	5.85	5.85	0.93711	Laminin, N-terminal (3);	.	.	.	.	D	0.95303	0.8476	M	0.91561	3.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95536	0.8608	9	0.87932	D	0	.	20.172	0.98160	0.0:0.0:1.0:0.0	.	199;199;223	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	A	223;199;199	ENSP00000377191:P223A;ENSP00000222399:P199A;ENSP00000377190:P199A	ENSP00000222399:P199A	P	-	1	0	LAMB1	107413873	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.869000	0.99810	2.766000	0.95052	0.650000	0.86243	CCC		0.393	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		14	65	0	0	0	0.003163	0	14	65				
C7orf60	154743	broad.mit.edu	37	7	112555434	112555434	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:112555434C>A	ENST00000297145.4	-	2	394	c.229G>T	c.(229-231)Gca>Tca	p.A77S	C7orf60_ENST00000485446.1_5'UTR	NM_152556.2	NP_689769.2	Q1RMZ1	BMT2_HUMAN	chromosome 7 open reading frame 60	77							rRNA (adenine) methyltransferase activity (GO:0016433)			breast(1)|endometrium(2)|lung(7)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	17						TTTTTCATTGCAACGGCATAT	0.348																																							uc003vgo.1		NA																	0				ovary(2)|skin(1)	3						c.(229-231)GCA>TCA		hypothetical protein LOC154743							153.0	142.0	145.0					7																	112555434		1865	4114	5979	SO:0001583	missense	154743							g.chr7:112555434C>A		CCDS43634.1	7q31.1	2011-01-11	2008-06-19		ENSG00000164603	ENSG00000164603			26475	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31818"""						Standard	NM_152556		Approved	DKFZp762M126, FLJ31818	uc003vgo.1	Q1RMZ1	OTTHUMG00000155233	ENST00000297145.4:c.229G>T	7.37:g.112555434C>A	ENSP00000297145:p.Ala77Ser					C7orf60_uc011kms.1_Missense_Mutation_p.A103S	p.A77S	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN			2	356	-			77					Q8N3D0|Q96MV7	Missense_Mutation	SNP	ENST00000297145.4	37	c.229G>T	CCDS43634.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.971136	0.92919	.	.	ENSG00000164603	ENST00000297145;ENST00000432572;ENST00000358032	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.75376	0.3841	L	0.51422	1.61	0.80722	D	1	D;D	0.69078	0.997;0.981	D;P	0.75020	0.985;0.727	T	0.72827	-0.4175	9	0.40728	T	0.16	-9.6124	19.6493	0.95794	0.0:1.0:0.0:0.0	.	24;77	B4DST1;Q1RMZ1	.;CG060_HUMAN	S	77;59;24	.	ENSP00000297145:A77S	A	-	1	0	C7orf60	112342670	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.419000	0.80179	2.711000	0.92665	0.591000	0.81541	GCA		0.348	C7orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338923.1	NM_152556		18	70	1	0	3.41278e-10	0.00499	5.40819e-10	18	70				
KCND2	3751	broad.mit.edu	37	7	120387741	120387741	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:120387741C>A	ENST00000331113.4	+	6	2687	c.1722C>A	c.(1720-1722)tcC>tcA	p.S574S	RP4-797C5.2_ENST00000450480.1_RNA	NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	574					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TCAGCCGATCCAGTTTAAATG	0.313																																							uc003vjj.1		NA																	0				ovary(2)|central_nervous_system(2)|skin(1)	5						c.(1720-1722)TCC>TCA		potassium voltage-gated channel, Shal-related							68.0	64.0	65.0					7																	120387741		2203	4300	6503	SO:0001819	synonymous_variant	3751				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding	g.chr7:120387741C>A	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.1722C>A	7.37:g.120387741C>A							p.S574S	NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN			6	2687	+	all_neural(327;0.117)		574			Cytoplasmic (Potential).		O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	ENST00000331113.4	37	c.1722C>A	CCDS5776.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.511280	0.00984	.	.	ENSG00000184408	ENST00000425288	.	.	.	5.59	3.72	0.42706	.	.	.	.	.	T	0.62865	0.2463	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59584	-0.7427	4	.	.	.	.	12.1688	0.54146	0.1479:0.7326:0.1195:0.0	.	.	.	.	Q	160	.	.	P	+	2	0	KCND2	120174977	1.000000	0.71417	0.999000	0.59377	0.409000	0.31022	4.437000	0.59955	0.750000	0.32877	-0.176000	0.13171	CCA		0.313	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281		12	41	1	0	3.07112e-06	0.000978	4.10484e-06	12	41				
CPED1	79974	broad.mit.edu	37	7	120911459	120911459	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:120911459G>A	ENST00000310396.5	+	22	3310	c.2843G>A	c.(2842-2844)gGg>gAg	p.G948E		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	948						endoplasmic reticulum (GO:0005783)											TTTCTACAGGGGAAGTGTGGA	0.323																																							uc003vjq.3		NA																	0				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.(2842-2844)GGG>GAG		hypothetical protein LOC79974 isoform 1							184.0	184.0	184.0					7																	120911459		2203	4300	6503	SO:0001583	missense	79974					endoplasmic reticulum		g.chr7:120911459G>A		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2843G>A	7.37:g.120911459G>A	ENSP00000309772:p.Gly948Glu						p.G948E	NM_024913	NP_079189	A4D0V7	CG058_HUMAN			22	3290	+	all_neural(327;0.117)		948					A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	c.2843G>A	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437391	0.83885	.	.	ENSG00000106034	ENST00000310396	T	0.30182	1.54	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.59891	0.2227	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60414	-0.7268	10	0.87932	D	0	.	20.3396	0.98756	0.0:0.0:1.0:0.0	.	948	A4D0V7	CG058_HUMAN	E	948	ENSP00000309772:G948E	ENSP00000309772:G948E	G	+	2	0	C7orf58	120698695	1.000000	0.71417	0.969000	0.41365	0.516000	0.34256	8.850000	0.92190	2.812000	0.96745	0.555000	0.69702	GGG		0.323	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		27	125	0	0	0	0.004656	0	27	125				
CPED1	79974	broad.mit.edu	37	7	120935692	120935692	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:120935692A>G	ENST00000310396.5	+	23	3534	c.3067A>G	c.(3067-3069)Aaa>Gaa	p.K1023E		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	1023						endoplasmic reticulum (GO:0005783)											GTGTGCAAATAAAAGGACTAT	0.483																																							uc003vjq.3		NA																	0				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.(3067-3069)AAA>GAA		hypothetical protein LOC79974 isoform 1							78.0	74.0	76.0					7																	120935692		2203	4300	6503	SO:0001583	missense	79974					endoplasmic reticulum		g.chr7:120935692A>G		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.3067A>G	7.37:g.120935692A>G	ENSP00000309772:p.Lys1023Glu						p.K1023E	NM_024913	NP_079189	A4D0V7	CG058_HUMAN			23	3514	+	all_neural(327;0.117)		1023					A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	c.3067A>G	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	A	6.027	0.373304	0.11409	.	.	ENSG00000106034	ENST00000310396	T	0.16597	2.33	5.65	-11.2	0.00127	.	1.486220	0.03604	N	0.233892	T	0.04003	0.0112	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41215	-0.9521	10	0.02654	T	1	.	12.8338	0.57761	0.2408:0.247:0.5122:0.0	.	1023	A4D0V7	CG058_HUMAN	E	1023	ENSP00000309772:K1023E	ENSP00000309772:K1023E	K	+	1	0	C7orf58	120722928	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.388000	0.07352	-1.840000	0.01184	0.533000	0.62120	AAA		0.483	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		18	74	0	0	0	0.007413	0	18	74				
LMOD2	442721	broad.mit.edu	37	7	123302771	123302771	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:123302771C>A	ENST00000458573.2	+	2	1288	c.1131C>A	c.(1129-1131)acC>acA	p.T377T	LMOD2_ENST00000456238.2_Intron	NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	377						cytoskeleton (GO:0005856)											ATCTTAGGACCAAAGTCTGGC	0.468																																							uc003vky.2		NA																	0					0						c.(1129-1131)ACC>ACA		leiomodin 2 (cardiac)							131.0	127.0	128.0					7																	123302771		1963	4165	6128	SO:0001819	synonymous_variant	442721					cytoskeleton	actin binding|tropomyosin binding	g.chr7:123302771C>A	AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.1131C>A	7.37:g.123302771C>A							p.T377T	NM_207163	NP_997046	Q6P5Q4	LMOD2_HUMAN			2	1288	+			377					A4D0W9|A4D0Y2|Q8WVJ8	Silent	SNP	ENST00000458573.2	37	c.1131C>A	CCDS47693.1																																																																																				0.468	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348525.1			18	87	1	0	0.000132079	0.008871	0.000159663	18	87				
AKR1B15	441282	broad.mit.edu	37	7	134260652	134260652	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:134260652G>T	ENST00000457545.2	+	8	976	c.716G>T	c.(715-717)aGc>aTc	p.S239I	AKR1B15_ENST00000423958.1_Missense_Mutation_p.S211I	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	239							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						ACGGCCTACAGCCCCCTGGGC	0.483																																							uc011kpr.1		NA																	0				ovary(1)	1						c.(715-717)AGC>ATC		aldo-keto reductase family 1, member B15							53.0	45.0	48.0					7																	134260652		2201	4295	6496	SO:0001583	missense	441282						oxidoreductase activity	g.chr7:134260652G>T		CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.716G>T	7.37:g.134260652G>T	ENSP00000389289:p.Ser239Ile					AKR1B15_uc011kps.1_Missense_Mutation_p.S211I	p.S239I	NM_001080538	NP_001074007	C9JRZ8	AK1BF_HUMAN			8	1015	+			239			NADP (By similarity).		C9J3V2	Missense_Mutation	SNP	ENST00000457545.2	37	c.716G>T	CCDS47715.2	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165962	0.57476	.	.	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.34275	1.37;1.37	3.87	3.87	0.44632	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.72252	0.3437	H	0.97315	3.98	0.50171	D	0.999852	D;D	0.89917	0.989;1.0	D;D	0.79784	0.957;0.993	D	0.83646	0.0153	9	0.87932	D	0	.	14.5989	0.68427	0.0:0.0:1.0:0.0	.	211;239	C9JRZ8-2;C9JRZ8	.;AK1BF_HUMAN	I	239;211	ENSP00000389289:S239I;ENSP00000397009:S211I	ENSP00000397009:S211I	S	+	2	0	AKR1B15	133911192	1.000000	0.71417	0.998000	0.56505	0.558000	0.35554	4.819000	0.62664	1.981000	0.57761	0.537000	0.68136	AGC		0.483	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2			8	44	1	0	2.17888e-05	0.006214	2.75588e-05	8	44				
CLCN1	1180	broad.mit.edu	37	7	143029957	143029957	+	Missense_Mutation	SNP	C	C	A	rs201919331		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:143029957C>A	ENST00000343257.2	+	12	1479	c.1392C>A	c.(1390-1392)ttC>ttA	p.F464L		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	464					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TTCTCTTCTTCGTCATGAAGG	0.502																																							uc003wcr.1		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(1390-1392)TTC>TTA		chloride channel 1, skeletal muscle							173.0	154.0	160.0					7																	143029957		2203	4300	6503	SO:0001583	missense	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143029957C>A	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1392C>A	7.37:g.143029957C>A	ENSP00000339867:p.Phe464Leu					CLCN1_uc011ktc.1_Intron	p.F464L	NM_000083	NP_000074	P35523	CLCN1_HUMAN			12	1479	+	Melanoma(164;0.205)		464			Helical; (By similarity).		A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	c.1392C>A	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	C	4.601	0.111739	0.08831	.	.	ENSG00000188037	ENST00000343257	D	0.93659	-3.26	5.76	-7.07	0.01563	Chloride channel, core (2);	0.151502	0.64402	D	0.000009	T	0.82084	0.4960	N	0.16066	0.365	0.23198	N	0.998131	P	0.40660	0.726	B	0.40741	0.339	T	0.74359	-0.3691	10	0.02654	T	1	.	16.0706	0.80928	0.0855:0.7136:0.0:0.2009	.	464	P35523	CLCN1_HUMAN	L	464	ENSP00000339867:F464L	ENSP00000339867:F464L	F	+	3	2	CLCN1	142740079	0.001000	0.12720	0.003000	0.11579	0.191000	0.23601	-0.032000	0.12266	-1.463000	0.01904	-0.822000	0.03109	TTC		0.502	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		41	114	1	0	3.38236e-24	0.006999	6.87545e-24	41	114				
TAS2R60	338398	broad.mit.edu	37	7	143141281	143141281	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:143141281C>G	ENST00000332690.1	+	1	736	c.736C>G	c.(736-738)Ctg>Gtg	p.L246V	EPHA1-AS1_ENST00000429289.1_RNA	NM_177437.1	NP_803186.1	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	246					sensory perception of bitter taste (GO:0050913)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(1)|large_intestine(2)|lung(17)|prostate(1)|skin(7)|urinary_tract(2)	31	Melanoma(164;0.172)					CATAAAGGCTCTGCTGGCTCT	0.478																																							uc011ktg.1		NA																	0				skin(6)	6						c.(736-738)CTG>GTG		taste receptor, type 2, member 60							135.0	139.0	138.0					7																	143141281		2203	4300	6503	SO:0001583	missense	338398				sensory perception of bitter taste	integral to membrane	G-protein coupled receptor activity	g.chr7:143141281C>G	AY114094	CCDS5885.1	7q35	2014-07-10			ENSG00000185899	ENSG00000185899		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	20639	protein-coding gene	gene with protein product		613968				12584440	Standard	NM_177437		Approved	T2R60	uc011ktg.2	P59551	OTTHUMG00000154891	ENST00000332690.1:c.736C>G	7.37:g.143141281C>G	ENSP00000327724:p.Leu246Val					uc003wda.2_Intron	p.L246V	NM_177437	NP_803186	P59551	T2R60_HUMAN			1	736	+	Melanoma(164;0.172)		246			Helical; Name=6; (Potential).		A4D2G8|Q645W8|Q7RTR7	Missense_Mutation	SNP	ENST00000332690.1	37	c.736C>G	CCDS5885.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.846305	0.32606	.	.	ENSG00000185899	ENST00000332690	T	0.01178	5.22	5.62	2.88	0.33553	.	0.179678	0.33382	U	0.004977	T	0.03783	0.0107	M	0.81341	2.54	0.09310	N	1	P	0.49635	0.926	P	0.54590	0.756	T	0.23868	-1.0176	10	0.72032	D	0.01	.	5.6259	0.17482	0.1566:0.6792:0.0:0.1641	.	246	P59551	T2R60_HUMAN	V	246	ENSP00000327724:L246V	ENSP00000327724:L246V	L	+	1	2	TAS2R60	142851403	0.176000	0.23096	0.006000	0.13384	0.330000	0.28571	0.949000	0.29109	0.336000	0.23639	-0.196000	0.12772	CTG		0.478	TAS2R60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337541.1			23	99	0	0	0	0.001882	0	23	99				
ARHGEF5	7984	broad.mit.edu	37	7	144059824	144059824	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:144059824G>T	ENST00000056217.5	+	2	236	c.62G>T	c.(61-63)aGc>aTc	p.S21I		NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	21					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GAGGAATTCAGCATTATCCCT	0.532																																							uc003wel.2		NA																	0				skin(2)	2						c.(61-63)AGC>ATC		rho guanine nucleotide exchange factor 5							84.0	99.0	94.0					7																	144059824		1506	3165	4671	SO:0001583	missense	7984				intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr7:144059824G>T	U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.62G>T	7.37:g.144059824G>T	ENSP00000056217:p.Ser21Ile					ARHGEF5_uc003wek.2_Missense_Mutation_p.S21I	p.S21I	NM_005435	NP_005426	Q12774	ARHG5_HUMAN			2	180	+	Melanoma(164;0.14)		21					A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	c.62G>T	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417414	0.25552	.	.	ENSG00000050327	ENST00000498580;ENST00000056217	T	0.74315	-0.83	4.16	-1.52	0.08637	.	1.910140	0.02896	U	0.134742	T	0.62636	0.2444	L	0.48642	1.525	0.09310	N	1	P	0.39964	0.697	B	0.32289	0.143	T	0.55742	-0.8093	10	0.72032	D	0.01	.	4.1337	0.10160	0.4654:0.1817:0.3529:0.0	.	21	Q12774	ARHG5_HUMAN	I	21	ENSP00000056217:S21I	ENSP00000056217:S21I	S	+	2	0	ARHGEF5	143690757	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.968000	0.03817	-0.175000	0.10725	0.650000	0.86243	AGC		0.532	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435		13	168	1	0	2.89027e-11	0.002299	4.70013e-11	13	168				
CNTNAP2	26047	broad.mit.edu	37	7	146741074	146741074	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:146741074C>A	ENST00000361727.3	+	4	994	c.478C>A	c.(478-480)Cgc>Agc	p.R160S		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	160	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.R160C(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CCGCTATGTGCGCATAGTGCC	0.428										HNSCC(39;0.1)																													uc003weu.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(478-480)CGC>AGC		cell recognition molecule Caspr2 precursor							194.0	168.0	177.0					7																	146741074		2203	4300	6503	SO:0001583	missense	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:146741074C>A	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.478C>A	7.37:g.146741074C>A	ENSP00000354778:p.Arg160Ser	HNSCC(39;0.1)					p.R160S	NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		4	994	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	160			F5/8 type C.|Extracellular (Potential).		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	c.478C>A	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218074	0.58560	.	.	ENSG00000174469	ENST00000361727	D	0.99060	-5.38	5.47	5.47	0.80525	Concanavalin A-like lectin/glucanase (1);Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.53938	D	0.000060	D	0.99477	0.9814	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98368	1.0552	10	0.87932	D	0	.	13.728	0.62769	0.1546:0.8454:0.0:0.0	.	160	Q9UHC6	CNTP2_HUMAN	S	160	ENSP00000354778:R160S	ENSP00000354778:R160S	R	+	1	0	CNTNAP2	146372007	0.998000	0.40836	0.985000	0.45067	0.322000	0.28314	3.895000	0.56258	2.568000	0.86640	0.462000	0.41574	CGC		0.428	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			32	105	1	0	2.81731e-10	0.002096	4.49585e-10	32	105				
WDR86	349136	broad.mit.edu	37	7	151093213	151093213	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:151093213G>T	ENST00000334493.6	-	3	805	c.375C>A	c.(373-375)gaC>gaA	p.D125E	WDR86_ENST00000463000.1_5'Flank|WDR86_ENST00000469830.2_Missense_Mutation_p.D125E|WDR86_ENST00000477459.1_5'UTR	NM_001284262.1|NM_198285.2	NP_001271191.1|NP_938026.2	Q86TI4	WDR86_HUMAN	WD repeat domain 86	125										breast(1)|endometrium(2)|kidney(1)|lung(6)	10			OV - Ovarian serous cystadenocarcinoma(82;0.00419)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCTGCCCCTTGTCCACACTCC	0.652																																							uc003wkb.2		NA																	0					0						c.(373-375)GAC>GAA		WD repeat domain 86							29.0	33.0	32.0					7																	151093213		2176	4277	6453	SO:0001583	missense	349136							g.chr7:151093213G>T	AK125347	CCDS5925.2, CCDS64805.1, CCDS64806.1, CCDS75680.1	7q36.1	2013-01-09			ENSG00000187260	ENSG00000187260		"""WD repeat domain containing"""	28020	protein-coding gene	gene with protein product						12477932	Standard	NM_198285		Approved		uc003wkb.2	Q86TI4	OTTHUMG00000150764	ENST00000334493.6:c.375C>A	7.37:g.151093213G>T	ENSP00000335522:p.Asp125Glu					WDR86_uc003wka.2_Missense_Mutation_p.D83E|WDR86_uc011kvk.1_Missense_Mutation_p.D125E|WDR86_uc003wkc.2_5'UTR	p.D125E	NM_198285	NP_938026	Q86TI4	WDR86_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00419)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	824	-			125			WD 3.		B4DJF1|C9JAJ5|C9JXE3|Q3KNT1|Q6ZUS8	Missense_Mutation	SNP	ENST00000334493.6	37	c.375C>A	CCDS5925.2	.	.	.	.	.	.	.	.	.	.	G	5.075	0.199548	0.09652	.	.	ENSG00000187260	ENST00000334493;ENST00000469830	T;T	0.17054	2.3;2.3	4.86	1.97	0.26223	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	.	.	.	.	T	0.08223	0.0205	N	0.17764	0.52	0.27314	N	0.957229	P;B;B	0.43750	0.816;0.014;0.261	B;B;B	0.32762	0.152;0.029;0.028	T	0.23726	-1.0180	8	.	.	.	-25.605	7.6956	0.28592	0.1529:0.1341:0.713:0.0	.	125;125;83	B4DJF1;Q86TI4;D3DX12	.;WDR86_HUMAN;.	E	125	ENSP00000335522:D125E;ENSP00000419162:D125E	.	D	-	3	2	WDR86	150724146	0.970000	0.33590	0.176000	0.23000	0.027000	0.11550	1.564000	0.36375	0.097000	0.17492	-0.671000	0.03813	GAC		0.652	WDR86-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319999.3	NM_198285		10	41	1	0	9.70103e-10	0.008291	1.52668e-09	10	41				
DPP6	1804	broad.mit.edu	37	7	154237702	154237702	+	Silent	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:154237702C>A	ENST00000377770.3	+	4	684	c.543C>A	c.(541-543)ggC>ggA	p.G181G	DPP6_ENST00000332007.3_Silent_p.G119G|DPP6_ENST00000404039.1_Silent_p.G117G|DPP6_ENST00000427557.1_Silent_p.G119G|DPP6_ENST00000406326.1_Silent_p.G181G|DPP6_ENST00000496611.1_3'UTR			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	181					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TAATAGAAGGCAAAAAAATTG	0.338																																					NSCLC(125;1384 1783 2490 7422 34254)	NSCLC(125;1384 1783 2490 7422 34254)	uc003wlk.2		NA																	0				pancreas(3)|breast(1)	4						c.(541-543)GGC>GGA		dipeptidyl-peptidase 6 isoform 1							61.0	57.0	58.0					7																	154237702		1819	4081	5900	SO:0001819	synonymous_variant	1804				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity	g.chr7:154237702C>A	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.543C>A	7.37:g.154237702C>A						DPP6_uc003wli.2_Silent_p.G117G|DPP6_uc003wlj.2_Silent_p.G181G|DPP6_uc003wlm.2_Silent_p.G119G|DPP6_uc011kvq.1_Silent_p.G119G	p.G181G	NM_130797	NP_570629	P42658	DPP6_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0562)		4	672	+	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	181			Extracellular (Potential).			Silent	SNP	ENST00000377770.3	37	c.543C>A																																																																																					0.338	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797		4	16	1	0	0.00909568	0.009096	0.00997167	4	16				
CNPY1	285888	broad.mit.edu	37	7	155295764	155295764	+	Nonstop_Mutation	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr7:155295764T>C	ENST00000321736.5	-	4	440	c.278A>G	c.(277-279)tAg>tGg	p.*93W	CNPY1_ENST00000406197.1_Nonstop_Mutation_p.*93W	NM_001103176.1	NP_001096646.1	Q3B7I2	CNPY1_HUMAN	canopy FGF signaling regulator 1	0										breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		ACGGCACTCCTAGAGCTCAGT	0.378																																							uc003wmc.1		NA																	0					0						c.(277-279)TAG>TGG		canopy 1 homolog							76.0	71.0	72.0					7																	155295764		1886	4124	6010	SO:0001578	stop_lost	285888							g.chr7:155295764T>C		CCDS43684.1	7q36.3	2014-02-12	2013-07-23		ENSG00000146910	ENSG00000146910			27786	protein-coding gene	gene with protein product		612493	"""canopy 1 homolog (zebrafish)"""			16488878	Standard	NM_001103176		Approved		uc003wmc.1	Q3B7I2	OTTHUMG00000151353	ENST00000321736.5:c.278A>G	7.37:g.155295764T>C	ENSP00000317439:p.*93Serext*11						p.*93W	NM_001103176	NP_001096646	Q3B7I2	CNPY1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	4	423	-	all_neural(206;0.119)	all_hematologic(28;0.0592)	93					A6NGX3	Nonstop_Mutation	SNP	ENST00000321736.5	37	c.278A>G	CCDS43684.1	.	.	.	.	.	.	.	.	.	.	T	9.473	1.096261	0.20552	.	.	ENSG00000146910	ENST00000406197;ENST00000321736	.	.	.	5.13	1.32	0.21799	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.1546	0.03809	0.1578:0.0871:0.1648:0.5904	.	.	.	.	W	93	.	.	X	-	2	0	CNPY1	154988525	0.014000	0.17966	0.001000	0.08648	0.388000	0.30384	0.999000	0.29757	0.040000	0.15660	0.533000	0.62120	TAG		0.378	CNPY1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322335.1	XM_001129537		9	24	0	0	0	0.008291	0	9	24				
DLGAP2	9228	broad.mit.edu	37	8	1624783	1624783	+	Splice_Site	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:1624783C>T	ENST00000421627.2	+	8	2181	c.2047C>T	c.(2047-2049)Cga>Tga	p.R683*		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	762					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		AGATGAGAAGCGGTAACTCAG	0.582																																							uc003wpl.2		NA																	0					0						c.(2047-2049)CGA>TGA		discs large-associated protein 2							33.0	37.0	36.0					8																	1624783		1911	4134	6045	SO:0001630	splice_region_variant	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1624783C>T	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2048+1C>T	8.37:g.1624783C>T						DLGAP2_uc003wpm.2_Nonsense_Mutation_p.R669*	p.R683*	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	8	2144	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	762					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Nonsense_Mutation	SNP	ENST00000421627.2	37	c.2047C>T	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	C	36	5.864159	0.97043	.	.	ENSG00000198010	ENST00000356067;ENST00000421627	.	.	.	5.66	2.83	0.33086	.	0.107337	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-4.6979	14.5081	0.67767	0.5095:0.4905:0.0:0.0	.	.	.	.	X	714;683	.	ENSP00000348366:R714X	R	+	1	2	DLGAP2	1612190	1.000000	0.71417	0.906000	0.35671	0.060000	0.15804	1.383000	0.34385	0.292000	0.22492	-0.309000	0.09137	CGA		0.582	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	Nonsense_Mutation	5	9	0	0	0	0.000602	0	5	9				
CSMD1	64478	broad.mit.edu	37	8	3166007	3166007	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:3166007C>A	ENST00000520002.1	-	25	4208	c.3653G>T	c.(3652-3654)tGt>tTt	p.C1218F	CSMD1_ENST00000602723.1_Missense_Mutation_p.C1218F|CSMD1_ENST00000400186.3_Missense_Mutation_p.C1218F|CSMD1_ENST00000542608.1_Missense_Mutation_p.C1217F|CSMD1_ENST00000602557.1_Missense_Mutation_p.C1218F|CSMD1_ENST00000539096.1_Missense_Mutation_p.C1217F|CSMD1_ENST00000537824.1_Missense_Mutation_p.C1217F			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1218	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGGATCCTCACATTTTACCAG	0.478																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(3652-3654)TGT>TTT		CUB and Sushi multiple domains 1 precursor							69.0	63.0	65.0					8																	3166007		1929	4137	6066	SO:0001583	missense	64478					integral to membrane		g.chr8:3166007C>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3653G>T	8.37:g.3166007C>A	ENSP00000430733:p.Cys1218Phe					CSMD1_uc011kwj.1_Missense_Mutation_p.C610F|CSMD1_uc003wqe.2_Missense_Mutation_p.C374F	p.C1218F	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	24	4043	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	1218			Extracellular (Potential).|Sushi 7.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.3653G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.89|12.89	2.074614|2.074614	0.36566|0.36566	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	D;D;D;D;D|.	0.99784|.	-6.74;-6.74;-6.74;-6.74;-6.74|.	5.1|5.1	5.1|5.1	0.69264|0.69264	Complement control module (2);Sushi/SCR/CCP (3);|.	0.059586|.	0.64402|.	D|.	0.000002|.	D|D	0.91727|0.91727	0.7384|0.7384	H|H	0.99487|0.99487	4.59|4.59	0.80722|0.80722	D|D	1|1	P;D;D|.	0.64830|.	0.714;0.994;0.991|.	P;D;D|.	0.73708|.	0.458;0.981;0.936|.	D|D	0.95403|0.95403	0.8491|0.8491	10|5	0.87932|.	D|.	0|.	.|.	18.8807|18.8807	0.92354|0.92354	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1218;1218;1218|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	F|I	1218;1218;1080;1217;1217;1217|697	ENSP00000383047:C1218F;ENSP00000430733:C1218F;ENSP00000441462:C1217F;ENSP00000446243:C1217F;ENSP00000441675:C1217F|.	ENSP00000320445:C1080F|.	C|M	-|-	2|3	0|0	CSMD1|CSMD1	3153414|3153414	1.000000|1.000000	0.71417|0.71417	0.953000|0.953000	0.39169|0.39169	0.071000|0.071000	0.16799|0.16799	7.529000|7.529000	0.81952|0.81952	2.517000|2.517000	0.84864|0.84864	0.561000|0.561000	0.74099|0.74099	TGT|ATG		0.478	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		6	12	1	0	0.00116845	0.001168	0.00134126	6	12				
BLK	640	broad.mit.edu	37	8	11412354	11412354	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:11412354G>A	ENST00000259089.4	+	7	1167	c.575G>A	c.(574-576)cGg>cAg	p.R192Q	RP11-148O21.4_ENST00000528629.1_RNA|RP11-148O21.6_ENST00000602626.1_lincRNA|BLK_ENST00000529894.1_Missense_Mutation_p.R121Q|RP11-148O21.3_ENST00000527922.1_RNA	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	192	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		ATCTCCCCCCGGATCACCTTC	0.597																																							uc003wty.2		NA																	0				large_intestine(1)|stomach(1)|ovary(1)	3						c.(574-576)CGG>CAG		B lymphoid tyrosine kinase							50.0	47.0	48.0					8																	11412354		2203	4300	6503	SO:0001583	missense	640				intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr8:11412354G>A	BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.575G>A	8.37:g.11412354G>A	ENSP00000259089:p.Arg192Gln					BLK_uc003wtz.2_Missense_Mutation_p.R121Q	p.R192Q	NM_001715	NP_001706	P51451	BLK_HUMAN	STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)	7	1156	+			192			SH2.		Q16291|Q96IN1	Missense_Mutation	SNP	ENST00000259089.4	37	c.575G>A	CCDS5982.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932368	0.73442	.	.	ENSG00000136573	ENST00000259089;ENST00000427279;ENST00000529894	D;D	0.88975	-2.45;-2.45	4.57	3.68	0.42216	SH2 motif (4);	0.000000	0.42053	D	0.000765	D	0.85327	0.5671	L	0.56280	1.765	0.09310	N	0.999991	P	0.50528	0.936	B	0.43950	0.437	T	0.80042	-0.1548	10	0.87932	D	0	.	7.4856	0.27429	0.091:0.1698:0.7392:0.0	.	192	P51451	BLK_HUMAN	Q	192;192;121	ENSP00000259089:R192Q;ENSP00000433663:R121Q	ENSP00000259089:R192Q	R	+	2	0	BLK	11449763	0.001000	0.12720	0.874000	0.34290	0.952000	0.60782	1.000000	0.29770	2.249000	0.74217	0.462000	0.41574	CGG		0.597	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207460.1			14	24	0	0	0	0.003163	0	14	24				
RB1CC1	9821	broad.mit.edu	37	8	53586509	53586509	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:53586509C>G	ENST00000025008.5	-	7	1421	c.898G>C	c.(898-900)Gat>Cat	p.D300H	RB1CC1_ENST00000539297.1_Missense_Mutation_p.D300H|RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000435644.2_Missense_Mutation_p.D300H	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	300					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				AAGGGCAGATCACCATCTTTA	0.388																																					GBM(180;1701 2102 13475 42023 52570)	GBM(180;1701 2102 13475 42023 52570)	uc003xre.3		NA																	0				ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11						c.(898-900)GAT>CAT		Rb1-inducible coiled coil protein 1 isoform 1							147.0	133.0	138.0					8																	53586509		2203	4300	6503	SO:0001583	missense	9821				autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding	g.chr8:53586509C>G	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.898G>C	8.37:g.53586509C>G	ENSP00000025008:p.Asp300His					RB1CC1_uc003xrf.3_Missense_Mutation_p.D300H	p.D300H	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN			7	1456	-		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)	300					Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	ENST00000025008.5	37	c.898G>C	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531448	0.64972	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.15372	2.43;2.43;2.43	5.49	5.49	0.81192	.	0.197517	0.42420	D	0.000720	T	0.36386	0.0965	L	0.53249	1.67	0.47584	D	0.99946	D;D	0.57571	0.98;0.966	P;P	0.58873	0.847;0.707	T	0.03043	-1.1079	10	0.87932	D	0	-12.7653	19.7268	0.96166	0.0:1.0:0.0:0.0	.	300;300	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	H	300	ENSP00000025008:D300H;ENSP00000396067:D300H;ENSP00000445960:D300H	ENSP00000025008:D300H	D	-	1	0	RB1CC1	53749062	0.945000	0.32115	0.934000	0.37439	0.730000	0.41778	1.873000	0.39558	2.727000	0.93392	0.563000	0.77884	GAT		0.388	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781		28	89	0	0	0	0.005443	0	28	89				
RP1	6101	broad.mit.edu	37	8	55537288	55537288	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:55537288A>T	ENST00000220676.1	+	4	994	c.846A>T	c.(844-846)aaA>aaT	p.K282N		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	282					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CTTCTGAGAAAACACATAATA	0.323																																					Colon(91;1014 1389 7634 14542 40420)	Colon(91;1014 1389 7634 14542 40420)	uc003xsd.1		NA																	0				skin(7)|ovary(4)|pancreas(1)	12						c.(844-846)AAA>AAT		retinitis pigmentosa RP1 protein							62.0	68.0	66.0					8																	55537288		2203	4297	6500	SO:0001583	missense	6101				axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding	g.chr8:55537288A>T	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.846A>T	8.37:g.55537288A>T	ENSP00000220676:p.Lys282Asn					RP1_uc011ldy.1_Intron	p.K282N	NM_006269	NP_006260	P56715	RP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)		4	994	+		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	282						Missense_Mutation	SNP	ENST00000220676.1	37	c.846A>T	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	A	19.37	3.813768	0.70912	.	.	ENSG00000104237	ENST00000220676	T	0.26518	1.73	5.19	5.19	0.71726	.	0.098253	0.45361	D	0.000365	T	0.52175	0.1718	M	0.77103	2.36	0.38493	D	0.948038	D	0.76494	0.999	D	0.72075	0.976	T	0.61544	-0.7041	10	0.72032	D	0.01	.	15.082	0.72122	1.0:0.0:0.0:0.0	.	282	P56715	RP1_HUMAN	N	282	ENSP00000220676:K282N	ENSP00000220676:K282N	K	+	3	2	RP1	55699841	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.824000	0.69279	1.971000	0.57363	0.533000	0.62120	AAA		0.323	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269		20	52	0	0	0	0.007413	0	20	52				
PREX2	80243	broad.mit.edu	37	8	69028086	69028086	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:69028086G>A	ENST00000288368.4	+	26	3522	c.3245G>A	c.(3244-3246)aGc>aAc	p.S1082N		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1082					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GAAAGAAACAGCAAACGGGTA	0.398																																							uc003xxv.1		NA																	0				skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						c.(3244-3246)AGC>AAC		DEP domain containing 2 isoform a							172.0	164.0	167.0					8																	69028086		2203	4300	6503	SO:0001583	missense	80243				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity	g.chr8:69028086G>A	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3245G>A	8.37:g.69028086G>A	ENSP00000288368:p.Ser1082Asn						p.S1082N	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN			26	3272	+			1082					B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	c.3245G>A	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651706	0.67472	.	.	ENSG00000046889	ENST00000288368;ENST00000396539	T	0.35789	1.29	5.86	5.86	0.93980	.	0.102777	0.64402	D	0.000003	T	0.25568	0.0622	N	0.08118	0	0.41372	D	0.987492	B	0.17038	0.02	B	0.22386	0.039	T	0.06661	-1.0814	10	0.33940	T	0.23	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	1082	Q70Z35	PREX2_HUMAN	N	1082;1085	ENSP00000288368:S1082N	ENSP00000288368:S1082N	S	+	2	0	PREX2	69190640	1.000000	0.71417	0.999000	0.59377	0.917000	0.54804	7.512000	0.81728	2.937000	0.99478	0.650000	0.86243	AGC		0.398	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170		29	74	0	0	0	0.002445	0	29	74				
SULF1	23213	broad.mit.edu	37	8	70539497	70539497	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:70539497T>C	ENST00000260128.4	+	16	2620	c.1903T>C	c.(1903-1905)Tcg>Ccg	p.S635P	SULF1_ENST00000458141.2_Missense_Mutation_p.S635P|SULF1_ENST00000419716.3_Missense_Mutation_p.S635P|SULF1_ENST00000402687.4_Missense_Mutation_p.S635P|SULF1_ENST00000521946.1_3'UTR	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	635					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			ACTGTACCAATCGGCCAGAGC	0.418																																							uc010lza.1		NA																	0				central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7						c.(1903-1905)TCG>CCG		sulfatase 1 precursor							150.0	133.0	139.0					8																	70539497		2203	4300	6503	SO:0001583	missense	23213				apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding	g.chr8:70539497T>C	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.1903T>C	8.37:g.70539497T>C	ENSP00000260128:p.Ser635Pro					SULF1_uc003xyd.2_Missense_Mutation_p.S635P|SULF1_uc003xye.2_Missense_Mutation_p.S635P|SULF1_uc003xyf.2_Missense_Mutation_p.S635P|SULF1_uc003xyg.2_Missense_Mutation_p.S635P|SULF1_uc003xyh.1_RNA|SULF1_uc003xyi.1_5'Flank	p.S635P	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)		16	2620	+	Breast(64;0.0654)		635					Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	37	c.1903T>C	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	T	18.76	3.692104	0.68271	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	D;D;D;D	0.99051	-5.37;-5.37;-5.37;-5.37	6.04	6.04	0.98038	Extracellular sulfatase, C-terminal (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99290	0.9752	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.99327	1.0908	10	0.87932	D	0	.	16.5885	0.84745	0.0:0.0:0.0:1.0	.	635	Q8IWU6	SULF1_HUMAN	P	635	ENSP00000403040:S635P;ENSP00000260128:S635P;ENSP00000385704:S635P;ENSP00000390315:S635P	ENSP00000260128:S635P	S	+	1	0	SULF1	70702051	1.000000	0.71417	0.862000	0.33874	0.056000	0.15407	7.903000	0.87398	2.317000	0.78254	0.460000	0.39030	TCG		0.418	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170		7	34	0	0	0	0.004482	0	7	34				
PRDM14	63978	broad.mit.edu	37	8	70981559	70981559	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:70981559C>A	ENST00000276594.2	-	2	738	c.537G>T	c.(535-537)gaG>gaT	p.E179D		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	179					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			TGGGACCATCCTCTGACTGCT	0.577																																					NSCLC(129;99 1813 5906 40656 46114)	NSCLC(129;99 1813 5906 40656 46114)	uc003xym.2		NA																	0				ovary(3)	3						c.(535-537)GAG>GAT		PR domain containing 14							81.0	81.0	81.0					8																	70981559		2203	4300	6503	SO:0001583	missense	63978				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:70981559C>A	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.537G>T	8.37:g.70981559C>A	ENSP00000276594:p.Glu179Asp						p.E179D	NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)		2	739	-	Breast(64;0.193)		179					Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	37	c.537G>T	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576024	0.28092	.	.	ENSG00000147596	ENST00000276594	T	0.11712	2.75	4.44	2.42	0.29668	.	0.958184	0.08747	N	0.899717	T	0.07548	0.0190	L	0.29908	0.895	0.09310	N	1	B	0.18863	0.031	B	0.09377	0.004	T	0.40850	-0.9541	10	0.17832	T	0.49	-23.9188	6.2251	0.20703	0.1896:0.7004:0.0:0.11	.	179	Q9GZV8	PRD14_HUMAN	D	179	ENSP00000276594:E179D	ENSP00000276594:E179D	E	-	3	2	PRDM14	71144113	0.008000	0.16893	0.802000	0.32245	0.002000	0.02628	-0.104000	0.10923	1.063000	0.40649	-0.182000	0.12963	GAG		0.577	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1			9	25	1	0	0.00448238	0.004482	0.00499424	9	25				
ZFHX4	79776	broad.mit.edu	37	8	77765793	77765793	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:77765793C>T	ENST00000521891.2	+	10	7084	c.6636C>T	c.(6634-6636)ccC>ccT	p.P2212P	ZFHX4_ENST00000050961.6_Silent_p.P2167P|ZFHX4_ENST00000518282.1_Silent_p.P2186P|ZFHX4_ENST00000455469.2_Silent_p.P2167P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATCCACAGCCCACCTCTTTAG	0.373										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(6499-6501)CCC>CCT		zinc finger homeodomain 4							107.0	103.0	104.0					8																	77765793		1874	4108	5982	SO:0001819	synonymous_variant	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77765793C>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6636C>T	8.37:g.77765793C>T		HNSCC(33;0.089)				ZFHX4_uc003yau.1_Silent_p.P2212P|ZFHX4_uc003yaw.1_Silent_p.P2167P	p.P2167P	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	6888	+			2167					G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	c.6501C>T	CCDS47878.2																																																																																				0.373	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		13	60	0	0	0	0.001368	0	13	60				
RRM2B	50484	broad.mit.edu	37	8	103231152	103231152	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:103231152C>A	ENST00000251810.3	-	6	817	c.574G>T	c.(574-576)Gct>Tct	p.A192S	RRM2B_ENST00000519317.1_Intron|RRM2B_ENST00000395912.2_Missense_Mutation_p.A140S|RRM2B_ENST00000519962.1_Intron	NM_001172478.1|NM_015713.4	NP_001165949.1|NP_056528.2	Q7LG56	RIR2B_HUMAN	ribonucleotide reductase M2 B (TP53 inducible)	192					deoxyribonucleoside diphosphate metabolic process (GO:0009186)|deoxyribonucleoside triphosphate metabolic process (GO:0009200)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA repair (GO:0006281)|kidney development (GO:0001822)|mitochondrial DNA replication (GO:0006264)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|renal system process (GO:0003014)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	9	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000728)		Cladribine(DB00242)	CCTTCTACAGCAGCAAAGGCC	0.368								Modulation of nucleotide pools																															uc003ykn.2		NA																	0				ovary(2)	2						c.(574-576)GCT>TCT	Direct_reversal_of_damage|Modulation_of_nucleotide_pools	ribonucleotide reductase M2 B (TP53 inducible)							114.0	120.0	118.0					8																	103231152		2203	4300	6503	SO:0001583	missense	50484				deoxyribonucleoside diphosphate metabolic process|DNA repair|nucleobase, nucleoside and nucleotide interconversion	nucleoplasm	ribonucleoside-diphosphate reductase activity|transition metal ion binding	g.chr8:103231152C>A	AB036532	CCDS34932.1, CCDS55267.1	8q23.1	2014-09-17			ENSG00000048392	ENSG00000048392			17296	protein-coding gene	gene with protein product		604712				10716435, 10980602, 17486094	Standard	NM_015713		Approved	p53R2	uc022azl.1	Q7LG56	OTTHUMG00000164776	ENST00000251810.3:c.574G>T	8.37:g.103231152C>A	ENSP00000251810:p.Ala192Ser					RRM2B_uc003yko.2_RNA|RRM2B_uc010mbv.1_Missense_Mutation_p.A140S|RRM2B_uc010mbw.1_Intron|RRM2B_uc010mbx.1_Intron|RRM2B_uc010mby.1_Intron	p.A192S	NM_015713	NP_056528	Q7LG56	RIR2B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.000728)		6	818	-	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		192					B4E2N4|Q17R22|Q75PQ6|Q75PQ7|Q75PY8|Q75PY9|Q86YE3|Q9NPD6|Q9NTD8|Q9NUW3	Missense_Mutation	SNP	ENST00000251810.3	37	c.574G>T	CCDS34932.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.98|18.98	3.738744|3.738744	0.69304|0.69304	.|.	.|.	ENSG00000048392|ENSG00000048392	ENST00000251810;ENST00000535248;ENST00000395912|ENST00000522368	D;D|.	0.97620|.	-4.46;-4.46|.	5.37|5.37	5.37|5.37	0.77165|0.77165	Ferritin/ribonucleotide reductase-like (1);Ribonucleotide reductase-related (1);|.	0.103036|.	0.64402|.	D|.	0.000003|.	T|T	0.80363|0.80363	0.4609|0.4609	M|M	0.88377|0.88377	2.95|2.95	0.80722|0.80722	D|D	1|1	B;B|.	0.22414|.	0.002;0.069|.	B;B|.	0.42112|.	0.126;0.376|.	D|D	0.83425|0.83425	0.0035|0.0035	10|5	0.59425|.	D|.	0.04|.	.|.	14.826|14.826	0.70113|0.70113	0.1444:0.8556:0.0:0.0|0.1444:0.8556:0.0:0.0	.|.	140;192|.	Q7LG56-2;Q7LG56|.	.;RIR2B_HUMAN|.	S|F	192;138;140|248	ENSP00000251810:A192S;ENSP00000379248:A140S|.	ENSP00000251810:A192S|.	A|C	-|-	1|2	0|0	RRM2B|RRM2B	103300328|103300328	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.938000|5.938000	0.70170|0.70170	2.511000|2.511000	0.84671|0.84671	0.650000|0.650000	0.86243|0.86243	GCT|TGC		0.368	RRM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380191.3			21	130	1	0	5.35047e-06	0.00333	7.10967e-06	21	130				
ATAD2	29028	broad.mit.edu	37	8	124383531	124383531	+	Missense_Mutation	SNP	C	C	A	rs548754454		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:124383531C>A	ENST00000287394.5	-	5	691	c.584G>T	c.(583-585)cGt>cTt	p.R195L	ATAD2_ENST00000534257.1_5'Flank|ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	195					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TCGCTGTCTACGCATCTTCTT	0.313																																							uc003yqh.3		NA																	0				ovary(2)	2						c.(583-585)CGT>CTT		ATPase family, AAA domain containing 2							94.0	92.0	93.0					8																	124383531		2203	4298	6501	SO:0001583	missense	29028				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity	g.chr8:124383531C>A	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.584G>T	8.37:g.124383531C>A	ENSP00000287394:p.Arg195Leu					ATAD2_uc011lii.1_5'UTR|ATAD2_uc003yqi.3_RNA|ATAD2_uc003yqj.2_Missense_Mutation_p.R195L	p.R195L	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		5	692	-	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		195					Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	c.584G>T	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700857	0.88924	.	.	ENSG00000156802	ENST00000287394	T	0.07327	3.2	5.06	5.06	0.68205	.	3.441010	0.01712	U	0.027766	T	0.33556	0.0867	L	0.55103	1.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00326	-1.1815	10	0.66056	D	0.02	-11.072	18.0327	0.89290	0.0:1.0:0.0:0.0	.	25;195	Q6PL18-2;Q6PL18	.;ATAD2_HUMAN	L	195	ENSP00000287394:R195L	ENSP00000287394:R195L	R	-	2	0	ATAD2	124452712	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.206000	0.72154	2.351000	0.79841	0.555000	0.69702	CGT		0.313	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109		5	38	1	0	8.12818e-05	0.001984	9.89581e-05	5	38				
BAI1	575	broad.mit.edu	37	8	143561100	143561100	+	Nonsense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:143561100G>A	ENST00000517894.1	+	9	2667	c.1773G>A	c.(1771-1773)tgG>tgA	p.W591*	BAI1_ENST00000323289.5_Nonsense_Mutation_p.W591*			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	591					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CTGTGATCTGGAAGGAGACCC	0.642																																							uc003ywm.2		NA																	0				lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8						c.(1771-1773)TGG>TGA		brain-specific angiogenesis inhibitor 1							89.0	99.0	96.0					8																	143561100		2061	4197	6258	SO:0001587	stop_gained	575				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding	g.chr8:143561100G>A	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1773G>A	8.37:g.143561100G>A	ENSP00000430945:p.Trp591*						p.W591*	NM_001702	NP_001693	O14514	BAI1_HUMAN			8	1956	+	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)		591			Extracellular (Potential).			Nonsense_Mutation	SNP	ENST00000517894.1	37	c.1773G>A		.	.	.	.	.	.	.	.	.	.	g	43	10.002561	0.99314	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	.	.	.	4.67	4.67	0.58626	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.5456	0.84444	0.0:0.0:1.0:0.0	.	.	.	.	X	591	.	ENSP00000313046:W591X	W	+	3	0	BAI1	143558102	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.382000	0.79729	2.162000	0.67917	0.306000	0.20318	TGG		0.642	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702		12	76	0	0	0	0.00245	0	12	76				
BAI1	575	broad.mit.edu	37	8	143561106	143561106	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:143561106G>A	ENST00000517894.1	+	9	2673	c.1779G>A	c.(1777-1779)gaG>gaA	p.E593E	BAI1_ENST00000323289.5_Silent_p.E593E			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	593					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TCTGGAAGGAGACCCCAGCGG	0.642																																							uc003ywm.2		NA																	0				lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8						c.(1777-1779)GAG>GAA		brain-specific angiogenesis inhibitor 1							88.0	98.0	95.0					8																	143561106		2076	4202	6278	SO:0001819	synonymous_variant	575				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding	g.chr8:143561106G>A	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1779G>A	8.37:g.143561106G>A							p.E593E	NM_001702	NP_001693	O14514	BAI1_HUMAN			8	1962	+	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)		593			Extracellular (Potential).			Silent	SNP	ENST00000517894.1	37	c.1779G>A																																																																																					0.642	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702		12	75	0	0	0	0.00245	0	12	75				
BAI1	575	broad.mit.edu	37	8	143562615	143562615	+	Splice_Site	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:143562615G>C	ENST00000517894.1	+	10	2723	c.1829G>C	c.(1828-1830)gGa>gCa	p.G610A	BAI1_ENST00000323289.5_Splice_Site_p.G610A			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	610					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GTCTCCCCAGGACTCATCCTG	0.622																																							uc003ywm.2		NA																	0				lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8						c.(1828-1830)GGA>GCA		brain-specific angiogenesis inhibitor 1							65.0	73.0	70.0					8																	143562615		2006	4185	6191	SO:0001630	splice_region_variant	575				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding	g.chr8:143562615G>C	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1829-1G>C	8.37:g.143562615G>C							p.G610A	NM_001702	NP_001693	O14514	BAI1_HUMAN			9	2012	+	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)		610			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000517894.1	37	c.1829G>C		.	.	.	.	.	.	.	.	.	.	g	16.57	3.161345	0.57368	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.50548	0.74;0.74	4.16	3.28	0.37604	.	0.070917	0.56097	U	0.000032	T	0.65698	0.2716	M	0.78049	2.395	0.46458	D	0.999055	D	0.76494	0.999	D	0.75020	0.985	T	0.66240	-0.5973	9	.	.	.	.	11.1395	0.48394	0.0913:0.0:0.9087:0.0	.	610	E9PBK0	.	A	610	ENSP00000430945:G610A;ENSP00000313046:G610A	.	G	+	2	0	BAI1	143559617	1.000000	0.71417	1.000000	0.80357	0.460000	0.32559	7.420000	0.80191	0.762000	0.33152	-0.642000	0.03964	GGA		0.622	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	Missense_Mutation	8	38	0	0	0	0.00308	0	8	38				
BAI1	575	broad.mit.edu	37	8	143562715	143562715	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:143562715G>C	ENST00000517894.1	+	10	2823	c.1929G>C	c.(1927-1929)caG>caC	p.Q643H	BAI1_ENST00000323289.5_Missense_Mutation_p.Q643H			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	643					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GAAACATCCAGATGATGGTGA	0.607																																							uc003ywm.2		NA																	0				lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8						c.(1927-1929)CAG>CAC		brain-specific angiogenesis inhibitor 1							60.0	65.0	63.0					8																	143562715		1935	4139	6074	SO:0001583	missense	575				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding	g.chr8:143562715G>C	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1929G>C	8.37:g.143562715G>C	ENSP00000430945:p.Gln643His						p.Q643H	NM_001702	NP_001693	O14514	BAI1_HUMAN			9	2112	+	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)		643			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000517894.1	37	c.1929G>C		.	.	.	.	.	.	.	.	.	.	G	13.72	2.320929	0.41096	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.28069	1.63;1.63	4.16	1.9	0.25705	.	0.000000	0.64402	U	0.000003	T	0.41926	0.1180	L	0.42245	1.32	0.46096	D	0.998861	D	0.89917	1.0	D	0.81914	0.995	T	0.11767	-1.0574	10	0.36615	T	0.2	.	10.3293	0.43812	0.2017:0.0:0.7983:0.0	.	643	E9PBK0	.	H	643	ENSP00000430945:Q643H;ENSP00000313046:Q643H	ENSP00000313046:Q643H	Q	+	3	2	BAI1	143559717	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	0.877000	0.28106	0.752000	0.32923	0.313000	0.20887	CAG		0.607	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702		9	34	0	0	0	0.008291	0	9	34				
DOCK8	81704	broad.mit.edu	37	9	328021	328021	+	Splice_Site	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:328021G>C	ENST00000453981.1	+	9	1006		c.e9-1		DOCK8_ENST00000469391.1_Splice_Site|DOCK8_ENST00000432829.2_Splice_Site			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CTCATTTACAGATCTCAGAAA	0.408																																							uc003zgf.2		NA																	0				ovary(3)|central_nervous_system(3)	6						c.e9-1		dedicator of cytokinesis 8							99.0	98.0	98.0					9																	328021		2203	4300	6503	SO:0001630	splice_region_variant	81704				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity	g.chr9:328021G>C	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.895-1G>C	9.37:g.328021G>C						DOCK8_uc011lls.1_Splice_Site_p.I299_splice|DOCK8_uc010mgu.2_Splice_Site|DOCK8_uc010mgv.2_Splice_Site_p.I231_splice|DOCK8_uc003zgg.2_Splice_Site_p.I231_splice|DOCK8_uc003zgh.2_Splice_Site	p.I299_splice	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)	9	1007	+		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)						A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Splice_Site	SNP	ENST00000453981.1	37	c.895_splice	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	G	25.2	4.608691	0.87258	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8738	0.96861	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK8	318021	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.322000	0.96357	2.798000	0.96311	0.650000	0.86243	.		0.408	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	Intron	21	46	0	0	0	0.001882	0	21	46				
PTPRD	5789	broad.mit.edu	37	9	8449761	8449761	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:8449761G>T	ENST00000381196.4	-	31	4495	c.3952C>A	c.(3952-3954)Cct>Act	p.P1318T	PTPRD_ENST00000355233.5_Missense_Mutation_p.P912T|PTPRD_ENST00000360074.4_Missense_Mutation_p.P1305T|PTPRD_ENST00000537002.1_Missense_Mutation_p.P908T|PTPRD_ENST00000397611.3_Missense_Mutation_p.P908T|PTPRD_ENST00000397606.3_Missense_Mutation_p.P897T|PTPRD_ENST00000358503.5_Missense_Mutation_p.P1296T|PTPRD_ENST00000486161.1_Missense_Mutation_p.P911T|PTPRD_ENST00000356435.5_Missense_Mutation_p.P1318T|PTPRD_ENST00000397617.3_Missense_Mutation_p.P897T|PTPRD_ENST00000540109.1_Missense_Mutation_p.P1318T	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1318					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.P1318S(2)|p.P789S(1)|p.P912S(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		AGTTCTACAGGGTCTGTTGGG	0.448										TSP Lung(15;0.13)																													uc003zkk.2		NA																	4	Substitution - Missense(4)		lung(4)	lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(3952-3954)CCT>ACT		protein tyrosine phosphatase, receptor type, D							355.0	324.0	334.0					9																	8449761		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8449761G>T	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3952C>A	9.37:g.8449761G>T	ENSP00000370593:p.Pro1318Thr	TSP Lung(15;0.13)				PTPRD_uc003zkp.2_Missense_Mutation_p.P912T|PTPRD_uc003zkq.2_Missense_Mutation_p.P911T|PTPRD_uc003zkr.2_Missense_Mutation_p.P902T|PTPRD_uc003zks.2_Missense_Mutation_p.P897T|PTPRD_uc003zkl.2_Missense_Mutation_p.P1309T|PTPRD_uc003zkm.2_Missense_Mutation_p.P1305T|PTPRD_uc003zkn.2_Missense_Mutation_p.P907T|PTPRD_uc003zko.2_Missense_Mutation_p.P908T	p.P1318T	NM_002839	NP_002830	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	33	4663	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	1318			Cytoplasmic (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.3952C>A	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582090	0.65992	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.55413	0.57;0.57;0.61;0.66;0.76;0.88;0.63;0.52;0.57;0.75;0.88	5.58	5.58	0.84498	.	0.051250	0.85682	D	0.000000	T	0.79088	0.4387	M	0.89601	3.045	0.80722	D	1	D;D;D;D;D;D;B;P;P	0.76494	0.998;0.998;0.998;0.998;0.998;0.999;0.226;0.856;0.697	D;D;D;D;D;D;B;B;B	0.78314	0.981;0.981;0.981;0.981;0.99;0.991;0.133;0.367;0.285	T	0.81854	-0.0741	9	.	.	.	.	19.9455	0.97180	0.0:0.0:1.0:0.0	.	897;902;911;912;908;908;1305;1318;1318	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	T	1318;1318;1305;1296;912;897;908;908;789;1318;911;897	ENSP00000370593:P1318T;ENSP00000348812:P1318T;ENSP00000353187:P1305T;ENSP00000351293:P1296T;ENSP00000347373:P912T;ENSP00000380741:P897T;ENSP00000380735:P908T;ENSP00000440515:P908T;ENSP00000438164:P1318T;ENSP00000417093:P911T;ENSP00000380731:P897T	.	P	-	1	0	PTPRD	8439761	1.000000	0.71417	0.996000	0.52242	0.889000	0.51656	9.271000	0.95698	2.788000	0.95919	0.650000	0.86243	CCT		0.448	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			38	118	1	0	7.53189e-24	0.007835	1.52198e-23	38	118				
C9orf72	203228	broad.mit.edu	37	9	27561600	27561600	+	Silent	SNP	A	A	G	rs149801256		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:27561600A>G	ENST00000380003.3	-	5	711	c.648T>C	c.(646-648)caT>caC	p.H216H	C9orf72_ENST00000379997.3_Silent_p.H216H|C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	216					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		GAAAGCCTTCATGACAGCTGT	0.328																																							uc003zqq.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(646-648)CAT>CAC		hypothetical protein LOC203228 isoform a		A	,	0,4406		0,0,2203	65.0	62.0	63.0		648,648	2.3	1.0	9	dbSNP_134	63	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous	C9orf72	NM_018325.2,NM_145005.4	,	0,1,6501	GG,GA,AA		0.0116,0.0,0.0077	,	216/482,216/223	27561600	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	203228							g.chr9:27561600A>G	AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.648T>C	9.37:g.27561600A>G						C9orf72_uc003zqr.1_Silent_p.H216H	p.H216H	NM_018325	NP_060795	Q96LT7	CI072_HUMAN		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)	5	745	-		all_neural(11;7.57e-10)	216					A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Silent	SNP	ENST00000380003.3	37	c.648T>C	CCDS6522.1																																																																																				0.328	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	NM_018325		12	30	0	0	0	0.001855	0	12	30				
RECK	8434	broad.mit.edu	37	9	36118894	36118894	+	Silent	SNP	C	C	G	rs200760523		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:36118894C>G	ENST00000377966.3	+	18	2960	c.2394C>G	c.(2392-2394)tcC>tcG	p.S798S		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	798					blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			AGCACAGCTCCGTCGCCGAGT	0.607																																							uc003zyv.2		NA																	0				skin(2)|ovary(1)	3						c.(2392-2394)TCC>TCG		RECK protein precursor							87.0	77.0	80.0					9																	36118894		2203	4300	6503	SO:0001819	synonymous_variant	8434					anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity	g.chr9:36118894C>G	E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.2394C>G	9.37:g.36118894C>G						RECK_uc003zyw.2_Silent_p.S670S|RECK_uc003zyx.2_RNA	p.S798S	NM_021111	NP_066934	O95980	RECK_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)		18	2480	+			798					B2RNS1|Q5W0K6|Q8WX37	Silent	SNP	ENST00000377966.3	37	c.2394C>G	CCDS6597.1																																																																																				0.607	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052409.1			6	45	0	0	0	0.001168	0	6	45				
RNF38	152006	broad.mit.edu	37	9	36369894	36369894	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:36369894C>T	ENST00000259605.6	-	4	499	c.392G>A	c.(391-393)cGt>cAt	p.R131H	RNF38_ENST00000350199.4_Missense_Mutation_p.R48H|RNF38_ENST00000353739.4_Missense_Mutation_p.R81H|RNF38_ENST00000491349.1_5'UTR|RNF38_ENST00000377885.2_Missense_Mutation_p.R48H|RNF38_ENST00000357058.3_Missense_Mutation_p.R48H|RNF38_ENST00000377877.4_Missense_Mutation_p.R55H	NM_022781.4	NP_073618.3	Q9H0F5	RNF38_HUMAN	ring finger protein 38	131					male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|sperm flagellum (GO:0036126)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(1)|lung(3)|stomach(1)	11			STAD - Stomach adenocarcinoma(86;0.228)			TCGAGACAGACGATCCCTTCT	0.453																																							uc003zzh.2		NA																	0				central_nervous_system(1)	1						c.(391-393)CGT>CAT		ring finger protein 38 isoform 1							129.0	128.0	129.0					9																	36369894		2203	4300	6503	SO:0001583	missense	152006						zinc ion binding	g.chr9:36369894C>T		CCDS6603.1, CCDS6604.1	9p	2013-01-09			ENSG00000137075	ENSG00000137075		"""RING-type (C3HC4) zinc fingers"""	18052	protein-coding gene	gene with protein product		612488					Standard	XM_005251364		Approved		uc003zzh.3	Q9H0F5	OTTHUMG00000019905	ENST00000259605.6:c.392G>A	9.37:g.36369894C>T	ENSP00000259605:p.Arg131His					RNF38_uc003zzi.2_Missense_Mutation_p.R81H|RNF38_uc003zzj.2_Missense_Mutation_p.R48H|RNF38_uc003zzk.2_Missense_Mutation_p.R48H|RNF38_uc003zzl.2_Missense_Mutation_p.R55H|RNF38_uc003zzm.2_Missense_Mutation_p.R48H	p.R131H	NM_022781	NP_073618	Q9H0F5	RNF38_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)		4	583	-			131					A6PVP9|B1AM81|B1AM82|B3KSG4|E7EVL3|Q7LB33|Q8N0Y0|Q9H748	Missense_Mutation	SNP	ENST00000259605.6	37	c.392G>A	CCDS6603.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372519	0.82573	.	.	ENSG00000137075	ENST00000259605;ENST00000353739;ENST00000377885;ENST00000357058;ENST00000350199;ENST00000377870;ENST00000377877	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.59689	0.2212	L	0.54323	1.7	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	P;D;P	0.63703	0.791;0.917;0.899	T	0.59558	-0.7432	10	0.72032	D	0.01	-11.9181	17.7379	0.88399	0.0:1.0:0.0:0.0	.	55;81;131	B1AM81;Q9H0F5-2;Q9H0F5	.;.;RNF38_HUMAN	H	131;81;48;48;48;55;55	ENSP00000259605:R131H;ENSP00000335239:R81H;ENSP00000367117:R48H;ENSP00000349566:R48H;ENSP00000343947:R48H;ENSP00000367109:R55H	ENSP00000259605:R131H	R	-	2	0	RNF38	36359894	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.774000	0.95407	0.655000	0.94253	CGT		0.453	RNF38-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052422.3	NM_022781		6	27	0	0	0	0.001168	0	6	27				
SPATA31D1	389763	broad.mit.edu	37	9	84607683	84607683	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:84607683G>A	ENST00000344803.2	+	4	2345	c.2298G>A	c.(2296-2298)atG>atA	p.M766I		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	766					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGCTTTCCATGGAGAATGTGG	0.473																																							uc004amn.2		NA																	0					0						c.(2296-2298)ATG>ATA		hypothetical protein LOC389763							66.0	62.0	63.0					9																	84607683		1854	4097	5951	SO:0001583	missense	389763					integral to membrane		g.chr9:84607683G>A		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2298G>A	9.37:g.84607683G>A	ENSP00000341988:p.Met766Ile						p.M766I	NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN			4	2345	+			766						Missense_Mutation	SNP	ENST00000344803.2	37	c.2298G>A	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	3.945	-0.013511	0.07727	.	.	ENSG00000214929	ENST00000344803	T	0.06371	3.31	2.98	-3.5	0.04710	.	4.406720	0.00868	N	0.001990	T	0.03434	0.0099	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.36480	-0.9746	10	0.18276	T	0.48	0.544	2.3322	0.04239	0.3551:0.0:0.2576:0.3873	.	766	Q6ZQQ2	F75D1_HUMAN	I	766	ENSP00000341988:M766I	ENSP00000341988:M766I	M	+	3	0	FAM75D1	83797503	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.285000	0.18883	-0.599000	0.05798	-1.618000	0.00794	ATG		0.473	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		9	41	0	0	0	0.008291	0	9	41				
SPATA31C1	441452	broad.mit.edu	37	9	90535409	90535409	+	RNA	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:90535409C>A	ENST00000602681.1	+	0	1313							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTAAGTGCCTCCCAGCCACCA	0.617																																							uc010mqi.2		NA																	0					0						c.(586-588)TCC>TAC		family with sequence similarity 75, member C1							30.0	34.0	33.0					9																	90535409		692	1591	2283			441452							g.chr9:90535409C>A	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90535409C>A						FAM75C1_uc004apq.3_Missense_Mutation_p.S179Y	p.S196Y	NM_001145124	NP_001138596					4	616	+									Missense_Mutation	SNP	ENST00000602681.1	37	c.587C>A																																																																																					0.617	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124		66	163	1	0	9.4991e-31	0.00361	2.01487e-30	66	163				
SEMA4D	10507	broad.mit.edu	37	9	91994486	91994486	+	Silent	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:91994486C>G	ENST00000450295.1	-	16	2498	c.1722G>C	c.(1720-1722)ctG>ctC	p.L574L	SEMA4D_ENST00000343780.4_Intron|SEMA4D_ENST00000455551.2_Intron|SEMA4D_ENST00000339861.4_Intron|SEMA4D_ENST00000438547.2_Silent_p.L574L|SEMA4D_ENST00000420987.1_Intron|SEMA4D_ENST00000422704.2_Silent_p.L574L|SEMA4D_ENST00000356444.2_Silent_p.L574L			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	574	Ig-like C2-type.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						GGGAGCATTTCAGTTCCGCTG	0.483																																							uc004aqo.1		NA																	0				ovary(1)|pancreas(1)	2						c.(1720-1722)CTG>CTC		semaphorin 4D isoform 1							101.0	115.0	110.0					9																	91994486		2203	4300	6503	SO:0001819	synonymous_variant	10507				anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding	g.chr9:91994486C>G	U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.1722G>C	9.37:g.91994486C>G						SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Silent_p.L572L	p.L574L	NM_006378	NP_006369	Q92854	SEM4D_HUMAN			18	2294	-			574			Ig-like C2-type.|Extracellular (Potential).		B2RPM6|Q7Z5S4|Q8N8B0	Silent	SNP	ENST00000450295.1	37	c.1722G>C	CCDS6685.1																																																																																				0.483	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342411.1	NM_006378		19	180	0	0	0	0.001882	0	19	180				
NOL8	55035	broad.mit.edu	37	9	95069173	95069173	+	Missense_Mutation	SNP	T	T	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:95069173T>G	ENST00000535387.1	-	9	2705	c.2706A>C	c.(2704-2706)aaA>aaC	p.K902N	NOL8_ENST00000358855.4_Missense_Mutation_p.K872N|NOL8_ENST00000542053.1_Missense_Mutation_p.K872N|NOL8_ENST00000545558.1_Missense_Mutation_p.K940N|NOL8_ENST00000442668.2_Missense_Mutation_p.K940N					nucleolar protein 8											endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						CATACTTAAATTTCTTAGCAG	0.343																																							uc004arv.2		NA																	0				ovary(1)	1						c.(2818-2820)AAA>AAC		nucleolar protein 8							183.0	182.0	182.0					9																	95069173		1845	4098	5943	SO:0001583	missense	55035				DNA replication|positive regulation of cell growth	nucleolus	nucleotide binding|protein binding|RNA binding	g.chr9:95069173T>G	AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000535387.1:c.2706A>C	9.37:g.95069173T>G	ENSP00000441300:p.Lys902Asn					NOL8_uc010mqw.2_RNA|NOL8_uc004arw.2_Missense_Mutation_p.K172N|NOL8_uc011ltw.1_Missense_Mutation_p.K872N	p.K940N	NM_017948	NP_060418	Q76FK4	NOL8_HUMAN			11	3157	-			940						Missense_Mutation	SNP	ENST00000535387.1	37	c.2820A>C	CCDS47993.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.989200	0.74589	.	.	ENSG00000198000	ENST00000442668;ENST00000375594;ENST00000358855;ENST00000545558;ENST00000535387;ENST00000542053;ENST00000432670	T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31	5.55	4.25	0.50352	.	0.249376	0.44902	D	0.000408	T	0.53029	0.1771	M	0.74258	2.255	0.42468	D	0.992816	D;D	0.76494	0.996;0.999	P;D	0.64144	0.866;0.922	T	0.57400	-0.7818	10	0.72032	D	0.01	-25.1845	8.0007	0.30295	0.0:0.1271:0.0:0.8729	.	872;940	Q76FK4-2;Q76FK4	.;NOL8_HUMAN	N	940;904;872;940;902;872;940	ENSP00000401177:K940N;ENSP00000351723:K872N;ENSP00000441140:K940N;ENSP00000441300:K902N;ENSP00000440709:K872N;ENSP00000414112:K940N	ENSP00000351723:K872N	K	-	3	2	NOL8	94108994	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.956000	0.40382	2.238000	0.73509	0.477000	0.44152	AAA		0.343	NOL8-010	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053082.2	NM_017948		38	92	0	0	0	0.009718	0	38	92				
C9orf43	257169	broad.mit.edu	37	9	116186556	116186556	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:116186556C>T	ENST00000288462.4	+	8	1213	c.767C>T	c.(766-768)tCt>tTt	p.S256F	C9orf43_ENST00000374165.1_Missense_Mutation_p.S256F	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	256										breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						AGTGTGATTTCTTCTAAGATG	0.433																																							uc004bho.3		NA																	0					0						c.(766-768)TCT>TTT		hypothetical protein LOC257169							182.0	188.0	186.0					9																	116186556		2203	4300	6503	SO:0001583	missense	257169							g.chr9:116186556C>T	BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.767C>T	9.37:g.116186556C>T	ENSP00000288462:p.Ser256Phe					C9orf43_uc004bhp.2_Missense_Mutation_p.S256F	p.S256F	NM_152786	NP_689999	Q8TAL5	CI043_HUMAN			8	1163	+			256						Missense_Mutation	SNP	ENST00000288462.4	37	c.767C>T	CCDS6796.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.187295	0.57909	.	.	ENSG00000157653	ENST00000374165;ENST00000288462	T;T	0.62232	0.04;0.04	4.33	4.33	0.51752	.	0.000000	0.44285	D	0.000467	T	0.68613	0.3020	L	0.34521	1.04	0.36838	D	0.887269	D	0.89917	1.0	D	0.91635	0.999	T	0.74581	-0.3618	10	0.87932	D	0	-17.7222	12.6377	0.56692	0.0:1.0:0.0:0.0	.	256	Q8TAL5	CI043_HUMAN	F	256	ENSP00000363280:S256F;ENSP00000288462:S256F	ENSP00000288462:S256F	S	+	2	0	C9orf43	115226377	1.000000	0.71417	0.980000	0.43619	0.614000	0.37383	2.906000	0.48735	2.689000	0.91719	0.563000	0.77884	TCT		0.433	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053739.1	NM_152786		21	170	0	0	0	0.002299	0	21	170				
BRINP1	1620	broad.mit.edu	37	9	121976385	121976385	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:121976385G>A	ENST00000265922.3	-	6	1195	c.734C>T	c.(733-735)tCg>tTg	p.S245L	BRINP1_ENST00000373964.2_Missense_Mutation_p.S245L	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	245	MACPF.				cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											GCTCAAGGCCGACTGGACAAA	0.478																																							uc004bkc.2		NA																	0				skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						c.(733-735)TCG>TTG		deleted in bladder cancer 1 precursor							98.0	83.0	88.0					9																	121976385		2203	4300	6503	SO:0001583	missense	1620				cell cycle arrest|cell death	cytoplasm	protein binding	g.chr9:121976385G>A	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.734C>T	9.37:g.121976385G>A	ENSP00000265922:p.Ser245Leu					DBC1_uc004bkd.2_Missense_Mutation_p.S245L	p.S245L	NM_014618	NP_055433	O60477	DBC1_HUMAN			6	1190	-			245			MACPF.		Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	c.734C>T	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.006571	0.74932	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	T;T	0.47177	2.43;0.85	5.43	5.43	0.79202	Membrane attack complex component/perforin (MACPF) domain (1);	0.000000	0.85682	D	0.000000	T	0.62998	0.2474	L	0.47716	1.5	0.80722	D	1	D;D	0.69078	0.997;0.994	D;P	0.66847	0.947;0.885	T	0.65117	-0.6246	10	0.87932	D	0	-6.1826	18.2224	0.89905	0.0:0.0:1.0:0.0	.	245;245	O60477-2;O60477	.;DBC1_HUMAN	L	245	ENSP00000265922:S245L;ENSP00000363075:S245L	ENSP00000265922:S245L	S	-	2	0	DBC1	121016206	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.476000	0.97823	2.552000	0.86080	0.563000	0.77884	TCG		0.478	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618		6	50	0	0	0	0.001168	0	6	50				
TTLL11	158135	broad.mit.edu	37	9	124751430	124751430	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:124751430C>A	ENST00000373776.3	-	4	1770	c.1583G>T	c.(1582-1584)gGc>gTc	p.G528V	TTLL11_ENST00000321582.5_Intron|TTLL11_ENST00000474723.1_Intron	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	528	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						CCTCTTGAGGCCGGTCAAGGC	0.602																																							uc004blt.1		NA																	0					0						c.(1582-1584)GGC>GTC		tubulin tyrosine ligase-like family, member 11							63.0	63.0	63.0					9																	124751430		2203	4300	6503	SO:0001583	missense	158135				protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity	g.chr9:124751430C>A	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.1583G>T	9.37:g.124751430C>A	ENSP00000362881:p.Gly528Val					TTLL11_uc011lyl.1_Intron|TTLL11_uc004blr.2_Intron|TTLL11_uc011lym.1_Intron|TTLL11_uc004blu.1_3'UTR	p.G528V	NM_194252	NP_919228	Q8NHH1	TTL11_HUMAN			4	1771	-			528			TTL.			Missense_Mutation	SNP	ENST00000373776.3	37	c.1583G>T	CCDS6834.2	.	.	.	.	.	.	.	.	.	.	C	10.84	1.465179	0.26335	.	.	ENSG00000175764	ENST00000373776	T	0.07114	3.22	3.9	3.0	0.34707	.	0.890365	0.09284	U	0.823329	T	0.05502	0.0145	N	0.14661	0.345	0.36541	D	0.871279	B	0.32968	0.392	B	0.29598	0.104	T	0.32052	-0.9921	10	0.87932	D	0	.	7.7268	0.28765	0.0:0.8865:0.0:0.1135	.	528	Q8NHH1	TTL11_HUMAN	V	528	ENSP00000362881:G528V	ENSP00000362881:G528V	G	-	2	0	TTLL11	123791251	0.015000	0.18098	0.039000	0.18376	0.001000	0.01503	3.127000	0.50484	1.220000	0.43490	-0.150000	0.13652	GGC		0.602	TTLL11-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053907.1	XM_088486		24	51	1	0	7.88262e-20	0.00333	1.54265e-19	24	51				
OR1N2	138882	broad.mit.edu	37	9	125315572	125315572	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:125315572C>G	ENST00000373688.2	+	1	182	c.124C>G	c.(124-126)Cct>Gct	p.P42A		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						AGAGGAGCAGCCTCTTCTGTT	0.527																																							uc011lyx.1		NA																	0				ovary(2)|skin(2)	4						c.(124-126)CCT>GCT		olfactory receptor, family 1, subfamily N,							136.0	121.0	126.0					9																	125315572		2203	4300	6503	SO:0001583	missense	138882				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125315572C>G		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.124C>G	9.37:g.125315572C>G	ENSP00000362792:p.Pro42Ala						p.P42A	NM_001004457	NP_001004457	Q8NGR9	OR1N2_HUMAN			1	124	+			42			Extracellular (Potential).		A3KFM2|B2RNY4|Q6IF17|Q96RA3	Missense_Mutation	SNP	ENST00000373688.2	37	c.124C>G	CCDS35123.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.649284	0.00785	.	.	ENSG00000171501	ENST00000373688	T	0.00420	7.47	4.37	0.0962	0.14489	.	0.857477	0.09487	N	0.795420	T	0.00271	0.0008	L	0.36672	1.1	0.09310	N	0.999997	B	0.19073	0.033	B	0.23018	0.043	T	0.41980	-0.9478	10	0.52906	T	0.07	.	1.8795	0.03225	0.1373:0.479:0.1342:0.2495	.	42	Q8NGR9	OR1N2_HUMAN	A	42	ENSP00000362792:P42A	ENSP00000362792:P42A	P	+	1	0	OR1N2	124355393	0.000000	0.05858	0.339000	0.25562	0.073000	0.16967	-0.001000	0.12947	0.120000	0.18254	-0.142000	0.14014	CCT		0.527	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2			20	60	0	0	0	0.007413	0	20	60				
PKN3	29941	broad.mit.edu	37	9	131469303	131469303	+	Splice_Site	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:131469303G>T	ENST00000291906.4	+	5	1044		c.e5+1		RN7SL560P_ENST00000577943.1_RNA	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3						epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						ACTGGCTGAGGTCAGGCCCCA	0.612																																							uc004bvw.2		NA																	0				stomach(2)|lung(2)	4						c.e5+1		protein kinase PKNbeta							79.0	77.0	77.0					9																	131469303		2203	4300	6503	SO:0001630	splice_region_variant	29941				signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity	g.chr9:131469303G>T	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.651+1G>T	9.37:g.131469303G>T						PKN3_uc010myh.2_Splice_Site_p.E217_splice|PKN3_uc011mbk.1_Splice_Site	p.E217_splice	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN			5	1044	+								Q9UM03	Splice_Site	SNP	ENST00000291906.4	37	c.651_splice	CCDS6908.1	.	.	.	.	.	.	.	.	.	.	G	12.50	1.956365	0.34565	.	.	ENSG00000160447	ENST00000291906	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8908	0.79296	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PKN3	130509124	1.000000	0.71417	1.000000	0.80357	0.128000	0.20619	8.363000	0.90103	2.345000	0.79718	0.555000	0.69702	.		0.612	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355	Intron	18	41	1	0	2.37509e-13	0.010504	4.1068e-13	18	41				
ADAMTS13	11093	broad.mit.edu	37	9	136310172	136310172	+	Splice_Site	SNP	A	A	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:136310172A>T	ENST00000371929.3	+	20	3053	c.2609A>T	c.(2608-2610)cAt>cTt	p.H870L	ADAMTS13_ENST00000536611.1_3'UTR|ADAMTS13_ENST00000356589.2_Splice_Site_p.H839L|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000355699.2_Splice_Site_p.H870L|ADAMTS13_ENST00000485925.1_3'UTR	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	870					cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GGCTGGGGCCATGTGAGTGCC	0.647																																							uc004cdv.3		NA																	0				central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6						c.(2608-2610)CAT>CTT		ADAM metallopeptidase with thrombospondin type 1							44.0	36.0	38.0					9																	136310172		2202	4300	6502	SO:0001630	splice_region_variant	11093				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr9:136310172A>T	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.2610+1A>T	9.37:g.136310172A>T						ADAMTS13_uc004cdp.3_Missense_Mutation_p.H97L|ADAMTS13_uc004cdt.1_Missense_Mutation_p.H870L|ADAMTS13_uc004cdu.1_Missense_Mutation_p.H839L|ADAMTS13_uc004cdw.3_Missense_Mutation_p.H870L|ADAMTS13_uc004cdx.3_Missense_Mutation_p.H839L|ADAMTS13_uc004cdy.1_RNA|ADAMTS13_uc004cdz.3_Missense_Mutation_p.H540L|ADAMTS13_uc004cds.1_Missense_Mutation_p.H395L|ADAMTS13_uc004cdr.1_RNA	p.H870L	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)	20	3053	+			870					Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	c.2609A>T	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	A	0.244	-1.011159	0.02095	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589	T;T;T	0.67171	-0.2;-0.25;-0.22	5.41	-2.01	0.07410	.	.	.	.	.	T	0.32585	0.0834	N	0.04508	-0.205	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.002	T	0.15607	-1.0431	9	0.10111	T	0.7	.	4.2337	0.10615	0.1963:0.5038:0.0776:0.2223	.	870;839;870	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	L	870;870;839	ENSP00000360997:H870L;ENSP00000347927:H870L;ENSP00000348997:H839L	ENSP00000347927:H870L	H	+	2	0	ADAMTS13	135299993	0.000000	0.05858	0.002000	0.10522	0.101000	0.19017	-0.152000	0.10159	-0.269000	0.09298	-0.865000	0.03005	CAT		0.647	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	Missense_Mutation	4	13	0	0	0	0.000602	0	4	13				
QSOX2	169714	broad.mit.edu	37	9	139115958	139115958	+	Splice_Site	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:139115958C>A	ENST00000358701.5	-	4	516	c.479G>T	c.(478-480)gGa>gTa	p.G160V		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	160	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)	p.G160E(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		TCGGTCAGGTCCTGCCGGAAG	0.657																																							uc010nbi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(478-480)GGA>GTA		quiescin Q6 sulfhydryl oxidase 2 precursor							88.0	75.0	80.0					9																	139115958		2203	4300	6503	SO:0001630	splice_region_variant	169714				cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity	g.chr9:139115958C>A	AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.479-1G>T	9.37:g.139115958C>A							p.G160V	NM_181701	NP_859052	Q6ZRP7	QSOX2_HUMAN		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)	4	517	-		Myeloproliferative disorder(178;0.0511)	160			Thioredoxin.		A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	ENST00000358701.5	37	c.479G>T	CCDS35178.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.00|17.00	3.277605|3.277605	0.59758|0.59758	.|.	.|.	ENSG00000165661|ENSG00000165661	ENST00000358701;ENST00000389471|ENST00000455222	T|.	0.68903|.	-0.36|.	5.18|5.18	5.18|5.18	0.71444|0.71444	Thioredoxin-like fold (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76212|0.76212	0.3956|0.3956	M|M	0.76727|0.76727	2.345|2.345	0.80722|0.80722	D|D	1|1	D|.	0.67145|.	0.996|.	P|.	0.62649|.	0.905|.	T|T	0.76621|0.76621	-0.2892|-0.2892	10|5	0.27082|.	T|.	0.32|.	.|.	17.672|17.672	0.88221|0.88221	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	160|.	Q6ZRP7|.	QSOX2_HUMAN|.	V|S	160;38|6	ENSP00000351536:G160V|.	ENSP00000351536:G160V|.	G|R	-|-	2|3	0|2	QSOX2|QSOX2	138255779|138255779	1.000000|1.000000	0.71417|0.71417	0.947000|0.947000	0.38551|0.38551	0.151000|0.151000	0.21798|0.21798	6.781000|6.781000	0.75068|0.75068	2.419000|2.419000	0.82065|0.82065	0.467000|0.467000	0.42956|0.42956	GGA|AGG		0.657	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701	Missense_Mutation	14	30	1	0	6.31663e-08	0.003163	9.19884e-08	14	30				
ARSH	347527	broad.mit.edu	37	X	2931179	2931179	+	Silent	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:2931179G>C	ENST00000381130.2	+	3	306	c.306G>C	c.(304-306)ctG>ctC	p.L102L		NM_001011719.1	NP_001011719.1	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	102					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(3)|endometrium(8)|kidney(2)|large_intestine(6)|lung(13)|skin(1)|stomach(1)	34		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TTGCCAAGCTGCTGCAGCACC	0.562																																							uc011mhj.1		NA																	0				lung(1)	1						c.(304-306)CTG>CTC		arylsulfatase family, member H							142.0	109.0	120.0					X																	2931179		2203	4300	6503	SO:0001819	synonymous_variant	347527					integral to membrane	arylsulfatase activity|metal ion binding	g.chrX:2931179G>C	AY875940	CCDS35198.1	Xp22.33	2013-02-14	2006-03-07		ENSG00000205667	ENSG00000205667		"""Arylsulfatase family"""	32488	protein-coding gene	gene with protein product		300586	"""arylsulfatase H"""			16174644	Standard	NM_001011719		Approved		uc011mhj.2	Q5FYA8	OTTHUMG00000159612	ENST00000381130.2:c.306G>C	X.37:g.2931179G>C							p.L102L	NM_001011719	NP_001011719	Q5FYA8	ARSH_HUMAN			3	306	+		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)	102						Silent	SNP	ENST00000381130.2	37	c.306G>C	CCDS35198.1																																																																																				0.562	ARSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356489.1	NM_001011719		11	81	0	0	0	0.008291	0	11	81				
STS	412	broad.mit.edu	37	X	7171273	7171273	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:7171273G>T	ENST00000217961.4	+	2	268	c.48G>T	c.(46-48)ctG>ctT	p.L16L		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	16					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	TGTTCTTTCTGTGGGAAGCCG	0.498									Ichthyosis																														uc004cry.3		NA																	0				central_nervous_system(1)	1						c.(46-48)CTG>CTT		steryl-sulfatase precursor	Estrone(DB00655)						113.0	83.0	93.0					X																	7171273		2203	4299	6502	SO:0001819	synonymous_variant	412	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity	g.chrX:7171273G>T	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.48G>T	X.37:g.7171273G>T						STS_uc004crw.2_RNA|STS_uc011mhp.1_RNA|STS_uc004crx.1_RNA|STS_uc010ndm.1_RNA	p.L16L	NM_000351	NP_000342	P08842	STS_HUMAN			2	293	+		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)	16					B2RA47	Silent	SNP	ENST00000217961.4	37	c.48G>T	CCDS14127.1																																																																																				0.498	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	NM_000351		10	39	1	0	1.76689e-08	0.006214	2.62345e-08	10	39				
OFD1	8481	broad.mit.edu	37	X	13778502	13778502	+	Silent	SNP	G	G	A	rs145300245	byFrequency	TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:13778502G>A	ENST00000340096.6	+	16	2250	c.1923G>A	c.(1921-1923)gaG>gaA	p.E641E	OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380567.1_Silent_p.E501E|OFD1_ENST00000380550.3_Silent_p.E601E	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	641	Mediates homooligomerization.|Mediates the interaction with SDCCAG8.				axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						TTCAGCAAGAGGCCGAACGCT	0.478													G|||	5	0.0013245	0.0	0.0014	3775	,	,		13915	0.0		0.004	False		,,,				2504	0.0						uc004cvp.3		NA																	0					0						c.(1921-1923)GAG>GAA		oral-facial-digital syndrome 1		G		1,3834		0,1,0,1631,571	93.0	81.0	85.0		1923	3.0	0.9	X	dbSNP_134	85	48,6680		0,35,13,2393,1859	no	coding-synonymous	OFD1	NM_003611.2		0,36,13,4024,2430	AA,AG,A,GG,G		0.7134,0.0261,0.4639		641/1013	13778502	49,10514	2203	4300	6503	SO:0001819	synonymous_variant	8481				cilium movement involved in determination of left/right asymmetry|G2/M transition of mitotic cell cycle	centriole|cilium|cytosol|microtubule basal body|nuclear membrane	alpha-tubulin binding|gamma-tubulin binding	g.chrX:13778502G>A	Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.1923G>A	X.37:g.13778502G>A						OFD1_uc004cvr.3_Silent_p.E208E|OFD1_uc011mil.1_Silent_p.E208E|OFD1_uc004cvq.3_Silent_p.E501E|OFD1_uc010nen.2_Silent_p.E640E|OFD1_uc004cvs.3_RNA|OFD1_uc004cvu.3_Silent_p.E600E|OFD1_uc004cvv.3_Silent_p.E600E	p.E641E	NM_003611	NP_003602	O75665	OFD1_HUMAN			16	2282	+			641			Potential.|Mediates the interaction with SDCCAG8.|Mediates homooligomerization.		B9ZVU5|O75666|Q4VAK4	Silent	SNP	ENST00000340096.6	37	c.1923G>A	CCDS14157.1																																																																																				0.478	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055808.1	NM_003611		4	100	0	0	0	0.009096	0	4	100				
SYAP1	94056	broad.mit.edu	37	X	16761894	16761894	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:16761894C>T	ENST00000380155.3	+	5	599	c.506C>T	c.(505-507)cCc>cTc	p.P169L		NM_032796.3	NP_116185.2	Q96A49	SYAP1_HUMAN	synapse associated protein 1	169	BSD. {ECO:0000255|PROSITE- ProRule:PRU00036}.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				endometrium(3)|lung(4)|pancreas(1)|prostate(1)|skin(1)	10	Hepatocellular(33;0.0997)					CAGATGTACCCCGTGGCCCTG	0.468																																							uc004cxp.2		NA																	0				skin(1)	1						c.(505-507)CCC>CTC		SYAP1 protein							235.0	220.0	225.0					X																	16761894		2203	4300	6503	SO:0001583	missense	94056							g.chrX:16761894C>T	AF338728	CCDS14177.1	Xp22.31	2010-06-25	2010-06-25		ENSG00000169895	ENSG00000169895			16273	protein-coding gene	gene with protein product	"""SAP47 homolog (Drosophila)"""					11483580	Standard	NM_032796		Approved	FLJ14495, PRO3113	uc004cxp.3	Q96A49	OTTHUMG00000021192	ENST00000380155.3:c.506C>T	X.37:g.16761894C>T	ENSP00000369500:p.Pro169Leu					SYAP1_uc004cxo.2_Missense_Mutation_p.P169L|SYAP1_uc011miv.1_Missense_Mutation_p.P135L	p.P169L	NM_032796	NP_116185	Q96A49	SYAP1_HUMAN			5	599	+	Hepatocellular(33;0.0997)		169			BSD.		Q68CP1|Q96C60|Q96JQ6|Q96T20	Missense_Mutation	SNP	ENST00000380155.3	37	c.506C>T	CCDS14177.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.821362	0.90873	.	.	ENSG00000169895	ENST00000380155	T	0.41400	1.0	5.31	5.31	0.75309	BSD (3);	0.000000	0.85682	D	0.000000	T	0.67316	0.2880	M	0.76838	2.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.995;1.0	T	0.71699	-0.4514	10	0.66056	D	0.02	-9.5954	18.136	0.89619	0.0:1.0:0.0:0.0	.	135;169;169	B4E1C9;Q96A49;B2RBI2	.;SYAP1_HUMAN;.	L	169	ENSP00000369500:P169L	ENSP00000369500:P169L	P	+	2	0	SYAP1	16671815	1.000000	0.71417	0.922000	0.36590	0.700000	0.40528	7.549000	0.82163	2.218000	0.71995	0.502000	0.49764	CCC		0.468	SYAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055904.1	NM_032796		6	226	0	0	0	0.001168	0	6	226				
CDKL5	6792	broad.mit.edu	37	X	18627664	18627664	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:18627664C>A	ENST00000379989.3	+	15	2411	c.2126C>A	c.(2125-2127)cCa>cAa	p.P709Q	CDKL5_ENST00000379996.3_Missense_Mutation_p.P709Q|CDKL5_ENST00000463994.1_3'UTR	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	709					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					GATCCTGTGCCAAGGAGAGTT	0.498																																							uc004cym.2		NA																	0				ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6						c.(2125-2127)CCA>CAA		cyclin-dependent kinase-like 5							127.0	106.0	113.0					X																	18627664		2203	4300	6503	SO:0001583	missense	6792				neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding	g.chrX:18627664C>A	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2126C>A	X.37:g.18627664C>A	ENSP00000369325:p.Pro709Gln					CDKL5_uc004cyn.2_Missense_Mutation_p.P709Q	p.P709Q	NM_003159	NP_003150	O76039	CDKL5_HUMAN			14	2379	+	Hepatocellular(33;0.183)		709					G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	c.2126C>A	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	c	28.3	4.905094	0.92035	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	D;D	0.84730	-1.89;-1.89	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	D	0.89462	0.6722	L	0.34521	1.04	0.46798	D	0.999207	D	0.89917	1.0	D	0.87578	0.998	D	0.90303	0.4331	10	0.87932	D	0	-15.2054	19.48	0.95005	0.0:1.0:0.0:0.0	.	709	O76039	CDKL5_HUMAN	Q	709	ENSP00000369332:P709Q;ENSP00000369325:P709Q	ENSP00000369325:P709Q	P	+	2	0	CDKL5	18537585	1.000000	0.71417	0.969000	0.41365	0.978000	0.69477	7.275000	0.78548	2.554000	0.86153	0.591000	0.81541	CCA		0.498	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159		7	54	1	0	8.12818e-05	0.001984	9.89581e-05	7	54				
MAGEB6	158809	broad.mit.edu	37	X	26212698	26212698	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:26212698G>A	ENST00000379034.1	+	2	884	c.735G>A	c.(733-735)gtG>gtA	p.V245V		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	245	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						AACATTTGGTGGTGGCCTTTG	0.507																																							uc004dbr.2		NA																	0				ovary(3)	3						c.(733-735)GTG>GTA		melanoma antigen family B, 6							69.0	57.0	61.0					X																	26212698		2202	4300	6502	SO:0001819	synonymous_variant	158809							g.chrX:26212698G>A	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.735G>A	X.37:g.26212698G>A						MAGEB6_uc010ngc.1_Silent_p.V25V	p.V245V	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN			2	884	+			245			MAGE.		Q6GS19|Q9H219	Silent	SNP	ENST00000379034.1	37	c.735G>A	CCDS14217.1																																																																																				0.507	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523		12	59	0	0	0	0.000978	0	12	59				
DCAF8L2	347442	broad.mit.edu	37	X	27765740	27765740	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:27765740T>A	ENST00000451261.2	+	5	1127	c.728T>A	c.(727-729)cTg>cAg	p.L243Q		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	243										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GGCACCCGGCTGGCCAGTAGC	0.532																																							uc011mjy.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(727-729)CTG>CAG		DDB1 and CUL4 associated factor 8-like 2							100.0	76.0	83.0					X																	27765740		692	1591	2283	SO:0001583	missense	347442							g.chrX:27765740T>A		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.728T>A	X.37:g.27765740T>A	ENSP00000462745:p.Leu243Gln						p.L243Q	NM_001136533	NP_001130005					1	815	+								B2RXH9|J3KT06	Missense_Mutation	SNP	ENST00000451261.2	37	c.728T>A	CCDS59162.1																																																																																				0.532	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354		4	26	0	0	0	0.009096	0	4	26				
DCAF8L1	139425	broad.mit.edu	37	X	27998837	27998837	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:27998837G>T	ENST00000441525.1	-	1	729	c.615C>A	c.(613-615)aaC>aaA	p.N205K		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	205										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						TGCCACGCTGGTTAAAGTGTA	0.537																																							uc004dbx.1		NA																	0				ovary(3)|skin(1)	4						c.(613-615)AAC>AAA		DDB1 and CUL4 associated factor 8-like 1							34.0	27.0	30.0					X																	27998837		2202	4299	6501	SO:0001583	missense	139425							g.chrX:27998837G>T		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.615C>A	X.37:g.27998837G>T	ENSP00000405222:p.Asn205Lys						p.N205K	NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN			1	730	-			205			WD 1.		B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	c.615C>A	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.830267	0.50845	.	.	ENSG00000226372	ENST00000441525	T	0.61040	0.14	0.842	-0.269	0.12930	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.73450	0.3588	M	0.90705	3.14	0.50632	D	0.999887	D	0.89917	1.0	D	0.81914	0.995	T	0.69884	-0.5024	10	0.87932	D	0	-16.2103	5.0986	0.14747	0.2599:0.0:0.7401:0.0	.	205	A6NGE4	DC8L1_HUMAN	K	205	ENSP00000405222:N205K	ENSP00000405222:N205K	N	-	3	2	DCAF8L1	27908758	1.000000	0.71417	0.833000	0.33012	0.279000	0.26890	2.051000	0.41307	-0.168000	0.10853	0.284000	0.19432	AAC		0.537	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690		6	25	1	0	4.096e-09	0.001168	6.31505e-09	6	25				
KRBOX4	55634	broad.mit.edu	37	X	46322201	46322201	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:46322201G>C	ENST00000344302.4	+	4	665	c.34G>C	c.(34-36)Gac>Cac	p.D12H	KRBOX4_ENST00000360017.5_Missense_Mutation_p.D12H|KRBOX4_ENST00000298190.6_Missense_Mutation_p.D12H|KRBOX4_ENST00000487081.1_Missense_Mutation_p.D12H|KRBOX4_ENST00000377919.2_Missense_Mutation_p.D12H|KRBOX4_ENST00000478600.1_Missense_Mutation_p.D12H	NM_001129898.1|NM_017776.2	NP_001123370.1|NP_060246.2	Q5JUW0	KRBX4_HUMAN	KRAB box domain containing 4	12	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)										GACCTTCAAGGACGTGTTTGT	0.547																																							uc004dgn.3		NA																	0					0						c.(34-36)GAC>CAC		zinc finger family member 673 isoform 1							176.0	122.0	140.0					X																	46322201		2203	4300	6503	SO:0001583	missense	55634				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding	g.chrX:46322201G>C		CCDS14267.1, CCDS48097.1, CCDS48098.1	Xp11.3	2013-01-08	2013-01-08	2013-01-08	ENSG00000147121	ENSG00000147121		"""-"""	26007	protein-coding gene	gene with protein product	"""hypothetical protein FLJ20344"""	300585	"""zinc finger protein 673"", ""zinc finger family member 673"""	ZNF673		11944989	Standard	NM_001129898		Approved	FLJ20344	uc004dgn.4	Q5JUW0	OTTHUMG00000021421	ENST00000344302.4:c.34G>C	X.37:g.46322201G>C	ENSP00000345797:p.Asp12His					ZNF673_uc004dgp.3_Missense_Mutation_p.D12H|ZNF673_uc010nhl.2_Missense_Mutation_p.D12H|ZNF673_uc004dgm.3_Missense_Mutation_p.D12H	p.D12H	NM_001129898	NP_001123370	Q5JUW0	ZN673_HUMAN			4	333	+			12			KRAB.		A8K0Y8|B3KU22|Q96EA3|Q9NXB1	Missense_Mutation	SNP	ENST00000344302.4	37	c.34G>C	CCDS48097.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.935558	0.34189	.	.	ENSG00000147121	ENST00000344302;ENST00000360017;ENST00000298190;ENST00000377919;ENST00000476762;ENST00000478600;ENST00000487081;ENST00000397212	T;T;T;T;T;T;T	0.12039	2.72;2.72;2.72;2.72;2.72;2.72;2.72	2.88	1.07	0.20283	Krueppel-associated box (4);	.	.	.	.	T	0.50103	0.1596	H	0.99675	4.695	0.09310	N	1	D;P;B;B	0.76494	0.999;0.517;0.041;0.033	D;B;B;B	0.63033	0.91;0.213;0.067;0.027	T	0.43734	-0.9373	9	0.72032	D	0.01	.	6.1826	0.20480	0.2843:0.0:0.7156:0.0	.	12;12;12;12	Q5JUW0-3;C9J804;Q5JUW0;Q5JUW0-2	.;.;ZN673_HUMAN;.	H	12	ENSP00000345797:D12H;ENSP00000353113:D12H;ENSP00000298190:D12H;ENSP00000367152:D12H;ENSP00000418205:D12H;ENSP00000418146:D12H;ENSP00000418076:D12H	ENSP00000298190:D12H	D	+	1	0	ZNF673	46207145	1.000000	0.71417	0.017000	0.16124	0.880000	0.50808	2.625000	0.46452	0.157000	0.19338	0.513000	0.50165	GAC		0.547	KRBOX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056359.2	NM_017776		8	34	0	0	0	0.00308	0	8	34				
PORCN	64840	broad.mit.edu	37	X	48369726	48369726	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:48369726G>A	ENST00000326194.6	+	2	223	c.180G>A	c.(178-180)ggG>ggA	p.G60G	PORCN_ENST00000361988.3_Silent_p.G60G|PORCN_ENST00000367574.4_Intron|PORCN_ENST00000359882.4_Silent_p.G60G|PORCN_ENST00000355961.4_Silent_p.G60G|PORCN_ENST00000537758.1_Silent_p.G60G|AF196972.9_ENST00000445586.1_RNA|PORCN_ENST00000486272.1_3'UTR|PORCN_ENST00000355092.3_Silent_p.G60G	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	60	Leu-rich.		G -> R (in FODH). {ECO:0000269|PubMed:17546030}.		glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGGCAGGCGGGTTCTTCAGCC	0.552											OREG0019764	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010nie.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(178-180)GGG>GGA		porcupine isoform D							166.0	131.0	143.0					X																	48369726		2203	4300	6503	SO:0001819	synonymous_variant	64840				Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity	g.chrX:48369726G>A	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.180G>A	X.37:g.48369726G>A			OREG0019764	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	954	PORCN_uc004djq.1_Silent_p.G173G|PORCN_uc004djr.1_Silent_p.G60G|PORCN_uc004djs.1_Silent_p.G60G|PORCN_uc004djt.1_Intron|PORCN_uc011mlx.1_Intron|PORCN_uc004dju.1_Intron|PORCN_uc004djv.1_Silent_p.G60G|PORCN_uc004djw.1_Silent_p.G60G	p.G60G	NM_203475	NP_982301	Q9H237	PORCN_HUMAN			3	338	+			60		G -> R (in FODH).	Extracellular (Potential).|Leu-rich.		B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Silent	SNP	ENST00000326194.6	37	c.180G>A	CCDS14299.1																																																																																				0.552	PORCN-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356990.1	NM_022825		14	98	0	0	0	0.006122	0	14	98				
WNK3	65267	broad.mit.edu	37	X	54275171	54275171	+	Silent	SNP	G	G	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:54275171G>A	ENST00000375159.2	-	16	3609	c.3610C>T	c.(3610-3612)Ctg>Ttg	p.L1204L	WNK3_ENST00000375169.3_Silent_p.L1204L|WNK3_ENST00000354646.2_Silent_p.L1204L			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1204					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						ATCACATTCAGGTCCCTTTTG	0.393																																							uc004dtd.1		NA																	0				lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						c.(3610-3612)CTG>TTG		WNK lysine deficient protein kinase 3 isoform 2							67.0	59.0	62.0					X																	54275171		2203	4300	6503	SO:0001819	synonymous_variant	65267				intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity	g.chrX:54275171G>A	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.3610C>T	X.37:g.54275171G>A						WNK3_uc004dtc.1_Silent_p.L1204L	p.L1204L	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN			17	4049	-			1204					B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Silent	SNP	ENST00000375159.2	37	c.3610C>T	CCDS14357.1																																																																																				0.393	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922		8	36	0	0	0	0.00308	0	8	36				
ITIH6	347365	broad.mit.edu	37	X	54784218	54784218	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:54784218C>T	ENST00000218436.6	-	8	2318	c.2289G>A	c.(2287-2289)gtG>gtA	p.V763V		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	763	Pro-rich.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										TGCCAGGTTTCACAGGTGGGA	0.532																																							uc004dtj.2		NA																	0				lung(2)|skin(2)|ovary(1)|breast(1)	6						c.(2287-2289)GTG>GTA		inter-alpha (globulin) inhibitor H5-like							110.0	102.0	105.0					X																	54784218		2203	4300	6503	SO:0001819	synonymous_variant	347365				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chrX:54784218C>T	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.2289G>A	X.37:g.54784218C>T							p.V763V	NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN			8	2319	-			763			Pro-rich.		A6NN03	Silent	SNP	ENST00000218436.6	37	c.2289G>A	CCDS14361.1																																																																																				0.532	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		6	75	0	0	0	0.001168	0	6	75				
APEX2	27301	broad.mit.edu	37	X	55033290	55033290	+	Missense_Mutation	SNP	C	C	A	rs138407648	byFrequency	TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:55033290C>A	ENST00000374987.3	+	6	1045	c.979C>A	c.(979-981)Cgc>Agc	p.R327S	ALAS2_ENST00000498636.1_5'Flank	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	327					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						TCTGTGCACCCGCTTCCTCCC	0.572								Other BER factors																															uc004dtz.2		NA																	0				breast(1)	1						c.(979-981)CGC>AGC	Other_BER_factors	apurinic/apyrimidinic endonuclease 2							54.0	46.0	49.0					X																	55033290		2203	4300	6503	SO:0001583	missense	27301				cell cycle|DNA recombination|DNA repair	nucleus	DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|endonuclease activity|exonuclease activity|zinc ion binding	g.chrX:55033290C>A	AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.979C>A	X.37:g.55033290C>A	ENSP00000364126:p.Arg327Ser					APEX2_uc011mom.1_Missense_Mutation_p.R156S	p.R327S	NM_014481	NP_055296	Q9UBZ4	APEX2_HUMAN			6	1055	+			327					Q9Y5X7	Missense_Mutation	SNP	ENST00000374987.3	37	c.979C>A	CCDS14365.1	.	.	.	.	.	.	.	.	.	.	C	14.12	2.439384	0.43326	.	.	ENSG00000169188	ENST00000374987	T	0.63255	-0.03	4.59	0.481	0.16809	.	0.503696	0.21411	N	0.074978	T	0.53384	0.1793	M	0.62723	1.935	0.43187	D	0.995011	B	0.30937	0.301	B	0.34038	0.174	T	0.49716	-0.8910	10	0.72032	D	0.01	-2.751	3.9963	0.09559	0.2452:0.4727:0.0:0.2821	.	327	Q9UBZ4	APEX2_HUMAN	S	327	ENSP00000364126:R327S	ENSP00000364126:R327S	R	+	1	0	APEX2	55050015	1.000000	0.71417	0.436000	0.26797	0.852000	0.48524	1.235000	0.32671	0.127000	0.18452	0.600000	0.82982	CGC		0.572	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056845.1			3	34	1	0	0.004672	0.004672	0.00517176	3	34				
USP51	158880	broad.mit.edu	37	X	55514457	55514457	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:55514457C>A	ENST00000500968.3	-	2	998	c.916G>T	c.(916-918)Gaa>Taa	p.E306*	USP51_ENST00000586165.1_Intron	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	306					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						AAAATTTTTTCTTTTGTTTCT	0.343																																							uc004dun.1		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(916-918)GAA>TAA		ubiquitin specific protease 51							70.0	69.0	69.0					X																	55514457		2203	4300	6503	SO:0001587	stop_gained	158880				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding	g.chrX:55514457C>A	BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.916G>T	X.37:g.55514457C>A	ENSP00000423333:p.Glu306*					USP51_uc011moo.1_Intron	p.E306*	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN			2	995	-			306					Q8IWJ8	Nonsense_Mutation	SNP	ENST00000500968.3	37	c.916G>T	CCDS14370.1	.	.	.	.	.	.	.	.	.	.	.	27.0	4.789594	0.90367	.	.	ENSG00000247746	ENST00000500968	.	.	.	3.19	2.32	0.28847	.	0.380615	0.28062	U	0.016755	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	3.8302	0.08871	0.0:0.6012:0.2516:0.1471	.	.	.	.	X	306	.	ENSP00000423333:E306X	E	-	1	0	USP51	55531182	1.000000	0.71417	0.953000	0.39169	0.973000	0.67179	2.525000	0.45598	0.738000	0.32606	0.508000	0.49915	GAA		0.343	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056871.2	NM_201286		4	72	1	0	0.00024832	0.009096	0.000291915	4	72				
PJA1	64219	broad.mit.edu	37	X	68382632	68382632	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:68382632C>A	ENST00000361478.1	-	2	827	c.450G>T	c.(448-450)aaG>aaT	p.K150N	PJA1_ENST00000477231.1_5'UTR|PJA1_ENST00000374571.4_Missense_Mutation_p.K95N|PJA1_ENST00000374583.1_Missense_Mutation_p.K150N|PJA1_ENST00000374584.3_Intron	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	150					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						GGTCATACAGCTTATCATCTT	0.512																																							uc004dxh.2		NA																	0					0						c.(448-450)AAG>AAT		praja 1 isoform a							51.0	43.0	46.0					X																	68382632		2203	4300	6503	SO:0001583	missense	64219						zinc ion binding	g.chrX:68382632C>A	AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.450G>T	X.37:g.68382632C>A	ENSP00000355014:p.Lys150Asn					PJA1_uc011mpi.1_5'UTR|PJA1_uc004dxg.2_Intron|PJA1_uc004dxi.2_Missense_Mutation_p.K95N	p.K150N	NM_145119	NP_660095	Q8NG27	PJA1_HUMAN			2	736	-			150					A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	ENST00000361478.1	37	c.450G>T	CCDS14393.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.774867	0.31411	.	.	ENSG00000181191	ENST00000396010;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T	0.14516	2.5;2.5;2.5	2.91	1.98	0.26296	.	0.462912	0.16997	U	0.191068	T	0.09247	0.0228	L	0.36672	1.1	0.20074	N	0.999937	B	0.12013	0.005	B	0.08055	0.003	T	0.25779	-1.0122	10	0.54805	T	0.06	.	3.0166	0.06061	0.2727:0.5759:0.0:0.1514	.	150	Q8NG27	PJA1_HUMAN	N	95;150;150;95	ENSP00000363711:K150N;ENSP00000355014:K150N;ENSP00000363699:K95N	ENSP00000355014:K150N	K	-	3	2	PJA1	68299357	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	1.060000	0.30530	0.616000	0.30141	0.464000	0.42555	AAG		0.512	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119		8	18	1	0	0.000157383	0.00308	0.000188254	8	18				
PHKA1	5255	broad.mit.edu	37	X	71856209	71856210	+	Nonsense_Mutation	DNP	CC	CC	TA			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:71856209_71856210CC>TA	ENST00000373542.4	-	15	1645_1646	c.1486_1487GG>TA	c.(1486-1488)GGa>TAa	p.G496*	PHKA1_ENST00000373539.3_Nonsense_Mutation_p.G496*|PHKA1_ENST00000541944.1_Nonsense_Mutation_p.G496*|PHKA1_ENST00000339490.3_Nonsense_Mutation_p.G496*|PHKA1_ENST00000373545.3_Nonsense_Mutation_p.G496*	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	496					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GTAGGGTCGTCCACTGAGTTTC	0.361																																							uc004eax.3		NA																	0				ovary(3)|skin(1)	4						c.(1486-1488)GGA>TAA		phosphorylase kinase, alpha 1 (muscle) isoform																																				SO:0001587	stop_gained	5255				glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:71856209_71856210CC>TA		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1486_1487delinsTA	X.37:g.71856209_71856210delinsTA	ENSP00000362643:p.Gly496*					PHKA1_uc004eay.3_Nonsense_Mutation_p.G496*|PHKA1_uc011mqi.1_Nonsense_Mutation_p.G496*	p.G496*	NM_002637	NP_002628	P46020	KPB1_HUMAN			15	1787_1788	-	Renal(35;0.156)		496					B7ZL05|B7ZL07|Q2M3D7	Nonsense_Mutation	DNP	ENST00000373542.4	37	c.1486_1487GG>TA	CCDS14421.1																																																																																				0.361	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1			13	70	0	0	0	0.004672	0	13	70				
FAM46D	169966	broad.mit.edu	37	X	79698805	79698805	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:79698805A>G	ENST00000308293.5	+	3	1006	c.767A>G	c.(766-768)aAa>aGa	p.K256R	FAM46D_ENST00000538312.1_Missense_Mutation_p.K256R	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	256										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						TCAGAAATCAAAAACCTAGAA	0.388																																							uc004edl.1		NA																	0				lung(2)	2						c.(766-768)AAA>AGA		hypothetical protein LOC169966							53.0	44.0	47.0					X																	79698805		2202	4297	6499	SO:0001583	missense	169966							g.chrX:79698805A>G	BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.767A>G	X.37:g.79698805A>G	ENSP00000308575:p.Lys256Arg					FAM46D_uc004edm.1_Missense_Mutation_p.K256R	p.K256R	NM_152630	NP_689843	Q8NEK8	FA46D_HUMAN			5	1101	+			256					B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	ENST00000308293.5	37	c.767A>G	CCDS14446.1	.	.	.	.	.	.	.	.	.	.	A	10.35	1.326791	0.24080	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.25414	1.8;1.8	4.57	4.57	0.56435	Domain of unknown function DUF1693 (1);	0.000000	0.45867	U	0.000335	T	0.43211	0.1237	L	0.58810	1.83	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	T	0.20571	-1.0271	10	0.21540	T	0.41	-9.456	11.9379	0.52884	1.0:0.0:0.0:0.0	.	256	Q8NEK8	FA46D_HUMAN	R	256	ENSP00000443410:K256R;ENSP00000308575:K256R	ENSP00000308575:K256R	K	+	2	0	FAM46D	79585461	1.000000	0.71417	0.941000	0.38009	0.009000	0.06853	8.411000	0.90229	1.692000	0.51112	0.472000	0.43445	AAA		0.388	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630		4	49	0	0	0	0.009096	0	4	49				
ZNF711	7552	broad.mit.edu	37	X	84510461	84510461	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:84510461G>T	ENST00000373165.3	+	4	582	c.276G>T	c.(274-276)gcG>gcT	p.A92A	ZNF711_ENST00000276123.3_Silent_p.A92A|ZNF711_ENST00000360700.4_Silent_p.A92A|ZNF711_ENST00000395402.1_Silent_p.A70A|ZNF711_ENST00000542798.1_5'Flank	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	92					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						TTCCTGAAGCGGTACTTGAAG	0.433																																							uc004eeo.2		NA																	0				ovary(3)|skin(1)	4						c.(274-276)GCG>GCT		zinc finger protein 711							285.0	237.0	253.0					X																	84510461		2203	4300	6503	SO:0001819	synonymous_variant	7552				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding	g.chrX:84510461G>T	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.276G>T	X.37:g.84510461G>T						ZNF711_uc004eep.2_Silent_p.A92A|ZNF711_uc004eeq.2_Silent_p.A92A	p.A92A	NM_021998	NP_068838	Q9Y462	ZN711_HUMAN			4	623	+			92					B4DSV4|Q6NX42|Q9Y4J6	Silent	SNP	ENST00000373165.3	37	c.276G>T	CCDS35344.1																																																																																				0.433	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998		48	126	1	0	1.00953e-15	0.003214	1.88906e-15	48	126				
PABPC5	140886	broad.mit.edu	37	X	90691151	90691151	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:90691151C>A	ENST00000312600.3	+	2	789	c.575C>A	c.(574-576)aCc>aAc	p.T192N	PABPC5_ENST00000373105.1_Missense_Mutation_p.T28N|PABPC5-AS1_ENST00000456187.1_RNA	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	192						mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						GAGGTCAGAACCAGGGATAGA	0.463																																							uc004efg.2		NA																	0				ovary(1)|lung(1)|pancreas(1)	3						c.(574-576)ACC>AAC		poly(A) binding protein, cytoplasmic 5							37.0	37.0	37.0					X																	90691151		2203	4300	6503	SO:0001583	missense	140886					cytoplasm	nucleotide binding|RNA binding	g.chrX:90691151C>A	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.575C>A	X.37:g.90691151C>A	ENSP00000308012:p.Thr192Asn					PABPC5_uc004eff.1_Missense_Mutation_p.T28N	p.T192N	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN			2	1015	+			192					A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	ENST00000312600.3	37	c.575C>A	CCDS14460.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.831138	0.32329	.	.	ENSG00000174740	ENST00000373105;ENST00000312600;ENST00000402906	T;D	0.85773	2.08;-2.03	4.53	4.53	0.55603	Nucleotide-binding, alpha-beta plait (1);	0.053052	0.85682	D	0.000000	T	0.70219	0.3199	N	0.04686	-0.185	0.46874	D	0.999237	B	0.19445	0.036	B	0.10450	0.005	T	0.66674	-0.5864	10	0.33141	T	0.24	.	14.0714	0.64863	0.0:1.0:0.0:0.0	.	192	Q96DU9	PABP5_HUMAN	N	28;192;160	ENSP00000362197:T28N;ENSP00000308012:T192N	ENSP00000308012:T192N	T	+	2	0	PABPC5	90577807	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.331000	0.79192	2.495000	0.84180	0.600000	0.82982	ACC		0.463	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832		15	48	1	0	6.31663e-08	0.003163	9.19884e-08	15	48				
PCDH11X	27328	broad.mit.edu	37	X	91873442	91873442	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:91873442C>A	ENST00000373094.1	+	7	4392	c.3547C>A	c.(3547-3549)Cag>Aag	p.Q1183K	PCDH11X_ENST00000406881.1_Missense_Mutation_p.Q1175K|PCDH11X_ENST00000298274.8_Missense_Mutation_p.Q1146K|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000361655.2_Missense_Mutation_p.Q1165K|PCDH11X_ENST00000373097.1_Missense_Mutation_p.Q1173K|PCDH11X_ENST00000373088.1_Missense_Mutation_p.Q1146K	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1183					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GGCCTCTACTCAGCACCACAG	0.587																																					NSCLC(38;925 1092 2571 38200 45895)	NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	0				large_intestine(2)	2						c.(3547-3549)CAG>AAG		protocadherin 11 X-linked isoform c							204.0	158.0	173.0					X																	91873442		2203	4300	6503	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91873442C>A	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3547C>A	X.37:g.91873442C>A	ENSP00000362186:p.Gln1183Lys					PCDH11X_uc004efl.1_Missense_Mutation_p.Q1173K|PCDH11X_uc004efo.1_Missense_Mutation_p.Q1146K|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Missense_Mutation_p.Q1175K|PCDH11X_uc004efn.1_Missense_Mutation_p.Q1165K	p.Q1183K	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN			7	4392	+			1183			Cytoplasmic (Potential).		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.3547C>A	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	8.539	0.872755	0.17322	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.50548	0.74;0.76;0.75;0.74;0.76;0.75	4.12	2.35	0.29111	.	.	.	.	.	T	0.23649	0.0572	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	T	0.28332	-1.0047	9	0.02654	T	1	.	7.1291	0.25490	0.0:0.7692:0.0:0.2308	.	1146;1165;1175;1173;1183	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	K	1183;1173;1146;1165;1175;1183;1146	ENSP00000362186:Q1183K;ENSP00000362189:Q1173K;ENSP00000362180:Q1146K;ENSP00000355105:Q1165K;ENSP00000384758:Q1175K;ENSP00000298274:Q1146K	ENSP00000298274:Q1146K	Q	+	1	0	PCDH11X	91760098	0.008000	0.16893	0.001000	0.08648	0.010000	0.07245	1.339000	0.33885	0.258000	0.21686	0.370000	0.22315	CAG		0.587	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		26	73	1	0	3.01185e-09	0.003954	4.65406e-09	26	73				
CENPI	2491	broad.mit.edu	37	X	100381698	100381698	+	Splice_Site	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:100381698G>T	ENST00000372927.1	+	8	965	c.688G>T	c.(688-690)Gga>Tga	p.G230*	CENPI_ENST00000423383.1_Splice_Site_p.G230*|CENPI_ENST00000372926.1_Splice_Site_p.G230*|CENPI_ENST00000218507.5_Splice_Site_p.G230*	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	230					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)				breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30						TTTATTTCAGGGAATGCAGCC	0.353																																							uc004egx.2		NA																	0				skin(1)	1						c.(688-690)GGA>TGA		centromere protein I							260.0	255.0	257.0					X																	100381698		2203	4300	6503	SO:0001630	splice_region_variant	2491				CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding	g.chrX:100381698G>T	X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384			3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1		16622420	Standard	NM_006733		Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	ENST00000372927.1:c.688-1G>T	X.37:g.100381698G>T						CENPI_uc011mrg.1_Nonsense_Mutation_p.G230*|CENPI_uc004egy.2_Nonsense_Mutation_p.G230*	p.G230*	NM_006733	NP_006724	Q92674	CENPI_HUMAN			8	958	+			230					Q5JWZ9|Q96ED0	Nonsense_Mutation	SNP	ENST00000372927.1	37	c.688G>T	CCDS14479.1	.	.	.	.	.	.	.	.	.	.	g	40	8.168091	0.98686	.	.	ENSG00000102384	ENST00000423383;ENST00000218507;ENST00000372926;ENST00000372927	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.1797	18.9446	0.92616	0.0:0.0:1.0:0.0	.	.	.	.	X	230	.	.	G	+	1	0	CENPI	100268354	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.013000	0.70776	2.508000	0.84585	0.600000	0.82982	GGA		0.353	CENPI-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057519.1	NM_006733	Nonsense_Mutation	10	398	1	0	7.48243e-07	0.006214	1.03872e-06	10	398				
NXF3	56000	broad.mit.edu	37	X	102333559	102333559	+	Splice_Site	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:102333559C>A	ENST00000395065.3	-	17	1481	c.1380G>T	c.(1378-1380)gtG>gtT	p.V460V	NXF3_ENST00000425644.1_Splice_Site_p.V132V	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	460	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						ACTGTCCTTCCACTTCAAAGA	0.517																																							uc004eju.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(1378-1380)GTG>GTT		nuclear RNA export factor 3							286.0	228.0	248.0					X																	102333559		2203	4300	6503	SO:0001630	splice_region_variant	56000					cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|protein binding	g.chrX:102333559C>A	AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.1379-1G>T	X.37:g.102333559C>A						NXF3_uc010noi.1_Intron	p.V460V	NM_022052	NP_071335	Q9H4D5	NXF3_HUMAN			17	1451	-			460			NTF2.		B4DYS7|Q5H9I1|Q9H1A9	Silent	SNP	ENST00000395065.3	37	c.1380G>T	CCDS14503.1																																																																																				0.517	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052	Silent	7	186	1	0	0.00448238	0.004482	0.00499424	7	186				
GLRA4	441509	broad.mit.edu	37	X	102979084	102979084	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:102979084C>A	ENST00000372617.4	-	4	836	c.416G>T	c.(415-417)gGg>gTg	p.G139V	GLRA4_ENST00000469567.1_5'Flank	NM_001024452.2	NP_001019623.2	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4	139						cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			cervix(1)|endometrium(2)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GAAGTTGGCCCCTTTCTCATT	0.527																																							uc011mse.1		NA																	0					0						c.(415-417)GGG>GTG		glycine receptor, alpha 4 precursor							177.0	173.0	175.0					X																	102979084		2138	4270	6408	SO:0001583	missense	441509					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity	g.chrX:102979084C>A	Z93848	CCDS43980.2	Xq22.2	2012-01-16			ENSG00000188828	ENSG00000188828		"""Ligand-gated ion channels / Glycine receptors"""	31715	protein-coding gene	gene with protein product							Standard	NM_001024452		Approved		uc011mse.2	Q5JXX5	OTTHUMG00000022110	ENST00000372617.4:c.416G>T	X.37:g.102979084C>A	ENSP00000361700:p.Gly139Val					GLRA4_uc010nou.2_Missense_Mutation_p.G139V	p.G139V	NM_001024452	NP_001019623	Q5JXX5	GLRA4_HUMAN			4	837	-			139			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000372617.4	37	c.416G>T	CCDS43980.2	.	.	.	.	.	.	.	.	.	.	C	19.47	3.834209	0.71373	.	.	ENSG00000188828	ENST00000372617	T	0.77877	-1.13	5.07	5.07	0.68467	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.77315	0.4112	L	0.38175	1.15	0.80722	D	1	P;P	0.51791	0.948;0.789	P;B	0.51297	0.665;0.411	T	0.79806	-0.1648	10	0.59425	D	0.04	.	14.8042	0.69938	0.0:1.0:0.0:0.0	.	139;98	Q5JXX5;B9WSA6	GLRA4_HUMAN;.	V	139	ENSP00000361700:G139V	ENSP00000361700:G139V	G	-	2	0	GLRA4	102865740	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.818000	0.86416	2.077000	0.62373	0.513000	0.50165	GGG		0.527	GLRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057742.2	NM_001024452		54	128	1	0	1.4374e-25	0.00361	2.96599e-25	54	128				
CXorf57	55086	broad.mit.edu	37	X	105905439	105905439	+	Nonsense_Mutation	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:105905439C>T	ENST00000372548.4	+	12	2282	c.2173C>T	c.(2173-2175)Cag>Tag	p.Q725*	CXorf57_ENST00000497124.1_3'UTR|CXorf57_ENST00000372544.2_Nonsense_Mutation_p.Q628*	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	725							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						GTATAATTCTCAGCCTGCGAA	0.403																																							uc004emi.3		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(2173-2175)CAG>TAG		hypothetical protein LOC55086							78.0	74.0	75.0					X																	105905439		2203	4300	6503	SO:0001587	stop_gained	55086							g.chrX:105905439C>T	AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.2173C>T	X.37:g.105905439C>T	ENSP00000361628:p.Gln725*					CXorf57_uc004emj.3_Nonsense_Mutation_p.Q628*	p.Q725*	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN			12	2324	+			725					H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Nonsense_Mutation	SNP	ENST00000372548.4	37	c.2173C>T	CCDS14519.1	.	.	.	.	.	.	.	.	.	.	C	38	7.167091	0.98107	.	.	ENSG00000147231	ENST00000372544;ENST00000372548;ENST00000421550	.	.	.	4.93	4.93	0.64822	.	0.284452	0.39615	N	0.001312	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-4.9429	15.1476	0.72671	0.0:1.0:0.0:0.0	.	.	.	.	X	628;725;436	.	ENSP00000361623:Q628X	Q	+	1	0	CXorf57	105792095	1.000000	0.71417	0.996000	0.52242	0.685000	0.39939	2.577000	0.46042	2.384000	0.81235	0.594000	0.82650	CAG		0.403	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057800.2	NM_018015		20	74	0	0	0	0.008871	0	20	74				
RBM41	55285	broad.mit.edu	37	X	106331911	106331911	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:106331911C>G	ENST00000372479.3	-	5	712	c.682G>C	c.(682-684)Ggc>Cgc	p.G228R	RBM41_ENST00000372487.1_Missense_Mutation_p.G228R|RBM41_ENST00000203616.8_Intron	NM_018301.3	NP_060771.3	Q96IZ5	RBM41_HUMAN	RNA binding motif protein 41	228							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	13						TCAGCTGTGCCACTATCACCC	0.463																																							uc004emz.2		NA																	0				ovary(1)	1						c.(682-684)GGC>CGC		RNA binding motif protein 41							98.0	80.0	86.0					X																	106331911		2203	4300	6503	SO:0001583	missense	55285						nucleotide binding|RNA binding	g.chrX:106331911C>G	BC006986	CCDS14526.1, CCDS55472.1	Xq22.3	2013-02-12			ENSG00000089682	ENSG00000089682		"""RNA binding motif (RRM) containing"""	25617	protein-coding gene	gene with protein product						12477932	Standard	NM_001171080		Approved	FLJ11016	uc004emz.3	Q96IZ5	OTTHUMG00000022156	ENST00000372479.3:c.682G>C	X.37:g.106331911C>G	ENSP00000361557:p.Gly228Arg					RBM41_uc004emy.1_Missense_Mutation_p.G228R	p.G228R	NM_018301	NP_060771	Q96IZ5	RBM41_HUMAN			5	713	-			228					Q5JSN7|Q5JSN8|Q9H8F7|Q9NV04	Missense_Mutation	SNP	ENST00000372479.3	37	c.682G>C	CCDS14526.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.418625	0.25552	.	.	ENSG00000089682	ENST00000372487;ENST00000372479	T;T	0.23147	1.92;1.97	6.17	4.37	0.52481	.	0.634783	0.16386	N	0.216691	T	0.15046	0.0363	N	0.14661	0.345	0.80722	D	1	B	0.27380	0.177	B	0.28553	0.091	T	0.07271	-1.0781	10	0.49607	T	0.09	.	7.224	0.26005	0.1775:0.7335:0.0:0.089	.	228	Q96IZ5	RBM41_HUMAN	R	228	ENSP00000361565:G228R;ENSP00000361557:G228R	ENSP00000361557:G228R	G	-	1	0	RBM41	106218567	0.934000	0.31675	0.992000	0.48379	0.882000	0.50991	1.381000	0.34362	1.308000	0.44962	0.600000	0.82982	GGC		0.463	RBM41-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057819.1	NM_018301		15	57	0	0	0	0.00499	0	15	57				
GUCY2F	2986	broad.mit.edu	37	X	108684624	108684624	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:108684624G>T	ENST00000218006.2	-	7	1948	c.1657C>A	c.(1657-1659)Cta>Ata	p.L553I		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	553	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						GCTGGAGTTAGACTCCCTGAA	0.438																																							uc004eod.3		NA																	0				lung(4)|breast(3)|central_nervous_system(1)	8						c.(1657-1659)CTA>ATA		guanylate cyclase 2F precursor							177.0	178.0	178.0					X																	108684624		2203	4300	6503	SO:0001583	missense	2986				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity	g.chrX:108684624G>T	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.1657C>A	X.37:g.108684624G>T	ENSP00000218006:p.Leu553Ile					GUCY2F_uc011msq.1_RNA	p.L553I	NM_001522	NP_001513	P51841	GUC2F_HUMAN			7	1933	-			553			Protein kinase.|Cytoplasmic (Potential).		Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	37	c.1657C>A	CCDS14545.1	.	.	.	.	.	.	.	.	.	.	G	9.382	1.073166	0.20147	.	.	ENSG00000101890	ENST00000218006	T	0.79247	-1.25	3.83	2.95	0.34219	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.163866	0.40554	N	0.001061	T	0.50446	0.1616	N	0.02736	-0.51	0.32039	N	0.598485	B	0.12630	0.006	B	0.13407	0.009	T	0.50180	-0.8858	10	0.19147	T	0.46	.	9.0646	0.36455	0.116:0.0:0.884:0.0	.	553	P51841	GUC2F_HUMAN	I	553	ENSP00000218006:L553I	ENSP00000218006:L553I	L	-	1	2	GUCY2F	108571280	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.824000	0.39072	0.947000	0.37659	0.600000	0.82982	CTA		0.438	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522		56	150	1	0	3.88204e-17	0.00361	7.40623e-17	56	150				
IL13RA1	3597	broad.mit.edu	37	X	117900509	117900509	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:117900509G>T	ENST00000371666.3	+	7	912	c.845G>T	c.(844-846)tGt>tTt	p.C282F	IL13RA1_ENST00000481868.1_3'UTR	NM_001560.2	NP_001551.1	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1	282	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin production (GO:0002639)	interleukin-13 receptor complex (GO:0005898)|plasma membrane (GO:0005886)	interleukin-13 receptor activity (GO:0016515)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	12						GAGGCTAAATGTGAGAATCCA	0.338																																							uc004eqs.2		NA																	0					0						c.(844-846)TGT>TTT		interleukin 13 receptor, alpha 1 precursor							79.0	76.0	77.0					X																	117900509		2203	4300	6503	SO:0001583	missense	3597					interleukin-13 receptor complex	cytokine receptor activity	g.chrX:117900509G>T	U62858	CCDS14573.1	Xq24	2008-02-05			ENSG00000131724	ENSG00000131724		"""Interleukins and interleukin receptors"", ""CD molecules"""	5974	protein-coding gene	gene with protein product	"""IL13 receptor alpha-1 chain"", ""CD213a1 antigen"""	300119				8910586, 9013879	Standard	NM_001560		Approved	IL-13Ra, NR4, CD213a1	uc004eqs.3	P78552	OTTHUMG00000022258	ENST00000371666.3:c.845G>T	X.37:g.117900509G>T	ENSP00000360730:p.Cys282Phe					IL13RA1_uc004eqt.1_Missense_Mutation_p.C282F	p.C282F	NM_001560	NP_001551	P78552	I13R1_HUMAN			7	888	+			282			Extracellular (Potential).		O95646|Q5JSL4|Q99656|Q9UDY5	Missense_Mutation	SNP	ENST00000371666.3	37	c.845G>T	CCDS14573.1	.	.	.	.	.	.	.	.	.	.	G	8.983	0.975768	0.18736	.	.	ENSG00000131724	ENST00000371666	D	0.90563	-2.69	4.78	3.87	0.44632	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.277740	0.04950	N	0.460106	D	0.93347	0.7879	L	0.60455	1.87	0.19300	N	0.999974	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.995	T	0.82016	-0.0666	10	0.09590	T	0.72	-20.8372	9.8822	0.41240	0.0:0.2016:0.7984:0.0	.	282;282	Q5JSL4;P78552	.;I13R1_HUMAN	F	282	ENSP00000360730:C282F	ENSP00000360730:C282F	C	+	2	0	IL13RA1	117784537	1.000000	0.71417	0.046000	0.18839	0.019000	0.09904	4.168000	0.58216	2.196000	0.70406	0.506000	0.49869	TGT		0.338	IL13RA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058009.1	NM_001560		5	109	1	0	1.23904e-05	0.000602	1.59673e-05	5	109				
DCAF12L2	340578	broad.mit.edu	37	X	125299247	125299247	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:125299247G>T	ENST00000360028.2	-	1	687	c.661C>A	c.(661-663)Cgg>Agg	p.R221R	DCAF12L2_ENST00000538699.1_Silent_p.R221R			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	221										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GGGTCCATCCGCCACAGAGCC	0.637																																							uc004euk.1		NA																	0		p.R221Q(1)		lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						c.(661-663)CGG>AGG		DDB1 and CUL4 associated factor 12-like 2							35.0	37.0	36.0					X																	125299247		2202	4296	6498	SO:0001819	synonymous_variant	340578							g.chrX:125299247G>T	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.661C>A	X.37:g.125299247G>T							p.R221R	NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN			1	688	-			221			WD 2.		B2RN42	Silent	SNP	ENST00000360028.2	37	c.661C>A	CCDS43991.1																																																																																				0.637	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		12	33	1	0	6.40141e-05	0.000978	7.90626e-05	12	33				
ARHGAP36	158763	broad.mit.edu	37	X	130218269	130218269	+	Silent	SNP	C	C	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:130218269C>T	ENST00000276211.5	+	5	981	c.636C>T	c.(634-636)tcC>tcT	p.S212S	ARHGAP36_ENST00000370922.1_Silent_p.S200S|ARHGAP36_ENST00000370921.1_Silent_p.S76S	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	212					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CAAAAATTTCCTTTCCAATTG	0.498																																							uc004evz.2		NA																	0				ovary(3)	3						c.(634-636)TCC>TCT		hypothetical protein LOC158763 precursor							43.0	42.0	42.0					X																	130218269		2203	4300	6503	SO:0001819	synonymous_variant	158763				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chrX:130218269C>T		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.636C>T	X.37:g.130218269C>T						ARHGAP36_uc004ewa.2_Silent_p.S200S|ARHGAP36_uc004ewb.2_Silent_p.S181S|ARHGAP36_uc004ewc.2_Silent_p.S76S	p.S212S	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN			5	981	+			212					B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Silent	SNP	ENST00000276211.5	37	c.636C>T	CCDS14628.1																																																																																				0.498	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967		13	32	0	0	0	0.001855	0	13	32				
DDX26B	203522	broad.mit.edu	37	X	134713926	134713926	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:134713926G>T	ENST00000370752.4	+	15	2556	c.2222G>T	c.(2221-2223)gGa>gTa	p.G741V	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	741										large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					TTTGTAGGAGGAGCCAAAAAC	0.453																																							uc004eyw.3		NA																	0					0						c.(2221-2223)GGA>GTA		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide							91.0	80.0	84.0					X																	134713926		2203	4300	6503	SO:0001583	missense	203522							g.chrX:134713926G>T	AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.2222G>T	X.37:g.134713926G>T	ENSP00000359788:p.Gly741Val					DDX26B_uc004eyx.3_Missense_Mutation_p.G342V	p.G741V	NM_182540	NP_872346	Q5JSJ4	DX26B_HUMAN			15	2585	+	Acute lymphoblastic leukemia(192;6.56e-05)		741					Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	ENST00000370752.4	37	c.2222G>T	CCDS35401.1	.	.	.	.	.	.	.	.	.	.	G	5.491	0.275541	0.10403	.	.	ENSG00000165359	ENST00000370752	T	0.32753	1.44	5.51	0.613	0.17597	.	0.265832	0.33959	N	0.004385	T	0.27241	0.0668	M	0.71206	2.165	0.20489	N	0.999891	B;B	0.21753	0.06;0.04	B;B	0.22601	0.032;0.04	T	0.21895	-1.0232	10	0.29301	T	0.29	-0.4982	6.1465	0.20289	0.293:0.122:0.5851:0.0	.	741;741	B9EIK3;Q5JSJ4	.;DX26B_HUMAN	V	741	ENSP00000359788:G741V	ENSP00000359788:G741V	G	+	2	0	DDX26B	134541592	0.982000	0.34865	0.000000	0.03702	0.014000	0.08584	1.507000	0.35758	-0.239000	0.09710	0.600000	0.82982	GGA		0.453	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058420.1	NM_182540		13	48	1	0	0.00136819	0.001368	0.00156791	13	48				
MAGEA10	4109	broad.mit.edu	37	X	151303839	151303839	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:151303839T>A	ENST00000370323.4	-	4	570	c.254A>T	c.(253-255)cAg>cTg	p.Q85L	RP11-1007I13.4_ENST00000509345.2_RNA|MAGEA10_ENST00000244096.3_Missense_Mutation_p.Q85L	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	85						nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					CTGAGCACTCTGGGGAGGATT	0.547																																							uc004ffk.2		NA																	0					0						c.(253-255)CAG>CTG		melanoma antigen family A, 10							161.0	161.0	161.0					X																	151303839		2203	4300	6503	SO:0001583	missense	4109							g.chrX:151303839T>A		CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.254A>T	X.37:g.151303839T>A	ENSP00000359347:p.Gln85Leu					MAGEA10_uc004ffl.2_Missense_Mutation_p.Q85L	p.Q85L	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN			5	662	-	Acute lymphoblastic leukemia(192;6.56e-05)		85						Missense_Mutation	SNP	ENST00000370323.4	37	c.254A>T	CCDS14705.1	.	.	.	.	.	.	.	.	.	.	T	7.661	0.684848	0.14973	.	.	ENSG00000124260	ENST00000370323;ENST00000244096;ENST00000444834;ENST00000427322	T;T;T;T	0.08634	3.07;3.07;3.07;3.07	2.12	-0.932	0.10435	Melanoma associated antigen, MAGE, N-terminal (1);	1.964930	0.02547	N	0.095199	T	0.27731	0.0682	M	0.82323	2.585	0.09310	N	1	D	0.67145	0.996	D	0.72982	0.979	T	0.13899	-1.0492	10	0.87932	D	0	.	2.4741	0.04571	0.2725:0.0:0.2751:0.4524	.	85	P43363	MAGAA_HUMAN	L	85	ENSP00000359347:Q85L;ENSP00000244096:Q85L;ENSP00000406161:Q85L;ENSP00000391977:Q85L	ENSP00000244096:Q85L	Q	-	2	0	MAGEA10	151054495	0.000000	0.05858	0.000000	0.03702	0.415000	0.31203	-0.330000	0.07925	-0.276000	0.09206	0.242000	0.17961	CAG		0.547	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060916.3	NM_021048		48	162	0	0	0	0.00361	0	48	162				
GABRQ	55879	broad.mit.edu	37	X	151819033	151819033	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:151819033G>T	ENST00000370306.2	+	7	911	c.891G>T	c.(889-891)agG>agT	p.R297S		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	297					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTGCAGCCAGGGTGACAATTG	0.438																																							uc004ffp.1		NA																	0				ovary(2)|pancreas(1)	3						c.(889-891)AGG>AGT		gamma-aminobutyric acid (GABA) receptor, theta							320.0	287.0	298.0					X																	151819033		2203	4300	6503	SO:0001583	missense	55879					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity	g.chrX:151819033G>T	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.891G>T	X.37:g.151819033G>T	ENSP00000359329:p.Arg297Ser						p.R297S	NM_018558	NP_061028	Q9UN88	GBRT_HUMAN			7	911	+	Acute lymphoblastic leukemia(192;6.56e-05)		297					A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	c.891G>T	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398700	0.62177	.	.	ENSG00000147402	ENST00000370306	D	0.90069	-2.61	6.08	3.36	0.38483	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.64402	D	0.000019	D	0.94522	0.8236	M	0.92738	3.34	0.39915	D	0.974082	D	0.89917	1.0	D	0.91635	0.999	D	0.93383	0.6745	10	0.87932	D	0	.	6.5502	0.22429	0.3654:0.0:0.6346:0.0	.	297	Q9UN88	GBRT_HUMAN	S	297	ENSP00000359329:R297S	ENSP00000359329:R297S	R	+	3	2	GABRQ	151569689	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	1.145000	0.31577	0.681000	0.31386	0.600000	0.82982	AGG		0.438	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558		73	249	1	0	2.13431e-38	0.00361	4.61307e-38	73	249				
MAGEA12	4111	broad.mit.edu	37	X	151900060	151900061	+	Missense_Mutation	DNP	GG	GG	CA			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:151900060_151900061GG>CA	ENST00000357916.4	-	2	895_896	c.740_741CC>TG	c.(739-741)aCC>aTG	p.T247M	CSAG4_ENST00000361201.4_RNA|MAGEA12_ENST00000393900.3_Missense_Mutation_p.T247M|MAGEA12_ENST00000393869.3_Missense_Mutation_p.T247M	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	247	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					CCAAATCTTGGGTGAGCAGCTT	0.574																																							uc010ntp.2		NA																	0				skin(1)	1						c.(739-741)ACC>ATG		melanoma antigen family A, 12																																				SO:0001583	missense	4111							g.chrX:151900060_151900061GG>CA		CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.740_741delinsCA	X.37:g.151900060_151900061delinsCA	ENSP00000350592:p.Thr247Met					MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Missense_Mutation_p.T247M	p.T247M	NM_005367	NP_005358	P43365	MAGAC_HUMAN			3	1094_1095	-	Acute lymphoblastic leukemia(192;6.56e-05)		247			MAGE.		Q9NSD3	Missense_Mutation	DNP	ENST00000357916.4	37	c.740_741CC>TG	CCDS14710.1																																																																																				0.574	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058764.1	NM_005367		52	192	0	0	0	0.004672	0	52	192				
SRPK3	26576	broad.mit.edu	37	X	153049525	153049525	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:153049525C>A	ENST00000370101.3	+	10	1050	c.1004C>A	c.(1003-1005)tCc>tAc	p.S335Y	SRPK3_ENST00000393786.3_Intron|SRPK3_ENST00000489426.1_Missense_Mutation_p.S402Y|SRPK3_ENST00000370100.1_Intron|SRPK3_ENST00000370108.3_Intron|SRPK3_ENST00000370104.1_Missense_Mutation_p.S334Y	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	Q9UPE1	SRPK3_HUMAN	SRSF protein kinase 3	335	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|muscle tissue development (GO:0060537)|skeletal muscle tissue development (GO:0007519)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(2)|pancreas(2)|urinary_tract(1)	13	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCTCTTCCTCCCCCGCCCCA	0.697																																					Esophageal Squamous(167;766 3400 32156)	Esophageal Squamous(167;766 3400 32156)	uc004fil.2		NA																	0				pancreas(2)|lung(1)	3						c.(1003-1005)TCC>TAC		serine arginine rich protein-specific kinase 3							20.0	23.0	22.0					X																	153049525		2190	4289	6479	SO:0001583	missense	26576				cell differentiation|muscle organ development|muscle tissue development		ATP binding|protein serine/threonine kinase activity	g.chrX:153049525C>A	AF027406	CCDS35441.1, CCDS55537.1, CCDS55538.1	Xq28	2010-06-23	2010-06-23	2006-08-17	ENSG00000184343	ENSG00000184343			11402	protein-coding gene	gene with protein product			"""serine/threonine kinase 23"", ""SFRS protein kinase 3"""	STK23		16140986	Standard	NM_014370		Approved	MSSK1	uc004fil.3	Q9UPE1	OTTHUMG00000024207	ENST00000370101.3:c.1004C>A	X.37:g.153049525C>A	ENSP00000359119:p.Ser335Tyr					SRPK3_uc004fik.2_Missense_Mutation_p.S401Y|SRPK3_uc010nul.2_Intron|SRPK3_uc004fin.2_Missense_Mutation_p.S334Y|SRPK3_uc004fim.2_Intron	p.S335Y	NM_014370	NP_055185	Q9UPE1	SRPK3_HUMAN			10	1036	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		335			Protein kinase.		Q13583|Q4F970|Q562F5|Q9UM62	Missense_Mutation	SNP	ENST00000370101.3	37	c.1004C>A	CCDS35441.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.841968	0.32513	.	.	ENSG00000184343	ENST00000489426;ENST00000370104;ENST00000370101	T;T;T	0.57107	0.42;0.44;0.45	4.52	4.52	0.55395	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.492057	0.16912	N	0.194449	T	0.37348	0.1000	N	0.08118	0	0.80722	D	1	P;B;P	0.44090	0.471;0.34;0.826	B;B;B	0.44315	0.24;0.121;0.446	T	0.41592	-0.9500	10	0.72032	D	0.01	-17.4993	11.4915	0.50383	0.0:1.0:0.0:0.0	.	334;335;402	Q9UPE1-4;Q9UPE1;E7ETV6	.;SRPK3_HUMAN;.	Y	402;334;335	ENSP00000420058:S402Y;ENSP00000359122:S334Y;ENSP00000359119:S335Y	ENSP00000359119:S335Y	S	+	2	0	SRPK3	152702719	0.152000	0.22762	0.423000	0.26634	0.047000	0.14425	3.650000	0.54424	2.091000	0.63221	0.529000	0.55759	TCC		0.697	SRPK3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354501.1	NM_014370		11	27	1	0	0.000673444	0.008291	0.00078626	11	27				
CLIC2	1193	broad.mit.edu	37	X	154508456	154508456	+	Silent	SNP	G	G	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chrX:154508456G>T	ENST00000369449.2	-	5	782	c.564C>A	c.(562-564)ccC>ccA	p.P188P	CLIC2_ENST00000465553.1_5'UTR	NM_001289.4	NP_001280.3	O15247	CLIC2_HUMAN	chloride intracellular channel 2	188	C-terminal.|GST C-terminal.				chloride transmembrane transport (GO:1902476)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|oxidation-reduction process (GO:0055114)|positive regulation of binding (GO:0051099)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|signal transduction (GO:0007165)|transport (GO:0006810)	chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)|glutathione peroxidase activity (GO:0004602)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)	18	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGTTCAGCTTGGGTAACAAGC	0.478																																					Melanoma(108;581 1592 2289 21669 28822)	Melanoma(108;581 1592 2289 21669 28822)	uc004fnf.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(562-564)CCC>CCA		chloride intracellular channel 2							96.0	87.0	90.0					X																	154508456		2203	4300	6503	SO:0001819	synonymous_variant	1193				signal transduction	chloride channel complex|cytoplasm|nucleus	voltage-gated chloride channel activity	g.chrX:154508456G>T	AJ000217	CCDS14767.1	Xq28	2012-09-26			ENSG00000155962	ENSG00000155962		"""Ion channels / Chloride channels : Intracellular"""	2063	protein-coding gene	gene with protein product		300138				9339381	Standard	NM_001289		Approved	XAP121	uc004fnf.3	O15247	OTTHUMG00000022660	ENST00000369449.2:c.564C>A	X.37:g.154508456G>T						CLIC2_uc010nvj.1_Silent_p.P206P	p.P188P	NM_001289	NP_001280	O15247	CLIC2_HUMAN			5	814	-	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		188			GST C-terminal.|C-terminal.		A8K9S0|O15174|Q5JT80|Q8TCE3	Silent	SNP	ENST00000369449.2	37	c.564C>A	CCDS14767.1																																																																																				0.478	CLIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058793.1	NM_001289		6	133	1	0	0.00116845	0.001168	0.00134126	6	133				
ESPN	83715	broad.mit.edu	37	1	6520177	6520178	+	Frame_Shift_Ins	INS	-	-	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:6520177_6520178insT	ENST00000377828.1	+	13	2704_2705	c.2536_2537insT	c.(2536-2538)ctgfs	p.L846fs	ESPN_ENST00000416731.1_Frame_Shift_Ins_p.L280fs|ESPN_ENST00000461727.1_Frame_Shift_Ins_p.L280fs	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	846					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		ACAGGTCATCCTGAAGAAGGGG	0.668																																							uc001amy.2		NA																	0					0						c.(2536-2538)CTGfs		espin																																				SO:0001589	frameshift_variant	83715				sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding	g.chr1:6520177_6520178insT	AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.2537dupT	1.37:g.6520178_6520178dupT	ENSP00000367059:p.Leu846fs					ESPN_uc001amz.2_Frame_Shift_Ins_p.L280fs	p.L846fs	NM_031475	NP_113663	B1AK53	ESPN_HUMAN		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)	13	2704_2705	+	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)	846					Q6XYB2|Q9H0A2|Q9Y329	Frame_Shift_Ins	INS	ENST00000377828.1	37	c.2536_2537insT	CCDS70.1																																																																																				0.668	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001887.3	NM_031475		14	45	NA	NA	NA	NA	NA	14	45	---	---	---	---
MST1L	11223	broad.mit.edu	37	1	17086085	17086086	+	RNA	INS	-	-	C	rs200532237		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:17086085_17086086insC	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										GGCAAGGTACGCCGCGGTGGTG	0.649																																							uc010ock.1		NA																	0					0						c.(811-813)GCGfs		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17086085_17086086insC	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17086087_17086087dupC						CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	p.A271fs	NR_002729						7	811_812	-								B7WPB1|Q13209	Frame_Shift_Ins	INS	ENST00000455405.2	37	c.811_812insG																																																																																					0.649	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		3	6	NA	NA	NA	NA	NA	3	6	---	---	---	---
PHGDH	26227	broad.mit.edu	37	1	120279767	120279768	+	Frame_Shift_Ins	INS	-	-	A	rs150995624		TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:120279767_120279768insA	ENST00000369409.4	+	8	959_960	c.823_824insA	c.(823-825)catfs	p.H275fs	PHGDH_ENST00000369407.3_Frame_Shift_Ins_p.H241fs	NM_006623.3	NP_006614.2	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	275					brain development (GO:0007420)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|G1 to G0 transition (GO:0070314)|gamma-aminobutyric acid metabolic process (GO:0009448)|glial cell development (GO:0021782)|glutamine metabolic process (GO:0006541)|glycine metabolic process (GO:0006544)|L-serine biosynthetic process (GO:0006564)|neural tube development (GO:0021915)|neuron projection development (GO:0031175)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|taurine metabolic process (GO:0019530)|threonine metabolic process (GO:0006566)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|phosphoglycerate dehydrogenase activity (GO:0004617)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	18	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)		CTTGGTGGACCATGAGAATGTC	0.609																																							uc001ehz.2		NA																	0				ovary(1)	1						c.(823-825)CATfs		phosphoglycerate dehydrogenase	NADH(DB00157)																																			SO:0001589	frameshift_variant	26227				brain development|L-serine biosynthetic process		electron carrier activity|NAD binding|phosphoglycerate dehydrogenase activity	g.chr1:120279767_120279768insA	BC011262	CCDS904.1	1p12	2008-02-05			ENSG00000092621	ENSG00000092621	1.1.1.95		8923	protein-coding gene	gene with protein product		606879					Standard	NM_006623		Approved	SERA, PGDH, PDG	uc001ehz.3	O43175	OTTHUMG00000012100	ENST00000369409.4:c.824dupA	1.37:g.120279768_120279768dupA	ENSP00000358417:p.His275fs					PHGDH_uc009whm.2_Frame_Shift_Ins_p.H173fs|PHGDH_uc001eia.2_Frame_Shift_Ins_p.H275fs|PHGDH_uc009whn.2_Frame_Shift_Ins_p.H275fs|PHGDH_uc001eib.2_Frame_Shift_Ins_p.H241fs	p.H275fs	NM_006623	NP_006614	O43175	SERA_HUMAN		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)	8	1050_1051	+	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)	275					B2RD08|Q5SZU3|Q9BQ01	Frame_Shift_Ins	INS	ENST00000369409.4	37	c.823_824insA	CCDS904.1																																																																																				0.609	PHGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033464.1	NM_006623		16	42	NA	NA	NA	NA	NA	16	42	---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237993848	237993848	+	Frame_Shift_Del	DEL	G	G	-			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr1:237993848delG	ENST00000366574.2	+	103	14991	c.14674delG	c.(14674-14676)gggfs	p.G4892fs	RYR2_ENST00000360064.6_Frame_Shift_Del_p.G4898fs|RYR2_ENST00000542537.1_Frame_Shift_Del_p.G4876fs	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4892					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTCATCTGTGGGATAGGCAA	0.433																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(14674-14676)GGGfs		cardiac muscle ryanodine receptor							216.0	199.0	204.0					1																	237993848		1935	4153	6088	SO:0001589	frameshift_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237993848delG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14674delG	1.37:g.237993848delG	ENSP00000355533:p.Gly4892fs					RYR2_uc010pyb.1_Intron	p.G4892fs	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		103	14794	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4892					Q15411|Q546N8|Q5T3P2	Frame_Shift_Del	DEL	ENST00000366574.2	37	c.14674delG	CCDS55691.1																																																																																				0.433	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		27	121	NA	NA	NA	NA	NA	27	121	---	---	---	---
TRHDE	29953	broad.mit.edu	37	12	73014906	73014907	+	Frame_Shift_Ins	INS	-	-	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr12:73014906_73014907insT	ENST00000261180.4	+	14	2449_2450	c.2353_2354insT	c.(2353-2355)gttfs	p.V785fs		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	785					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TTTAAAGCAAGTTGCAACAACA	0.292																																							uc001sxa.2		NA																	0				ovary(2)|skin(1)	3						c.(2353-2355)GTTfs		thyrotropin-releasing hormone degrading enzyme																																				SO:0001589	frameshift_variant	29953				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr12:73014906_73014907insT	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2355dupT	12.37:g.73014908_73014908dupT	ENSP00000261180:p.Val785fs						p.V785fs	NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN			14	2383_2384	+			785			Extracellular (Potential).		A5PL19|Q6UWJ4	Frame_Shift_Ins	INS	ENST00000261180.4	37	c.2353_2354insT	CCDS9004.1																																																																																				0.292	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381		14	55	NA	NA	NA	NA	NA	14	55	---	---	---	---
POSTN	10631	broad.mit.edu	37	13	38158979	38158980	+	Frame_Shift_Ins	INS	-	-	A			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr13:38158979_38158980insA	ENST00000379747.4	-	8	1098_1099	c.981_982insT	c.(979-984)aatacafs	p.T328fs	POSTN_ENST00000379743.4_Frame_Shift_Ins_p.T328fs|POSTN_ENST00000541179.1_Frame_Shift_Ins_p.T328fs|POSTN_ENST00000541481.1_Frame_Shift_Ins_p.T328fs|POSTN_ENST00000379742.4_Frame_Shift_Ins_p.T328fs|POSTN_ENST00000379749.4_Frame_Shift_Ins_p.T328fs	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	328	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		ATCTCAATTGTATTTCCTTCCA	0.376																																							uc001uwo.3		NA																	0				ovary(2)	2						c.(979-984)AATACAfs		periostin, osteoblast specific factor isoform 1																																				SO:0001589	frameshift_variant	10631				cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding	g.chr13:38158979_38158980insA	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.982dupT	13.37:g.38158980_38158980dupA	ENSP00000369071:p.Thr328fs					POSTN_uc001uwp.3_Frame_Shift_Ins_p.N327fs|POSTN_uc001uwr.2_Frame_Shift_Ins_p.N327fs|POSTN_uc001uwq.2_Frame_Shift_Ins_p.N327fs|POSTN_uc010teu.1_Frame_Shift_Ins_p.N327fs|POSTN_uc010tev.1_Frame_Shift_Ins_p.N327fs|POSTN_uc010tew.1_Frame_Shift_Ins_p.N327fs|POSTN_uc010tex.1_Frame_Shift_Ins_p.N242fs	p.N327fs	NM_006475	NP_006466	Q15063	POSTN_HUMAN		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)	8	1099_1100	-		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)	327_328			FAS1 2.		B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Frame_Shift_Ins	INS	ENST00000379747.4	37	c.981_982insT	CCDS9364.1																																																																																				0.376	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475		17	39	NA	NA	NA	NA	NA	17	39	---	---	---	---
ADAL	161823	broad.mit.edu	37	15	43638085	43638086	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	TT	TT	-	-	TT	TT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr15:43638085_43638086delTT	ENST00000562188.1	+	6	475_476	c.459_460delTT	c.(457-462)cctttafs	p.L154fs	ADAL_ENST00000422466.2_Frame_Shift_Del_p.L154fs|ADAL_ENST00000389651.4_Frame_Shift_Del_p.L154fs|ADAL_ENST00000428046.3_Frame_Shift_Del_p.L154fs			Q6DHV7	ADAL_HUMAN	adenosine deaminase-like	154					adenosine catabolic process (GO:0006154)|drug metabolic process (GO:0017144)|inosine biosynthetic process (GO:0046103)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	adenosine deaminase activity (GO:0004000)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)	7		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;9.31e-07)		GAGGTGGCCCTTTAGTAGCCAA	0.411																																							uc010udo.1		NA																	0					0						c.(457-462)CCTTTAfs		adenosine deaminase-like isoform 1																																				SO:0001589	frameshift_variant	161823				adenosine catabolic process|inosine biosynthetic process|purine ribonucleoside monophosphate biosynthetic process		adenosine deaminase activity|metal ion binding	g.chr15:43638085_43638086delTT		CCDS32214.1, CCDS53936.1	15q15.3	2014-08-08			ENSG00000168803	ENSG00000168803			31853	protein-coding gene	gene with protein product							Standard	NM_001012969		Approved		uc010udo.2	Q6DHV7	OTTHUMG00000176646	ENST00000562188.1:c.459_460delTT	15.37:g.43638085_43638086delTT	ENSP00000456242:p.Leu154fs					ADAL_uc001zrh.2_Frame_Shift_Del_p.P153fs|ADAL_uc001zri.1_Frame_Shift_Del_p.P38fs	p.P153fs	NM_001159280	NP_001152752	Q6DHV7	ADAL_HUMAN		GBM - Glioblastoma multiforme(94;9.31e-07)	9	1033_1034	+		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)	153_154					A6NHZ3|B4DQM8	Frame_Shift_Del	DEL	ENST00000562188.1	37	c.459_460delTT																																																																																					0.411	ADAL-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432960.1	XM_091156		10	88	NA	NA	NA	NA	NA	10	88	---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168103030	168103030	+	Frame_Shift_Del	DEL	G	G	-			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr2:168103030delG	ENST00000409195.1	+	9	5217	c.5128delG	c.(5128-5130)ggtfs	p.G1711fs	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Frame_Shift_Del_p.G1711fs|XIRP2_ENST00000409273.1_Frame_Shift_Del_p.G1489fs	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1536					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGAAGTAATAGGTGGTGATGT	0.338																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(5128-5130)GGTfs		xin actin-binding repeat containing 2 isoform 1							137.0	132.0	133.0					2																	168103030		1876	4103	5979	SO:0001589	frameshift_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168103030delG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5128delG	2.37:g.168103030delG	ENSP00000386840:p.Gly1711fs					XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Frame_Shift_Del_p.G1535fs|XIRP2_uc010fpq.2_Frame_Shift_Del_p.G1488fs|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	p.G1710fs	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			8	5146	+			1535					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Frame_Shift_Del	DEL	ENST00000409195.1	37	c.5128delG	CCDS42769.1																																																																																				0.338	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		20	71	NA	NA	NA	NA	NA	20	71	---	---	---	---
BPI	671	broad.mit.edu	37	20	36932652	36932652	+	Frame_Shift_Del	DEL	G	G	-			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:36932652delG	ENST00000262865.4	+	1	128	c.39delG	c.(37-39)ccgfs	p.P13fs	CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	13					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)	p.P13P(1)		kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				GCAACGCGCCGAGATGGGCGT	0.617																																							uc002xib.2		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(4)	4						c.(37-39)CCGfs		bactericidal/permeability-increasing protein							74.0	73.0	73.0					20																	36932652		2203	4300	6503	SO:0001589	frameshift_variant	671				defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding	g.chr20:36932652delG	J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.39delG	20.37:g.36932652delG	ENSP00000262865:p.Pro13fs						p.P13fs	NM_001725	NP_001716	P17213	BPI_HUMAN			1	101	+		Myeloproliferative disorder(115;0.00878)	13					B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Frame_Shift_Del	DEL	ENST00000262865.4	37	c.39delG	CCDS13303.1																																																																																				0.617	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2	NM_001725		16	116	NA	NA	NA	NA	NA	16	116	---	---	---	---
BMP7	655	broad.mit.edu	37	20	55777651	55777651	+	Frame_Shift_Del	DEL	G	G	-			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr20:55777651delG	ENST00000395863.3	-	3	1145	c.640delC	c.(640-642)cgtfs	p.R214fs	BMP7_ENST00000450594.2_Frame_Shift_Del_p.R214fs|BMP7_ENST00000395864.3_Frame_Shift_Del_p.R214fs|BMP7_ENST00000460817.1_5'UTR	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	214					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)			endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			CAGAGGGTACGGCTGTCGAGC	0.617																																							uc010gip.1		NA																	0				skin(1)	1						c.(640-642)CGTfs		bone morphogenetic protein 7 precursor							51.0	48.0	49.0					20																	55777651		2203	4300	6503	SO:0001589	frameshift_variant	655				BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity	g.chr20:55777651delG		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.640delC	20.37:g.55777651delG	ENSP00000379204:p.Arg214fs					BMP7_uc010giq.1_Frame_Shift_Del_p.R214fs|BMP7_uc002xyc.2_Frame_Shift_Del_p.R214fs	p.R214fs	NM_001719	NP_001710	P18075	BMP7_HUMAN	BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)		3	1169	-	all_lung(29;0.0133)|Melanoma(10;0.242)		214					Q9H512|Q9NTQ7	Frame_Shift_Del	DEL	ENST00000395863.3	37	c.640delC	CCDS13455.1																																																																																				0.617	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2			14	56	NA	NA	NA	NA	NA	14	56	---	---	---	---
ZBED9	114821	broad.mit.edu	37	6	28541080	28541081	+	Frame_Shift_Ins	INS	-	-	T			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:28541080_28541081insT	ENST00000452236.2	-	4	3202_3203	c.2585_2586insA	c.(2584-2586)aagfs	p.K862fs	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						gagctaccttctttgctgcaga	0.416																																							uc003nlo.2		NA																	0				ovary(1)	1						c.(2584-2586)AAGfs		SCAN domain containing 3																																				SO:0001589	frameshift_variant	114821				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr6:28541080_28541081insT																												ENST00000452236.2:c.2586dupA	6.37:g.28541083_28541083dupT	ENSP00000395259:p.Lys862fs						p.K862fs	NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN			4	3203_3204	-			862						Frame_Shift_Ins	INS	ENST00000452236.2	37	c.2585_2586insA	CCDS34355.1																																																																																				0.416	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			24	173	NA	NA	NA	NA	NA	24	173	---	---	---	---
OPRM1	4988	broad.mit.edu	37	6	154410994	154410994	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr6:154410994delC	ENST00000330432.7	+	2	561	c.324delC	c.(322-324)tacfs	p.Y108fs	OPRM1_ENST00000434900.2_Frame_Shift_Del_p.Y201fs|OPRM1_ENST00000520708.1_Frame_Shift_Del_p.Y8fs|OPRM1_ENST00000522555.1_Frame_Shift_Del_p.Y8fs|OPRM1_ENST00000337049.4_Frame_Shift_Del_p.Y108fs|OPRM1_ENST00000414028.2_Frame_Shift_Del_p.Y108fs|OPRM1_ENST00000522236.1_Frame_Shift_Del_p.Y8fs|OPRM1_ENST00000419506.2_Frame_Shift_Del_p.Y108fs|OPRM1_ENST00000452687.2_Frame_Shift_Del_p.Y108fs|OPRM1_ENST00000229768.5_Frame_Shift_Del_p.Y108fs|OPRM1_ENST00000518759.1_Frame_Shift_Del_p.Y27fs|OPRM1_ENST00000428397.2_Frame_Shift_Del_p.Y108fs|OPRM1_ENST00000435918.2_Frame_Shift_Del_p.Y108fs|OPRM1_ENST00000360422.4_Frame_Shift_Del_p.Y108fs|OPRM1_ENST00000524163.1_Frame_Shift_Del_p.Y108fs	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1	108					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCAACATCTACATTTTCAACC	0.433																																							uc003qpr.2		NA																	0				ovary(1)	1						c.(322-324)TACfs		opioid receptor, mu 1 isoform MOR-1	Alfentanil(DB00802)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tramadol(DB00193)						106.0	100.0	102.0					6																	154410994		2033	4237	6270	SO:0001589	frameshift_variant	4988				behavior|negative regulation of cell proliferation|sensory perception	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	mu-opioid receptor activity|protein binding	g.chr6:154410994delC	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.324delC	6.37:g.154410994delC	ENSP00000328264:p.Tyr108fs					OPRM1_uc011efb.1_Frame_Shift_Del_p.Y156fs|OPRM1_uc011efc.1_Frame_Shift_Del_p.Y27fs|OPRM1_uc011efd.1_Frame_Shift_Del_p.Y8fs|OPRM1_uc011efe.1_Frame_Shift_Del_p.Y201fs|OPRM1_uc003qpn.2_Frame_Shift_Del_p.Y108fs|OPRM1_uc003qpo.1_Frame_Shift_Del_p.Y108fs|OPRM1_uc011eff.1_Frame_Shift_Del_p.Y108fs|OPRM1_uc011efg.1_Frame_Shift_Del_p.Y108fs|OPRM1_uc011efh.1_Frame_Shift_Del_p.Y108fs|OPRM1_uc003qpq.1_Frame_Shift_Del_p.Y108fs|OPRM1_uc003qpt.1_Frame_Shift_Del_p.Y108fs|OPRM1_uc011efi.1_Frame_Shift_Del_p.Y108fs|OPRM1_uc003qpp.2_RNA|OPRM1_uc003qps.2_RNA|OPRM1_uc010kjg.2_Frame_Shift_Del_p.Y8fs|OPRM1_uc003qpu.2_Frame_Shift_Del_p.Y8fs	p.Y108fs	NM_000914	NP_000905	P35372	OPRM_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	2	561	+		Ovarian(120;0.196)	108			Helical; Name=2; (Potential).		B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Frame_Shift_Del	DEL	ENST00000330432.7	37	c.324delC	CCDS55070.1																																																																																				0.433	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914		28	87	NA	NA	NA	NA	NA	28	87	---	---	---	---
SNTG1	54212	broad.mit.edu	37	8	51664620	51664620	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:51664620delC	ENST00000522124.1	+	18	2005	c.1344delC	c.(1342-1344)agcfs	p.S448fs	SNTG1_ENST00000518864.1_Frame_Shift_Del_p.S448fs|SNTG1_ENST00000276467.5_Intron|SNTG1_ENST00000517473.1_Intron	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	448					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				ATGGCAAGAGCAAAATCAAAT	0.358																																							uc010lxy.1		NA																	0				ovary(5)	5						c.(1342-1344)AGCfs		syntrophin, gamma 1							122.0	125.0	124.0					8																	51664620		2203	4300	6503	SO:0001589	frameshift_variant	54212				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding	g.chr8:51664620delC	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1344delC	8.37:g.51664620delC	ENSP00000429842:p.Ser448fs					SNTG1_uc003xqs.1_Frame_Shift_Del_p.S448fs|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_RNA	p.S448fs	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN			19	1715	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)	448					Q2M3Q0|Q9NY98	Frame_Shift_Del	DEL	ENST00000522124.1	37	c.1344delC	CCDS6147.1																																																																																				0.358	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			29	90	NA	NA	NA	NA	NA	29	90	---	---	---	---
TRPA1	8989	broad.mit.edu	37	8	72967791	72967791	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:72967791delC	ENST00000262209.4	-	12	1616	c.1409delG	c.(1408-1410)agtfs	p.S470fs	RP11-383H13.1_ENST00000457356.4_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	470					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CCTCGTATCACTTATGTCTTG	0.388																																							uc003xza.2		NA																	0				ovary(4)|lung(1)|kidney(1)	6						c.(1408-1410)AGTfs		ankyrin-like protein 1	Menthol(DB00825)						76.0	76.0	76.0					8																	72967791		2203	4299	6502	SO:0001589	frameshift_variant	8989					integral to plasma membrane		g.chr8:72967791delC	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1409delG	8.37:g.72967791delC	ENSP00000262209:p.Ser470fs						p.S470fs	NM_007332	NP_015628	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		12	1584	-			470			ANK 11.|Cytoplasmic (Potential).		A6NIN6	Frame_Shift_Del	DEL	ENST00000262209.4	37	c.1409delG	CCDS34908.1																																																																																				0.388	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		14	63	NA	NA	NA	NA	NA	14	63	---	---	---	---
TRIB1	10221	broad.mit.edu	37	8	126448538	126448539	+	Frame_Shift_Ins	INS	-	-	TC			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr8:126448538_126448539insTC	ENST00000519576.1	+	2	514_515	c.251_252insTC	c.(250-255)attcgcfs	p.R85fs	TRIB1_ENST00000520847.1_Frame_Shift_Ins_p.R150fs|TRIB1_ENST00000311922.3_Frame_Shift_Ins_p.R316fs					tribbles pseudokinase 1											NS(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			AGGTGCCTCATTCGCAGCCTCT	0.574																																							uc003yrx.2		NA																	0				lung(1)	1						c.(943-945)ATTfs		G-protein-coupled receptor induced protein																																				SO:0001589	frameshift_variant	10221				JNK cascade|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity|response to lipopolysaccharide	cytoplasm|nucleus	ATP binding|mitogen-activated protein kinase kinase binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity	g.chr8:126448538_126448539insTC	AF205437	CCDS6357.1, CCDS64971.1	8q24.13	2013-10-03	2013-10-03			ENSG00000173334			16891	protein-coding gene	gene with protein product		609461	"""tribbles homolog 1 (Drosophila)"""			9342215, 16715410	Standard	NM_001282985		Approved	C8FW, GIG2, TRB1	uc003yrx.3	Q96RU8		ENST00000519576.1:c.252_253dupTC	8.37:g.126448539_126448540dupTC	ENSP00000428879:p.Arg85fs					TRIB1_uc011lis.1_Frame_Shift_Ins_p.I149fs|TRIB1_uc010mdn.2_Frame_Shift_Ins_p.I84fs	p.I315fs	NM_025195	NP_079471	Q96RU8	TRIB1_HUMAN	STAD - Stomach adenocarcinoma(47;0.000918)		3	1526_1527	+	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		315			Protein kinase.			Frame_Shift_Ins	INS	ENST00000519576.1	37	c.944_945insTC																																																																																					0.574	TRIB1-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000381433.1	NM_025195		16	142	NA	NA	NA	NA	NA	16	142	---	---	---	---
PAPPA	5069	broad.mit.edu	37	9	118949903	118949904	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1679-01A-21D-2063-08	TCGA-64-1679-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	529d953a-880b-4dd4-a6aa-c09c8c89d980	510b548e-4350-45c8-889d-8930c2f20f9c	g.chr9:118949903_118949904insC	ENST00000328252.3	+	2	1255_1256	c.886_887insC	c.(886-888)gccfs	p.A296fs	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	296	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TGTGAAGCATGCCTGGTCCCCC	0.584																																							uc004bjn.2		NA																	0				ovary(4)|skin(4)|pancreas(1)	9						c.(886-888)GCCfs		pregnancy-associated plasma protein A																																				SO:0001589	frameshift_variant	5069				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding	g.chr9:118949903_118949904insC		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.888dupC	9.37:g.118949905_118949905dupC	ENSP00000330658:p.Ala296fs					PAPPA_uc011lxp.1_Frame_Shift_Ins_p.A89fs|PAPPA_uc011lxq.1_Frame_Shift_Ins_p.A89fs	p.A296fs	NM_002581	NP_002572	Q13219	PAPP1_HUMAN			2	1267_1268	+			296			Metalloprotease.		B1AMF9|Q08371|Q68G52|Q9UDK7	Frame_Shift_Ins	INS	ENST00000328252.3	37	c.886_887insC	CCDS6813.1																																																																																				0.584	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581		15	34	NA	NA	NA	NA	NA	15	34	---	---	---	---
